- Email: [email protected]
Bovine herpesvirus 1 as a live virus vector for expression of foreign genes
190,666-673
VIROLOGY
(1992)
Bovine
Herpesvirus LEONARD
Department
of Pathobiology,
1 as a Live Virus Vector for Expression
I. BELLO,’ School
I. CHARLES
of Veterinary Received
WHITBECK,
Medicine, February
University
AND
WILLIAM
of Pennsylvania,
10, 1992; accepted
July
of Foreign
Genes
C. LAWRENCE
Philadelphia,
Pennsylvania
19 104-6049
1, 1992
DNA sequence analysis and Y-end mapping of mRNA were used to identify and clone DNA fragments which contain the presumptive promoter (P,,) and poly(A) site (A,) of the bovine herpesvirus 1 (BHVl) gl glycoprotein. To confirm the presence of these regulatory regions in the above fragments, they were cloned together with a chloramphenicol acetyltransferase (CAT) reporter gene into pUCI9. The recombinant plasmid formed, pEC3, was capable of inducing CAT activity when transfected into bovine cells demonstrating that the P,,-CAT-A, sequence constituted a functional CAT expression cassette. The cassette was excised from pEC3, transferred to a plasmid insertion vector (pIV3A) and subsequently inserted into the thymidine kinase (tk) gene of BHVl. Insertion in either orientation, relative to the &gene, gave rise to BHVl recombinants which expressed CAT activity in infected cells. Analysis of RNA from infected cells indicated that CAT transcripts were present in multiple species of RNA. This unexpected result was found to reflect temporal shifts in promoter and poly(A) site usage during infection. Although the poly(A) site which forms part of the expression cassette was used extensively early in infection, most CAT transcripts synthesized at late times read through this promoter-proximal site and terminated at the distal site normally used for tk mRNA synthesis. o issz Academic
Press, Inc.
INTRODUCTION
al., 1982) and has been mapped and sequenced in several laboratories including our own (Bell0 et a/., 1987; Kit and Kit, 1987; Mittal and Field, 1989; Smith et al., 1990). In addition, we and others have mapped and sequenced the gene for a BHVl glycoprotein designated gl (Lawrence et al., 1986; Whitbeck et a/., 1988; Misra et a/., 1988). We now report that the BHVl gl promoter can be used to drive the expression of the chloramphenicol acetyltransferase (CAT) gene when cloned into the tk locus of BHVl
Bovine herpesvirus 1 (BHVl), a member of the alphaherpesvirus group (Roizman et a/., 1982), is an important cattle pathogen whose effects range from mild inapparent infections to a wide variety of clinical manifestations including respiratory disease, reproductive tract lesions, abortion, and even fatal systemic infections (Kahrs, 1977; Ludwig, 1983). BHVl has several properties which make it an ideal candidate to serve as a vaccine vector for genes of other bovine pathogens. First, BHVl infects only cattle and a narrow spectrum of other animals and, more importantly, does not infect humans (Kahrs, 1977). Thus, its use as a cattle vaccine vector, in contrast to vaccinia virus, would entail few public health considerations. Second, live attenuated vaccine strains of BHVl already exist and have been safely used in cattle for many years. Third, precedent exists for the use of alphaherpesviruses to express genes of other viruses (Shih et a/., 1984; Thompsen et a/., 1987; Lowe eta/., 1987). This report represents the initial results of our investigation into the potential use of BHVl to express foreign genes. Use of BHVl as a vaccine vector has two minimal requirements, namely, a nonessential site into which foreign genes can be inserted and a promoter which can be used to drive the transcription of the foreign gene. The thymidine kinase (tk) gene of BHVl is known to be nonessential (Kit and Qavi, 1983; Weinmaster et ’ To whom 0042-6822/92
reprint
requests
should
$5.00
CopyrIght 0 1992 by Academic Press, Inc. All rights of reproduction in any form reserved.
MATERIALS
AND
METHODS
Virus and cell culture The Colorado 1 (Cooper 1) strain of BHVl, the bovine turbinate (BT) cells, and the Madin-Darby bovine Kidney (MDBK) cells used in this study were obtained from the American Type Culture Collection. The MDBK(BU1OO) cell line used is a TK-negative cell line derived from MDBKcells and has been described previously (Bell0 et al., 1987). Propagation of the virus and cells has also been described (Lawrence et al., 1986). Plasmid
constructions
Construction of pBH99. A 3.6-kb Hpal-Kpnl BHV-1 restriction fragment was previously identified by our laboratory as the site of the gene for the BHVl glycoprotein gl (Lawrence et al., 1986). This fragment contains the entire coding sequence of gl as well as upstream and downstream regulatory sequences (Whit-
be addressed. 666
BHVl
AS A VECTOR
beck et a/., 1988). To construct pBH99, a Sall-Kpnl restriction fragment 48 nucleotides larger than the above /-/pal-Kpnl fragment (the SalI site is 48 nucleotides upstream of the Hpal site) was cloned into the Sall-Kpnl sites of pUCl8. In the constructions to follow, the first base of the SalI recognition site of pBH99 is designated base number one and numbering proceeds from there in the direction of the Kpnl recognition site. Construction of pEC3. The construction of an expression cassette (pEC3) containing the promotor region and transcription start site of gl (designated PQ,) adjacent to the procaryotic chloramphenicol acetyltransferase (CAT) gene is depicted in Fig. 1. The pEC3 construct also includes a region from pBH99 (designated A,) which contains the mRNA cleavage/polyadenylation [poly(A)] site of gl. The A, fragment has been placed 3’to the CAT gene. Construction took place in three steps. Step 1: To obtain the P,, fragment, pBH99 was cleaved with the restriction enzyme &cl. This enzyme cuts pBH99 after bases 2, 410, and 1735, yielding restriction fragments of 0.4, 1.3, and 4.6 kb. The 0.4-kb fragment, designated P,, , contains the promotor region and transcription start site of gl but lacks the translation start site which begins at base number 432. The 0.4-kb fragment was separated from the other fragments by electrophoresis through low-gelling-temperature agarose, converted to blunt ends by filling, and cloned into the Smal site of pUCl9. Orientation of the inserted fragment was such that base number 2 (numbering from pBH99) was closest to the Kpnl site of pUCl9 and base number 410 of the insert was closest to the HindIll site of pUCl9 (see Fig. 1). The newly constructed plasmid was designated pBH 100. Step 2: To obtain the region of pBH99 which contains the poly(A) site of gl, pBH99 was cleaved first with Pvull which yields fragments of 2.8, 2.4, 0.8, and 0.3 kb. The 0.8-kb fragment (bases 2658 to 3471) was isolated by electrophoresis through low-gelling-temperature agarose and cleaved with Stul. The latter enzyme cleaves the 0.8-kb fragment at base number 3232, yielding 0.24- and 0.58-kb fragments. The 0.24-kb fragment (A,) (bases 3233 to 347 1) which contains the poly(A) site of gl was isolated by electrophoresis as described above and cloned into the Hincll site of pBH 100. The orientation of the A, fragment was similar to that of the P,, fragment. The construct, which was designated pBH 102, contains a unique BamHl and a unique Xbal restriction site between the two inserted fragments so that an insert can be cloned between P,, and A,, . Step 3: To complete the construction of pEC3, a chloramphenicol acetyltransferase (CAT) GenBlock,
FOR
FOREIGN
GENES
667
K SmHn I
,r--\
H ’
/ x ‘1 \ ( cdJcI9 , I \\ /’ ‘L-M
,“I X
X CAT
FIG. 1. Plasmid constructions, see text and Mateiials and Methods for details. pEC3 contains a CAT expression cassette consisting of the BHVl gl promoter (P,,) and poly(A) site (A,) flanking a CAT reporter gene. pBH95X contains a 2.7.Kb BHVl SalI fragment cloned into pUCl8. The Sal fragment includes the BHVl #-coding region. pfV3A is an insertion vector constructed by inserting the CAT expression cassette from pEC3 into the Bg/ll site of pBH95X. Open boxes, BHVl fragments containing the gl promoter and poly(A) site; filled boxes, CAT coding regions: hatched boxes, t&coding regions; solid lines, BHVl sequences contiguous to the tk-coding region; dashed lines, pUC sequences. K. Kpnl; Sm, Seal; Hn, Hincll; H, HindIll; X, Xbal; S, Safl; Bg, 8g111.
