Broad but Distinct Role of Pregnane X Receptor on the Expression of Individual Cytochrome P450s in Human Hepatocytes

Drug Metab. Pharmacokinet. 22 (4): 276–286 (2007).

Regular Article Broad but Distinct Role of Pregnane X Receptor on the Expression of Individual Cytochrome P450s in Human Hepatocytes Koki KOJIMA1,2, Kiyoshi NAGATA1,3, Tsutomu MATSUBARA1 and Yasushi YAMAZOE1,* 1Division

of Drug Metabolism and Molecular Toxicology, Graduate School of Pharmaceutical Sciences, Tohoku University, Miyagi, Japan Full text of this paper is available at http://www.jstage.jst.go.jp/browse/dmpk

Summary: In the present study, we have utilized a target selective human pregnane X receptor-siRNA (hPXR-siRNA)-adenovirus expression system to examine the contribution of hPXR on the gene regulation of drug-metabolizing P450s in human hepatocytes. Introduction of the hPXR-siRNA adenoviral vector reduced the level of PXR mRNA. After infection with Ad hPXR-siRNA, the basal and ligand-activated CYP2A6, CYP2C8, CYP3A4 and CYP3A5 mRNA levels were decreased signiˆcantly in dose-dependent manners, whereas CYP2B6, CYP2C9 and CYP2C19 mRNA levels were moderately in‰uenced after infection with Ad hPXR-siRNA. These data suggest the distinct PXR in‰uences on the regulation of these genes. The expression of CYP1A2 and CYP2D6 mRNA were not aŠected by the introduction of hPXR-siRNA, suggesting that PXR plays no functional role in the expression of either of these genes. This is the ˆrst report to compare simultaneously the relative contribution of hPXR on the expression of nine forms of P450 in primary cultured human hepatocytes. Mutual sharing among nuclear receptors of their binding cis-elements becomes clear now. Thus, the present method using the combination of adenovirus-mediated hPXR-siRNA expression and human hepatocytes may oŠer clear information on the relative role of nuclear receptors such as hPXR on the expression of drug metabolizing genes.

Key words: PXR; CYP3A4; P450; siRNA; human hepatocytes including drugs (e.g., macrolide antibiotics, antimycotics, glucocorticoids), herbs (e.g., St. John's wort) and pesticides (e.g., DDT, pyributicarb).1,3–5) Ligand-activation of PXR and W or CAR stimulates expression of the target gene through binding to elements located in the regulatory regions following dimerization with retinoid X receptor (RXRa; NR2B1).6–8) The induction of CYP3A4 and CYP2B6 is mainly mediated through activation of PXR and CAR, respectively.9–14) However, it has been reported that PXR and CAR are also involved in basic transactivation of both CYP2B6 and CYP3A4 genes.15–17) Hepatic levels of other P450, such as CYP2A6, CYP2C8, CYP2C9 and

Introduction It is now widely recognized that a number of nuclear receptors are involved in P450 gene regulation. Among these nuclear receptors pregnane X receptor (PXR; NR1I2) and constitutive androstane receptor (CAR; NR1I3) are major determinants in the expression of genes associated with various aspects of drug metabolism, including oxidative metabolism, conjugation, and transport.1) PXR is expressed mainly in the liver and intestine, where it plays important roles in detoxiˆcation and elimination of xenobiotics from the body.2) PXR is activated by a structurally diverse array of xenobiotics,

Received; March 15, 2007, Accepted; May 22, 2007 *To whom correspondence should be addressed: Yasushi YAMAZOE, Division of Drug Metabolism and Molecular Toxicology, Graduate School of Pharmaceutical Sciences, Tohoku University, Aramaki-aoba 6-3, Aoba-ku, Sendai, Miyagi 980-8578, Japan. Tel. ＋81-22-795-6827, Fax. ＋81-22-795-6826, E-mail: yamazoe＠mail.tains.tohoku.ac.jp 2 Current address: Exploratory Toxicology & DMPK Research Laboratories, Tanabe Seiyaku Co., Ltd., 2-50 Kawagishi 2-chome, Toda, Saitama 335-8505, Japan. 3 Current address: Tohoku Pharmaceutical University, 4-4-1 Komatsushima, Aobaku, Sendai, Miyagi 981-8558, Japan. Abbreviations used are: PXR, pregnane X receptor; CAR, constitutive androstane receptor; HNF4a, hepatocyte nuclear factor-4a; RXRa, retinoid X receptor-a; FXR, farnesoid X receptor; GRa, glucocorticoid receptor-a; SHP, small heterodimer partner; P450, cytochrome P450; DMSO, dimethyl sulfoxide; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; siRNA, small interfering RNA; Ad hPXR-siRNA, hPXRsiRNA-expression adenovirus; PB, phenobarbital; CLO, clotrimazole; PCR, polymerase chain reaction; RT-PCR, reverse transcriptionpolymerase chain reaction; TCID50, 50z titer culture infectious dose; MOI, multiplicity of infection.

