BRAF and GNAQ mutations in melanocytic tumors of the oral cavity

Vol. 114 No. 6 December 2012

BRAF and GNAQ mutations in melanocytic tumors of the oral cavity Yoram Cohen, MD,a Nitza Goldenberg-Cohen, MD,c Sharon Akrish, DMD,c Tali Shani, DMD,d,e Ninette Amariglio, PhD,e Olga Dratviman-Storobinsky, MSc,b Ilana Kaplan, DMD,f Iris Barshack, MD,g and Abraham Hirshberg, MD, DMDd,e Chaim Sheba Medical Center, Tel Hashomer; Felsenstein Medical Research Center, Petach Tikva; Tel Aviv University, Tel Aviv; Rambam Medical Center and Technion School of Medicine, Haifa; Rabin Medical Center, Petach Tikva, Israel

Objective. The genetic factors participating in oral melanoma evolution have not been studied extensively. We aimed to analyze the prevalence of BRAF and GNAQ mutations in a series of oral melanocytic tumors, nevi, and melanomas. Study Design. The study group consisted of 4 melanomas and 10 nevi (6 intramucosal, 4 blue nevi). DNA was extracted from paraffin-embedded tissue sections, and mutations in GNAQ and BRAF were analyzed with the use of mass spectrometery. Results. V600E point mutation was identified in the BRAF gene in 3 intramucosal nevi and in 2 melanomas. Only 1 blue nevus harbored the GNAQ209 mutation. None of the BRAF-positive samples harbored GNAQ mutations. Conclusions. The finding of BRAF mutations in oral benign and malignant melanocytic lesions points to a potential initiating role of BRAF in malignant transformation, which may have important therapeutic implications as those with BRAF mutations may benefit from specific treatment using RAF inhibitors. (Oral Surg Oral Med Oral Pathol Oral Radiol 2012;114:778-784)

Mucosal melanoma is a rare entity, the head and neck being the most common site, comprising ⬍1% of all melanomas in the West.1-4 Approximately one-half of melanomas in the oronasal region occur in the oral cavity,5 accounting for 0.5% of all primary oral malignancies.6,7 Compared with cutaneous melanoma, oral melanomas tend to present at a higher stage and are more aggressive and in a vertical growth phase of disease; the 5-year survival rate is ⬃15%.7,8 A definitive precursor lesion for mucosal melanoma has not been identified; however, atypical melanocytic hyperplasia may represent a proliferative phase before overt tumorigenesis occurs.5,6,9 The etiologic factors participating in melanoma evolution in the skin are well established, however, such factors are either not a consideration (sun exposure, The first 2 authors contributed equally to this work. a Department of Obstetrics and Gynecology, Chaim Sheba Medical Center, and Sackler School of medicine, Tel Aviv University. b Krieger Eye Research Laboratory, Felsenstein Medical Research Center; and Sackler School of Medicine, Tel Aviv University, Tel Aviv. c Institute of Pathology, Rambam Medical Center and Technion School of Medicine. d Department of Oral Pathology and Oral Medicine, Maurice and Gabriela Goldschleger School of Dental Medicine, Tel Aviv University. e Cancer Research Center, Chaim Sheba Medical Center. f Institute of Pathology, Rabin Medical Center. g Institute of Pathology, Chaim Sheba Medical Center. Received for publication Jul 1, 2012; returned for revision Aug 19, 2012; accepted for publication Sep 1, 2012. © 2012 Elsevier Inc. All rights reserved. 2212-4403/$ - see front matter http://dx.doi.org/10.1016/j.oooo.2012.09.001

778

tendency to tan poorly) or have not been studied extensively (familial history, syndromes, cytogenetic defects) in oral mucosal melanomas. The RAS-RAF-MEK-ERK mitogen-activated protein kinase (MAPK) cascade is a key cell-signaling pathway mediating cellular responses to growth signals which regulates cell proliferation, survival, and differentiation.10,11 BRAF, one of the three RAF genes in humans (along with ARAF and CRAF), is mutated in many human cancers.12,13 The most common BRAF mutation is a thymine-to-adenine transversion at position 1,799 leading to substitution of a glutamic acid for valine at position 600 (V600E).14 Somatic mutation of BRAF causes constitutive activation of the serine-threonine kinases in the MAPK pathway,12,15,16 which stimulates growth in melanoma cells. BRAF mutations are probably an early event in the progression of nevi toward melanoma, because they occur at a similar frequency in benign nevi and in primary and metastatic melanomas.17,18 Additional evidence has come from a study on zebra fish, in which premalignant and malignant lesions can be created by the expression of mutant BRAF with or without p53 mutation.19