obtained from Pharmacia, Inc. (Piscataway, NJ), was converted to Xbal termini and cloned into the unique Xbal site of pBH102. Thus, the final construction, pEC3, contains P,, , CAT, and A, all in the same orientation. It should be noted that genes other than CAT can be cloned into pBH 102, yielding different expression cassettes. Construction oiplV3A. Construction of the insertion vector plV3A used to insert a functional CAT gene into the BHV-1 genome is also depicted in Fig. 1. The construction required the use of pBH95X which consists of
668
BELLO,
WHITBECK,
a 2.7-kb BHVl Sa/l fragment containing the BHVl TKcoding region (Bell0 et a/., 1987; Kit and Kit, 1987; Mittal and Field, 1989) cloned into the SalI site of pUCl8. To complete the construction of pBH95X, theXbal site derived from the multiple cloning region of pUCl8 was eliminated by digestion with Xbal, blunting with mung bean nuclease, and recircularization of the plasmid. Thus, pBH95X contains no Xbal restriction site. To construct plV3A, the 1.4-kb P,,-CAT-A, insert was excised from pEC3 by digestion with Kpnl and HindIll. The Kpnl and HindIll restriction sites of pEC3 are part of the original multiple cloning region of pUC19 and lie outside of the P,,-CAT-A, insert. The 1.4-kb Kpn-Hind fragment was isolated by electrophoresis, converted to blunt ends with T4 DNA polymerase, and cloned into the blunted Bglll site of pBH95X. The unique Bglll site in pBH95X resides within the 1077-bp ORF of tk, 468 bp from the Y-end. Thus, the final construction contains a CAT gene adjacent to a BHVl promoter and transcription start site derived from gl. The CAT gene and BHVl regulatory sequences are bracketed by tk sequences which direct the CAT insert to the tk locus of BHVl during recombination with BHVl DNA. It should be noted that the CAT coding sequence can be easily excised from plV3A by cutting with Xbal (see Fig. 1) since no Xbal sites other than those bracketing CAT are present in either pEC3 or plV3A. For that reason, other genes can be cloned into plV3A in place of CAT and directed to the tk locus of BHVl. Thus, plV3A can serve as a general insertion vector for inserting foreign genes under the control of the BHVl gl promotor. Construction
and isolation
of vIV3A
To construct a BHVl recombinant containing the CAT expression cassette within the tk ORF, BT cell cultures were cotransfected with mixtures of infectious BHVl DNA and plV3A DNA. Procedures for preparations of infectious DNA and cotransfection of cells have been described in detail (Lawrence et al., 1986; Belle et a/., 1987; Miller et al., 1991). Recombinant viruses containing the cassette were isolated by selecting large plaques in the presence of 200 pg/ml of 5-bromo-2-deoxyuridine using the TK-negative MDBK(BUlO0) cell line previously described (Bell0 et a/., 1987). Under these conditions, the isolated recombinants which lack TK activity due to insertional inactivation of the BHVl tk gene replicated in a normal manner whereas wild type virus was inhibited. Isolation
of viral RNA
Viral RNA was isolated with BHVl at a multiplicity
from MDBK cells infected of 5-10 PFU per cell. Total
AND
LAWRENCE
RNA was isolated by the guanidinium method (Kingston, 1987) and poly(A) RNA was prepared using oligodeoxythymidylate cellulose according to the manufacturer’s instructions (GIBCO BRL, Gaithersburg, MD). Size fractionation
and Northern
blot analysis
of RNA
Total infected cell RNA or poly(A) RNA was glyoxalated using the method described by Carmichael and McMaster (1980) and electrophoresed through a horizontal 1% agarose gel in 10 mM sodium phosphate buffer (pH 7). The gel was blotted onto nylon transfer membrane using 1OX SSC (1 X SSC is 0.15 M NaCI, 0.015 M sodium citrate, pH 7). Following transfer of the RNA to nylon, the blot was dried, UV irradiated for 2 min (Fotodyne 3-3000 light source), and baked for 2 hr at 80”. RNA blots to be hybridized were preincubated in 1 x SSC, 0.1% SDS for 1 hr at 65”. Blots were then prehybridized for 2 hr at 45” in buffer containing 50% formamide, 5~ SSC, 25 mM sodium phosphate (pH 6.5) 0.2% SDS, 0.1 O/O Ficoll, 0.1% polyvinylpyrrolidone, 0.1% BSA, and 200 pg/ml denatured, sonicated calf thymus DNA. Hybridization probes were generated by nick translation of plasmid DNA and labeled with [a-32P]dCTP (3000 Ci/mmol). Probes were denatured by adjusting to 0.1 N NaOH and incubating in a boiling water bath for 5 min. Probes were then chilled on ice for 5 min and added to fresh hybridization solution (same as prehybridization buffer) at a concentration of 2-5X 1 O6 CPM/ml. The hybridization solution (containing probe) was then added to the blot and incubation was carried out at 45” for 18 hr. Following hybridization, the blots were washed two times in 1 X SSC, 0.1% SDS at room temperature for 30 min and two times in 1X SSC, 0.1% SDS at 65” for 1 hr, dried, and exposed to Kodak X-OMAT AR film. Identification extension
of the gl mRNA
5’-end by primer
Primer extension was performed largely as described by Calzone et al. (1987). A 17 base synthetic oligonucleotide (designated B37) complementary to a sequence within the gl ORF was 5’-end-labeled with [y-32P]ATP (3000 Ci/mmol) using polynucleotide kinase to a specific activity of 5X 1 O6 CPM/pmol. Approximately 0.25 pmol of the end-labeled B37 oligonucleotide was combined with 5 pg of BHVl-infected cell poly(A) RNA (16 hpi) and hybridized at 52” for 4 hr. Hybridized primer was then extended on the gl mRNA template using AMV reverse transcriptase. Extension products were analyzed on a 8% polyacrylamide sequencing gel. A dideoxynucleotide sequencing reaction was also performed using the same B37 oligonu-
BHVl
AS A VECTOR
ATGCA
FOR
FOREIGN
GENES
669
PE
A A TATA 5’TATATCCGCGAGCTCGTTCTGGCCCGCGCCGTCTTTGCGT 3’ ATATAGGCGCTCGAGCAAGACCGGGCGEGGCAGAAACGCA L--L
mRNA
m 3’ 5’ primer extension
FIG. 2. Determination of the Y-end of gl mRNA by primer extension. A dideoxynucleotide sequencing reaction was also performed using the same oligonucleotide (B37) on a recombinant single-stranded Ml 3 DNA template containing a gl insert. Sequencing lanes are designated A, T, G, C, and A. The primer extension lane is denoted PE. The sequence in the relevant portion of the autoradiogram is given to the right and the primer extension end points are indicated. The major band represents a primer extension of 207 nucleotides. The sequence below the autoradiogram identifies the major mRNA start site against the sequence of the promoter region. The start site is positioned 1 19 nucleotides upstream of the previously identified gl ORF. (Whitbeck et al., 1988)
cleotide primer on a recombinant single-stranded M 13 DNA template containing a gl insert.
RESULTS To test the feasibility of using BHVl as an expression vector, we selected the tk gene as a cloning site. The tk gene is an ideal site for insertion of foreign genes because it is nonessential for BHVl growth and, when interrupted by inserts, yields TK-negative recombinants which are easily recognized. We selected the BHVl glycoprotein I (gl) promoter and poly(A) site for use in this study since we had previously sequenced this gene and identified the presumptive regulatory regions by sequence analysis (Whitbeck et a/., 1988).
Identification
of the gl mRNA 5’-end
To confirm the position of the gl promoter within BHVl, it was necessary to map the 5’-end of the gl mRNA. This was carried out by primer extension and the results are shown in Fig. 2. The 5’-end of the gl mRNA was identified as a G residue positioned 30 nucleotides downstream of the first T of a probable TATA box and 119 nucleotides upstream of the gl open reading frame (ORF) previously determined in our laboratory (Whitbeck et a/., 1988).
Construction of a CAT expression cassette and insertion into BHVI Since herpesvirus early promoters often lie within 120 bp of the transcription start site (Homa et a/,, 1991) identification of the gl mRNA 5’-end made it possible to isolate a BHVl fragment which was expected to contain the gl promoter. The starting material forthis isolation was plasmid pBH99 which contains the entire 2796-bp gl ORF as well as 431 bp upstream and 405 bp downstream of the gl ORF cloned into pUCl8. A 410-bp fragment designated P,,, containing 310 bp upstream and 100 bp downstream of the gl transcription start site (-310 to +lOO) was excised from pBH99 and cloned into pUC19 (Fig. 1). The new plasmid (pBHlO0) contains the presumptive gl promoter and transcription start site but lacks the gl translation start site which begins at +120. A 239-bp fragment, designated A,, which begins three bases downstream of the gl ORF and contains canonical sequence elements for mRNA cleavage and polyadenylation [poly(A) site] was also excised from pBH99 and cloned into pBHlO0 at a position downstream of the presumptive gl promoter. The resultant plasmid was designated pBHlO2. To determine whether the P,, fragment contained a functional promoter, a promoterless procaryotic CAT gene was cloned into pBH 102 between the P,, and A, inserts to form pEC3. Transfection of BT cells with
BELLO,
670
WHITBECK,
AND
LAWRENCE
pEC3 resulted in the production of CAT activity demonstrating that the PSImCATeAnsequence constituted a functional expression cassette (data not shown). Constructs which lacked either the P,, or A, fragments or contained the Pgl fragment in an inverted orientation yielded 2% or less of the pEC3 value. To insert the CAT expression cassette into the tk gene of BHVl it was necessary to bracket the cassette with tk sequences to direct it to the tk locus of BHVl during recombination. Accordingly, the CAT expression cassette was excised from pEC3 and cloned into the Bglll site of the BHVl tk ORF to form plV3A (Fig. 1). to transfer the CAT expression cassette from plV3A to BHVl , BT cells were cotransfected with a mixture of intact infectious BHVl DNA and plV3A DNA and the recombinant virus, designated vIV3A, was isolated. Restriction enzyme analysis of purified vIV3A DNA confirmed that an intact CAT expression cassette had been inserted into the tk locus of vIV3A in the orientation depicted in Fig. 3B. E Analysis
of RNAs
synthesized
by recombinant
vIV3A
To determine whether the P,, and A, fragments were functioning as expected in the recombinant, poly(A) RNA was isolated from vlV3A-infected cells 16 hr postinfection and analyzed by Northern blot analysis (Fig. 3). Transcripts which initiated from the inserted P,, locus and terminated at the inserted A, were expected to yield a 1.2-kb mRNA species which could be detected with a CAT probe. Although a 1.2-kb mRNA species was detected (Fig. 3D, lane 4), the dominant transcript was 4.9 kb. The size of this transcript is consistent with initiation at the P,, site, transcription through the inserted poly(A) site, and termination downstream at the poly(A) site used for tk mRNA synthesis (Bell0 eta/., 1992). Thus, although detection of a 1.2-kb mRNA species confirms the presence of a functional poly(A) site within the inserted A, fragment, this site was apparently not used by most of the transcripts that initiated at P,,. In view of this unexpected result, the various RNA species were examined further. To confirm that the 4.9-kb mRNA was derived from initiation at P,, , the RNA blots were probed with a DNA fragment which overlaps the tk coding region but is 5’ to the CAT expression cassette (probe a). This probe (Fig. 30, lane 2) detected a 2.0-kb mRNA which was also seen with the CAT probe. The 4.9-kb mRNA was not detected, confirming that the latter mRNA species initiated at P,,. The 2.0-kb mRNA is consistent with initiation at the tk promoter (PTK) and termination within the inserted A, locus. Thus, although most mRNAs initiated at P,, read through the inserted A, fragment, those initiated from the tk promoter did not. Probing
FIG. 3. Northern blot analysis of RNAfrom vlV3A-infected or BHVlinfected cells. (A) Potential CAT mRNA species synthesized by vlV3A-infected cells. The different sizes reflect initiation at the tk promoter (Prk) vs initiation at the gl promoter (P,,) and termination at the gl poly(A) site (A,) vs termination at the downstream tk poly(A) site. Wild type BHVl-infected cells yield a single 4.3-kb mRNA species from the tk region. (Bell0 et al., 1992). (B) Partial structure of vlV3A showing the tk coding region and the inserted CAT expression cassette. (C) DNA probes used to analyze the RNA blots. The region of vlV3A represented by each probe is indicated. (D) RNA blots. Poly(A) RNA was isolated 16.5 hr postinfection from vIV3A infected and wild type BHV-1 -infected MDBK cells. The sizes in kilobases are shown for the transcripts which hybridized with probes from the indicated regions of vIV3A. Lanes 1, 3, and 5 contain 2 rg of poly(A) RNA from wild-type BHVl -infected cells. Lanes 2, 4, and 6 contain 2 rg of poly(A) RNA from vlV3A-infected cells. (E) RNA blots. Analysis of RNA from MDBK cells infected with vIV3A for different lengths of time. Poly(A) RNA was isolated 4, 8, 12, and 16 hr postinfection and analyzed with probe b. Sizes in kilobases for the transcripts which hybridized are shown. Lane 1,4 hr; lane 2, 8 hr; lane 3, 12 hr; lane 4, 16 hr postinfection.