276

Contribution of PXR to P450 Gene Expression

CYP2C19 are also increased after treatment with rifampicin, a typical PXR activator.11,13,14) It is also reported that CYP2C8, CYP2C9 and CYP2C19 are transactivated through CAR.18,19) At present, the exact contribution of individual nuclear receptors on individual P450 gene expression in human liver remain unclear. For studies of gene transcriptional activation, reporter gene assay systems are mostly used to investigate promoter and enhancer elements to provide information on the gene regulation. The results, however, do not always re‰ect the induction proˆle that was observed in vivo, possibly because of established cell lines, artiˆcially fused genes and W or over-expressed transfactors.20,21) In most studies of hepatic P450 gene regulation, the HepG2 cell line, which is derived from human hepatocellular carcinoma, has been used.17–19,22–25) Expression of PXR is detectable but CAR is below the limit of detection in HepG2 cells.5) In addition, CAR translocates spontaneously to the nucleus in many cell lines, even after the over-expression. The nuclear translocation of CAR is tightly regulated in the liver and primary hepatocytes.26) Recently, we have reported that the induction of both human CYP1A1 and CYP1A2 are controlled simultaneously through common regulatory elements found inside the CYP1A1 gene.25) This ˆnding suggests a possibility that gene expression might be aŠected by neighboring genes. In addition, inconsistent results are obtained from reporter gene assays using established cell lines and from those in the liver. To overcome these di‹culties, human primary hepatocytes are preferred for the analysis of the function of PXR in the gene regulation of P450s. When hepatocytes are cultured under conditions that restore near-normal hepatocellular morphology and the expression of liver-speciˆc genes, P450 enzymes can be detected in hepatocytes in a manner re‰ecting that in vivo in terms of the magnitude and speciˆcity of P450 induction.27,28) Recently, target selective knock-down technology, using small interfering RNA (siRNA), has been developed.29) This siRNA technology is applicable to speciˆcally suppress the expression of PXR and may contribute to the elucidation of the involvement of PXR in transcriptional activation of P450 genes involved in drug metabolism and disposition. However, the e‹ciency of siRNA is largely dependent on the delivery system transports the siRNA into target cells. Adenoviral vectors represent one of the most sophisticated expression systems available today.30) The present study aims to investigate and understand how PXR contributes to the regulation of endogenous human P450 genes in primary cultured hepatocytes. For this purpose we have constructed the hPXR-siRNA adenovirus expression vector to selectively suppress PXR expression and examined the eŠects on the expres-

277

sion and W or induction of nine drug-metabolizing P450s to examine diŠerences in the contribution of PXR in the expression of these genes. Materials and Methods Materials: William's medium E, insulin, transferrin, selenium, dexamethasone, phenobarbital and clotrimazole were obtained from Sigma Chemical (St. Louis, MO). Matrigel was purchased from BD Bioscience-Discovery Labware (Bedford, MA). Penicillin-Streptomycin was purchased from Gibco BRL (Gaithersburg, MD). KHEM5310 was purchased from KAC (Shiga, Japan). Cell cultures: Cryopreserved human hepatocytes (lot. 582; Caucasian, female, aged 60 years) were purchased from XenoTech LLC (Lenexa, KS), and thawed as recommended by the vendor prior to use for incubations. Viability of the cryopreserved hepatocytes was at least 85z at the start of the incubation. The hepatocytes pellets were resuspended in KHEM5310 medium (KAC). Hepatocytes were plated at 2.5×105 cells W well on 24-well plates, coated with collagen, type I (Iwaki, Tokyo, Japan). Cells were allowed to attach for 4 h in a humidiˆed atmosphere of 5z CO2 at 379C. Culture dishes were gently mixed by swirling, and medium containing unattached cells was then aspirated. Fresh ice-cold serum-free William's medium E containing 0.1 mM dexamethasone, 6.25 mg W mL insulin, 6.25 mg W mL transferrin, 6.25 ng W mL selenium and 50 mg W mL Matrigel was added to each dish. For virus experiments, the day after seeding, cells were infected with 0.05 mL of the hPXR-siRNA adenovirus expression vector (Ad hPXR-siRNA) stock solution (1×106 TCID50 W well) for 1 h, and then medium was added to each well and the cells were cultured for an additional 72 hrs. Multiplicity of infection (MOI) was calculated by dividing the TCID50 by the number of cells. For the induction study including virus, medium containing 1 mM phenobarbital, 10 mM clotrimazole, or 0.1z (v W v) DMSO (vehicle alone) was added to the wells 48 hrs after virus infection and cultured for an additional 24 hrs. 0.1z DMSO had little eŠect on expression of target mRNAs. Construction of the Ad hPXR-siRNA and the infection conditions have been reported previously.5) Ad hPXR-siRNA strongly suppressed the expression of hPXR protein to a similar degree as that of the mRNA. Ad LacZ, which expresses b-galactosidase, was provided by Dr. Izumi Saito (Tokyo University). We demonstrated that this adenovirus and an adenovirus expressing a non-targeting siRNA, mouse st2b2-targeting siRNA, which does not match any human mRNA, did not aŠect any of the mRNA levels evaluated in this experiment (data not shown). Thus, we used Ad LacZ as a control for the RNA knockdown experiments.

278

Koki KOJIMA, et al. Table 1. Gene Probe

Primers and Probes for TaqMan analysis

Sequence

Accession No.

