Bromodomain and extraterminal domain-containing protein inhibition attenuates acute inflammation after spinal cord injury

Experimental Neurology 309 (2018) 181–192

Contents lists available at ScienceDirect

Experimental Neurology journal homepage: www.elsevier.com/locate/yexnr

Researh Paper

Bromodomain and extraterminal domain-containing protein inhibition attenuates acute inflammation after spinal cord injury

T

⁎

Michelle D. Rudmana,b, James S. Choia, Ha Eun Leea, Sze Kiat Tanb,c, Nagi G. Ayada,b,c, , ⁎ Jae K. Leea, a

The Miami Project to Cure Paralysis, Department of Neurological Surgery, University of Miami Miller School of Medicine, Miami, FL, USA The Center for Therapeutic Innovation, The Department of Psychiatry and Behavioral Sciences, University of Miami Miller School of Medicine, Miami, FL, USA c The University of Miami Brain Tumor Initiative, Sylvester Comprehensive Cancer Center, University of Miami Miller School of Medicine, Miami, FL, USA b

A R T I C LE I N FO

A B S T R A C T

Keywords: Epigenetics Epigenetic reader (+)-JQ1 Macrophages Neutrophils Microglia Neurons Oligodendrocytes Astrocytes Neuroprotection

Inflammation is a major contributor to the secondary damage that occurs after spinal cord injury (SCI). The inflammatory response is coordinated by many different signaling modalities including the epigenetic modification of promoters and enhancers. Bromodomain and extraterminal domain-containing proteins (BETs; Brd2, Brd3, Brd4, BrdT) are epigenetic readers that bind acetylated histones to promote transcription of pro-inflammatory genes. BET inhibition is anti-inflammatory in animal models of cancer, rheumatoid arthritis, and coronary artery disease. However, the role of BETs in neuroinflammation remains largely unexplored. In this study, we investigated the role of BETs in promoting inflammation in neural cells and the ability of the BET inhibitor JQ1 to decrease inflammation acutely after SCI. Expression of BET mRNA was assessed via qPCR in purified primary mouse macrophages, astrocytes, neurons, oligodendrocytes, and microglia, as well as in naïve, sham-injured, and contusion-injured mouse spinal cord. Brd2, Brd3, and Brd4 mRNA were expressed in all purified primary neural cells and in the uninjured and injured mouse spinal cord. BET inhibition significantly attenuated proinflammatory signaling in all activated cell populations in vitro. To investigate the effects of BET modulation after SCI, the BET inhibitor JQ1 was injected intraperitoneally (30 mg/kg, bidaily) 3 h after spinal cord contusion in adult female C57BL/6 mice. By 3 days post-injury, BET inhibition significantly decreased proinflammatory cytokine expression and leukocyte recruitment to the injury site. However, this decrease did not lead to locomotor improvements or smaller lesion size. Taken together, our data implicate BETs as regulators of multiple key pro-inflammatory cytokines, and suggest that BETs can be pharmacologically inhibited to reduce inflammation acutely after SCI.

1. Background Inflammation after spinal cord injury (SCI) contributes significantly to secondary damage. After physical injury to the spinal cord, cytokines are rapidly synthesized and released by all cells in the affected area (Hayashi et al., 2000; Pineau and Lacroix, 2007). Cytokines promote apoptosis of local neuronal cells as well as recruitment of activated leukocytes into the injured spinal cord (Beck et al., 2010; Chen et al., 2011; D'Souza et al., 1995; Saiwai et al., 2010; Stirling and Yong, 2008; Xing et al., 2011). Infiltrating leukocytes amplify inflammatory cytokine signaling, increase neurotoxicity, and promote scar formation by

recruiting fibroblasts into the injury site (Horn et al., 2008; Kigerl et al., 2009; Zhu et al., 2014). Additionally, the lesion site maintains a proinflammatory phenotype chronically after SCI, which may hinder wound healing and regeneration (Beck et al., 2010; Blight, 1983, 1991; Popovich et al., 1997). Due to these detrimental effects of inflammation after SCI, inhibiting inflammation has been a major goal for improving outcomes after SCI. However, an anti-inflammatory agent that effectively decreases inflammation and promotes improved outcomes after clinical SCI has not yet been found and new anti-inflammatory interventions are needed. Bromodomain and extraterminal domain-containing proteins

Abbreviations: SCI, Spinal cord injury; BET, Bromodomain and extraterminal domain-containing protein; qPCR, reverse transcription, quantitative polymerase chain reaction; CNS, Central nervous system; CT, Cycle Threshold; OPC, oligodendrocyte precursor cell; BMDM, Bone marrow-derived macrophage; PEM, Peritonealelicited macrophage; LPS, Lipopolysaccharide; FACS, Fluorescence-activated cell sorting ⁎ Corresponding authors at: University of Miami, Miami Project to Cure Paralysis, 1095 NW 14th Terrace, LPLC R-48, Miami, FL 33136, USA. E-mail addresses: [email protected] (N.G. Ayad), [email protected] (J.K. Lee). https://doi.org/10.1016/j.expneurol.2018.08.005 Received 20 June 2018; Received in revised form 2 August 2018; Accepted 15 August 2018 Available online 19 August 2018 0014-4886/ © 2018 Published by Elsevier Inc.

Experimental Neurology 309 (2018) 181–192

M.D. Rudman et al.

(BETs) have recently emerged as important regulators of inflammation (Belkina et al., 2013; Clifford et al., 2015; Khan et al., 2014; Klein et al., 2016; Meng et al., 2014; Nicodeme et al., 2010; Perry et al., 2015). BETs are epigenetic readers that bind acetylated lysines via their two Nterminal bromodomains (Filippakopoulos et al., 2012; Filippakopoulos et al., 2010; Liu et al., 2008; Nicodeme et al., 2010). The BET protein family consists of 4 isoforms: Brd2, Brd3, Brd4, and testis-specific Brd6/ t. BETs specifically regulate newly activated gene promoters and enhancers and may be targeted to interrupt transiently activated transcription. In the context of inflammation, BETs have been shown to bind to promoters and enhancers of cytokines and chemokines to promote proinflammatory gene expression (Belkina et al., 2013; Clifford et al., 2015; Gamsjaeger et al., 2011; Khan et al., 2014; Meng et al., 2014; Nicodeme et al., 2010; Perry et al., 2015). In macrophages, fibroblasts, and other cell types, siRNA knockdown of Brd2, Brd3, or Brd4 inhibits cytokine expression, suggesting that BETs contribute to cytokine expression in multiple cell types in vitro (Gallagher et al., 2014; Khan et al., 2014; Klein et al., 2014, 2016; Perry et al., 2015; Xiao et al., 2016). Pharmacologic inhibition of BETs is also anti-inflammatory. Small molecules that mimic acetylated lysines competitively bind the BET bromodomain binding pockets and displace BETs from chromatin, thereby inhibiting transcription (Filippakopoulos et al., 2010; Nicodeme et al., 2010). Due to the unique loop-regions flanking the bromodomains of BETs, these small-molecule inhibitors are highly selective for BET bromodomains over other bromodomain-containing proteins, thus limiting their off-target effects (Filippakopoulos et al., 2010; Nicodeme et al., 2010). BET inhibitors potently attenuate inflammation in multiple mouse models of inflammatory diseases, including sepsis, rheumatoid arthritis, inflammatory bowel disease, and atherosclerosis (Belkina et al., 2013; Jahagirdar et al., 2017; Jahagirdar et al., 2014; Meng et al., 2014; Nicodeme et al., 2010). These studies demonstrate that BET inhibition is effective for decreasing inflammation in vivo. BET inhibition is also anti-inflammatory in the central nervous system (CNS). In purified primary astrocytes and microglial cell lines, BET inhibition attenuates cytokine synthesis (Choi et al., 2015; Demars et al., 2018; Jung et al., 2015). In a mouse model of multiple sclerosis, pharmacological inhibition of BETs inhibited disease development when given prophylactically and decreased early symptoms of disease onset and pathology when given therapeutically (Barrett et al., 2014; Jahagirdar et al., 2017). However, our understanding of the role of BETs in neurons and glia is still limited. In neurons, studies have suggested that Brd4 may play a role in synaptic plasticity (Korb et al., 2015) and that BET inhibition may promote neural progenitor differentiation into neurons rather than glia (Li et al., 2016). Brd4 has also been implicated in the development of neuropathic pain in spinal cord neurons (Hsieh et al., 2017; Takahashi et al., 2018b). However, a role for BETs in inflammation after traumatic injuries to the CNS has not yet been investigated. In this study, we explored the role of BETs in neuroinflammation after contusive spinal cord injury. We detected Brd2, Brd3, and Brd4 mRNA in both neuronal and glial cell populations in vitro as well as in the naïve and injured mouse spinal cord. We demonstrated that BET inhibition decreases inflammatory cytokine expression in primary neurons, oligodendrocytes, microglia, and astrocytes in vitro as well as in the spinal cord after a contusive SCI. Finally, we assessed leukocyte infiltration using flow cytometry and found that mice treated with the BET inhibitor JQ1 had significantly decreased leukocyte infiltration in the SCI lesion at 3 days post-injury compared to vehicle controls. Despite the significant attenuation of inflammation, we did not observe improved lesion size or locomotor recovery. These findings suggest that BETs play a role in promoting the expression of a wide range of proinflammatory genes in all CNS cell types and that BET inhibition can significantly attenuate neuroinflammation after SCI.