the RNA blots with a DNA fragment which overlaps the tk coding region but is 3’ to the CAT expression cassette (probe c) confirmed this interpretation. The latter
BHVl
AS A VECTOR
probe detected the 4.9-kb mRNA but not the 1.2- or 2.0-kb mRNAs. (Fig. 3D, lane 6). A small quantity of a 5.7-kb mRNA representing initiation from the tk promoter and termination at the downstream tk poly(A) site could be detected with any of the probes used if the blots were extensively overexposed. As a control for these experiments, Northern blot analysis of poly(A) RNA from cells infected with wild type BHVI was also carried out (Fig. 3D, lanes I, 3 and 5). Probes (a) and(c) detected only the 4.3 kb tk mRNA(Bello, eta/., in press) while probe (b), as expected, did not react with the blot. The transcription pattern shown in Fig. 3D reflects steady-state levels of RNA 16.5 hr postinfection. To determine whether this unusual pattern was exhibited at earlier times in infection, poly(A) RNA was isolated from vlV3A-infected cells at 4, 8, 12, and 16 hr postinfection. The RNA was analyzed using the CAT probe (probe b) which can detect all of the relevant RNA species. The results are shown in Fig. 3E. At 4 hr postinfection (lane 1) the only RNA species present was the 2.0-kb transcript which represents initiation from the tk promoter and exclusive use of the promoter-proximal A, poly(A) site. The 2.0-kb band intensity increased at 8 hr (lane 2) and then decreased at 12 (lane 3) and 16 hr (lane 4) postinfection indicating that the tk promoter was inactive or minimally active after 8 hr. The 1.2- and 4.9-kb bands, in approximately equal amounts, first appeared during the 4-8 hr interval reflecting the start of P,, activity and equal use of both the upstream A, and downstream tk poly(A) sites. The 4.9-kb band intensity increased at 12 and 16 hrwhile the 1.2-kb band remained more or less constant, indicating continued activity of the gl promoter but preferential use of the downstream tk poly(A) site late in infection. It appears, therefore, that during the course of infection with vIV3A the various transcripts which encompass the CAT insert reflect transitions in both promoter usage and poly(A) site selection. Expression
of CAT activity
Since the RNA analysis indicated that the inserted poly(A) site in vIV3A might not be necessary for P,,driven CAT expression, a new BHVI recombinant (vBCA1) was constructed in which the A, fragment was omitted. In addition, a BHVI recombinant (vIV3B) was constructed in which the intact CAT expression cassette was present but was inserted in the opposite orientation to the tk coding sequence. The two new recombinants, as well as the original vlV3A recombinant were each tested for the ability to induce CAT activity in infected cells and all three were found to induce high levels (Table 1). The vIV3B recombinant, which contained the expression cassette in an inverted orienta-
FOR
FOREIGN
GENES
671 TABLE
INDUCTION
Vi& BHVl vlV3A vBCA1 vlV3B
1
OF CAT ACTIVITY AFTER INFECTION WITH DIFFERENT BHVl RECOMBINANT~
Orientation of expression cassettec
POSY insert
CAT activity” (units/mg protein)
NA Forward Forward Inverted
NA Present Absent Present
0 23.0 23.1 16.2
Note. NA, not applicable a Confluent layers of MDBK cells were infected with 10 PFWcell of either BHVl , vIVBA, vIV3B, or vBCA1 for 15 hr. Cells were collected and assayed for CAT activity by the method of Neuman et al. (1987). b vIV3A contains a complete CAT expression cassette and has the structure shown in Fig. 38. vBCA1 lacks the A, fragment and, therefore, contains an expression cassette which does not include a poly(A) site. vIV3B contains a complete cassette but the cassette is inserted in the opposite orientation to the tk ORF. c Relative to the fk ORF. ’ One unit of CAT activity is defined as the amount that catalyzes the transfer of 1 nmol of butryl groups from butyryl CoA to chloramphenicol in 1 min at room temperature.
tion, induced the lowest level of CAT activity. This may reflect interference by antisense RNA transcribed from the tk promoter. The vBCAl recombinant, which lacks the inserted poly(A) site, induced levels of CAT activity which were comparable to that induced by vIV3A. Thus, the RNA analysis and CAT assays were consistent with each other and indicate that the inserted poly(A) site in vIV3A is unnecessary for CAT expression.
DISCUSSION We have demonstrated that an expression cassette consisting of the CAT-coding sequence bracketed by the BHVl gl promoter and poly(A) site can be successfully inserted into the tk gene of BHVl to form a viable recombinant. The CAT insert was expressed when placed in either orientation relative to the tk-coding sequence. We chose not to use the endogenous tk promoter for expression of CAT because this would have required insertion at or near the 5’-end of the tk coding region. In HSVl, inserts placed nearthe S’end of the tk gene altered the upstream contiguous gene and reduced virus growth extensively (Jacobson et a/., 1989). Consequently, we used the expression strategy previously employed by Mackett et al. (I 984) for vaccinia virus and Shih et al., (I 984) for HSVI The strategy involved insertion of a new promoter within the tk-coding region where contiguous genes were less likely to
672
BELLO,
WHITBECK,
be affected and use of the new promoter to express foreign genes. Northern blot analysis of RNA from cells infected with the BHVl recombinant vIV3A revealed the presence of the CAT sequence in multiple species of RNA. This was not unexpected since the recombinant virus contained a complete expression cassette, i.e., a promoter, ORF, and poly(A) site, inserted within the coding region of the tk gene. As a result, the inserted CAT ORF was preceded by both the upstream tk promoter and the inserted gl promoter of the expression cassette. The tk and gl promoters are both early promoters (Ludwig and Letchworth, 1987; Seal et a/., 1992) although the gl promoter becomes functional later than that of tk and remains functional longer (unpublished observation). CAT transcripts consistent in size and time of appearance with initiation from both of these promoters were observed. However, only transcripts initiated from the inserted gl promoter would be expected to yield functional CAT protein. Although CAT transcripts initiated from both promoters were anticipated, most, if not all, transcripts were expected to terminate at the inserted gl poly(A) site which forms part of the expression cassette. The gl poly(A) site, in fact, was used preferentially at early times in infection (O-4 hr), but most transcripts synthesized late in infection (8-16 hr) read through this promoter-proximal poly(A) site and terminated at the distal site normally used for tk mRNA (Fig. 3). It is known that when multiple poly(A) sites are placed in tandem downstream of a promoter that all sites are often used (Denome and Cole, 1988). However, only a few examples of preferential use of a promoter-distal site have been described (see Jacob et a/., 1990, for review). Herpesvirus-infected cells, however, appear to represent a biological system where poly(A) site selection differs from the norm. Transcription through promoterproximal poly(A) sites occurs in HSVl-infected cells and increases in frequency late in infection (Wagner, 1985). Recently McLauchlan et al. (1989) have observed a heat-labile factor in nuclear extracts of HSVlinfected cells which alters the specificity of poly(A) site selection in vitro and preferentially increases processing efficiency at a late HSV poly(A) site. Analysis of RNAs produced in viva by HSVl recombinants that contained the late poly(A) site in tandem with a promoter-proximal IE poly(A) site indicated that increased processing at the downstream late poly(A) site occurred late in infection. Interestingly, however, even when the preferred late poly(A) site was the promoterproximal site in a tandem arrangement with the IE poly(A) site, increased transcription through the proximal site was observed at late times in infection. Thus, the results of McLauchlan et al. (1989) suggest that
AND
LAWRENCE
late in HSVl -infected ceils there is both an altered process of poly(A) site selection which is sequence specific and an increased tendency to read through promoter-proximal poly(A) sites which is independent of sequence. The mechanism involved and benefits accruing, if any, to increased transcription through promoter-proximal poly(A) sites at late times in herpesvirus infections is unclear but the phenomenon itself is dramatically illustrated by the results obtained in this study with the vIV3A recombinant. One practical consideration which emerges from these observations is the question of whether a poly(A) site is a necessary component of expression cassettes inserted into BHVl, The question, with respect to cassettes inserted into the BHVl tkgene in a forward orientation, was tested directly in our study and the answer was clearly no (Table 1). The downstream poly(A) site normally used for TK synthesis satisfied the poly(A) requirement for CAT synthesis. It should be noted, however, that inclusion of a poly(A) site in the cassette was also not detrimental to CAT expression. Since it is likely that inserts cloned into other sites within the BHVl genome might not have an appropriate downstream poly(A) site available, it seems prudent, in our judgement, to generally include a poly(A) site in expression cassette constructs. BHVl is one of a group of respiratory viruses, including bovine parainfluenza virus 3 (BPIV3), bovine respiratory syncytial virus (BRSV), and bovine viral diarrhea virus (BVDV) which, in combination with bacteria, can lead to an acute febrile respiratory infection of feedlot cattle. The latter condition, often referred to as shipping fever, causes economic losses greaterthan those caused by all other feedlot diseases combined (Wikse, 1985). Our studies demonstrate the feasibility of using BHVl as an expression vector and raise the possibility of its eventual use as a vaccine vector. In particular, its potential for use as a vector to express genes from bovine viruses which make up the shipping fever cornplex seems quite promising. In this regard, it is pertnent to note that HSV can be engineered, according to estimates, to accommodate at least 24 kb of foreign DNA (Roizman and Jenkins, 1985). The similarity in size and structure of BHVl to HSV suggest that it too could be engineered to accommodate the large quantity of foreign DNA required to form a multivalent bovine respiratoryvaccine. Experiments are currently in progress in our laboratory to insert and study the expression of genes from BPIV3, BRSV, and BVDV in BHVl. ACKNOWLEDGMENTS This (USDA)
work Grant
was supported 89-37266-4693,
by U.S. Department USDA Grant 88-341
of Agriculture 16-3651, USDA
BHVl
AS A VECTOR
Section 1433 Formula Funds, and Commonwealth of Pennsylvania, Department of Agriculture Grant ME 44036. We thank Janet Brooks for help in preparing the manuscript.