Reference

PXR

Forward primer Reverse primer Probe

GGCCACTGGCTATCACTTCAA TTTCATGGCCCTCCTGAAAA TCATGACATGTGAAGGATGCAAGGGC

AF061056

39

CAR

Forward primer Reverse primer Probe

GCAAGGGTTTCTTCAGGAGAAC CTTCACAGCTTCCAGCAAAGG TCAGCAAAAGCATTGGTCCCACC

NM_005122

HNF4a

Forward primer Reverse primer Probe

GAGGAACCAGTGCCGCTACT TCTGGACGGCTTCCTTCTTC CTCAAGAAATGCTTCCGGGCTGGC

NM_000457

RXRa

Forward primer Reverse primer Probe

AAGGACCGGAACGAGAATGA ATCCTCTCCACCGGCATGT CGACCAGCAGCGCCAACGAG

NM_002957

FXR

Forward primer Reverse primer Probe

AGGTAGCAGAGATGCCTGTAACAA CACAGCTCATCCCCTTTGATC ATGGGCGCGTCAGCAGGG

NM_005123

SHP

Forward primer Reverse primer Probe

GGTGCAGTGGCTTCAATGC GGTTGAAGAGGATGGTCCCTTT CCTTCTGGAGCCTGGAGCTTAGC

NM_021969

GRa

Forward primer Reverse primer Probe

GAGGAGGAGCTACTGTGAAGGTTT GCTGCTTGGAGTCTGATTGAGA TGCGTCTTCACCCTCACTGGCTGT

NM_000176

VDR

Forward primer Reverse primer Probe

TAGAGCTGTCCCAGCTCTCCAT TGACCTTTTGGATGCTGTAACTGA CTGCCCCACCTGGCTGACCT

NM_000376

CYP1A2

Forward primer Reverse primer Probe

TGTTCAAGCACAGCAAGAAGG TGCTCCAAAGACGTCATTGAC CTAGAGCCAGCGGCAACCTCATCCCA

AF182274

38

CYP2A6

Forward primer Reverse primer Probe

TTTTGGTGGCCTTGCTGGT GGAGTTGTACATCTGCTCTGTGTTCA TGCCTGACTGTGATGGTCTTGATGTCTGTT

AF182275

38

CYP2B6

Forward primer Reverse primer Probe

CCCCAAGGACACAGAAGTATTTC GATTGAAGGCGTCTGGTTTTTC TGAGCACTGCTCTCCATGACCCACACTA

AF182277

38

CYP2C8

Forward primer Reverse primer Probe

GGACTTTATGGATTGCTTCCTG CCATATCTCAGAGTGGTGCTTG TTGGCACTGTAGCTGATCTATTTGTTGCTGGA

NM_000770

38

CYP2C9

Forward primer Reverse primer Probe

GACATGAACAACCCTCAGGACTTT TGCTTGTCGTCTCTGTCCCA AAAACACTGCAGTTGACTTGTTTGGAGC

M61857

38

CYP2C19

Forward primer Reverse primer Probe

GAACACCAAGAATCGATGGACA TCAGCAGGAGAAGGAGAGCATA TAATCACTGCAGCTGACTTACTTGGAGCTGGG

NM_000769

38

CYP2D6

Forward primer Reverse primer Probe

CCTACGCTTCCAAAAGGCTTT AGAGAACAGGTCAGCCACCACT CAGCTGGATGAGCTGCTAACTGAGCACA

NM_000106

38

CYP3A4

Forward primer Reverse primer Probe

GATTGACTCTCAGAATTCAAAAGAAACTGA GGTGAGTGGCCAGTTCATACATAATG AGGAGAGAACACTGCTCGTGGTTTCACAG

AF182273

38

CYP3A5

Forward primer Reverse primer Probe

CCTTACCCCAGTTTTTGAAGCA TCCAGATCAGACAGAGCTTTGTG TTTCTTTCGAATTCTGGGAGTCAATCATC

NM_000777

38

ABCB1

Forward primer Reverse primer Probe

GTCCCAGGAGCCCATCCT CCCGGCTGTTGTCTCCATA TTGACTGCAGCATTGCTGAGAACATTGC

NM_000927

40

ABCC2

Forward primer Reverse primer Probe

ACTGTTGGCTTTGTTCTGTCCA CAACAGCCACAATGTTGGTCTCTA CTCAATATCACACAAACCCTGAACTGGCTG

NM_000392

38

GAPDH

Forward primer Reverse primer Probe

TCATGGGTGTGAACCATGAGA ACTGTGGTCATGAGTCCTTCCA CAGCCTCAAGATCATCAGCAATGCCTC

AF261085

38

Contribution of PXR to P450 Gene Expression

Real-time polymerase chain reaction: At the end of the culture period, the medium was removed and total RNA was extracted from human hepatocytes using TRIzol reagent (Invitrogen) and RNeasy Mini Kits (Qiagen) according to manufacturers' protocols. Optical density (OD) measurements were determined on the RNA samples at 260 nm. For the real-time PCR analysis, the TaqMan One-Step RT-PCR Master Mix reagents Kit (Applied Biosystems) with gene-speciˆc primers and probes were used in a reaction volume of 25 mL W tube. The primer pairs and the TaqMan probes for the target mRNAs are listed in Table 1. The primers and ‰uorogenic probes for the real-time PCR were purchased from Operon Technologies, Inc. (Alameda, CA). The real-time probe consisted of a reporter dye (6-FAM) conjugated to the 5? end and a quencher dye (TAMRA) conjugated to the 3? end. Real-time PCR was performed in a total volume of 25 mL consisting of 2x TaqMan Universal PCR Master Mix (Applied Biosystems), 300 nM forward primer, 900 nM reverse primers, 200 nM TaqMan probe, 40x MultiScribe & RNase inhibitor mix, and 25 ng of template. Ampliˆcation and detection were performed on an ABI PRISM 7900HT Sequence Detection System (Applied Biosystems). The cycling conditions were 10 min at 95 9 C for initial denaturation and activation of AmpliTaq Gold DNA polymerase, followed by 40 cycles of 15s at 959 C for denaturation, 1 min at 609C for combined annealing and primer extension. A relative standard curve was generated by serial dilutions of total RNA. Ct values of standards were plotted against the log of the respective dilution factors. The slope and y-intercept of the standard curve line were determined by linear regression and used to calculate the input amount of the unknown samples for the respective genes. To standardize the amount of sample, the calculated amount of the gene of interest was divided by the calculated amount of the constitutively expressed glyceraldehyde3-phosphate dehydrogenase (GAPDH) gene in the sample. These normalized amounts were then used to compare the relative amount of target mRNA between diŠerent samples. Statistical analysis: Data were expressed as the mean±SEM from three or four independent experiments. Comparison of two groups was performed with two-tailed Student's t-test. Comparison of multiple groups was evaluated using one-way ANOVA with the Bonferroni W Dunn post hoc test with Bonferroni's adjustment in a level and the levels of probability were noted (*, pº0.05, **, pº0.01). Results EŠect of Ad hPXR-siRNA on expression of PXR mRNA: To determine the in‰uence of hPXR-siRNA