Table 1 Primers for Quantitative PCR (F = forward primer, R = reverse primer; 5′ to 3′). Brd2 Brd3 Brd4 Tnf Il-1β Il-6 Cxcl10 Ccl5 Ccl2 Gapdh

F R F R F R F R F R F R F R F R F R F R

GCTGTGAAGCTGGGTTTGC AATCCTGCATACATTCTGAGGCA TTACAAGCCAGTGGACGCGG TGCATCTGGGTACTCTCGGCT GGACGAGGGAGGAAAGAAACA AGGAAAGGGGTGAGTTGTGG AGGCACTCCCCCAAAAGATG TCACCCCGAAGTTCAGTAGAC CTTCAAATCTCACAGCAGCAGCACATC CCACGGGAAAGACACAGGTAG AACCACGGCCTTCCCTACTTCA TCATTTCCACGATTTCCCAGAG GCCGTCATTTTCTGCCTCATCCT CTCATTCTCACTGGCCCGTCATC TGCCCACGTCAAGGAGTATTTCTA TGGCGGTTCCTTCGAGTGACAA CCCCACTCACCTGCTGCTAC CCTGCTGCTGGTGATTCTCTT TGGCCTTCCGTGTTCCTAC GAGTTGCTGTTGAAGTCG

2. Methods 2.1. Reverse transcription quantitative PCR (qPCR) RNA was isolated using TRIzol-chloroform extraction, precipitated with ethanol, and purified with the Ambion PureLink RNA Mini Kit (Ambion, Cat# 12183018A) according to the manufacturer's protocol. For smaller cell culture samples, RNA was isolated and purified using the Arcturus PicoPure RNA Isolation Kit (ThermoScientific, Cat# KIT0204). RNA was converted to cDNA using the Applied Biosystems High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Cat# 4368814) following the manufacturer's protocol. Quantitative PCR was performed using QuantStudio 6 Flex Real-Time PCR System and software in a 384 well-plate format with Fast SYBR Green Master Mix (ThermoFisher, Cat# 4385612) and the PCR primer sets listed below (Table 1). Primers were designed to span introns and generated using the primer3 online program (primer3.ut.ee). Sample threshold cycle (CT) values for each gene were normalized to that of Gapdh and converted to ΔΔCT using the following equation: ΔΔCT = log2(−(CTGene − CTGapdh)). 2.2. Primary cell isolation and culture Astrocytes (GLAST+), microglia (CD11b+), and oligodendrocyte progenitor cells (OPCs) (CD140a + (a.k.a PDGFRα)) were isolated using Miltenyi MACS Cell Separation according to the manufacturer's protocols. Briefly, the cortices of post-natal day 3–5 CD1 mice were homogenized using the papain-based Neural Tissue Dissociation Kit (P) (Miltenyi, 130–092-628) and a single-cell suspension was obtained by passing the cell mixture through a 70 μm cell strainer. The cells were then resuspended in MACS Buffer (0.5% BSA in DPBS) and incubated with magnetic beads conjugated to one of the following primary antibodies: anti-GLAST (Miltenyi, 130-095-826), anti-CD11b (Miltenyi, 130-097-142), or CD140a/PDGFRα (Miltenyi, 130-101-502). For magnetic bead isolation, cells were washed, resuspended in MACS Buffer, and added to a pre-conditioned LS Column in a MACS Magnet. The cell suspension was allowed to passively flow through the column and the column was washed three times with MACS Buffer. The labeled cells were then eluted from the column in 5 mL complete culture medium. Astrocyte complete culture medium was 10% fetal bovine serum/1% Antibiotic-Antimycotic (Life Technologies 15,240-062)/1% GlutaMAX (Life Technologies 35,050-061)/DMEM with high glucose, glutamate, and sodium pyruvate (Life Technologies, 11,995-065). Microglial culture medium was 10% fetal bovine serum/1% Antibiotic182

Experimental Neurology 309 (2018) 181–192

M.D. Rudman et al.

2.3. Experimental spinal cord injuries and JQ1 injections

antimycotic/Roswell Park Memorial Institute (RPMI) medium. OPC complete medium was 1% N2 Supplement/2% B27 Supplement/1% Antibiotic-Antimycotic/0.01% BSA/40 ng/mL bFGF/20 ng/mL PDGFAA in DMEM/F-12 (Life Technologies, 11,320-033). OPCs were allowed to expand for 3 days in culture before the cells were differentiated in Oligodendrocyte Differentiation Medium (1% N2/2% B27/1% Antibiotic-Antimycotic/0.01% BSA/1 ng/mL CNTF/40 ng/mL T3/ 50 μg/mL insulin in DMEM/F-12) for an additional 3 days. Peritoneal elicited macrophages were obtained from adult C57BL/6 mice using intraperitoneal injection of 1.5 mL 3% Thioglycollate broth to recruit macrophages into the peritoneal cavity. Four days post-injection, the mice were sacrificed and the peritoneal cavity was lavaged twice with 10 mL Roswell Park Memorial Institute medium (RPMI). Red blood cells were lysed by incubation in ACK lysis buffer (155 mM NH4Cl, 10 mM KHCO3, 10 mM Na2-EDTA in water, sterile-filtered) for 1 min at room temperature. Macrophages were plated at 3–5 × 105 cells per cm2 in RPMI and incubated in a tissue culture incubator for 2 h to allow attachment to the plate. RPMI was then replaced with complete medium (10%FBS, 1% Antibiotic-Antimycotic (Life Technologies 15,240-062), RPMI) and macrophages were incubated for a maximum of 3 days before experimentation. Cerebellar granule neurons were isolated from post-natal day 7 CD1 mouse cerebella. Up to 20 cerebella were combined and dissociated in 5 mL of 0.025% Trypsin, 0.5 mg/mL DNase, Basal Medium Eagle (BME) for 20 min at 37 °C. The digestion solution was then aspirated and the cerebella were triturated in 5 mL of 0.5 mg/mL DNase/BME to disrupt tissue. The samples were collected by centrifugation for 5 min at 580 ×g at room temperature, and a single cell suspension was obtained by resuspending the cells in 1 mL 0.5 mg/mL DNase/BME per 5 cerebella and passing cells through a 40 μm filter. The cells were then separated on a 35%–60% percoll gradient centrifuged for 10 min at 4 °C at 2750 rpm with full acceleration and no brake in a Thermo Scientific Sorvall RC6+ centrifuge. Cerebellar granule cell progenitors were recovered from the 60%–35% percoll layer interface and washed in DPBS. The cell pellet was resuspended in 5 mL complete medium (2% D(+)-glucose (0.9% solution), 10% horse serum, 5% fetal bovine serum, 1% penicillin/streptomycin (100 U/mL), 1% 2 mM glutamine in Basal Medium Eagle). To deplete fibroblasts and other adhesive cells, the cell suspension was added to a petri dish, and incubated for 10 min at 37 °C, 5% CO2 in a tissue culture incubator. The cells were then transferred to a tissue culture-treated dish and incubated for 15 min at 37 °C, 5% CO2 in a tissue culture incubator. The cerebellar granule cell progenitors were then counted and plated on poly-D-lysine- and laminin-coated 48well plates at a density of 2–9 × 105/cm2. The medium was replaced the next day and cerebellar granule cell progenitors were allowed to differentiate for 3 days to become cerebellar granule neurons. Cell culture purity of > 90% was verified for all cell types using immunocytochemistry with antibodies against GFAP (Life Technologies, 13-0300) for astrocytes, βIII-tubulin (Abcam, ab107216) for neurons, Iba1 (Wako, 019-19,741) and CD11b (Life Technologies, RM2800) for microglia, F4/80 (AbD Serotec, MCA497R) and CD11b for PEMs, NG2 (Millipore, AB5320) for OPCs, and a monoclonal O1 antibody (generously gifted by the lab of Dr. Paula Monje at the University of Miami) for mature oligodendrocytes. Purified primary CNS cells were grown in culture for 4–5 days, with two medium changes, to minimize basal inflammatory activation after isolation. The day before experimentation, the medium was reduced to half its maximum volume to allow addition of medium during the experiment with minimal disturbance to the cells. Cells were pre-treated with either 1 μM JQ1 or 0.01% DMSO vehicle-control for 30 min at 37°C, 5% CO2. Cells were then treated with a mixture of 10 ng/mL TNF (Sigma, T7539) and 10 ng/mL IL-1β (Sigma, I5271) or vehicle control with either JQ1 or DMSO for 1 h, 37°C, 5% CO2. The cells were then washed with PBS and the RNA was immediately isolated as described above for qPCR analysis. JQ1 was a generous gift from Dr. James Bradner at the Dana-Farner Cancer Institute (MA, USA).