REFERENCES BELLO, L. 1. (1974). Regulation of thymidine kinase synthesis in human cells. fxp. Cell Res. 89, 263-274. BELLO. L. J., WHITBECK, 1. C., and LAWRENCE, W. C. (I 987). Map location of the thymidine kinase gene of bovine herpesvirus 1. /. Viral. 61,4023-4025. BELLO, L. J., WHITBECK. J. C., and LAWRENCE, W. C. (1992). Sequence and transcript analysis of the bovine herpesvirus 1 thymidine kinase locus. Virology 189, 407-414. CAIIONE, F. J., BRITTEN, R. J., and DAVIDSON, E. H. (1987). Mapping of gene transcripts by nuclease protection assays and cDNA primer extension. Methods Enzymol. 152, 611-632. CARMICHAEL, G. G., and MCMASTER, G. K. (1980). The analysis of nucleic acids in gels using glyoxal and acridine orange. Methods Enzymol. 65, 380-391. DENOME, R. M., and COLE, C. N. (I 988). Patterns of polyadenylation site selection in gene constructs containing multiple polyadenylation signals. Mol. Cell. Biol. 8, 4829-4839. HOMA, F. L., KRIKOS. A., GLORIOSO, J. C., and LEVINE, M. (1991). Functional analysis of regulatory regions controlling strict late HSV gene expression. ln “Herpesvirus Transcription and Its Regulation” (E. K. Wagner, Ed.), pp. 207-231. CRC Press, Boston. JACOB, S. T., TERNS, M. P., HENGST-ZHANG, J. A., and VULAPALLI, R. S. (1990). Polyadenylation of mRNA and its control. Crit. Rev. Eukaryotic Gene Expression 1, 49-59. JACOBSON, J. G., MARTIN, S. L., and COEN, D. M. (1989). A conserved open reading frame that overlaps the herpes simplex virus thymidine kinase gene is important for viral growth in cell culture.1. Vifol. 63, 1839-l 843. KAHRS, R. F. (1977). Infectious bovine rhinotracheitis: A review and update. 1. Am. Vet. Med. Assoc. 171, 1055-1064. KINGSTON, R. E. (1987). Guanidinium method for total RNA preparation: Basic protocol. In “Current Protocols in Molecular Biology” (F. M. Ausubel, R. Brent, R. E. Kingston, D. E. Moore, J. G. Seidman, J. A. Smith, and K. Struhl, Eds.), pp. 4.2.1-4.2.5. Wiley, New York. KIT, M., and KIT, S. (1987). Thymidine kinase deletion mutants of bovine herpesvirus-1. U.S. Patent 4.703,Ol 1. KIT, S., and QAVI, H. (1983). Thymidine kinase (TK) induction after infection of TK-deficient rabbit cell mutants with bovine herpesvirus type 1 (BHV-1): Isolation of TK- BHV-1 mutants. Virology 130, 381-389. LAWRENCE, W. C., D’URSO, R. C., KUNDEL, C. A., WHITBECK, J. C., and BELLO, L. J. (1986). Map location of the gene for a 130,000-dalton glycoprotein of bovine herpesvirus I. f. Vii-o/. 60, 405-414. LOWE, R. S., KELLER, P. M.. KEECH, B. J., DAVISON, A. J., WHANG, Y., MORGAN, A. J., KIEFF, E., and ELLIS, R. W. (1987). Varicella-Zoster virus as a live vector for the expression of foreign genes. Proc. Nat/. Acad. Sci. USA 84, 3896-3900. LUDWIG, G. V.. and LETCHWORTH, G. J. (1987). Temporal control of
FOR
FOREIGN
GENES
673
bovine herpesvirus 1 glycoprotein synthesis. f. viral. 61, 32923294. LUDWIG, H. (1983). Bovine herpesviruses. /n “The Herpesviruses” (B. Roizman, Ed.), Vol. 2, pp. 135-214. Plenum, New York. MACKETT, M., SMITH. G. L., and Moss, B. (I 984). General method for production and selection of infectious vaccinia virus recombinants expressing foreign genes. /. Viral. 49, 857-864. MCLAUCHLAN, J., SIMPSON, S., and CLEMENTS, J. B. (1989). Herpes simplex virus induces a processing factor that stimulates poly(A) site usage. Cell 59, 1093-l 105. MILLER, 1. M., WHETSTONE, C. A., BELLO, L. J., and LAWRENCE, W. C. (1991). Determination of ability of a thymidine kinase-negative deletion mutant of bovine herpesvirus-l to cause abortion in cattle. Am. J. Vet. Res. 52, 1038-1042. MISRA, V., NELSON, R., and SMITH, M. (1988). Sequence of a bovine herpesvirus type-l glycoprotein gene that is homologous to the herpes simplex gene for the glycoprotein gB. virology 166, 542549. MITTAL, S. K., and FIELD, H. J. (1989). Analysis of the bovine herpesvirus type 1 thymidine kinase (TK) gene from wild-type virus and TK-deficient mutants. J. Gen. Viral. 70, 901-918. NEUMAN, J. R., MORENCY, C. A., and RUSSIAN, K. 0. (1987). A novel rapid assay for chloramphenicol acetyltransferase gene expression. Biotechniques 5, 444-447. ROIZMAN, B., CARMICHAEL, L. E., DEINHARDT, F., DE THE, G., NAHMIAS, A. J., PLOWRIGHT, W., RAPP, F., SHELDRICH, P., TAKAHASHI, M., and WOLF, K. (1982). Herpesviridae: Definition, provisional nomenclature and taxonomy. Intervirology 16, 201-217. ROIZMAN, B., and JENKINS, F. J. (1985). Genetic engineering of novel genomes of large DNA viruses. Science 229, 1208-I 2 14. SEAL, B. S., WHETSTONE, C. A., ZAMB, T. J., BELLO, L. J., and LAWRENCE, W. C. (1992). Relationship of bovine herpesvirus 1 immediate-early, early and late gene expression to host cellular gene transcription. Virology 188, 152-I 59. SHIH, M. F.. ARSENAKIS, M., TIOLLAIS, P., and ROIZMAN, B. (1984). Expression of hepatitis B virus S gene by herpes simplex virus type 1 vectors carrying CY- and P-regulated gene chimeras. Proc. Nat/. Acad. Sci USA 81,5867-5870. SMITH, G. A., YOUNG, P. L., and MATTICK, J. S. (1990). The location and nucleotide sequence of the thymidine kinase gene of bovine herpesvirus type 1.2. J. Gen. L&o/. 71, 2417-2424. THOMPSEN, D. R., MAROT~I, K. R., PALERMO, D. P., and POST, L. E. (1987). Pseudorabies virus as a live virus vector for expression of foreign genes. Gene 57, 261-265. WAGNER, E. K. (1985). Individual HSV transcripts: Characterization of specific genes. /n “The Herpesvirus” (B. Roizman, Ed.), Vol. 3, pp. 45-l 04. Plenum, New York. WEINMASTER, G. A., MISRA, V., MCGUIRE, R., BABIUK, L. A., and DECLERCQ, E. (1982). Bovid herpesvirus type-l (infectious bovine rhinotracheitis virus)-induced thymidine kinase. Virology 118, 191-201. WHITBECK, J. C., BELLO, L. J., and LAWRENCE, W. C. (1988). Comparison of the bovine herpesvirus 1 gl gene and the herpes simplex virus type 1 gB gene. J. Viral. 62, 3319-3327. WIKSE, S. E. (1985). Feedlot cattle pneumonias. Vet. C/in. North Am. Food Anim. Pratt. 1, 289-310.