Statement of Clinical Relevance BRAF mutations in benign and malignant oral melanocytic lesions points to a potential role of BRAF in malignant transformation. This may have important therapeutic implications, because individuals with BRAF mutations may benefit from specific treatment with RAF inhibitors.

OOOO Volume 114, Number 6

BRAF mutations in cutaneous melanoma have been found to be very common in melanomas arising on nonchronically sun-damaged skin such as the trunk and proximal extremities.15 Several studies demonstrated a low incidence of BRAF mutation in melanoma arising from nonhair bearing skin, which has a thickened cornified layer that protects skin from UV damage.20 Low incidence of BRAF mutations was also found in uveal melanomas as well as in melanoma arising from mucosa and from various internal organs that are sun protected.21-25 The incidence of BRAF mutation in oral melanoma is rare, with few studies published. Wong, et al. investigated BRAF mutation in fifty-one melanomas from various internal organs including three from maxilla and four from the hard palate and floor of mouth. BRAF mutation was absent in all oral tumors,25 and Buery, et al. found, in a recently published study, BRAF missense mutations in only 1 out of 15 cases of oral melanoma.26 Recently, somatic mutations of the GNAQ gene at codon 209, has been reported in uveal melanoma and blue nevi.27 The GNAQ gene encodes a G-protein ␣-subunit that mediates signals from G-protein– coupled receptors (GPCRs) to the MAPK pathway. Glutamine, encoded by codon 209 of the GNAQ gene lies within the RAS-like domain of GNAQ and is essential for GTP hydrolysis. A systematic study of the mutational profile of exon 5 of the GNAQ gene in a panel of tumors (glioblastoma; gastrointestinal stromal tumors; acute myeloid leukemia; bladder, breast, colorectal, lung, ovarian, pancreas, and thyroid carcinomas; skin melanoma; and blue nevi) yielded positive findings only for blue nevi.28 GNAQ behaves similarly to the oncogenes BRAF and NRAS, via MAPK activation.27 Further studies are necessary to determine whether differences in tissue involvement between melanocytic neoplasms with BRAF mutations and those with GNAQ mutations are a functional consequence of the mutations themselves, or indicates differences in the target cell populations in which these mutations occur.27 Clarifying the genetic pathways of oral melanoma development has important therapeutic implications because those with BRAF mutations may benefit from specific treatment with an RAF inhibitor. However, the rarity of melanoma in the oral cavity makes it hard to collect large numbers of cases for molecular analysis. The aim of the present study, therefore, was to analyze the prevalence of BRAF and GNAQ mutations in a series of primary oral melanocytic tumors: nevi and melanomas.

MATERIALS AND METHODS Four cases of oral malignant melanomas were retrieved from archives of the pathology departments of Rabin Medical Center and Sheba Medical Center. In addition,