All animal procedures were in accordance with University of Miami IACUC and NIH guidelines. 8–10 week-old C57BL/6 female mice were anesthetized with 100 mg/kg ketamine and 15 mg/kg xylazine intraperitoneally and monitored until loss of response to toe-pinch. A T8 laminectomy was then performed to expose the spinal cord, and the spinal cord was secured with spinal clamps by the T7 and T9 vertebrae. A moderate (65-75kD) contusion injury was delivered using the Infinite Horizons Impactor (Precision Systems and Instrumentation, IH-0400). Overlying muscle was closed with sutures, and the skin incision was closed with wound clips. Mice received 0.1 mg/kg buprenorphine and 5 mg/kg gentamycin in 1 mL Lactated Ringer's solution immediately after injury, and thereafter received 0.1 mg/kg buprenorphine in Lactated Ringers Solution bidaily and 5 mg/kg gentamycin in Lactated Ringers Solution once daily. JQ1 and vehicle control injection solutions were prepared fresh before each injection. Injections were delivered in the lower peritoneal cavity, with a total injection volume of 150 μL. Vehicle solution was 5% DMSO, 5% Tween-80, in sterile saline, and JQ1 was dosed at 30 mg/kg body weight. Injections were given 3 h post-injury and bidaily thereafter until sacrifice or until 5 days postinjury. Experimenters were blinded to the treatment and mice were randomly assigned to either the experimental or control groups. 2.4. qPCR array Sixteen 8–10 week-old female C57BL/6 mice received experimental spinal cord injuries as described above. Half of the mice were injected intraperitoneally with 30 mg/kg JQ1 in 5% DMSO/5% Tween-80/ saline at 3 h post-injury, and the other half were injected with vehicle control solution. The mice were subsequently injected with either JQ1 or vehicle bidaily until sacrifice at 3 days post-injury. Experimenters were blinded to the treatment and mice were randomly placed into the experimental groups. Between 1 and 3 h after the last injection, mice were anesthetized with ketamine/xylazine until loss of response to toepinch, and perfused transcardially with DEPC-treated PBS. A 4 mm segment of the spinal cord was dissected out and frozen immediately in an RNase-free 1.5 mL tube on dry ice. The spinal cord segments were homogenized in 1 mL TRIzol with an RNase-free pestle and RNA was extracted as described above for qPCR. Qiagen's RT2Profiler Mouse Cytokines & Chemokines PCR Array (Cat# PAMM-150ZE-4) was used according to the manufacturer's protocol with Power SYBR Green Master Mix. Gene expression was quantified using the ΔΔCT method, and expression levels were normalized to the average of the 5 housekeeping genes included in the array. Significance for each gene was determine using Student's t-test for JQ1-treated versus vehicle controltreated groups with alpha = 0.05. 2.5. Flow cytometry Sixteen 8–10 week-old female C57BL/6 mice received experimental spinal cord injuries and injected with either 30 mg/kg JQ1 or vehicle control as described above. Mice were anesthetized 3 days post-injury with ketamine/xylazine until loss of response to toe-pinch, and perfused transcardially with sterile, 4 °C PBS. An 8 mm segment of the spinal cord centered at the injury site and the whole spleen was isolated and mechanically homogenized into a single-cell suspension on a 70 μm cell strainer. Red blood cells were lysed by incubating in ACK lysis buffer for 1 min at room temperature. For spinal cord samples, myelin removal was performed using myelin removal beads (Miltenyi Biotec). Briefly, each sample was resuspended in 90 μL MACS buffer (0.5% BSA/ HBSS without Ca2+/Mg2+) and 10 μL myelin removal beads for 15 min on ice. The cells were then washed with MACS buffer, resuspended in 1 mL MACS buffer, and added to a pre-equilibrated LS Column on a magnet. The column was washed twice with 1 mL MACS buffer and the effluent with the unlabeled cells was collected. Subsequently, cells were 183

Experimental Neurology 309 (2018) 181–192

M.D. Rudman et al.

the significance of differences between the means of two treatment groups for in vivo experiments comparing JQ1-treated and vehicle control-treated gene expression (PCR array and qPCR) and lesion areas. Two-way ANOVA with Tukey post-test was used to determine significance for longitudinal behavioral studies in JQ1-treated versus vehicle control-treated groups. Statistical analyses were performed using GraphPad Prism or Microsoft Excel software, and all analyses used alpha = 0.05. Animals were randomly placed into experimental groups, and experimenters were blinded to the treatment.

Table 2 List of primary antibodies for flow cytometry. Antibody

Company

Catalog #

Dilution

anti-CD45-APC/Cy7 anti-CD11b-APC anti-B220-FITC anti-CD3-PE/Cy7 anti-Ly6G clone 1A8-PerCP/Cy5.5

BioLegend BioLegend eBioscience BioLegend BioLegend

103,116 101,212 11-0452-81 100,219 127,616

1:200 1:200 1:500 1:200 1:200

resuspended in 100 μL FACS buffer (1% BSA, 0.05% sodium azide, HBSS without Ca2+/Mg2+) and blocked with anti-mouse CD16/32 (TruStain fcX, BioLegend, 1:100) for 5 min on ice. The samples were then incubated for 20 min on ice with anti-CD45-APC/Cy7, anti-CD11bAPC, anti-B220-FITC, anti-CD3-PE/Cy7, and anti-Ly6G clone 1A8PerCP/Cy5.5 (Table 2). The samples were washed with FACS buffer, fixed with 1% PFA, and stored in 0.5% PFA until analysis on a flow cytometer. To prepare for flow cytometry, cells were resuspended in FACS buffer and 8 μL 123countBeads (eBioscience, 01-1234) was added to 400 μL cell suspension. Cell suspensions were analyzed using the BD Biosciences LSR II flow cytometer and the BD FACSDiva 8.1 as previously described (Zhu et al., 2014). Cell numbers were quantified using 123countBeads and the following equation: ((Event#)*(8 μL))/((BeadCount)*(400 μL))*1019 beads/μL.

3. Results Because BETs have been well-characterized in macrophages (Belkina et al., 2013; Nicodeme et al., 2010), we used peritoneal-elicited macrophages as a positive control to compare BET gene expression in microglia, cerebellar granule neurons, oligodendrocytes, and astrocytes. Brd2 and Brd4 mRNA were expressed in CNS cells at levels comparable to those seen in macrophages, with the exception of oligodendrocytes, which expressed higher levels of Brd2. Brd3 mRNA was expressed at similar levels in macrophages, microglia, and astrocytes, and at approximately 3-fold higher levels in neurons and oligodendrocytes (Fig. 1A). These results indicate that mRNA for all three BETs are expressed in all CNS cell populations. To determine whether BET expression is modulated by SCI, we analyzed spinal cord tissue from naïve, contusion-injured, or sham-injured mice. Brd2, Brd3, and Brd4 mRNA levels were not altered by contusion injury in the adult mouse spinal cord (Fig. 1B). Taken together, our data indicate that all CNS cells express Brd2, Brd3, and Brd4, and that BET mRNA levels are not modulated in response to SCI. To determine whether BETs play a role in the inflammatory response of CNS cells, purified primary neuronal, astrocytic, microglial, and oligodendroglial cell cultures were pre-treated with the BET inhibitor JQ1 (or DMSO vehicle) for 30 min and then activated with TNF and IL-1β for 1 h. TNF and IL-1β were used to mimic the sterile inflammation that occurs after a contusive SCI, as both are rapidly upregulated in the spinal cord in the minutes and hours after SCI (Pineau and Lacroix, 2007). qPCR was used to quantify the expression of 6 key cytokines at 1 h. In most CNS cells, incubation with TNF and IL-1β induced the expression of multiple cytokines and chemokines (Fig. 2). For cytokines whose expression was significantly increased by activation with TNF and IL-1β, JQ1 pre-treatment frequently inhibited this up-regulation. For example, across all four cell types, Il-6 was significantly upregulated in response to TNF and IL-1β, with increases in mRNA levels between 7 and 40 fold above baseline. However, when cells were pre-treated with JQ1, Il-6 expression was significantly attenuated in all four cell types. JQ1 pre-treatment decreased Il-6 mRNA levels by > 60% in microglia, and in neurons, mRNA levels were decreased 7-fold back to baseline levels (Fig. 2). In neurons, astrocytes, and oligodendrocytes, all six cytokines tested were significantly upregulated in response to TNF and IL-1β, and at least five out of six of these cytokines were attenuated by JQ1 pretreatment. Overall, JQ1 inhibited cytokine upregulation about 80% of the time. The exceptions to this JQ1-induced attenuation were Cxcl10 in microglia and neurons, and Tnf in microglia. In these cases, cytokine-induced upregulation was resistant to BET inhibition. Interestingly, each cell type displayed a different pattern of TNF and IL-1β-induced upregulation of the six cytokines and chemokines tested. The chemokine Ccl2 was not upregulated in response to TNF and IL-1β in microglia, but was strongly upregulated in neurons, oligodendrocytes, and astrocytes. In contrast, Il1β was strongly upregulated in microglia, but was only mildly upregulated in oligodendrocytes. There was also a cell-type specific sensitivity to BET inhibition. For example, Cxcl10 was down-regulated by JQ1 treatment in oligodendrocytes and astrocytes, but not in neurons or microglia. These subtle variations suggest differences in the inflammatory response between cell types as well as possible differences in BET-interacting partners and/or chromatin modifications among