VIROLOGY
(1992)
Bovine
Herpesvirus LEONARD
Department
of Pathobiology,
1 as a Live Virus Vector for Expression
I. BELLO,’ School
I. CHARLES
of Veterinary Received
WHITBECK,
Medicine, February
University
AND
WILLIAM
of Pennsylvania,
10, 1992; accepted
July
of Foreign
Genes
C. LAWRENCE
Philadelphia,
Pennsylvania
19 104-6049
1, 1992
DNA sequence analysis and Y-end mapping of mRNA were used to identify and clone DNA fragments which contain the presumptive promoter (P,,) and poly(A) site (A,) of the bovine herpesvirus 1 (BHVl) gl glycoprotein. To confirm the presence of these regulatory regions in the above fragments, they were cloned together with a chloramphenicol acetyltransferase (CAT) reporter gene into pUCI9. The recombinant plasmid formed, pEC3, was capable of inducing CAT activity when transfected into bovine cells demonstrating that the P,,-CAT-A, sequence constituted a functional CAT expression cassette. The cassette was excised from pEC3, transferred to a plasmid insertion vector (pIV3A) and subsequently inserted into the thymidine kinase (tk) gene of BHVl. Insertion in either orientation, relative to the &gene, gave rise to BHVl recombinants which expressed CAT activity in infected cells. Analysis of RNA from infected cells indicated that CAT transcripts were present in multiple species of RNA. This unexpected result was found to reflect temporal shifts in promoter and poly(A) site usage during infection. Although the poly(A) site which forms part of the expression cassette was used extensively early in infection, most CAT transcripts synthesized at late times read through this promoter-proximal site and terminated at the distal site normally used for tk mRNA synthesis. o issz Academic
Press, Inc.
INTRODUCTION
al., 1982) and has been mapped and sequenced in several laboratories including our own (Bell0 et a/., 1987; Kit and Kit, 1987; Mittal and Field, 1989; Smith et al., 1990). In addition, we and others have mapped and sequenced the gene for a BHVl glycoprotein designated gl (Lawrence et al., 1986; Whitbeck et a/., 1988; Misra et a/., 1988). We now report that the BHVl gl promoter can be used to drive the expression of the chloramphenicol acetyltransferase (CAT) gene when cloned into the tk locus of BHVl
Bovine herpesvirus 1 (BHVl), a member of the alphaherpesvirus group (Roizman et a/., 1982), is an important cattle pathogen whose effects range from mild inapparent infections to a wide variety of clinical manifestations including respiratory disease, reproductive tract lesions, abortion, and even fatal systemic infections (Kahrs, 1977; Ludwig, 1983). BHVl has several properties which make it an ideal candidate to serve as a vaccine vector for genes of other bovine pathogens. First, BHVl infects only cattle and a narrow spectrum of other animals and, more importantly, does not infect humans (Kahrs, 1977). Thus, its use as a cattle vaccine vector, in contrast to vaccinia virus, would entail few public health considerations. Second, live attenuated vaccine strains of BHVl already exist and have been safely used in cattle for many years. Third, precedent exists for the use of alphaherpesviruses to express genes of other viruses (Shih et a/., 1984; Thompsen et a/., 1987; Lowe eta/., 1987). This report represents the initial results of our investigation into the potential use of BHVl to express foreign genes. Use of BHVl as a vaccine vector has two minimal requirements, namely, a nonessential site into which foreign genes can be inserted and a promoter which can be used to drive the transcription of the foreign gene. The thymidine kinase (tk) gene of BHVl is known to be nonessential (Kit and Qavi, 1983; Weinmaster et ’ To whom 0042-6822/92
reprint
requests
should
$5.00
CopyrIght 0 1992 by Academic Press, Inc. All rights of reproduction in any form reserved.
MATERIALS
AND
METHODS
Virus and cell culture The Colorado 1 (Cooper 1) strain of BHVl, the bovine turbinate (BT) cells, and the Madin-Darby bovine Kidney (MDBK) cells used in this study were obtained from the American Type Culture Collection. The MDBK(BU1OO) cell line used is a TK-negative cell line derived from MDBKcells and has been described previously (Bell0 et al., 1987). Propagation of the virus and cells has also been described (Lawrence et al., 1986). Plasmid
constructions
Construction of pBH99. A 3.6-kb Hpal-Kpnl BHV-1 restriction fragment was previously identified by our laboratory as the site of the gene for the BHVl glycoprotein gl (Lawrence et al., 1986). This fragment contains the entire coding sequence of gl as well as upstream and downstream regulatory sequences (Whit-
be addressed. 666
BHVl
AS A VECTOR
beck et a/., 1988). To construct pBH99, a Sall-Kpnl restriction fragment 48 nucleotides larger than the above /-/pal-Kpnl fragment (the SalI site is 48 nucleotides upstream of the Hpal site) was cloned into the Sall-Kpnl sites of pUCl8. In the constructions to follow, the first base of the SalI recognition site of pBH99 is designated base number one and numbering proceeds from there in the direction of the Kpnl recognition site. Construction of pEC3. The construction of an expression cassette (pEC3) containing the promotor region and transcription start site of gl (designated PQ,) adjacent to the procaryotic chloramphenicol acetyltransferase (CAT) gene is depicted in Fig. 1. The pEC3 construct also includes a region from pBH99 (designated A,) which contains the mRNA cleavage/polyadenylation [poly(A)] site of gl. The A, fragment has been placed 3’to the CAT gene. Construction took place in three steps. Step 1: To obtain the P,, fragment, pBH99 was cleaved with the restriction enzyme &cl. This enzyme cuts pBH99 after bases 2, 410, and 1735, yielding restriction fragments of 0.4, 1.3, and 4.6 kb. The 0.4-kb fragment, designated P,, , contains the promotor region and transcription start site of gl but lacks the translation start site which begins at base number 432. The 0.4-kb fragment was separated from the other fragments by electrophoresis through low-gelling-temperature agarose, converted to blunt ends by filling, and cloned into the Smal site of pUCl9. Orientation of the inserted fragment was such that base number 2 (numbering from pBH99) was closest to the Kpnl site of pUCl9 and base number 410 of the insert was closest to the HindIll site of pUCl9 (see Fig. 1). The newly constructed plasmid was designated pBH 100. Step 2: To obtain the region of pBH99 which contains the poly(A) site of gl, pBH99 was cleaved first with Pvull which yields fragments of 2.8, 2.4, 0.8, and 0.3 kb. The 0.8-kb fragment (bases 2658 to 3471) was isolated by electrophoresis through low-gelling-temperature agarose and cleaved with Stul. The latter enzyme cleaves the 0.8-kb fragment at base number 3232, yielding 0.24- and 0.58-kb fragments. The 0.24-kb fragment (A,) (bases 3233 to 347 1) which contains the poly(A) site of gl was isolated by electrophoresis as described above and cloned into the Hincll site of pBH 100. The orientation of the A, fragment was similar to that of the P,, fragment. The construct, which was designated pBH 102, contains a unique BamHl and a unique Xbal restriction site between the two inserted fragments so that an insert can be cloned between P,, and A,, . Step 3: To complete the construction of pEC3, a chloramphenicol acetyltransferase (CAT) GenBlock,
FOR
FOREIGN
GENES
667
K SmHn I
,r--\
H ’
/ x ‘1 \ ( cdJcI9 , I \\ /’ ‘L-M
,“I X
X CAT
FIG. 1. Plasmid constructions, see text and Mateiials and Methods for details. pEC3 contains a CAT expression cassette consisting of the BHVl gl promoter (P,,) and poly(A) site (A,) flanking a CAT reporter gene. pBH95X contains a 2.7.Kb BHVl SalI fragment cloned into pUCl8. The Sal fragment includes the BHVl #-coding region. pfV3A is an insertion vector constructed by inserting the CAT expression cassette from pEC3 into the Bg/ll site of pBH95X. Open boxes, BHVl fragments containing the gl promoter and poly(A) site; filled boxes, CAT coding regions: hatched boxes, t&coding regions; solid lines, BHVl sequences contiguous to the tk-coding region; dashed lines, pUC sequences. K. Kpnl; Sm, Seal; Hn, Hincll; H, HindIll; X, Xbal; S, Safl; Bg, 8g111.