279

Fig. 1. Time-course of PXR mRNA expression in cultured human hepatocytes after transfection with hPXR-siRNA adenovirus expression. Human hepatocytes were seeded and cultured as described in Materials and Methods. Cells were infected with hPXR-siRNA adenovirus for one hour and cultured for various times, as shown in the ˆgure. Values were expressed as the mean±SEM from four independent samples. *, pº0.05, **, pº0.01 when treated samples were compared with controls using student's t-test.

expression by the Ad hPXR-siRNA on the level of PXR mRNA, the changes in the level of speciˆc PXR mRNA were determined in primary human hepatocytes by realtime PCR after infection with 4 MOI of Ad hPXR-siRNA. PXR mRNA levels were decreased to 22z, 28z and 28z of controls after 3, 5 and 7 days post-infection with the Ad hPXR-siRNA, respectively (Fig. 1). In hepatocytes transfected with a control virus (Ad LacZ), there was no apparent change in the expression of hPXR compared with virus-free hepatocytes. From these results, three days post-infection was selected as the point of determination in the following experiments. Speciˆcity of Ad hPXR-siRNA: It is well known that several types of nuclear receptors are involved in P450 regulation. To verify the speciˆcity of the hPXRsiRNA used throughout this study, we transfected cultured hepatocytes with various concentrations of Ad hPXR-siRNA (0.04–4 MOI) for 3 days and determined the speciˆc levels of PXR, CAR, FXR, RXRa, HNF4a, SHP, GRa and VDR mRNAs by real-time PCR. Although clear decreases of speciˆc PXR mRNA were observed in a dose dependent manner after the introduction of hPXR-siRNA (Fig. 2), no signiˆcant in‰uences were detected on the levels of CAR, FXR, RXRa, HNF4a, SHP, and GRa mRNAs. VDR mRNA was not estimated quantitatively, due to the low detectable level. The reduction of PXR mRNA after introduction of hPXR-siRNA was reproducible in duplicate experiments. Speciˆc PXR mRNA levels were reduced to 68z, 74 z, 57z and 22z of the controls after transfection at 0.12, 0.4, 1.2 and 4 MOI of Ad hPXR-siRNA, respec-

280

Koki KOJIMA, et al.

Fig. 2. Dose-dependency of hPXR-siRNA adenovirus expression on mRNA expression of various nuclear receptors in human hepatocytes. Human hepatocytes were seeded and cultured as described in Materials and Methods. Cells were infected with various MOI of hPXR-siRNA adenovirus for one hour and cultured for seventy-two hours. Values were expressed as the mean±SEM from three or four independent samples. *, pº0.05, **, pº0.01 when treated samples were compared with controls using one-way ANOVA with Bonferroni W Dunn post hoc test with Bonferroni's adjustment in a level.

tively. Thus, the IC50 for hPXR was calculated to be 1.15 MOI of Ad hPXR-siRNA. Changes in the basal levels of various P450 mRNAs: To conˆrm the in‰uence of hPXR-siRNA expression on well-known PXR target genes, speciˆc levels of CYP3A4 mRNA were determined in human hepatocytes transfected with various MOI of Ad hPXR-siRNA. Levels of speciˆc CYP3A4 mRNA were reduced in a dose-dependent manner with increasing MOI of Ad hPXR-siRNA (Fig. 3). The expression levels of CYP3A4 mRNA in human hepatocytes were 59z, 32 z, 34z and 18z of control after infection with 0.12, 0.4, 1.2 and 4 MOI of Ad hPXR-siRNA, respectively (statistically signiˆcant). The IC50 of Ad hPXR-siRNA for CYP3A4 was calculated to be 0.224 MOI. To characterize the eŠect of hPXR-siRNA expression on speciˆc P450 mRNA levels other than the CYP3A4, the levels of CYP1A2, CYP2A6, CYP2B6, CYP2C8, CYP2C9, CYP2C19, CYP2D6 and CYP3A5 mRNAs were determined. Speciˆc mRNA levels of seven out of the nine P450s examined were aŠected by the introduction of hPXR-siRNA. Speciˆc mRNA levels of CYP2A6, CYP2C8 and CYP3A5 were strikingly suppressed, and those of CYP2B6, CYP2C9 and CYP2C19 were moderately attenuated following infection with increasing MOI of Ad hPXR-siRNA. There was no clear in‰uence of the Ad hPXR-siRNA on the expression of CYP1A2 and CYP2D6 mRNAs. Levels of CYP2A6, CYP2C8 and CYP3A5 mRNAs in human hepatocytes after infection with 4 MOI of Ad hPXR-siRNA reached 16z, 29z and 31z of their con-

trols, respectively. The IC50 values of Ad hPXR-siRNA for CYP2A6, CYP2C8 and CYP3A5 mRNAs expression were calculated to be 0.198 MOI, 0.303 MOI, and 1.20 MOI, respectively. The levels of CYP2B6, CYP2C9 and CYP2C19 mRNAs in human hepatocytes were 58z, 63z and 45z of their controls, respectively, after infection with 4 MOI of Ad hPXR-siRNA. Large deviations between experiments were observed for CYP2C19 mRNA levels due to the low abundance in primary hepatocytes. Thus, changes in CYP2C19 mRNA did not reach statistical signiˆcance in this experiment; although a decreasing trend was observed. In‰uences on phenobarbital and clotrimazole induction: To assess the contribution of ligand-activated hPXR on the expression of CYP3A4, the in‰uence of hPXR-siRNA on ligand-mediated P450 induction was evaluated in human hepatocytes. The expression of hPXR was clearly attenuated following the introduction of Ad hPXR-siRNA, even in the presence of phenobarbital or clotrimazole. The presence of phenobarbital or clotrimazole did not in‰uence the level of PXR mRNA in either the Ad LacZ and Ad hPXR-siRNA treated groups (Fig. 4). Phenobarbital (1 mM) and clotrimazole (10 mM) signiˆcantly enhanced the expression of CYP3A4 mRNA, to 3.3 and 2.0 times of vehicle control (DMSO), respectively. The induction of CYP3A4 mRNA by treatment with phenobarbital or clotrimazole was signiˆcantly suppressed to 9.7z and 16z, respectively, relative to the virus control (Ad LacZ) after infection with Ad hPXR-siRNA. Ligand-activated mRNA levels of CYP1A2, CYP2A6, CYP2B6, CYP2C8, CYP2C19, CYP2D6 and