2.6. Open field locomotor assay Mice were assayed for open field locomotion for 5 min per session using the Basso mouse scale scoring system at 1 day post-injury and weekly thereafter until sacrifice at 4 weeks post-injury. Evaluators were blinded to the treatment groups during assessments. Significance was determined using a two-way ANOVA with Tukey post-test and alpha = 0.05. 2.7. Immnohistochemistry and lesion area measurement At 4 weeks post-injury, mice were sacrificed and perfused transcardially with 4% paraformaldehyde for 5 min to fix the tissue. The brain and spinal cord were removed and post-fixed for an additional 2 h on ice, and then cryopreserved by incubation in 30% sucrose in PBS for 48 h at 4 °C. A 4 mm segment of the spinal cord centered at T8 was removed, embedded in O.C.T. Compound (VWR, 102094–106), and frozen on dry ice. Longitudinal sections were cut 10 μm thick, and adjacent sections on a single histology slide were 150 μm apart, such that a single slide contained 8–9 sections representing the entire width of the spinal cord. For staining, non-specific binding was blocked for 45 min at room temperature with 5% normal goat serum/0.3% TritonX100/PBS. Rat anti-GFAP primary antibody (Invitrogen 13–0300) was diluted 1:2000 in blocking buffer and incubated on the slides at 4 °C overnight in a humidified box. The next day, slides were washed and incubated for 1 h at room temperature in goat anti-rat secondary antibody conjugated to Alexa Fluor 488 (Life Technologies, A11006) diluted in 0.3% TritonX-100/PBS. Nuclei were stained with 1:10,000 DAPI in 0.3% TritonX-100/PBS for 10 min at room temperature. Slides were washed twice more and mounted with Fluoromount G (VWR, 100241–874). Images were captured using a Nikon Ti fluorescent microscope and exposure times were kept constant between samples. Lesion areas were quantified using the Area polygon tool in the Nikon software and were defined as the average GFAP-negative area of 3 consecutive sections centered on the largest lesion area. 2.8. Statistical analyses One-Way ANOVA with Tukey's post-test was used to determine the significance of differences between multiple means for in vitro experiments with 4 treatment groups. A Student's t-test was used to determine 184

Experimental Neurology 309 (2018) 181–192

M.D. Rudman et al.

female C57BL/6 mice were given a moderate T8 contusion injury and were injected intraperitoneally with 30 mg/kg JQ1 or vehicle 3 h postinjury. Mice were first injected at 3 h post-injury in order to mimic a clinically relevant treatment window. Intraperitoneal JQ1 injections were continued twice daily until sacrifice at 3 days post-injury. The injured segment of the spinal cord was homogenized, RNA extracted, and cytokine expression measured by qPCR array. Compared to vehicletreated mice, JQ1-treated mice had significantly decreased cytokine expression in 21 out of 84 cytokines in the array (Fig. 3A). We validated the attenuation of Il-1β, Il-6, and Ccl2 seen in the cytokine array with an independent qPCR, and found that Tnf and Ccl5 were also decreased to a slightly lesser extent (Fig. 3B). Of the 21 cytokines in the array that were decreased by JQ1 treatment, 10 have chemotactic activity for monocytes, neutrophils, lymphocytes, and other leukocytes. One of the chemokines decreased by JQ1, Ccl2, is known to promote macrophage infiltration after SCI (Ma et al., 2002). Six of the 21 cytokines decreased by JQ1 were pro-inflammatory cytokines, including Il-1β which is known to be rapidly upregulated acutely after SCI and contributes to secondary damage (Nesic et al., 2001; Zong et al., 2012). Other cytokines decreased by JQ1 included the oxidized-LDL scavenger receptor Cxcl16 and Oncostatin M (Osm), which promotes leukocyte adhesion and Il-6 expression (Barlic et al., 2009; Brown et al., 1991; Yao et al., 1996). JQ1 treatment also increased the expression of 7 cytokines (Fig. 3A). JQ1 treatment increased the anti-inflammatory cytokine Il13, which inhibits the production of pro-inflammatory cytokines and chemokines by macrophages (Minty et al., 1993), as well as Il-5, which is co-regulated with the anti-inflammatory cytokines Il-13 and Il-4 (Kelly and Locksley, 2000). JQ1 treatment also increased the pro-inflammatory cytokines Il-17a and Il-23a (Fossiez et al., 1996; Oppmann et al., 2000), the proliferation-inducing cytokine Il-11 (Harmegnies et al., 2003), and the T cell-activating cytokines Il-2 and Ccl17 (Imai et al., 1997; Schorle et al., 1991). Based on prior studies of JQ1 in inflammation and our own in vitro results, we had hypothesized that BET inhibition would decrease cytokine expression after SCI. Although a minority of cytokines were upregulated by JQ1, three-fold more cytokines were decreased, accounting for 25% of the total number of cytokines tested. Overall, these results indicate that BET inhibition with JQ1 leads to a net decrease in pro-inflammatory cytokines and chemokines after experimental SCI. In response to chemokine signaling, peripheral leukocytes including neutrophils and macrophages are recruited to the injured spinal cord. In order to determine whether JQ1-mediated attenuation of chemokines could decrease leukocyte infiltration post-SCI, we treated mice with JQ1 beginning at 3 h post-SCI and quantified leukocyte infiltration into the injury site 3 days post-injury by flow cytometry. JQ1-treated mice had significantly fewer CD45-positive leukocytes infiltrating the lesion site by 3 days post-injury (Fig. 4). Furthermore, the total numbers of macrophages (CD45hi/CD11b+) and neutrophils (CD45+/Ly-6G+) were significantly decreased in the spinal cords of JQ1-treated mice. The percentage of leukocytes that were macrophages, microglia, neutrophils, B cells or T cells was not changed by JQ1 treatment, indicating that BET inhibition did not preferentially act on any one subpopulation of leukocytes after SCI. Together, these results indicate that BET inhibition decreases leukocyte infiltration into the spinal cord after SCI. Since JQ1 was administered systemically in this study, we also assessed leukocyte populations in the spleen to determine whether JQ1 was having systemic effects on inflammatory cell populations. The spleen has been shown to contribute a significant proportion of leukocytes to the infiltrating cell population acutely after SCI (Blomster et al., 2013). At 3 days post-SCI, the total number of CD45-positive leukocytes were not significantly decreased in the spleens of JQ1treated mice (Fig. 5). However, there was a significant decrease in the number of macrophages and neutrophils as well as the percent of leukocytes identified as macrophages and neutrophils. These results suggest that while JQ1 treatment does not significantly deplete total leukocyte stores, the specific depletion of macrophages and neutrophils in

Fig. 1. BETs are expressed in all major CNS cell populations and their mRNA levels are not altered by SCI. (A) Brd2 and Brd4 expression levels in macrophages were similar to those in all cell types tested, with the exception of higher Brd2 expresion in oligodendrocytes. Brd3 expression was higher in cerebellar granule neurons and oligodendrocytes. Expression levels for each gene were normalized to that of macrophages (positive control). n = 3 biological replicates. (B) Brd2, Brd3, and Brd4 expression in a 4 mm segment of spinal cord tissue centered at the lesion epicenter was not altered by injury. n = 3 biological replicates per group. Error bars represent SEM. *p < .05 compared to macrophages, #p < .05 compared to microglia. One-Way ANOVA with Tukey's post-test.

different cell types that impart differential sensitivity to JQ1. Together, these results demonstrate that neurons, oligodendrocytes, microglia, and astrocytes upregulate pro-inflammatory cytokines in response to sterile inflammation, and that BET inhibition broadly attenuates cytokine expression in a gene- and cell type-specific manner. Because BET inhibition decreased inflammatory transcription in all four major CNS cell populations in vitro, we investigated whether a similar decrease would occur after experimental SCI. Prior studies using JQ1 in mouse models of inflammation demonstrated anti-inflammatory effects with 50 mg/kg once daily or 30 mg/kg twice daily (Filippakopoulos et al., 2010; Mele et al., 2013). We investigated whether BET inhibition via twice daily injections of JQ1 (60 mg/kg/ day) decreases inflammation in a mouse model of contusive SCI. Adult 185

Experimental Neurology 309 (2018) 181–192

M.D. Rudman et al.