ORIGINAL ARTICLE Cohen et al. 779

10 melanocytic nevi were retrieved from the department of oral pathology at the School of Dental Medicine, Tel-Aviv University. The study protocol was approved by the Institutional Review Board and by the Ministry of Health Ethical Review Board for the Use of Genetic Material. The anonymity of the patients investigated was preserved according to the data protection rules of the Ministry of Health for the Use of Genetic Material. Laser capture microdissection of tumor cells and DNA isolation Five-micrometer-thick sections were cut from each paraffin embedded tissue and placed on membrane-coated slides (PALM, Munich, Germany). From each case, ⱖ10 sections were cut on slides for microdissection. Slides were heated at 60°C overnight and stained with hematoxylin and eosin. Slides were then placed on a robot stage microscope equipped with a 337-nm pulsed laser microbeam (Palm, Munich, Germany). Groups of tumor cells were dissected from the slides with the laser microbeam and then catapulted with a single laser shot into the lid of a microfuge tube. Tumor cells and the covering epithelium were dissected in separate tubes for mutational analysis. DNA was extracted by a column-based method (QIAamp DNA Micro Kit; Qiagen). Purified DNA was suspended in 50 ␮L 10 mmol/L Tris-HCl (pH 7.4) and 1 mmol/L EDTA buffer. Mutation analysis Oncogenic mutations in GNAQ (GNAQ209, exon 5) and BRAF (BRAFV600E, exon 15) were analyzed with a chip-based matrix-assisted laser desorption time-offlight (MALDI-TOF) mass spectrometer (Sequenom, San Diego, CA). Specific primers flanking the mutation sites and extension primers that bind adjacent to the mutation site were designed with assay-design software (Table I) (Massarray; Sequenom). After amplification of the region of interest, a primer extension reaction was carried out which included sequence-specific hybridization and sequence-dependent termination, generating different products for the mutated and wild-type alleles, each with a unique mass value. The extension products were spotted onto silicon chips preloaded with proprietary matrix (Spectrochip; Sequenom) and read by the MALDI-TOF mass spectrometer. Direct sequencing The mutations were validated by direct sequencing of selected samples. Each polymerase chain reaction (PCR) amplification was performed in a 50-␮L reaction volume containing 150 ng sample DNA as a template. The

ORAL AND MAXILLOFACIAL PATHOLOGY 780 Cohen et al.

OOOO December 2012

Table I. Primers for the Sequenom GNAQ mutation 627 A⬎T

Forward

Reverse

Extension

ACG TTG GAT GTG CAG AAT GGT CGA TGT AGG

ACG TTG GAT GCA CTA AGC GCT ACT AGA AAC ACG TTG GAT GGA GGT GAC ATT TTC AAA GCA G ACG TTG GAT GGA GGT GAC ATT TTC AAA GCA G

ATT TTC TTC TCT CTG ACC T

ACG TTG GAT GTC TTC ATG AAG ACC TCA CAG

ACT CCA TCG AGA TTT C

626 A⬎T

ACG TTG GAT GAC CTT GCA GAA TGG TCG ATG

626 A⬎C

ACG TTG GAT GAC CTT GCA GAA TGG TCG ATG

BRAF mutation 1799 T⬎A

ACG TTG GAT GTT CAA ACT GAT GGG ACC CAC

TTT TCT TCT CTC TGA CCT T TTT TCT TCT CTC TGA CCT T

Table II. Primers used for direct sequencing validation of mutations by PCR Gene

Forward

Reverse

PCR product size

BRAF V600E GNAQ209

GGCACATCACTGAACATAATTATC TTTTCCCTAAGTTTGTAAGTAGTGC

AGCATGATATCACAAAGGTACT CCTCATTGTCTGACTCCACG

224 bp 222 bp

reaction was performed with the use of specific primers for BRAF and GNAQ (Table II). PCR parameters were as follows: denaturation for 5 minutes at 95°C; 35 cycles of 1 minute at 95°C; annealing for 1 minute at 56-60°C and for 1 minute at 72°C. The PCR products were separated on 2% agarose gel and visualized with ethidium bromide staining. Direct sequencing of the PCR products was performed (Big Dye Terminator Cycle Sequencing and ABI Prism 3700 DNA Analyzer; Applied Biosystems, Foster City, CA).

RESULTS Of the 4 melanomas, 3 were primary oral tumors and 1 case was an extension of melanoma from the middle concha of the nose. Of the 10 nevi, 6 were intramucosal and 4 were blue nevi. The histopathologic diagnosis was confirmed by 2 of the authors (A.H. and I.K.; Figure 1). Table III presents the clinical presentation of the study group. The incidence of T1799A BRAF mutations among the various lesions is depicted in Table IV. V600E point mutation was identified in the BRAF gene in 3 of the 8 nevi, all 3 of them intramucosal nevi. In 1 of the nevi, the mutation was found also in the epithelial lining the lesion. T1799A BRAF mutations were identified in 2 of the 4 melanomas studied; the mutation was identified also in the seemingly intact epithelium adjacent to the tumors. Only 1 blue nevus harbored the GNAQ209 mutation. DISCUSSION Melanocytes are dispersed throughout the oral mucosa, giving rise to various conditions, such as mel-