Contribution of PXR to P450 Gene Expression

281

Fig. 3. Dose-dependency of hPXR-siRNA adenovirus expression on mRNA expression of various P450s in human hepatocytes. Human hepatocytes were seeded and cultured as described in Materials and Methods. Cells were infected with various MOI of hPXR-siRNA adenovirus for one hour and cultured for seventy-two hours. Values were expressed as the mean±SEM from three or four independent samples. *, pº0.05, **, pº0.01 when treated samples were compared with controls using one-way ANOVA with Bonferroni W Dunn post hoc test with Bonferroni's adjustment in a level.

CYP3A5 were also determined to characterize the eŠect of hPXR-siRNA expression on these P450s. Seven of the nine P450s examined were altered by the introduction of hPXR-siRNA. Speciˆc mRNA levels of CYP2A6, CYP2B6, CYP2C8, CYP2C9, CYP2C19 and CYP3A5, were enhanced after 1 mM phenobarbital treatment to 4.1, 16, 2.8, 1.9, 1.6 and 2.0 fold of their controls, respectively. Introduction of Ad hPXR-siRNA resulted in variable degrees of changes in the level of P450 mRNA species. The enhanced expression levels of CYP2A6, CYP2B6, CYP3A5, CYP2C8, CYP2C9 and CYP2C19 by phenobarbital were attenuated following the introduction of Ad hPXR-siRNA to 14z, 16z, 16z, 30z, 39 z and 53z, respectively, relative to the virus control

(Ad LacZ) (statistically signiˆcant). Clotrimazole (10 mM) signiˆcantly enhanced not only the expression of CYP2B6 and CYP3A5 mRNA but also that of CYP1A2 mRNA. The levels of CYP1A2, CYP2B6 and CYP3A5 mRNA increased to 12, 7.2 and 3.2 times that of their controls, respectively. However clotrimazole treatment did not signiˆcantly aŠect the expression of CYP2A6, CYP2C8, CYP2C9, and CYP2C19 mRNAs in the control virus group. The increased expression of CYP2B6 and CYP3A5 mRNAs by clotrimazole was attenuated to 24z and 19z, respectively, relative to the virus control (Ad LacZ) after introduction of Ad hPXR-siRNA (statistically signiˆcant). In contrast, expression of hPXR-siRNA did not aŠect the expression of CYP1A2 mRNA.

282

Koki KOJIMA, et al.

Fig. 4. EŠect of hPXR-siRNA on the expression of various P450s. Human hepatocytes were exposed to solvent (0.1z DMSO), 1 mM phenobarbital, or 10 mM clotrimazole for twenty-four hours, forty-eight hours after infection with the hPXR-siRNA adenovirus. Results were expressed as relative expression levels vs. controls. Values were expressed as the mean±SEM from four independent samples. *, pº0.05, **, pº0.01 when treated samples were compared with control using one-way ANOVA with Bonferroni W Dunn post hoc test with Bonferroni's adjustment in a level.

Discussion In the present study, we have determined the contribution of hPXR on gene expression of hepatic P450s using an adenovirus-mediated target speciˆc siRNA expression system in human hepatocytes as a model relevant to in vivo states. The most advantageous application of siRNA is through the ability to verify speciˆcally by knockdown of the role of the functional transfactor in a gene transcriptional pathway. This hPXRsiRNA expression system selectively reduced the levels of hPXR mRNA and protein in HepG2 cells, as report-

ed recently.5) The introduction of hPXR-siRNA reduced the levels of PXR mRNA in human hepatocytes in a dose-dependent manner, without obvious in‰uences on the levels of CAR, FXR, RXRa, HNF4a, SHP, and GRa mRNAs after treatment for 3 days (Fig. 2). Concomitant with the loss of PXR mRNA, the basal expression level of CYP3A4 mRNA was reduced with increasing amounts of Ad hPXR-siRNA (Fig. 3). Ad hPXR-siRNA diŠerently aŠected the expression of individual P450s in the absence or presence of typical inducers. Phenobarbital and clotrimazole rather than

Contribution of PXR to P450 Gene Expression

Fig. 4.

rifampicin are used in the present study. The reason remains unclear, but the treatment with rifampicin, itself, resulted in the repressed expression of hPXR in our preliminary experiments. Introduction of hPXR-siRNA resulted in signiˆcantly decreased expression of CYP2A6, CYP2C8, CYP3A4 and CYP3A5 mRNAs at both the basal and ligand-activated conditions, suggesting a possibility that PXR is a main determinant of the P450 expression in hepatocytes. These results are roughly consistent with those identiˆed previously through the use of the reporter gene assay methods,15,19,31,32) although the expression of CYP2C8 was not up-regulated by over-expression of PXR in the previous study.19) Interestingly, speciˆc levels of mRNA for CYP3A4 and CYP2A6, rather than

283

(Continued)

for PXR, were more intensely suppressed at lower concentrations of Ad hPXR-siRNA. The extent of suppression for CYP3A5 and CYP2C8 mRNAs was similar to that of PXR. The extent of suppression for CYP2B6, CYP2C9 and CYP2C19 were lesser than that of PXR. EŠect of hPXR-siRNA on the expression of P450s diŠered among CYP2A6, CYP2B6, CYP2C8, CYP2C9, CYP2C19, CYP3A4 and CYP3A5. These results might be re‰ected in the diŠerential susceptibilities of the P450s shown above. The mechanistic cause of the variability is unclear, further studies are necessary but it is possible to be a consequence of the number of PXR binding sites in the regulatory regions of these genes. More than three PXR binding sites have been observed in the enhancer regions of the CYP3A4 and CYP2A6

284

Koki KOJIMA, et al.