Fig. 2. BET inhibition attenuates pro-inflammatory cytokine expression in activated primary CNS cells. Activation by TNF/IL-1β increased the expression of many pro-inflammatory cytokines and chemokines in primary cerebellar granule neurons (A), astrocytes (B), oligodendrocytes (C, oligo), and microglia (D). Treatment with the BET inhibitor JQ1 attenuated this increase in most cases. Treatment with JQ1 in unactivated primary cells did not affect cytokine/chemokine expression in most cases. n = 3 technical replicates per group. One representative experiment from 3 independent experiments is shown (other biological replicates shown in Supplementary Fig. 1). #p < .05 vehicle vs. TNF/IL-1β, *p < .05 TNF/IL-1β vs. JQ1+ TNF/IL-1β, One-Way ANOVA with Tukey's post-test. Error Bars are SEM.

did not improve locomotor recovery or lesion size perhaps due to a delay in effectively suppressing cytokine expression during the very early phases after injury.

the spleens of JQ1-treated mice may have contributed to decreased leukocyte infiltration into the spinal cord injury site. After experimental SCI, BET inhibition with JQ1 decreased the expression of multiple cytokines and chemokines and attenuated injuryinduced leukocyte infiltration. Therefore, we hypothesized that by decreasing molecular and cellular inflammation after experimental SCI, BET inhibition may decrease secondary injury and promote locomotor recovery. To test this hypothesis, we assessed locomotor recovery using the Basso mouse scale (BMS) on adult female C57BL/6 mice that had been given a moderate contusion SCI and treated at 3 h post-injury and bidaily until 5 days post-injury with JQ1 (30 mg/kg) or vehicle control. Locomotor recovery was assessed at 1 day post-injury and then weekly until sacrifice at 4 weeks post-injury, at which time the spinal cord was analyzed histologically to measure the injury size. By 4 weeks post-SCI, JQ1-treated mice did not exhibit improved locomotor recovery compared to vehicle-treated mice (Fig. 6A, B). Accordingly, the lesion area at 4 weeks post-injury was not significanty different between the two groups (Fig. 6C-E). To consider potential explanations for this lack of behavioral and histopathological improvement after JQ1 treatment, we assessed the time course of cytokine expression after JQ1 treatment. After bidaily JQ1 treatment (see methods), we found that cytokine expression levels showed significant decrease at three days, but not at one and two days, after injury (Fig. 6F). Taken together, our data indicate that despite significantly attenuating pro-inflammatory cytokine expression and leukocyte infiltration at 3 days after SCI, JQ1 treatment

4. Discussion Inflammation after SCI results in the release of cytotoxic cytokines and recruitment of pro-inflammatory leukocytes to the site of injury. Decreasing this inflammatory process has been shown to decrease the extent of tissue damage after SCI (Boato et al., 2013; Lee et al., 2003; Zhu et al., 2014; Zong et al., 2012). BETs are epigenetic readers that have recently been shown to regulate the inflammatory response by binding pro-inflammatory promoters and enhancers and recruiting protranscriptional complexes (Belkina et al., 2013; Clifford et al., 2015; Filippakopoulos et al., 2010; Jung et al., 2015; Khan et al., 2014; Korb et al., 2015; Meng et al., 2014; Nicodeme et al., 2010; Perry et al., 2015). We hypothesized that BETs promote the expression of pro-inflammatory cytokines after SCI, which would be inhibited by the BET inhibitor JQ1. We found that the BETs Brd2, Brd3, and Brd4 are expressed in all major CNS cell types and that their mRNA levels are not altered after SCI. Using the small molecule JQ1 to inhibit BETs, we observed that BET inhibition attenuates inflammatory cytokine expression in all four major CNS cell types in vitro. In a mouse model of contusive SCI, BET inhibition decreased the expression of multiple cytokines and inhibited leukocyte infiltration into the injury site by 3 days 186

Experimental Neurology 309 (2018) 181–192

M.D. Rudman et al.

Fig. 3. BET inhibition significantly decreases the expression of multiple cytokines at the injury site after experimental spinal cord injury. (A) Treatment with JQ1 decreased the expression of 21 cytokines and increased expression of 7 cytokines (out of 84 tested) at 3 days post-SCI as compared to vehicletreated controls. All genes included in (A) are statistically significant compared to vehicle-treated controls. Student's t-test, alpha = 0.05. (B) Validation of Tnf, Il-1β, Il-6, Ccl5, and Ccl2 expression changes using standard reverse transcription qPCR using same mRNA as in (A). Results are expressed as fold change compared to vehicle-treated controls. JQ1 was given 3 h after injury and bidaily for 3 days. n = 8 biological replicates per group. *p < .05, Student's t-test. Error bars are SEM.

strongly attenuated by BET inhibition with JQ1. It should be noted that although we found that BETs are expressed in cells from brain, we believe similar effects will be present in purified cells from the spinal cord. Indeed, this was found in adult mouse spinal cord tissue where we did see a decrease in inflammatory cytokine levels after BET inhibition. However, future experiments are required to determine the role of BETs in purified cells from the spinal cord. Taken together, our data suggest that BETs are important mediators of CNS inflammation, and our studies are the first to directly assess the expression and functional consequence of BETs in both neurons and glia. BET mRNA was also expressed in naïve mouse spinal cord homogenate, and BET mRNA levels were not significantly altered by either sham injury (laminectomy) or moderate contusion injury. This suggests that transcriptional regulation of BETs does not contribute to the inflammatory response to injury. Rather, prior studies suggest alternative mechanisms for BET regulation, including phosphorylation and differential recruitment to chromatin (Korb et al., 2015; Wu et al., 2013). Differential protein degradation is another mechanism by which BETs may be regulated after SCI, and potential differences in protein expression levels and phosphorylation could be investigated in future studies. In addition, it is important to note that other BET-interacting proteins may be differentially expressed, modified, or recruited after SCI, also contributing to the differential activity of BETs after SCI. For example, BRD4 interacts directly with the proinflammatory transcription factor NF-κB, and acetylation of NF-κB promotes interaction with BRD4 and proinflammatory transcription (Huang et al., 2009). Whether one or more of these mechanisms is responsible for inflammatory activation after SCI will be the subject of future investigation. BETs regulate genes in a context-dependent manner. In resting cells, BET inhibition has little effect on transcription; only after activation of the cells by an inflammatory stimulus does BET inhibition cause significant changes in the transcriptome. For example, in non-activated

post-injury. We did not observe improved locomotor recovery or decreased lesion size in these mice, but this may be due to the inability of JQ1 to decrease cytokine expression within 24 h post-injury. This study is the first to demonstrate that BETs regulate a broad range of inflammatory cytokines and chemokines in all four major CNS cell types. Furthermore, this is the first study to demonstrate that pharmacologic BET inhibition can decrease cytokine expression and leukocyte infiltration after experimental SCI. To date, BETs have not been extensively studied in the CNS. Furthermore, existing studies on BETs in the CNS have focused on the role of BETs in neurons. Brd4 binds to promoters of immediate early genes in neurons and is implicated in synaptic plasticity and learning and memory in mice (Korb et al., 2015; Sartor et al., 2015). By contrast, the expression of BETs in glia has been suggested to be minimal (Korb et al., 2015). However, we observed that Brd2, Brd3, and Brd4 are expressed in primary astrocytes, oligodendrocytes, macrophages, microglia, and cerebellar granule neurons. Additionally, JQ1 inhibited inflammatory transcription in primary microglia, astrocytes, oligodendrocytes, and neurons. Other recent studies have observed inflammatory attenuation by BET inhibition in microglial cell lines and in primary astrocytes (Choi et al., 2015; Demars et al., 2018; Jung et al., 2015). These data, together with our own, indicate that BETs play a functional role in inflammatory signaling in all four major CNS cell populations. Interestingly, oligodendrocytes have traditionally been viewed as bystanders and casualties in inflammation-induced cytotoxicity. Only recently have oligodendrocytes been recognized as active players in the inflammatory response, and even so, only in limited settings such as in chronic pain (Skaper et al., 2018). Our data further support a role for oligodendrocytes in inflammatory signaling as oligodendrocytes strongly upregulated multiple cytokines including Tnf, Il-6, Cxcl10, and Ccl2 in response to stimulation with key cytokines expressed after SCI, and oligodendroglial cytokine expression was also 187

Experimental Neurology 309 (2018) 181–192

M.D. Rudman et al.

Fig. 4. BET inhibition decreases leukocyte infiltration 3 days post-SCI. (A) Leukocyte subpopulations were identified using flow cytometric analysis of SCI cells labeled with antibodies against CD45, Ly6G, CD11b, B220, and CD3. CD45+ cells were divided into Ly6G+ neutrophils and Ly6G− cells. The Ly6G− cells were then divided into CD11b− lymphocytes or CD11b+ cells. CD11b+ cells were further divided into CD45hi macrophages or CD45lo microglia. Finally, CD11b− lymphocytes were divided into B220+/CD3− B cells or CD3+/B220− T cells. (B) Flow cytometric analysis of a cell suspension derived from the spinal cords of contusion-injured mice injected with either 60 mg/kg/d JQ1 or DMSO vehicle control. Mice were injected at 3 h post-injury and bidaily until sacrifice at 3 days post-injury. Total leukocytes, macrophages, and neutrophils were significantly decreased in the SCI lesions of JQ1-treated mice. n = 8 per group, Error bars are SEM. *p < .05, Student's t-test.