anosis, melanotic macule, nevi, and in rare cases malignant melanoma. Although cutaneous melanocytic nevi of young adult whites number in the dozens, oral melanocytic nevi (OMNs) are rare, and their etiology and pathogenesis are poorly understood.8,29 Differences in incidence rates, exposure profiles, and clinical behavior suggest that cutaneous and mucosal melanomas may not necessarily share identical pathways of tumorigenesis, and indeed, according to the recommendation of the WESTOP workshop in 1997,30 oral mucosal melanomas should be considered to be different from cutaneous melanoma. Because of its rare occurrence, oral melanoma has not been extensively investigated. p53 protein alterations have been identified in about two-thirds of oral malignant melanomas (OMM),31 and loss of heterozygosity at 12p13 and loss of p27KIP1 protein expression have recently been suggested to contribute to melanoma progression.32 Cytogenetic analysis and evaluation of melanocyte-specific gene 1 (MSG-1) appears to be very helpful for understanding the pathogenesis of OMM.32,33 The RAS-RAF-MEK-ERK-MAP kinase pathway mediates cellular responses to growth signals and is involved in a large number of physiologic and neoplastic processes.10,11 More than 80% of the mutations involve a single base substitution in the kinase domain (T1799A), leading to a V600E amino acid substitution. Activating mutations in the BRAF gene have been identified in human cancers, with the highest frequency of mutations found in cutaneous melanomas.12 BRAF mutations appear to be commonly involved in the progression of cutaneous malignant melanoma. Nevertheless, several recent studies have demonstrated

OOOO Volume 114, Number 6

ORIGINAL ARTICLE Cohen et al. 781

Fig. 1. Representative photomicrographs of (a, b) intramucosal nevus, (c, d) blue nevus, and (e, f) melanoma (hematoxylin and eosin stain). On the left are low-power micrographs (original magnification ⫻40), and on the right higher-power micrographs (original magnification ⫻200).

a low incidence of BRAF mutation in melanoma arising from non– hair-bearing skin that is relatively protected from ultraviolet light damage and in melanoma arising from mucosa that is totally sun protected.20-23,25 Unlike cutaneous melanoma, BRAF mutation is rarely reported in melanoma arising in the oral mucosa. Maldonado et al.24 investigated 21 mucosal melanomas in the oral cavity and nasal and anogenital regions and found BRAF mutations in 2 cases; however, the exact ana-

tomic location of those lesions was not reported. Wong et al.25 studied 36 mucosal melanomas, including 3 from the maxilla and 4 from the hard palate and floor of mouth; BRAF mutations were not identified in any of these lesions. Buery RR et al.,26 in a recently published study, found BRAF mutation in 1 of 15 oral melanomas. Although it is considered to be a founder event in the formation of melanocytic tumors, several authors have recently argued against this notion by showing marked

ORAL AND MAXILLOFACIAL PATHOLOGY 782 Cohen et al.

OOOO December 2012

Table III. Epidemiologic and tumor data of the study cohort Case

Age

Sex

Histologic diagnosis

Clinical

1 2

37 19

F F

Common blue nevus Common blue nevus

3 4 5 6 7

22 53 24 26 35

M M M M M

Common blue nevus Common blue nevus Intramucosal nevus Intramucosal nevus Intramucosal nevus

8

20

M

Intramucosal nevus

9 10

40 56

F F

Intramucosal nevus Intramucosal nevus

11

79

M

Malignant melanoma, nodular

12 13 14

38 73 70

M F F

Malignant melanoma superficial spreading Malignant melanoma, nodular Malignant melanoma Nodular

Pigmented macule Slightly raised pigmented lesion Pigmented macule Pigmented macule Pigmented macule Pigmented macule Slightly raised pigmented lesion Slightly raised pigmented lesion Pigmented macule Slightly raised pigmented lesion Nasal bleeding and ulcerated palatal nodule Ulcerated mass Pigmented nodule Ulcerated mass

Location

Follow-up

Posterior hard palate Upper lip vermilion

UR UR

Posterior Posterior Posterior Posterior Posterior

UR UR UR UR UR

hard hard hard hard hard

palate palate palate palate palate

Upper lip vermilion

UR

Posterior hard palate Attached gingiva

UR UR

Hard palate extension from the nose Upper gingiva Palate-tuberosity Post. hard palate

Unknown Unknown Survival 8 mo Survival 16 mo

UR, Unremarkable.