obtained from Pharmacia, Inc. (Piscataway, NJ), was converted to Xbal termini and cloned into the unique Xbal site of pBH102. Thus, the final construction, pEC3, contains P,, , CAT, and A, all in the same orientation. It should be noted that genes other than CAT can be cloned into pBH 102, yielding different expression cassettes. Construction oiplV3A. Construction of the insertion vector plV3A used to insert a functional CAT gene into the BHV-1 genome is also depicted in Fig. 1. The construction required the use of pBH95X which consists of
668
BELLO,
WHITBECK,
a 2.7-kb BHVl Sa/l fragment containing the BHVl TKcoding region (Bell0 et a/., 1987; Kit and Kit, 1987; Mittal and Field, 1989) cloned into the SalI site of pUCl8. To complete the construction of pBH95X, theXbal site derived from the multiple cloning region of pUCl8 was eliminated by digestion with Xbal, blunting with mung bean nuclease, and recircularization of the plasmid. Thus, pBH95X contains no Xbal restriction site. To construct plV3A, the 1.4-kb P,,-CAT-A, insert was excised from pEC3 by digestion with Kpnl and HindIll. The Kpnl and HindIll restriction sites of pEC3 are part of the original multiple cloning region of pUC19 and lie outside of the P,,-CAT-A, insert. The 1.4-kb Kpn-Hind fragment was isolated by electrophoresis, converted to blunt ends with T4 DNA polymerase, and cloned into the blunted Bglll site of pBH95X. The unique Bglll site in pBH95X resides within the 1077-bp ORF of tk, 468 bp from the Y-end. Thus, the final construction contains a CAT gene adjacent to a BHVl promoter and transcription start site derived from gl. The CAT gene and BHVl regulatory sequences are bracketed by tk sequences which direct the CAT insert to the tk locus of BHVl during recombination with BHVl DNA. It should be noted that the CAT coding sequence can be easily excised from plV3A by cutting with Xbal (see Fig. 1) since no Xbal sites other than those bracketing CAT are present in either pEC3 or plV3A. For that reason, other genes can be cloned into plV3A in place of CAT and directed to the tk locus of BHVl. Thus, plV3A can serve as a general insertion vector for inserting foreign genes under the control of the BHVl gl promotor. Construction
and isolation
of vIV3A
To construct a BHVl recombinant containing the CAT expression cassette within the tk ORF, BT cell cultures were cotransfected with mixtures of infectious BHVl DNA and plV3A DNA. Procedures for preparations of infectious DNA and cotransfection of cells have been described in detail (Lawrence et al., 1986; Belle et a/., 1987; Miller et al., 1991). Recombinant viruses containing the cassette were isolated by selecting large plaques in the presence of 200 pg/ml of 5-bromo-2-deoxyuridine using the TK-negative MDBK(BUlO0) cell line previously described (Bell0 et a/., 1987). Under these conditions, the isolated recombinants which lack TK activity due to insertional inactivation of the BHVl tk gene replicated in a normal manner whereas wild type virus was inhibited. Isolation
of viral RNA
Viral RNA was isolated with BHVl at a multiplicity
from MDBK cells infected of 5-10 PFU per cell. Total
AND
LAWRENCE
RNA was isolated by the guanidinium method (Kingston, 1987) and poly(A) RNA was prepared using oligodeoxythymidylate cellulose according to the manufacturer’s instructions (GIBCO BRL, Gaithersburg, MD). Size fractionation
and Northern
blot analysis
of RNA
Total infected cell RNA or poly(A) RNA was glyoxalated using the method described by Carmichael and McMaster (1980) and electrophoresed through a horizontal 1% agarose gel in 10 mM sodium phosphate buffer (pH 7). The gel was blotted onto nylon transfer membrane using 1OX SSC (1 X SSC is 0.15 M NaCI, 0.015 M sodium citrate, pH 7). Following transfer of the RNA to nylon, the blot was dried, UV irradiated for 2 min (Fotodyne 3-3000 light source), and baked for 2 hr at 80”. RNA blots to be hybridized were preincubated in 1 x SSC, 0.1% SDS for 1 hr at 65”. Blots were then prehybridized for 2 hr at 45” in buffer containing 50% formamide, 5~ SSC, 25 mM sodium phosphate (pH 6.5) 0.2% SDS, 0.1 O/O Ficoll, 0.1% polyvinylpyrrolidone, 0.1% BSA, and 200 pg/ml denatured, sonicated calf thymus DNA. Hybridization probes were generated by nick translation of plasmid DNA and labeled with [a-32P]dCTP (3000 Ci/mmol). Probes were denatured by adjusting to 0.1 N NaOH and incubating in a boiling water bath for 5 min. Probes were then chilled on ice for 5 min and added to fresh hybridization solution (same as prehybridization buffer) at a concentration of 2-5X 1 O6 CPM/ml. The hybridization solution (containing probe) was then added to the blot and incubation was carried out at 45” for 18 hr. Following hybridization, the blots were washed two times in 1 X SSC, 0.1% SDS at room temperature for 30 min and two times in 1X SSC, 0.1% SDS at 65” for 1 hr, dried, and exposed to Kodak X-OMAT AR film. Identification extension
of the gl mRNA
5’-end by primer
Primer extension was performed largely as described by Calzone et al. (1987). A 17 base synthetic oligonucleotide (designated B37) complementary to a sequence within the gl ORF was 5’-end-labeled with [y-32P]ATP (3000 Ci/mmol) using polynucleotide kinase to a specific activity of 5X 1 O6 CPM/pmol. Approximately 0.25 pmol of the end-labeled B37 oligonucleotide was combined with 5 pg of BHVl-infected cell poly(A) RNA (16 hpi) and hybridized at 52” for 4 hr. Hybridized primer was then extended on the gl mRNA template using AMV reverse transcriptase. Extension products were analyzed on a 8% polyacrylamide sequencing gel. A dideoxynucleotide sequencing reaction was also performed using the same B37 oligonu-
BHVl
AS A VECTOR
ATGCA
FOR
FOREIGN
GENES
669
PE
A A TATA 5’TATATCCGCGAGCTCGTTCTGGCCCGCGCCGTCTTTGCGT 3’ ATATAGGCGCTCGAGCAAGACCGGGCGEGGCAGAAACGCA L--L
mRNA
m 3’ 5’ primer extension
FIG. 2. Determination of the Y-end of gl mRNA by primer extension. A dideoxynucleotide sequencing reaction was also performed using the same oligonucleotide (B37) on a recombinant single-stranded Ml 3 DNA template containing a gl insert. Sequencing lanes are designated A, T, G, C, and A. The primer extension lane is denoted PE. The sequence in the relevant portion of the autoradiogram is given to the right and the primer extension end points are indicated. The major band represents a primer extension of 207 nucleotides. The sequence below the autoradiogram identifies the major mRNA start site against the sequence of the promoter region. The start site is positioned 1 19 nucleotides upstream of the previously identified gl ORF. (Whitbeck et al., 1988)
cleotide primer on a recombinant single-stranded M 13 DNA template containing a gl insert.
RESULTS To test the feasibility of using BHVl as an expression vector, we selected the tk gene as a cloning site. The tk gene is an ideal site for insertion of foreign genes because it is nonessential for BHVl growth and, when interrupted by inserts, yields TK-negative recombinants which are easily recognized. We selected the BHVl glycoprotein I (gl) promoter and poly(A) site for use in this study since we had previously sequenced this gene and identified the presumptive regulatory regions by sequence analysis (Whitbeck et a/., 1988).
Identification
of the gl mRNA 5’-end
To confirm the position of the gl promoter within BHVl, it was necessary to map the 5’-end of the gl mRNA. This was carried out by primer extension and the results are shown in Fig. 2. The 5’-end of the gl mRNA was identified as a G residue positioned 30 nucleotides downstream of the first T of a probable TATA box and 119 nucleotides upstream of the gl open reading frame (ORF) previously determined in our laboratory (Whitbeck et a/., 1988).
Construction of a CAT expression cassette and insertion into BHVI Since herpesvirus early promoters often lie within 120 bp of the transcription start site (Homa et a/,, 1991) identification of the gl mRNA 5’-end made it possible to isolate a BHVl fragment which was expected to contain the gl promoter. The starting material forthis isolation was plasmid pBH99 which contains the entire 2796-bp gl ORF as well as 431 bp upstream and 405 bp downstream of the gl ORF cloned into pUCl8. A 410-bp fragment designated P,,, containing 310 bp upstream and 100 bp downstream of the gl transcription start site (-310 to +lOO) was excised from pBH99 and cloned into pUC19 (Fig. 1). The new plasmid (pBHlO0) contains the presumptive gl promoter and transcription start site but lacks the gl translation start site which begins at +120. A 239-bp fragment, designated A,, which begins three bases downstream of the gl ORF and contains canonical sequence elements for mRNA cleavage and polyadenylation [poly(A) site] was also excised from pBH99 and cloned into pBHlO0 at a position downstream of the presumptive gl promoter. The resultant plasmid was designated pBHlO2. To determine whether the P,, fragment contained a functional promoter, a promoterless procaryotic CAT gene was cloned into pBH 102 between the P,, and A, inserts to form pEC3. Transfection of BT cells with
BELLO,
670
WHITBECK,
AND
LAWRENCE
pEC3 resulted in the production of CAT activity demonstrating that the PSImCATeAnsequence constituted a functional expression cassette (data not shown). Constructs which lacked either the P,, or A, fragments or contained the Pgl fragment in an inverted orientation yielded 2% or less of the pEC3 value. To insert the CAT expression cassette into the tk gene of BHVl it was necessary to bracket the cassette with tk sequences to direct it to the tk locus of BHVl during recombination. Accordingly, the CAT expression cassette was excised from pEC3 and cloned into the Bglll site of the BHVl tk ORF to form plV3A (Fig. 1). to transfer the CAT expression cassette from plV3A to BHVl , BT cells were cotransfected with a mixture of intact infectious BHVl DNA and plV3A DNA and the recombinant virus, designated vIV3A, was isolated. Restriction enzyme analysis of purified vIV3A DNA confirmed that an intact CAT expression cassette had been inserted into the tk locus of vIV3A in the orientation depicted in Fig. 3B. E Analysis
of RNAs
synthesized
by recombinant
vIV3A
To determine whether the P,, and A, fragments were functioning as expected in the recombinant, poly(A) RNA was isolated from vlV3A-infected cells 16 hr postinfection and analyzed by Northern blot analysis (Fig. 3). Transcripts which initiated from the inserted P,, locus and terminated at the inserted A, were expected to yield a 1.2-kb mRNA species which could be detected with a CAT probe. Although a 1.2-kb mRNA species was detected (Fig. 3D, lane 4), the dominant transcript was 4.9 kb. The size of this transcript is consistent with initiation at the P,, site, transcription through the inserted poly(A) site, and termination downstream at the poly(A) site used for tk mRNA synthesis (Bell0 eta/., 1992). Thus, although detection of a 1.2-kb mRNA species confirms the presence of a functional poly(A) site within the inserted A, fragment, this site was apparently not used by most of the transcripts that initiated at P,,. In view of this unexpected result, the various RNA species were examined further. To confirm that the 4.9-kb mRNA was derived from initiation at P,, , the RNA blots were probed with a DNA fragment which overlaps the tk coding region but is 5’ to the CAT expression cassette (probe a). This probe (Fig. 30, lane 2) detected a 2.0-kb mRNA which was also seen with the CAT probe. The 4.9-kb mRNA was not detected, confirming that the latter mRNA species initiated at P,,. The 2.0-kb mRNA is consistent with initiation at the tk promoter (PTK) and termination within the inserted A, locus. Thus, although most mRNAs initiated at P,, read through the inserted A, fragment, those initiated from the tk promoter did not. Probing
FIG. 3. Northern blot analysis of RNAfrom vlV3A-infected or BHVlinfected cells. (A) Potential CAT mRNA species synthesized by vlV3A-infected cells. The different sizes reflect initiation at the tk promoter (Prk) vs initiation at the gl promoter (P,,) and termination at the gl poly(A) site (A,) vs termination at the downstream tk poly(A) site. Wild type BHVl-infected cells yield a single 4.3-kb mRNA species from the tk region. (Bell0 et al., 1992). (B) Partial structure of vlV3A showing the tk coding region and the inserted CAT expression cassette. (C) DNA probes used to analyze the RNA blots. The region of vlV3A represented by each probe is indicated. (D) RNA blots. Poly(A) RNA was isolated 16.5 hr postinfection from vIV3A infected and wild type BHV-1 -infected MDBK cells. The sizes in kilobases are shown for the transcripts which hybridized with probes from the indicated regions of vIV3A. Lanes 1, 3, and 5 contain 2 rg of poly(A) RNA from wild-type BHVl -infected cells. Lanes 2, 4, and 6 contain 2 rg of poly(A) RNA from vlV3A-infected cells. (E) RNA blots. Analysis of RNA from MDBK cells infected with vIV3A for different lengths of time. Poly(A) RNA was isolated 4, 8, 12, and 16 hr postinfection and analyzed with probe b. Sizes in kilobases for the transcripts which hybridized are shown. Lane 1,4 hr; lane 2, 8 hr; lane 3, 12 hr; lane 4, 16 hr postinfection.