no decrease in BMDM expression of Tnf with a similar BET inhibitor IBET 151 (Nicodeme et al., 2010). The mechanisms for differential promoter binding are only beginning to be elucidated. BETs bind acetylated histones H3 and H4 as well as acetylated transcription factors with varying affinities (Jung et al., 2014). Variations in these epigenetic marks and transcription factors at promoters may account for some of the variation in BET inhibitor sensitivity observed between cell types. Further exploration of this topic using chromatin immunoprecipitation could provide important insights into the cell typespecific epigenetic regulation of inflammatory gene expression. BET inhibition is strongly anti-inflammatory in animal models of immune disorders ranging from sepsis to rheumatoid arthritis (Klein et al., 2014; Nicodeme et al., 2010). These studies illustrate that BET inhibition is not only effective as a preventative treatment, but can inhibit inflammation after disease onset as well. However, these studies all focused on models of peripheral inflammation. The potential role of BETs in inflammation of the CNS has not yet been well-studied, especially for innate immune responses. In experimental autoimmune encephalitis, a mouse model of multiple sclerosis, BET inhibition has been found to delay disease onset and decrease disease severity (Barrett et al., 2014; Jahagirdar et al., 2017; Mele et al., 2013). The mechanism for this improvement is unclear, but may involve a combination of effects on adaptive and innate immune responses in both the periphery and the CNS. In this study, we demonstrate that BET inhibition is an effective anti-inflammatory intervention in experimental SCI. Of the 84 genes assessed by PCR array at 3 days post-injury, 25% were decreased in JQ1-treated mice. This proportion of down-regulated genes is similar to the percent of LPS-induced genes down-regulated by BET inhibition in activated BMDM and BV-2 microglia (Jung et al., 2015; Nicodeme et al., 2010). Many of these genes such as IL-1β, IL-6, and Ccl2 have

bone marrow-derived macrophages (BMDMs) and BV-2 microglial cells, BET inhibition resulted in minimal changes in the transcriptome and had no effect on housekeeping genes (Jung et al., 2015; Nicodeme et al., 2010). After BMDM activation by lipopolysaccharide (LPS), approximately 20% of up-regulated genes were inhibited by BET inhibition (Nicodeme et al., 2010), and in the BV-2 microglial cell line, JQ1 attenuated the expression of 36% of LPS-induced genes (Jung et al., 2015). Similarly, in our studies on primary CNS cells, JQ1 alone did not affect cytokine expression. After inflammatory activation, however, JQ1 significantly attenuated the expression of multiple cytokines. These results indicate that in all major primary CNS cell types, as in peripheral cells and cell lines, BET inhibition has little effect on gene expression in basal resting conditions, but potently attenuates inflammatory gene expression in the context of an inflammatory stimulus. BETs also regulate genes in a cell-type specific manner. While JQ1mediated BET inhibition attenuated the expression of Il-6 in neurons, oligodendrocytes, astrocytes, and microglia, Cxcl10 expression was only attenuated in astrocytes and oligodendrocytes. JQ1 did not alter the cytokine-induced upregulation of Cxcl10 in neurons, and even slightly increased Cxcl10 expression in microglia. These differences are likely the result of differential BET binding due to variations in epigenetic modifications and transcription factor profiles in different cell populations. Cell type-specific promoter binding of BETs has also been demonstrated in other cell types. For example, in the BV-2 microglial cell line, Tnf expression was not decreased by JQ1-mediated BET inhibition (Jung et al., 2015), while in primary astrocytes, JQ1 BET inhibition decreased Tnf expression (Choi et al., 2015). In both BMDMs and the RAW264.7 macrophage-like cells, Belkina et al. demonstrated a dose-dependent decrease in Tnf expression with increasing concentrations of JQ1 (Belkina et al., 2013). By contrast, Nicodeme et al. found 188

Experimental Neurology 309 (2018) 181–192

M.D. Rudman et al.

Fig. 5. BET inhibition decreases splenic monocyte and neutrophil reserves 3 days post-SCI. (A) Leukocyte subpopulations were identified using flow cytometric analysis of splenic cells labeled with antibodies against CD45, Ly6G, CD11b, B220, and CD3. CD45+ cells were divided into Ly6G+ neutrophils and Ly6G− cells. The Ly6G− cells were then divided into CD11b− lymphocytes or CD11b+ macrophages. Finally, CD11b− lymphocytes were divided into B220+/CD3− B cells or CD3+/ B220− T cells. (B) Flow cytometric analysis of a cell suspension of the spleens of contusion-injured mice injected with either 60 mg/kg/d JQ1 or DMSO vehicle control. Mice were injected at 3 h post-injury and bidaily until sacrifice at 3 days post-injury. Total monocytes and neutrophils and percent monocytes and neutrophils were significantly decreased in the spleens of JQ1-treated mice. n = 5 per group, Error bars are SEM. *p < .05, Student's t-test.

neutrophils, it is unknown whether BET inhibition may cause more subtle phenotypic changes in the infiltrating leukocyte population. One recent study suggests that BET inhibition may promote the expression of M1 macrophage phenotypic marker HLA-DR and decrease M2 marker CD206 in mouse macrophage-like RAW 264.7 cells (Leal et al., 2017). However, other studies have shown a mixed effect on the expression of classic cell surface and secreted markers of M1 and M2 macrophages. For example, BET inhibition decreased the pro-inflammatory macrophage-associated genes CD86, Il-6, Il-23a, and Nos2 as well as the anti-inflammatory macrophage-associated gene Il-10 (Nicodeme et al., 2010). Here, we observed an overall anti-inflammatory effect of BET inhibition after SCI with multiple key cytokines and chemokines decreased at the injury site and relatively few proinflammatory cytokines increased. However, a more detailed flow cytometric analysis could be used to determine whether BET inhibition may promote phenotypic changes of the infiltrating monocyte population after SCI. The ultimate goal of anti-inflammatory interventions after SCI is to decrease secondary cell death, increase tissue sparing, and improve recovery of function. However, we did not observe improvements in SCI lesion size or locomotor recovery in this study. This may be explained, in part, by our finding that JQ1 did not significantly decrease cytokine expression in the spinal cord until 3 days post-injury. Therefore, much of the initial inflammatory response, especially the initial cytokine surge, was not effectively targeted in our treatment paradigm and may have caused an overwhelming amount of damage that could not subsequently be mitigated by inflammatory suppression in the days following injury. It is possible that we did not see significant effects until 3 days post-injury because multiple doses were required for JQ1 to build up to sufficient concentrations in the spinal cord. It is also possible that JQ1 exclusively inhibited peripheral macrophages and did not affect the local spinal cord environment. If this were the case, then we

been previously described as being regulated by BETs. A handful of genes was also upregulated by JQ1. This could be due to direct or indirect modulation of gene expression by BET inhibition or to changes in protein complex recruitment at promoters. A more comprehensive analysis of gene expression by RNA-sequencing or assessment of promoter binding by chromatin immunoprecipitation could be used to evaluate these candidate mechanisms. Another possible cause for JQ1mediated gene up-regulation in SCI could be changes in the cell composition of the injury site. Native CNS cells likely have different gene expression profiles than infiltrating peripheral immune cells. Changes in the relative proportions of native cells to peripheral leukocytes may account for some changes in gene expression as well. Further studies comparing the relative expression of the up-regulated genes in the various cell populations at the injury site, using FACS-qPCR for example, could help elucidate the contribution of changing cell populations. Multiple cytokines decreased by JQ1 post-SCI are strong chemoattractants, including Ccl2. This raised the question of whether JQ1mediated BET inhibition may decrease leukocyte infiltration after SCI. We found that the numbers of macrophages and neutrophils were significantly decreased in the SCI lesion sites of JQ1-treated mice, as assessed by flow cytometry. The numbers of macrophages and neutrophils were also decreased in the spleens of JQ1-treated SCI mice. Because the spleen is the primary source of infiltrating macrophages after SCI (Blomster et al., 2013), it is likely that a portion of the decrease in macrophage infiltration at the injury site is due to a decrease in the splenic monocyte reservoir. The extent of the contribution of peripheral inflammatory suppression to the observed inflammatory suppression in the spinal cord remains to be determined, and could potentially be addressed using intrathecal JQ1 administration or local application of JQ1 to the SCI site. While BETs decreased the numbers of infiltrating macrophages and 189

Experimental Neurology 309 (2018) 181–192

M.D. Rudman et al.