Table IV. Results of the mutational analysis Case

Diagnosis

1 2 3 4 4 5 6 7 8 9 11 12 13 14

Common blue nevus Common blue nevus Common blue nevus Common blue nevus Intramucosal nevus Intramucosal nevus Intramucosal nevus Intramucosal nevus Intramucosal nevus Intramucosal nevus Malignant melanoma Malignant melanoma Malignant melanoma Malignant melanoma

BRAF mutation

GNAQ mutation ⫹

⫹ ⫹ ⫹ ⫹ ⫹

polyclonality of BRAF mutations in acquired melanocytic nevi, suggesting that it may be one of the multiple clonal events in melanoma development, which are selected for during progression.34 Uveal melanoma has not been characterized by the presence of activating mutations in BRAF; however, activation of the MAPK pathway in uveal melanoma remains important for disease development and progression. An activating mutation has been reported in codon 209 (Gln209Leu) of the guanine nucleotide– binding protein Q polypeptide (GNAQ), a heterotrimeric protein that couples transmembrane domain receptors to intracellular signaling pathways, such as MAPK, in 45%-50% of patients with uveal melanoma.27 Thus, the lack of a GNAQ mutation in skin melanoma highlights its different pathogenesis from uveal melanoma. GNAQ behaves similarly to the on-

cogenes BRAF in that its mutation is insufficient for full progression to melanoma. This is illustrated best by blue nevi, which are generally stable lesions that rarely become malignant.35 Thus, MAPK activation appears to be an early event in neoplasms with GNAQ mutations, because it is in neoplasms with BRAF mutations,19 but both mutations never occur simultaneously.36 In the present study, we show for the first time the presence of BRAF mutation in 3 out of 8 oral intramucosal nevi. The presence of BRAF mutation in these 3 nevi does not necessarily indicate that these nevi are premalignant; more genetic events are needed for malignant transformation to occur. Two cases of oral mucosal melanoma in the present study harbored BRAF mutation. In one, the oral tumor was probably an extension from the nasal mucosa, and the other case was considered to be primary in the oral cavity; nevertheless, metastasis can not be absolutely excluded, as with most oral melanomas. These results do not contradict the rare occurrence of BRAF mutations found in the literature, owing to the small number of cases studied. Clinical differences between these 2 lesions and the other nonmutated cases can not be confirmed, because of the small number of cases studied. BRAF mutation was identified in the lining epithelium in 1 of the nevi and in the 2 melanoma cases, which may suggest that the mutation originated from melanocytes residing the epithelium. GNAQ mutation was found in 1 case diagnosed as a common blue nevus. That case originated from the vermilion of the upper lip and it can be debated whether it can be considered to be an intraoral or a skin lesion.