Fig. 5. EŠect of hPXR-siRNA on the expression of ABCB1 and ABCC2. Human hepatocytes were exposed to solvent (0.1z DMSO), 1 mM phenobarbital, or 10 mM clotrimazole for twenty-four hours, forty-eight hours after infection with the hPXR-siRNA adenovirus. Results were expressed as relative expression levels vs. controls. Values were expressed as the mean±SEM from four independent samples. *, pº0.05, **, pº0.01 when treated samples were compared with control using one-way ANOVA with Bonferroni W Dunn post hoc test with Bonferroni's adjustment in a level.

genes.15,31) Two PXR binding sites were found in the enhancer region of CYP2C8,19) but at present only a single PXR binding site has been found in the enhancer region of CYP3A5.32) Introduction of hPXR-siRNA moderately decreased the basal and ligand-activated expression of CYP2C9 and CYP2C19 in dose-dependent manners. These results suggest the role of PXR on the expression of CYP2C9 and CYP2C19. CAR may play a auxiliary role

in the regulation of CYP2C9 and CYP2C19. Consistent with the present results, CYP2C9 and CYP2C19 have been reported to be up-regulated following over-expression of PXR and CAR.18,19,23) While the introduction of hPXR-siRNA strongly suppressed the ligand-activated expression of CYP2B6, basal expression was only marginally suppressed by the introduction of hPXR-siRNA. Thus, PXR is likely to be essential in ligand-activated expression of CYP2B6, but may not be obligatory on the basal expression of CYP2B6. CAR might play a prominent role in the basal expression of CYP2B6. Although further experiments are necessary, the distinct contribution of PXR in basal and ligand-activated expression of CYP2B6 may suggest functional diŠerences between two PXR binding sites in the enhancer region of CYP2B6.17,22) The level of CYP1A2 mRNA was strongly enhanced after treatment with clotrimazole. This is the ˆrst report to show that clotrimazole is an inducer of CYP1A2 in human hepatocytes, although clotrimazole has been shown to enhance expression of rodent CYP1A1 W 2.33) The clotrimazole-activated expression of CYP1A2 mRNA was however, not suppressed after the introduction of hPXR-siRNA. These results suggest that PXR has no clear role in the expression of CYP1A2. CYP1A2 induction via activation of the aryl hydrocarbon receptor (AhR) is well established.25,34) On the other hand, speciˆc levels of CYP2D6 mRNA were not altered after introduction of hPXR-siRNA or PXR ligand. These results suggest again that PXR plays no clear role in the expression of CYP2D6. Induction studies in human hepatocytes after treatment with typical PXR ligands suggest the association of PXR in the regulation of CYP2A6, CYP2B6, CYP2C8, CYP2C9, CYP2C19, CYP3A4 and CYP3A5; although PXR involvement has not been shown directly.9–14,19,32) The combination use of human hepatocytes and the adenovirus-mediated target speciˆc siRNA expression system facilitates clear identiˆcation of the involvement of PXR in transcriptional activation of P450 genes. In the present study, CYP2A6, CYP2B6, CYP2C8, CYP2C9, CYP2C19, CYP3A4 and CYP3A5, but not CYP1A2 and CYP2D6, have been shown to be under the control of PXR. From the evidence obtained in these experiments, PXR plays a prominent role, not only in the regulation of CYP3A4, but also in the regulation of other major human hepatic P450s, in varying degrees. The detailed mechanisms by which PXR regulates each of the P450 genes were not clariˆed in the present study and await further studies. Induction studies in human hepatocytes after treatment with typical PXR ligands suggest the involvement of PXR in the regulation of multidrug resistance protein 1 (MDR1 W ABCB1), and multi-drug resistance-associated protein 2 (MRP2 W ABCC2); although PXR involve-

Contribution of PXR to P450 Gene Expression

ment has not been shown directly.35–37) In this study, introduction of hPXR-siRNA also resulted in signiˆcantly decreased expression of ABCB1 and ABCC2 mRNAs at both the basal and ligand-activated conditions, suggesting that ABCB1 and ABCC2 are under control of PXR in human hepatocytes (Fig. 5). The combination use of hPXR-siRNA adenovirus expression and human hepatocytes would oŠer information on the relative contribution of hPXR in these gene regulations. This is the ˆrst report to simultaneously compare the relative contribution of hPXR in the regulation of P450 involving drug metabolism in primary cultured human hepatocytes. References 1)

2)

3)

4)

5)

6)

7)

8)

9)