Fig. 6. BET inhibition does not improve locomotor recovery or decrease lesion size by 4 weeks after experimental SCI. (A, B) Locomotor recovery is not improved by JQ1 treatment after SCI. Assessed using the Basso mouse scale (BMS, A) and subscore (B) at 1 day and weekly after SCI. Vehicle n = 14, JQ1 n = 11. Two way ANOVA with Bonferroni post-test. Error bars are SEM. (C-E) Lesion area is not affected by JQ1 treatment at 4 weeks post-injury. Measured as the average GFAP-negative area at the lesion site (D, E). n = 5 per group. Student's t-test. Error bars are SEM. (F) Cytokine mRNA levels are not significantly decreased until three days of JQ1 treatment post-SCI. qPCR of spinal cord injury homogenate. 1, 2 day Vehicle, 1 day JQ1 n = 5. 2 day JQ1 n = 4. 3 day vehicle and 3 day JQ1 n = 8. 3 day data are the same as those in Fig. 3B. *p < .05, Student's t-test. Error bars are SEM. Scale bar = 500 μm.

repair after SCI. For example, BET inhibition has been shown to promote the differentiation of neural precursor cells towards neurons at the expense of astrocytes in a dose-dependent manner (Li et al., 2016). Therefore, BET inhibition could be a useful adjunctive therapy to cell transplantation methods seeking to replenish neurons after SCI. Our study is particularly timely given that multiple BET inhibitors are already in clinical trials for cancers and inflammatory disorders, including coronary artery disease (Nicholls et al., 2018). In addition, the ability of BET inhibition to suppress inflammation in human cells has recently been demonstrated, suggesting epigenetic pro-inflammatory mechanisms are conserved in humans and mice (Chan et al., 2015; Khan et al., 2014). If BET inhibition was ultimately found to be beneficial in experimental SCI, these factors increase the likelihood that translation into clinical therapeutic interventions would be possible. Taken together, our study demonstrates that BET inhibition decreases pro-inflammatory cytokine expression and leukocyte infiltration after SCI. BET inhibition provides the unique advantage of decreasing the expression of a broad subset of proinflammatory genes using a common transcriptional pathway while also targeting only those cells that are activated by injury. Further investigations will explore the utility of BET inhibition both alone or as part of combinatorial approaches for decreasing inflammation and promoting spinal cord repair.

would not expect to see inflammatory suppression until peripheral macrophages cells infiltrate the spinal cord beginning at 2–3 days postinjury. JQ1 was administered beginning at 3 h post-injury, but it is unclear to what extent JQ1 was able to penetrate the spinal cord within the first day after injury. Limitations to JQ1 delivery to the spinal cord may have included the disruption of local circulation by hemorrhage and ischemia that occurs with a traumatic injury. Strategies to circumvent this issue can include local or intraventricular delivery of drugs. It would also be informative to conduct a dose-response study to test whether JQ1 dosing could be optimized to promote locomotor recovery. Additionally, there are several limiting factors relating to JQ1 itself. JQ1 has a serum half-life of only 1–2 h (Matzuk et al., 2012), which severely limits tissue exposure from intraperitoneal injections and may require repeated doses to build up therapeutic concentrations. In recent years, additional BET inhibitors have been developed that have more favorable pharmacokinetic and pharmacodynamics properties. Therefore, testing newer BET inhibitors with more drug-like properties and testing different modes of drug delivery is warranted in future studies. Furthermore, although BET inhibition did not promote locomotor recovery in our study paradigm, its anti-inflammatory effects may still be beneficial in other contexts. Neuropathic pain is promoted by inflammation and BETs have been suggested to play a role in the development of inflammation-induced neuropathic pain (Hsieh et al., 2017; Takahashi et al., 2018a). Therefore, BETs may be a useful target for inhibiting the development of neuropathic pain after SCI. BET inhibition may also be useful as a combinatorial approach to promoting 190

Experimental Neurology 309 (2018) 181–192

M.D. Rudman et al.

5. Conclusions

Chen, K.B., Uchida, K., Nakajima, H., Yayama, T., Hirai, T., Watanabe, S., Guerrero, A.R., Kobayashi, S., Ma, W.Y., Liu, S.Y., Baba, H., 2011. Tumor necrosis factor-alpha antagonist reduces apoptosis of neurons and oligodendroglia in rat spinal cord injury. Spine 36, 1350–1358. Choi, C.S., Hong, S.H., Sim, S., Cho, K.S., Kim, J.W., Yang, S.M., Jeon, S.J., You, J.S., Shin, C.Y., 2015. The epigenetic reader BRD2 as a specific modulator of PAI-1 expression in lipopolysaccharide-stimulated mouse primary astrocytes. Neurochem. Res. 40, 2211–2219. Clifford, R.L., Patel, J.K., John, A.E., Tatler, A.L., Mazengarb, L., Brightling, C.E., Knox, A.J., 2015. CXCL8 histone H3 acetylation is dysfunctional in airway smooth muscle in asthma: regulation by BET. Am. J. Physiol. 308, L962–L972. Demars, K.M., Yang, C., Castro-Rivera, C.I., Candelario-Jalil, E., 2018. Selective degradation of BET proteins with dBET1, a proteolysis-targeting chimera, potently reduces pro-inflammatory responses in lipopolysaccharide-activated microglia. Biochem. Biophys. Res. Commun. 497 (1), 410–415. D'Souza, S., Alinauskas, K., McCrea, E., Goodyer, C., Antel, J.P., 1995. Differential susceptibility of human CNS-derived cell populations to TNF-dependent and independent immune-mediated injury. J. Neurosci. 15, 7293–7300. Filippakopoulos, P., Qi, J., Picaud, S., Shen, Y., Smith, W.B., Fedorov, O., Morse, E.M., Keates, T., Hickman, T.T., Felletar, I., Philpott, M., Munro, S., McKeown, M.R., Wang, Y., Christie, A.L., West, N., Cameron, M.J., Schwartz, B., Heightman, T.D., La Thangue, N., French, C.A., Wiest, O., Kung, A.L., Knapp, S., Bradner, J.E., 2010. Selective inhibition of BET bromodomains. Nature 468, 1067–1073. Filippakopoulos, P., Picaud, S., Mangos, M., Keates, T., Lambert, J.P., Barsyte-Lovejoy, D., Felletar, I., Volkmer, R., Muller, S., Pawson, T., Gingras, A.C., Arrowsmith, C.H., Knapp, S., 2012. Histone recognition and large-scale structural analysis of the human bromodomain family. Cell 149, 214–231. Fossiez, F., Djossou, O., Chomarat, P., Flores-Romo, L., Ait-Yahia, S., Maat, C., Pin, J.J., Garrone, P., Garcia, E., Saeland, S., Blanchard, D., Gaillard, C., Das Mahapatra, B., Rouvier, E., Golstein, P., Banchereau, J., Lebecque, S., 1996. T cell interleukin-17 induces stromal cells to produce proinflammatory and hematopoietic cytokines. J. Exp. Med. 183, 2593–2603. Gallagher, S.J., Mijatov, B., Gunatilake, D., Gowrishankar, K., Tiffen, J., James, W., Jin, L., Pupo, G., Cullinane, C., McArthur, G.A., Tummino, P.J., Rizos, H., Hersey, P., 2014. Control of NF-kB activity in human melanoma by bromodomain and extraterminal protein inhibitor I-BET151. Pigment Cell Melanoma Res. 27, 1126–1137. Gamsjaeger, R., Webb, S.R., Lamonica, J.M., Billin, A., Blobel, G.A., MacKay, J.P., 2011. Structural basis and specificity of acetylated transcription factor GATA1 recognition by BET family bromodomain protein Brd3. Mol. Cell. Biol. 31, 2632–2640. Harmegnies, D., Wang, X.M., Vandenbussche, P., Leon, A., Vusio, P., Grotzinger, J., Jacques, Y., Goormaghtigh, E., Devreese, B., Content, J., 2003. Characterization of a potent human interleukin-11 agonist. Biochem. J. 375, 23–32. Hayashi, M., Ueyama, T., Nemoto, K., Tamaki, T., Senba, E., 2000. Sequential mRNA expression for immediate early genes, cytokines, and neurotrophins in spinal cord injury. J. Neurotrauma 17, 203–218. Horn, K.P., Busch, S.A., Hawthorne, A.L., van Rooijen, N., Silver, J., 2008. Another barrier to regeneration in the CNS: activated macrophages induce extensive retraction of dystrophic axons through direct physical interactions. J. Neurosci. 28, 9330–9341. Hsieh, M.C., Ho, Y.C., Lai, C.Y., Wang, H.H., Lee, A.S., Cheng, J.K., Chau, Y.P., Peng, H.Y., 2017. Bromodomain-containing Protein 4 activates voltage-gated sodium channel 1.7 transcription in dorsal root ganglia neurons to mediate thermal hyperalgesia in rats. Anesthesiology 127, 862–877. Huang, B., Yang, X.D., Zhou, M.M., Ozato, K., Chen, L.F., 2009. Brd4 coactivates transcriptional activation of NF-kappaB via specific binding to acetylated RelA. Mol. Cell. Biol. 29, 1375–1387. Imai, T., Baba, M., Nishimura, M., Kakizaki, M., Takagi, S., Yoshie, O., 1997. The T celldirected CC chemokine TARC is a highly specific biological ligand for CC chemokine receptor 4. J. Biol. Chem. 272, 15036–15042. Jahagirdar, R., Zhang, H., Azhar, S., Tobin, J., Attwell, S., Yu, R., Wu, J., McLure, K.G., Hansen, H.C., Wagner, G.S., Young, P.R., Srivastava, R.A., Wong, N.C., Johansson, J., 2014. A novel BET bromodomain inhibitor, RVX-208, shows reduction of atherosclerosis in hyperlipidemic ApoE deficient mice. Atherosclerosis 236, 91–100. Jahagirdar, R., Attwell, S., Marusic, S., Bendele, A., Shenoy, N., McLure, K.G., Gilham, D., Norek, K., Hansen, H.C., Yu, R., Tobin, J., Wagner, G.S., Young, P.R., Wong, N.C.W., Kulikowski, E., 2017. RVX-297, a BET bromodomain inhibitor, has therapeutic effects in preclinical models of acute inflammation and autoimmune disease. Mol. Pharmacol. 92, 694–706. Jung, M., Philpott, M., Muller, S., Schulze, J., Badock, V., Eberspacher, U., Moosmayer, D., Bader, B., Schmees, N., Fernandez-Montalvan, A., Haendler, B., 2014. Affinity map of bromodomain protein 4 (BRD4) interactions with the histone H4 tail and the small molecule inhibitor JQ1. J. Biol. Chem. 289, 9304–9319. Jung, K.H., Das, A., Chai, J.C., Kim, S.H., Morya, N., Park, K.S., Lee, Y.S., Chai, Y.G., 2015. RNA sequencing reveals distinct mechanisms underlying BET inhibitor JQ1mediated modulation of the LPS-induced activation of BV-2 microglial cells. J. Neuroinflammation 12, 36. Kelly, B.L., Locksley, R.M., 2000. Coordinate regulation of the IL-4, IL-13, and IL-5 cytokine cluster in Th2 clones revealed by allelic expression patterns. J. Immunol. 165, 2982–2986. Khan, Y.M., Kirkham, P., Barnes, P.J., Adcock, I.M., 2014. Brd4 is essential for IL-1betainduced inflammation in human airway epithelial cells. PLoS One 9, e95051. Kigerl, K.A., Gensel, J.C., Ankeny, D.P., Alexander, J.K., Donnelly, D.J., Popovich, P.G., 2009. Identification of two distinct macrophage subsets with divergent effects causing either neurotoxicity or regeneration in the injured mouse spinal cord. J. Neurosci. 29, 13435–13444. Klein, K., Kabala, P.A., Grabiec, A.M., Gay, R.E., Kolling, C., Lin, L.L., Gay, S., Tak, P.P., Prinjha, R.K., Ospelt, C., Reedquist, K.A., 2014. The bromodomain protein inhibitor I-