OOOO Volume 114, Number 6

The other 3 cases of palatal blue nevi lacked mutations of either BRAF or GNAQ. This is in contrast to skin blue nevi, where GNAQ mutations were identified in 83% of the cases.27 None of the BRAF-mutated cases in the present study harbored GNAQ mutations, which is in accordance with recently published studies.37,38 BRAF mutations have been reported to occur in a large majority of cutaneous nevi, suggesting that melanomas with this mutation may arise from preexisting nevi. This is probably not the case in the development of most oral melanomas. Nevertheless, the finding of BRAF mutations in both benign and malignant melanocytic lesions of the oral mucosa points to a potential initiating role of BRAF in transformation of some oral lesions and to the need for additional cooperating genetic events to achieve full malignancy. Studies of the molecular changes in oral melanomas could help to clarify their genetic pathway of development. It is clear that melanoma subtypes differ between anatomic sites and need to be viewed individually, not collectively, as novel strategies are designed that target critical genetic alterations.39 The results of the present study may have important therapeutic implications, because patients with BRAF mutations, though a small number of cases, may benefit from specific treatment with RAF inhibitors.37,39 REFERENCES 1. Mendenhall WM, Amdur RJ, Hinerman RW, Werning JW, Villaret DB, Mendenhall NP. Head and neck mucosal melanoma. Am J Clin Oncol 2005;28:626-30. 2. Chang AE, Karnell LH, Menck HR, American College of Surgeons Commission on Cancer, American Cancer Society. The National Cancer Data Base report on cutaneous and noncutaneous melanoma: a summary of 84,836 cases from the past decade. Cancer 1998;83:1664-78. 3. Vikey AK, Vikey D. Primary malignant melanoma, of head and neck: a comprehensive review of literature. Oral Oncol 2012;48:399-403. 4. Conley J, Pack GT. Melanoma of the mucous membranes of the head and neck. Arch Otolaryngol 1974;99:315-19. 5. Hicksa MJ, Flaitz CM. Oral mucosal melanoma: epidemiology and pathobiology. Oral Oncol 2000;36:152-69. 6. Ostman J, Anneroth G, Gustafsson H, Tavelin B. Malignant oral tumours in Sweden 1960-1989 —an epidemiological study. Oral Oncol. Eur J Cancer 1995;31B:106-12. 7. Meleti M, Leemans CR, Mooi WJ, Vescovi P, van der Waal I. Oral malignant melanoma: a review of the literature. Oral Oncol 2007;43:116-21. 8. Buchner A, Merrell PW, Carpenter WM. Relative frequency of solitary melanocytic lesions of the oral mucosa. J Oral Pathol Med 2004;33:550-7. 9. Gu GM, Epstein JB, Morton TH. Intraoral melanoma: Long-term follow-up and implication for dental clinicians. A case report and literature review. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2003;96:404-13. 10. Peyssonnaux C, Eychène A. The Raf/MEK/ERK pathway: new concepts of activation. Biol Cell 2001;93:53-62. 11. Duesbery NS, Webb CP, van de Woude GF. MEK wars, a new front in the battle against cancer. Nat Med 1999;5:736-7.

ORIGINAL ARTICLE Cohen et al. 783 12. Davies H, Bignell GR, Cox C, Stephens P, Edkins S, Clegg S, et al. Mutations of the BRAF gene in human cancer. Nature 2002;417:949-54. 13. Garnett MJ, Marais R. Guilty as charged: BRAF is a human oncogene. Cancer Cell 2004;6:313-9. 14. Wan PT, Garnett MJ, Roe SM, Lee S, Niculescu-Duvaz D, Good VM, et al. Mechanism of activation of the RAF-ERK signaling pathway by oncogenic mutations of B-RAF cell 2004;116:855-67. 15. Daud A, Bastian BC. Beyond BRAF in melanoma. Curr Top Microbiol Immunol. Published online 2011. 16. Miller AJ, Mihm MC Jr. Melanoma. N Engl J Med 2006; 355:51-65. 17. Michaloglou C, Vredeveld LC, Soengas MS, Denoyelle C, Kuilman T, van der Horst CM, et al. BRAFE600-associated senescence-like cell cycle arrest of human naevi. Nature 2005; 436:720-4. 18. Patton EE, Widlund HR, Kutok JL, Kopani KR, Amatruda JF, Murphey RD, et al. BRAF mutations are sufficient to promote nevi formation and cooperate with p53 in the genesis of melanoma. Curr Biol 2005;15:249-54. 19. Pollock PM, Harper UL, Hansen KS, Yudt LM, Stark M, Robbins CM, et al. High frequency of BRAF mutations in nevi. Nat Genet 2003;33:19-20. 20. Cohen Y, Rosenbaum E, Begum S, Goldenberg D, Esche C, Lavie O, et al. Exon 15 BRAF mutations are uncommon in melanomas arising in nonsun-exposed sites. Clin Cancer Res 2004;10:3444-7. 21. Cohen Y, Goldenberg-Cohen N, Parrella P, Chowers I, Merbs SL, Pe’er J, Sidransky D. Lack of BRAF mutation in primary uveal melanoma. Invest Ophthalmol Vis Sci 2003;44:2876-8. 22. Rimoldi D, Salvi S, Liénard D, Lejeune FJ, Speiser D, Zografos L, Cerottini JC. Lack of BRAF mutations in uveal melanoma. Cancer Res 2003;63:5712-15. 23. Edwards RH, Ward MR, Wu H, Medina CA, Brose MS, Volpe P, et al. Absence of BRAF mutations in UV-protected mucosal melanomas. J Med Genet 2004;41:270-2. 24. Maldonado JL, Fridlyand J, Patel H, Jain AN, Busam K, Kageshita T, et al. Determinants of BRAF mutations in primary melanomas. J Natl Cancer Inst 2003;95:1878-90. 25. Wong CW, Fan YS, Chan TL, Chan ASW, Ho LC, Ma TKF, et al. BRAF and NRAS mutations are uncommon in melanomas arising in diverse internal organs. J Clin Pathol 2005;58:640-4. 26. Buery RR, Siar CH, Katase N, Gunduz M, Lefeuvre M, Fujii M, et al. NRAS and BRAF mutation frequency in primary oral mucosal melanoma. Oncol Rep 2011;26:783-7. 27. van Raamsdonk CD, Bezrookove V, Green G, Bauer J, Gaugler L, O’Brien JM, et al. Frequent somatic mutations of GNAQ in uveal melanoma and blue naevi. Nature 2009;457:599-602. 28. Lamba S, Felicioni L, Buttitta F, Bleeker FE, Malatesta S, Corbo V, et al. Mutational profile of GNAQQ209 in human tumors. PLoS ONE 2009;4:e6833. 29. Meleti M, Mooi WJ, Casparie MK, van der Waal I. Melanocytic nevi of the oral mucosa—no evidence of increased risk for oral malignant melanoma: an analysis of 119 cases. Oral Oncol 2007;43:976-81. 30. Barker BF, Carpenter WM, Daniels TE, Kahn MA, Leider AS, Lozada-Nur F, et al. Oral mucosal melanomas: the WESTOP Banff workshop proceedings. Western Society of Teachers of Oral Pathology. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 1997;83:672-9. 31. Korabiowska M, Brinck U, Hoenig JF, Bartkowski SB, Kellner S, Marx D, Schauer A. Significance of P-53 antigen in malignant melanomas and naevi of the head and neck area. Anticancer Res 1995;15:885-9.