the RNA blots with a DNA fragment which overlaps the tk coding region but is 3’ to the CAT expression cassette (probe c) confirmed this interpretation. The latter
BHVl
AS A VECTOR
probe detected the 4.9-kb mRNA but not the 1.2- or 2.0-kb mRNAs. (Fig. 3D, lane 6). A small quantity of a 5.7-kb mRNA representing initiation from the tk promoter and termination at the downstream tk poly(A) site could be detected with any of the probes used if the blots were extensively overexposed. As a control for these experiments, Northern blot analysis of poly(A) RNA from cells infected with wild type BHVI was also carried out (Fig. 3D, lanes I, 3 and 5). Probes (a) and(c) detected only the 4.3 kb tk mRNA(Bello, eta/., in press) while probe (b), as expected, did not react with the blot. The transcription pattern shown in Fig. 3D reflects steady-state levels of RNA 16.5 hr postinfection. To determine whether this unusual pattern was exhibited at earlier times in infection, poly(A) RNA was isolated from vlV3A-infected cells at 4, 8, 12, and 16 hr postinfection. The RNA was analyzed using the CAT probe (probe b) which can detect all of the relevant RNA species. The results are shown in Fig. 3E. At 4 hr postinfection (lane 1) the only RNA species present was the 2.0-kb transcript which represents initiation from the tk promoter and exclusive use of the promoter-proximal A, poly(A) site. The 2.0-kb band intensity increased at 8 hr (lane 2) and then decreased at 12 (lane 3) and 16 hr (lane 4) postinfection indicating that the tk promoter was inactive or minimally active after 8 hr. The 1.2- and 4.9-kb bands, in approximately equal amounts, first appeared during the 4-8 hr interval reflecting the start of P,, activity and equal use of both the upstream A, and downstream tk poly(A) sites. The 4.9-kb band intensity increased at 12 and 16 hrwhile the 1.2-kb band remained more or less constant, indicating continued activity of the gl promoter but preferential use of the downstream tk poly(A) site late in infection. It appears, therefore, that during the course of infection with vIV3A the various transcripts which encompass the CAT insert reflect transitions in both promoter usage and poly(A) site selection. Expression
of CAT activity
Since the RNA analysis indicated that the inserted poly(A) site in vIV3A might not be necessary for P,,driven CAT expression, a new BHVI recombinant (vBCA1) was constructed in which the A, fragment was omitted. In addition, a BHVI recombinant (vIV3B) was constructed in which the intact CAT expression cassette was present but was inserted in the opposite orientation to the tk coding sequence. The two new recombinants, as well as the original vlV3A recombinant were each tested for the ability to induce CAT activity in infected cells and all three were found to induce high levels (Table 1). The vIV3B recombinant, which contained the expression cassette in an inverted orienta-
FOR
FOREIGN
GENES
671 TABLE
INDUCTION
Vi& BHVl vlV3A vBCA1 vlV3B
1
OF CAT ACTIVITY AFTER INFECTION WITH DIFFERENT BHVl RECOMBINANT~
Orientation of expression cassettec
POSY insert
CAT activity” (units/mg protein)
NA Forward Forward Inverted
NA Present Absent Present
0 23.0 23.1 16.2
Note. NA, not applicable a Confluent layers of MDBK cells were infected with 10 PFWcell of either BHVl , vIVBA, vIV3B, or vBCA1 for 15 hr. Cells were collected and assayed for CAT activity by the method of Neuman et al. (1987). b vIV3A contains a complete CAT expression cassette and has the structure shown in Fig. 38. vBCA1 lacks the A, fragment and, therefore, contains an expression cassette which does not include a poly(A) site. vIV3B contains a complete cassette but the cassette is inserted in the opposite orientation to the tk ORF. c Relative to the fk ORF. ’ One unit of CAT activity is defined as the amount that catalyzes the transfer of 1 nmol of butryl groups from butyryl CoA to chloramphenicol in 1 min at room temperature.
tion, induced the lowest level of CAT activity. This may reflect interference by antisense RNA transcribed from the tk promoter. The vBCAl recombinant, which lacks the inserted poly(A) site, induced levels of CAT activity which were comparable to that induced by vIV3A. Thus, the RNA analysis and CAT assays were consistent with each other and indicate that the inserted poly(A) site in vIV3A is unnecessary for CAT expression.
DISCUSSION We have demonstrated that an expression cassette consisting of the CAT-coding sequence bracketed by the BHVl gl promoter and poly(A) site can be successfully inserted into the tk gene of BHVl to form a viable recombinant. The CAT insert was expressed when placed in either orientation relative to the tk-coding sequence. We chose not to use the endogenous tk promoter for expression of CAT because this would have required insertion at or near the 5’-end of the tk coding region. In HSVl, inserts placed nearthe S’end of the tk gene altered the upstream contiguous gene and reduced virus growth extensively (Jacobson et a/., 1989). Consequently, we used the expression strategy previously employed by Mackett et al. (I 984) for vaccinia virus and Shih et al., (I 984) for HSVI The strategy involved insertion of a new promoter within the tk-coding region where contiguous genes were less likely to
672
BELLO,
WHITBECK,
be affected and use of the new promoter to express foreign genes. Northern blot analysis of RNA from cells infected with the BHVl recombinant vIV3A revealed the presence of the CAT sequence in multiple species of RNA. This was not unexpected since the recombinant virus contained a complete expression cassette, i.e., a promoter, ORF, and poly(A) site, inserted within the coding region of the tk gene. As a result, the inserted CAT ORF was preceded by both the upstream tk promoter and the inserted gl promoter of the expression cassette. The tk and gl promoters are both early promoters (Ludwig and Letchworth, 1987; Seal et a/., 1992) although the gl promoter becomes functional later than that of tk and remains functional longer (unpublished observation). CAT transcripts consistent in size and time of appearance with initiation from both of these promoters were observed. However, only transcripts initiated from the inserted gl promoter would be expected to yield functional CAT protein. Although CAT transcripts initiated from both promoters were anticipated, most, if not all, transcripts were expected to terminate at the inserted gl poly(A) site which forms part of the expression cassette. The gl poly(A) site, in fact, was used preferentially at early times in infection (O-4 hr), but most transcripts synthesized late in infection (8-16 hr) read through this promoter-proximal poly(A) site and terminated at the distal site normally used for tk mRNA (Fig. 3). It is known that when multiple poly(A) sites are placed in tandem downstream of a promoter that all sites are often used (Denome and Cole, 1988). However, only a few examples of preferential use of a promoter-distal site have been described (see Jacob et a/., 1990, for review). Herpesvirus-infected cells, however, appear to represent a biological system where poly(A) site selection differs from the norm. Transcription through promoterproximal poly(A) sites occurs in HSVl-infected cells and increases in frequency late in infection (Wagner, 1985). Recently McLauchlan et al. (1989) have observed a heat-labile factor in nuclear extracts of HSVlinfected cells which alters the specificity of poly(A) site selection in vitro and preferentially increases processing efficiency at a late HSV poly(A) site. Analysis of RNAs produced in viva by HSVl recombinants that contained the late poly(A) site in tandem with a promoter-proximal IE poly(A) site indicated that increased processing at the downstream late poly(A) site occurred late in infection. Interestingly, however, even when the preferred late poly(A) site was the promoterproximal site in a tandem arrangement with the IE poly(A) site, increased transcription through the proximal site was observed at late times in infection. Thus, the results of McLauchlan et al. (1989) suggest that
AND
LAWRENCE
late in HSVl -infected ceils there is both an altered process of poly(A) site selection which is sequence specific and an increased tendency to read through promoter-proximal poly(A) sites which is independent of sequence. The mechanism involved and benefits accruing, if any, to increased transcription through promoter-proximal poly(A) sites at late times in herpesvirus infections is unclear but the phenomenon itself is dramatically illustrated by the results obtained in this study with the vIV3A recombinant. One practical consideration which emerges from these observations is the question of whether a poly(A) site is a necessary component of expression cassettes inserted into BHVl, The question, with respect to cassettes inserted into the BHVl tkgene in a forward orientation, was tested directly in our study and the answer was clearly no (Table 1). The downstream poly(A) site normally used for TK synthesis satisfied the poly(A) requirement for CAT synthesis. It should be noted, however, that inclusion of a poly(A) site in the cassette was also not detrimental to CAT expression. Since it is likely that inserts cloned into other sites within the BHVl genome might not have an appropriate downstream poly(A) site available, it seems prudent, in our judgement, to generally include a poly(A) site in expression cassette constructs. BHVl is one of a group of respiratory viruses, including bovine parainfluenza virus 3 (BPIV3), bovine respiratory syncytial virus (BRSV), and bovine viral diarrhea virus (BVDV) which, in combination with bacteria, can lead to an acute febrile respiratory infection of feedlot cattle. The latter condition, often referred to as shipping fever, causes economic losses greaterthan those caused by all other feedlot diseases combined (Wikse, 1985). Our studies demonstrate the feasibility of using BHVl as an expression vector and raise the possibility of its eventual use as a vaccine vector. In particular, its potential for use as a vector to express genes from bovine viruses which make up the shipping fever cornplex seems quite promising. In this regard, it is pertnent to note that HSV can be engineered, according to estimates, to accommodate at least 24 kb of foreign DNA (Roizman and Jenkins, 1985). The similarity in size and structure of BHVl to HSV suggest that it too could be engineered to accommodate the large quantity of foreign DNA required to form a multivalent bovine respiratoryvaccine. Experiments are currently in progress in our laboratory to insert and study the expression of genes from BPIV3, BRSV, and BVDV in BHVl. ACKNOWLEDGMENTS This (USDA)
work Grant
was supported 89-37266-4693,
by U.S. Department USDA Grant 88-341
of Agriculture 16-3651, USDA
BHVl
AS A VECTOR
Section 1433 Formula Funds, and Commonwealth of Pennsylvania, Department of Agriculture Grant ME 44036. We thank Janet Brooks for help in preparing the manuscript.