Chang, T. K. and Waxman, D. J.: Synthetic drugs and natural products as modulators of constitutive androstane receptor (CAR) and pregnane X receptor (PXR). Drug Metab. Rev., 38: 51–73 (2006). Honkakoski, P. and Negishi, M.: Regulation of cytochrome P450 (CYP) genes by nuclear receptors. Biochem. J., 347: 321–337 (2000). Lemaire, G., de Sousa, G. and Rahmani, R.: A PXR reporter gene assay in a stable cell culture system: CYP3A4 and CYP2B6 induction by pesticides. Biochem. Pharmacol., 68: 2347–2358 (2004). Noracharttiyapot, W., Nagai, Y., Matsubara, T., Miyata, M., Shimada, M., Nagata, K. and Yamazoe, Y.: Construction of several human-derived stable cell lines displaying distinct proˆles of CYP3A4 induction. Drug Metab. Pharmacokinet., 21: 99–108 (2006). Matsubara, T., Noracharttiyapot, W., Toriyabe, T., Yoshinari, K., Nagata, K. and Yamazoe, Y.: Assessment of human pregnane X receptor-involvement in pesticidemediated activation of CYP3A4 gene. Drug Metab. Disp., in press. Blumberg, B., Sabbagh, W., Jr., Juguilon, H., Bolado, J., Jr., van Meter, C. M., Ong, E. S. and Evans, R. M.: SXR, a novel steroid and xenobiotic-sensing nuclear receptor. Genes Dev., 12: 3195–3205 (1998). Kliewer, S. A., Moore, J. T., Wade, L., Staudinger, J. L., Watson, M. A., Jones, S. A., McKee, D. D., Oliver, B. B., Willson, T. M., Zetterstrom, R. H., Perlmann, T. and Lehmann, J. M.: An orphan nuclear receptor activated by pregnanes deˆnes a novel steroid signaling pathway. Cell, 92: 73–82 (1998). Lehmann, J. M., McKee, D. D., Watson, M. A., Willson, T. M., Moore, J. T. and Kliewer, S. A.: The human orphan nuclear receptor PXR is activated by compounds that regulate CYP3A4 gene expression and cause drug interactions. J. Clin. Invest., 102: 1016–1023 (1998). Maglich, J. M., Stoltz, C. M., Goodwin, B., HawkinsBrown, D., Moore, J. T. and Kliewer, S. A.: Nuclear pregnane x receptor and constitutive androstane receptor regulate overlapping but distinct sets of genes involved in xenobiotic detoxiˆcation. Mol. Pharmacol., 62: 638–646 (2002).

10)

11)

12)

13)

14)

15)

16)

17)

18)

19)

285

Watkins, R. E., Maglich, J. M., Moore, L. B., Wisely, G. B., Noble, S. M., Davis-Searles, P. R., Lambert, M. H., Kliewer, S. A. and Redinbo, M. R.: 2.1 A crystal structure of human PXR in complex with the St. John's wort compound hyperforin. Biochemistry, 42: 1430– 1438 (2003). Madan, A., Graham, R. A., Carroll, K. M., Mudra, D. R., Burton, L. A., Krueger, L. A., Downey, A. D., Czerwinski, M., Forster, J., Ribadeneira, M. D., Gan, L. S., LeCluyse, E. L., Zech, K., Robertson, P. Jr., Koch, P., Antonian, L., Wagner, G., Yu, L. and Parkinson, A.: EŠects of prototypical microsomal enzyme inducers on cytochrome P450 expression in cultured human hepatocytes. Drug Metab. Dispos., 31: 421–431 (2003). Faucette, S. R., Wang, H., Hamilton, G. A., Jolley, S. L., Gilbert, D., Lindley, C., Yan, B., Negishi, M. and LeCluyse, E. L.: Regulation of CYP2B6 in primary human hepatocytes by prototypical inducers. Drug Metab. Dispos., 32: 348–358 (2004). Donato, M. T., Serralta, A., Jimenez, N., Perez, G., Castell, J. V., Mir, J. and Gomez-Lechon, M. J.: Liver grafts preserved in Celsior solution as source of hepatocytes for drug metabolism studies: comparison with surgical liver biopsies. Drug Metab. Dispos., 33: 108–114 (2005). Girault, I., Rougier, N., Chesne, C., Lidereau, R., Beaune, P., Bieche, I. and de Waziers, I.: Simultaneous measurement of 23 isoforms from the human cytochrome P450 families 1 to 3 by quantitative reverse transcriptase-polymerase chain reaction. Drug Metab. Dispos., 33: 1803–1810 (2005). Goodwin, B., Hodgson, E. and Liddle, C.: The orphan human pregnane X receptor mediates the transcriptional activation of CYP3A4 by rifampicin through a distal enhancer module. Mol. Pharmacol., 56: 1329–1339 (1999). Tirona, R. G., Lee, W., Leake, B. F., Lan, L. B., Cline, C. B., Lamba, V., Parviz, F., Duncan, S. A., Inoue, Y., Gonzalez, F. J., Schuetz, E. G. and Kim, R. B.: The orphan nuclear receptor HNF4alpha determines PXR- and CAR-mediated xenobiotic induction of CYP3A4. Nat. Med., 9: 220–224 (2003). Wang, H., Faucette, S., Sueyoshi, T., Moore, R., Ferguson, S., Negishi, M. and LeCluyse, E. L.: A novel distal enhancer module regulated by pregnane X receptor W constitutive androstane receptor is essential for the maximal induction of CYP2B6 gene expression. J. Biol. Chem., 278: 14146–14152 (2003). Chen, Y., Ferguson, S. S., Negishi, M. and Goldstein, J. A.: Identiˆcation of constitutive androstane receptor and glucocorticoid receptor binding sites in the CYP2C19 promoter. Mol. Pharmacol., 64: 316–324 (2003). Ferguson, S. S., Chen, Y., LeCluyse, E. L., Negishi, M. and Goldstein, J. A.: Human CYP2C8 is transcriptionally regulated by the nuclear receptors constitutive androstane receptor, pregnane X receptor, glucocorticoid receptor, and hepatic nuclear factor 4alpha. Mol. Pharmacol., 68: 747–757 (2005).

286

20)

21)

22)

23)

24)

25)

26)

27)

28)

29)

30)

Koki KOJIMA, et al.