ORAL AND MAXILLOFACIAL PATHOLOGY 784 Cohen et al. 32. Woenckhaus C, Fenic I, Giebel J, Hauser S, Failing K, Woenckhaus J, et al. Loss of heterozygosity at 12p13 and loss of p27Kip1 protein expression contribute to melanoma progression. Virchows Arch 2004;445:491-7. 33. Farnedi A, Magrini E, Betts CM, Cocchi R, Pession A, Foschini MP. Cytogenetic analysis of oral malignant melanoma. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2005;99:655-6. 34. Lin J, Goto Y, Murata H, Sakaizawa K, Uchiyama A, Saida T, Takata M. Polyclonality of BRAF mutations in primary melanoma and the selection of mutant alleles during progression. Br J Cancer 2011;104:464-8. 35. Zembowicz A, Mihm MC. Dermal dendritic melanocytic proliferations: an update. Histopathology 2004;45:433-51. 36. Dratviman-Storobinsky O, Cohen Y, Frenkel S, Pe’er J, Goldenberg-Cohen N. Lack of oncogenic GNAQ mutations in melanocytic lesions of the conjunctiva. Invest Ophthalmol Vis Sci 2010;51:6180-2. 37. Sosman JA, Kim KB, Schuchter L, Gonzalez R, Pavlick AC, Weber JS, et al. Survival in BRAF V600-mutant advanced mel-

OOOO December 2012 anoma treated with vemurafenib. N Engl J Med 2012;366: 707-14. 38. Mitsiades N, Chew SA, He B, Riechardt AI, Karadedou T, Kotoula V, Poulaki V. Genotype-dependent sensitivity of uveal melanoma cell lines to inhibition of B-Raf, MEK, and Akt kinases: rationale for personalized therapy. Invest Ophthalmol Vis Sci 2011;52:7248-55. 39. Romano E, Schwartz GK, Chapman PB, Wolchock JD, Carvajal RD. Treatment implications of the emerging molecular classification system for melanoma. Lancet Oncol 2011;12:913-22. Reprint requests: Prof. Abraham Hirshberg, MD, DMD Department of Oral Pathology and Oral Medicine Maurice and Gabriela, Goldschleger School of Dental Medicine Tel Aviv University Tel Aviv Israel [email protected]