REFERENCES BELLO, L. 1. (1974). Regulation of thymidine kinase synthesis in human cells. fxp. Cell Res. 89, 263-274. BELLO. L. J., WHITBECK, 1. C., and LAWRENCE, W. C. (I 987). Map location of the thymidine kinase gene of bovine herpesvirus 1. /. Viral. 61,4023-4025. BELLO, L. J., WHITBECK. J. C., and LAWRENCE, W. C. (1992). Sequence and transcript analysis of the bovine herpesvirus 1 thymidine kinase locus. Virology 189, 407-414. CAIIONE, F. J., BRITTEN, R. J., and DAVIDSON, E. H. (1987). Mapping of gene transcripts by nuclease protection assays and cDNA primer extension. Methods Enzymol. 152, 611-632. CARMICHAEL, G. G., and MCMASTER, G. K. (1980). The analysis of nucleic acids in gels using glyoxal and acridine orange. Methods Enzymol. 65, 380-391. DENOME, R. M., and COLE, C. N. (I 988). Patterns of polyadenylation site selection in gene constructs containing multiple polyadenylation signals. Mol. Cell. Biol. 8, 4829-4839. HOMA, F. L., KRIKOS. A., GLORIOSO, J. C., and LEVINE, M. (1991). Functional analysis of regulatory regions controlling strict late HSV gene expression. ln “Herpesvirus Transcription and Its Regulation” (E. K. Wagner, Ed.), pp. 207-231. CRC Press, Boston. JACOB, S. T., TERNS, M. P., HENGST-ZHANG, J. A., and VULAPALLI, R. S. (1990). Polyadenylation of mRNA and its control. Crit. Rev. Eukaryotic Gene Expression 1, 49-59. JACOBSON, J. G., MARTIN, S. L., and COEN, D. M. (1989). A conserved open reading frame that overlaps the herpes simplex virus thymidine kinase gene is important for viral growth in cell culture.1. Vifol. 63, 1839-l 843. KAHRS, R. F. (1977). Infectious bovine rhinotracheitis: A review and update. 1. Am. Vet. Med. Assoc. 171, 1055-1064. KINGSTON, R. E. (1987). Guanidinium method for total RNA preparation: Basic protocol. In “Current Protocols in Molecular Biology” (F. M. Ausubel, R. Brent, R. E. Kingston, D. E. Moore, J. G. Seidman, J. A. Smith, and K. Struhl, Eds.), pp. 4.2.1-4.2.5. Wiley, New York. KIT, M., and KIT, S. (1987). Thymidine kinase deletion mutants of bovine herpesvirus-1. U.S. Patent 4.703,Ol 1. KIT, S., and QAVI, H. (1983). Thymidine kinase (TK) induction after infection of TK-deficient rabbit cell mutants with bovine herpesvirus type 1 (BHV-1): Isolation of TK- BHV-1 mutants. Virology 130, 381-389. LAWRENCE, W. C., D’URSO, R. C., KUNDEL, C. A., WHITBECK, J. C., and BELLO, L. J. (1986). Map location of the gene for a 130,000-dalton glycoprotein of bovine herpesvirus I. f. Vii-o/. 60, 405-414. LOWE, R. S., KELLER, P. M.. KEECH, B. J., DAVISON, A. J., WHANG, Y., MORGAN, A. J., KIEFF, E., and ELLIS, R. W. (1987). Varicella-Zoster virus as a live vector for the expression of foreign genes. Proc. Nat/. Acad. Sci. USA 84, 3896-3900. LUDWIG, G. V.. and LETCHWORTH, G. J. (1987). Temporal control of
FOR
FOREIGN
GENES
673
bovine herpesvirus 1 glycoprotein synthesis. f. viral. 61, 32923294. LUDWIG, H. (1983). Bovine herpesviruses. /n “The Herpesviruses” (B. Roizman, Ed.), Vol. 2, pp. 135-214. Plenum, New York. MACKETT, M., SMITH. G. L., and Moss, B. (I 984). General method for production and selection of infectious vaccinia virus recombinants expressing foreign genes. /. Viral. 49, 857-864. MCLAUCHLAN, J., SIMPSON, S., and CLEMENTS, J. B. (1989). Herpes simplex virus induces a processing factor that stimulates poly(A) site usage. Cell 59, 1093-l 105. MILLER, 1. M., WHETSTONE, C. A., BELLO, L. J., and LAWRENCE, W. C. (1991). Determination of ability of a thymidine kinase-negative deletion mutant of bovine herpesvirus-l to cause abortion in cattle. Am. J. Vet. Res. 52, 1038-1042. MISRA, V., NELSON, R., and SMITH, M. (1988). Sequence of a bovine herpesvirus type-l glycoprotein gene that is homologous to the herpes simplex gene for the glycoprotein gB. virology 166, 542549. MITTAL, S. K., and FIELD, H. J. (1989). Analysis of the bovine herpesvirus type 1 thymidine kinase (TK) gene from wild-type virus and TK-deficient mutants. J. Gen. Viral. 70, 901-918. NEUMAN, J. R., MORENCY, C. A., and RUSSIAN, K. 0. (1987). A novel rapid assay for chloramphenicol acetyltransferase gene expression. Biotechniques 5, 444-447. ROIZMAN, B., CARMICHAEL, L. E., DEINHARDT, F., DE THE, G., NAHMIAS, A. J., PLOWRIGHT, W., RAPP, F., SHELDRICH, P., TAKAHASHI, M., and WOLF, K. (1982). Herpesviridae: Definition, provisional nomenclature and taxonomy. Intervirology 16, 201-217. ROIZMAN, B., and JENKINS, F. J. (1985). Genetic engineering of novel genomes of large DNA viruses. Science 229, 1208-I 2 14. SEAL, B. S., WHETSTONE, C. A., ZAMB, T. J., BELLO, L. J., and LAWRENCE, W. C. (1992). Relationship of bovine herpesvirus 1 immediate-early, early and late gene expression to host cellular gene transcription. Virology 188, 152-I 59. SHIH, M. F.. ARSENAKIS, M., TIOLLAIS, P., and ROIZMAN, B. (1984). Expression of hepatitis B virus S gene by herpes simplex virus type 1 vectors carrying CY- and P-regulated gene chimeras. Proc. Nat/. Acad. Sci USA 81,5867-5870. SMITH, G. A., YOUNG, P. L., and MATTICK, J. S. (1990). The location and nucleotide sequence of the thymidine kinase gene of bovine herpesvirus type 1.2. J. Gen. L&o/. 71, 2417-2424. THOMPSEN, D. R., MAROT~I, K. R., PALERMO, D. P., and POST, L. E. (1987). Pseudorabies virus as a live virus vector for expression of foreign genes. Gene 57, 261-265. WAGNER, E. K. (1985). Individual HSV transcripts: Characterization of specific genes. /n “The Herpesvirus” (B. Roizman, Ed.), Vol. 3, pp. 45-l 04. Plenum, New York. WEINMASTER, G. A., MISRA, V., MCGUIRE, R., BABIUK, L. A., and DECLERCQ, E. (1982). Bovid herpesvirus type-l (infectious bovine rhinotracheitis virus)-induced thymidine kinase. Virology 118, 191-201. WHITBECK, J. C., BELLO, L. J., and LAWRENCE, W. C. (1988). Comparison of the bovine herpesvirus 1 gl gene and the herpes simplex virus type 1 gB gene. J. Viral. 62, 3319-3327. WIKSE, S. E. (1985). Feedlot cattle pneumonias. Vet. C/in. North Am. Food Anim. Pratt. 1, 289-310.