Duncan, S. A., Navas, M. A., Dufort, D., Rossant, J. and StoŠel, M.: Regulation of a transcription factor network required for diŠerentiation and metabolism. Science, 281: 692–695 (1998). Aouabdi, S., Gibson, G. and Plant, N.: Transcriptional regulation of the PXR gene: identiˆcation and characterization of a functional peroxisome proliferator-activated receptor alpha binding site within the proximal promoter of PXR. Drug Metab. Dispos., 34: 138–144 (2006). Sueyoshi, T., Kawamoto, T., Zelko, I., Honkakoski, P. and Negishi, M.: The repressed nuclear receptor CAR responds to phenobarbital in activating the human CYP2B6 gene. J. Biol. Chem., 274: 6043–6046 (1999). Chen, Y., Ferguson, S. S., Negishi, M. and Goldstein, J. A.: Induction of human CYP2C9 by rifampicin, hyperforin, and phenobarbital is mediated by the pregnane X receptor. J. Pharmacol. Exp. Ther., 308: 495–501 (2004). Pitarque, M., Rodriguez-Antona, C., Oscarson, M. and Ingelman-Sundberg, M.: Transcriptional regulation of the human CYP2A6 gene. J. Pharmacol. Exp. Ther., 313: 814–822 (2005). Ueda, R., Iketaki, H., Nagata, K., Kimura, S., Gonzalez, F. J., Kusano, K., Yoshimura, T. and Yamazoe, Y.: A common regulatory region functions bidirectionally in transcriptional activation of the human CYP1A1 and CYP1A2 genes. Mol. Pharmacol., 69: 1924–1930 (2006). Kawamoto, T., Sueyoshi, T., Zelko, I., Moore, R., Washburn, K. and Negishi, M.: Phenobarbital–responsive nuclear translocation of the receptor CAR in induction of the CYP2B gene. Mol. Cell Biol., 19: 6318–6322 (1999). Sidhu, J. S., Farin, F. M. and Omiecinski, C. J.: In‰uence of extracellular matrix overlay on phenobarbitalmediated induction of CYP2B1, 2B2, and 3A1 genes in primary adult rat hepatocyte culture. Arch. Biochem. Biophys., 301: 103–113 (1993). LeCluyse, E., Madan, A., Hamilton, G., Carroll, K., DeHaan, R. and Parkinson, A.: Expression and regulation of cytochrome P450 enzymes in primary cultures of human hepatocytes. J. Biochem. Mol. Toxicol., 14:177–188 (2000). Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E. and Mello, C. C.: Potent and speciˆc genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature, 391: 806–811 (1998). Massie, B., Couture, F., Lamoureux, L., Mosser, D. D., Guilbault, C., Jolicoeur, P., Belanger, F. and Langelier, Y.: Inducible overexpression of a toxic protein by an adenovirus vector with a tetracycline-regulatable expres-

31)

32)

33)

34) 35)

36)

37)

38)

39)

40)

sion cassette. J. Virol., 72: 2289–2296 (1998). Itoh, M., Nakajima, M., Higashi, E., Yoshida, R., Nagata, K., Yamazoe, Y. and Yokoi, T.: Induction of human CYP2A6 is mediated by the pregnane X receptor with peroxisome proliferator-activated receptor-s gamma tcoactivator 1salphat. J. Pharmacol. Exp. Ther., 319: 693–702 (2006). Burk, O., Koch, I., Raucy, J., Hustert, E., Eichelbaum, M., Brockmoller, J., Zanger, U. M. and Wojnowski, L.: The induction of cytochrome P450 3A5 (CYP3A5) in the human liver and intestine is mediated by the xenobiotic sensors pregnane X receptor (PXR) and constitutively activated receptor (CAR). J. Biol. Chem., 279: 38379–38385 (2004). Kobayashi, Y., Matsuura, Y., Kotani, E., Fukuda, T., Aoyagi, T., Tobinaga, S., Yoshida, T. and Kuroiwa, Y.: Structural requirements for the induction of hepatic microsomal cytochrome P450 by imidazole- and pyridine-containing compounds in rats. J. Biochem. (Tokyo), 114: 697–701 (1993). Whitlock, J. P. Jr.: Induction of cytochrome P4501A1. Annu. Rev. Pharmacol. Toxicol., 39: 103–125 (1999). Geick, A., Eichelbaum, M. and Burk, O.: Nuclear receptor response elements mediate induction of intestinal MDR1 by rifampin. J. Biol. Chem., 276: 14581–14587 (2001). Synold, T. W., Dussault, I. and Forman, B. M.: The orphan nuclear receptor SXR coordinately regulates drug metabolism and eŒux. Nat. Med., 7: 584–590 (2001). Kast, H. R., Goodwin, B., Tarr, P. T., Jones, S. A., Anisfeld, A. M., Stoltz, C. M., Tontonoz, P., Kliewer, S., Willson, T. M. and Edwards, P. A.: Regulation of multidrug resistance-associated protein 2 (ABCC2) by the nuclear receptors pregnane X receptor, farnesoid Xactivated receptor, and constitutive androstane receptor. J. Biol. Chem., 277: 2908–2915 (2002). Nishimura, M., Yoshitsugu, H., Naito, S. and Hiraoka, I.: Evaluation of gene induction of drug-metabolizing enzymes and transporters in primary culture of human hepatocytes using high-sensitivity real-time reverse transcription PCR. Yakugaku Zasshi, 122: 339–361 (2002). Nishimura, M., Naito, S. and Yokoi, T.: Tissue-speciˆc mRNA expression proˆles of human nuclear receptor subfamilies. Drug Metab. Pharmacokinet., 19: 135–149 (2004). Langmann, T., Mauerer, R., Zahn, A., Moehle, C., Probst, M., Stremmel, W. and Schmitz, G.: Real-time reverse transcription-PCR expression proˆling of the complete human ATP-binding cassette transporter superfamily in various tissues. Clin. Chem., 49: 230–238 (2003).