BETs are epigenetic proteins expressed in all CNS cell subpopulations, and BET inhibition disrupts inflammatory signaling broadly in all neural cells. In a mouse model of experimental SCI, BET inhibition with JQ1 attenuates the expression of multiple cytokines and chemokines and decreases monocyte and neutrophil infiltration by 3 days post-injury. However, JQ1 treatment did not decrease cytokine expression at more acute time points such as 24 h post-injury and did not decrease lesion size or promote locomotor recovery by 4 weeks post-injury. This study demonstrates that BET inhibition is an effective mechanism for inhibiting inflammation after SCI, and further investigation is needed to determine whether different BET inhibitors with better drug-like properties or modes of drug delivery may ultimately decrease secondary injury and promote improved functional outcomes after SCI. Funding This study was supported by the Miami Project to Cure Paralysis, the Buoniconti Fund, and the University of Miami School of Medicine internal grant (UM SAC 2016-40R1). Acknowledgements We are grateful to the laboratory of Dr. James Bradner for supplying (+)-JQ1 and for guidance on handling and dosing of JQ1; to Dr. Oliver Umland of the University of Miami Flow Cytometry Core Facility for technical support and advice on flow cytometry experiments; Dr. Lucy Funk with technical assistance with flow cytometry; to Marie Maloof for providing cerebellar granule cell cultures and assistance in experimental planning; and to Dr. Matt Danzi for assistance in analyzing the qPCR Array data. We would like to thank all members of the Lemmon, Bixby laboratories and the Center for Therapeutic Innovation for helpful discussions and suggestions. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.expneurol.2018.08.005. References Barlic, J., Zhu, W., Murphy, P.M., 2009. Atherogenic lipids induce high-density lipoprotein uptake and cholesterol efflux in human macrophages by up-regulating transmembrane chemokine CXCL16 without engaging CXCL16-dependent cell adhesion. J. Immunol. 182, 7928–7936. Barrett, E., Brothers, S., Wahlestedt, C., Beurel, E., 2014. I-BET151 selectively regulates IL-6 production. Biochim. Biophys. Acta 1842, 1549–1555. Beck, K.D., Nguyen, H.X., Galvan, M.D., Salazar, D.L., Woodruff, T.M., Anderson, A.J., 2010. Quantitative analysis of cellular inflammation after traumatic spinal cord injury: evidence for a multiphasic inflammatory response in the acute to chronic environment. Brain 133, 433–447. Belkina, A.C., Nikolajczyk, B.S., Denis, G.V., 2013. BET protein function is required for inflammation: Brd2 genetic disruption and BET inhibitor JQ1 impair mouse macrophage inflammatory responses. J. Immunol. 190, 3670–3678. Blight, A.R., 1983. Cellular morphology of chronic spinal cord injury in the cat: analysis of myelinated axons by line-sampling. Neuroscience 10, 521–543. Blight, A.R., 1991. Morphometric analysis of a model of spinal cord injury in Guinea pigs, with behavioral evidence of delayed secondary pathology. J. Neurol. Sci. 103, 156–171. Blomster, L.V., Brennan, F.H., Lao, H.W., Harle, D.W., Harvey, A.R., Ruitenberg, M.J., 2013. Mobilisation of the splenic monocyte reservoir and peripheral CX(3)CR1 deficiency adversely affects recovery from spinal cord injury. Exp. Neurol. 247, 226–240. Boato, F., Rosenberger, K., Nelissen, S., Geboes, L., Peters, E.M., Nitsch, R., Hendrix, S., 2013. Absence of IL-1beta positively affects neurological outcome, lesion development and axonal plasticity after spinal cord injury. J. Neuroinflammation 10, 6. Brown, T.J., Rowe, J.M., Liu, J.W., Shoyab, M., 1991. Regulation of IL-6 expression by oncostatin M. J. Immunol. 147, 2175–2180. Chan, C.H., Fang, C., Qiao, Y., Yarilina, A., Prinjha, R.K., Ivashkiv, L.B., 2015. BET bromodomain inhibition suppresses transcriptional responses to cytokine-Jak-STAT signaling in a gene-specific manner in human monocytes. Eur. J. Immunol. 45, 287–297.

191

Experimental Neurology 309 (2018) 181–192

M.D. Rudman et al.

Zurawski, S., Liu, Y., Abrams, J.S., Moore, K.W., Rennick, D., de Waal-Malefyt, R., Hannum, C., Bazan, J.F., Kastelein, R.A., 2000. Novel p19 protein engages IL-12p40 to form a cytokine, IL-23, with biological activities similar as well as distinct from IL12. Immunity 13, 715–725. Perry, M.M., Durham, A.L., Austin, P.J., Adcock, I.M., Chung, K.F., 2015. BET bromodomains regulate transforming growth factor-beta-induced proliferation and cytokine release in asthmatic airway smooth muscle. J. Biol. Chem. 290, 9111–9121. Pineau, I., Lacroix, S., 2007. Proinflammatory cytokine synthesis in the injured mouse spinal cord: multiphasic expression pattern and identification of the cell types involved. J. Comp. Neurol. 500, 267–285. Popovich, P.G., Wei, P., Stokes, B.T., 1997. Cellular inflammatory response after spinal cord injury in Sprague-Dawley and Lewis rats. J. Comp. Neurol. 377, 443–464. Saiwai, H., Ohkawa, Y., Yamada, H., Kumamaru, H., Harada, A., Okano, H., Yokomizo, T., Iwamoto, Y., Okada, S., 2010. The LTB4-BLT1 axis mediates neutrophil infiltration and secondary injury in experimental spinal cord injury. Am. J. Pathol. 176, 2352–2366. Sartor, G.C., Powell, S.K., Brothers, S.P., Wahlestedt, C., 2015. Epigenetic readers of lysine acetylation regulate cocaine-induced plasticity. J. Neurosci. 35, 15062–15072. Schorle, H., Holtschke, T., Hunig, T., Schimpl, A., Horak, I., 1991. Development and function of T cells in mice rendered interleukin-2 deficient by gene targeting. Nature 352, 621–624. Skaper, S.D., Facci, L., Zusso, M., Giusti, P., 2018. An inflammation-centric view of neurological disease: beyond the neuron. Front. Cell. Neurosci. 12, 72. Stirling, D.P., Yong, V.W., 2008. Dynamics of the inflammatory response after murine spinal cord injury revealed by flow cytometry. J. Neurosci. Res. 86, 1944–1958. Takahashi, K., Yi, H., Liu, C.H., Liu, S., Kashiwagi, Y., Patin, D.J., Hao, S., 2018a. Spinal bromodomain-containing protein 4 contributes to neuropathic pain induced by HIV glycoprotein 120 with morphine in rats. Neuroreport 29, 441–446. Takahashi, K., Yi, H., Liu, C.H., Liu, S., Kashiwagi, Y., Patin, D.J., Hao, S., 2018b. Spinal bromodomain-containing protein 4 contributes to neuropathic pain induced by HIV glycoprotein 120 with morphine in rats. Neuroreport 29 (6), 441–446. Wu, S.Y., Lee, A.Y., Lai, H.T., Zhang, H., Chiang, C.M., 2013. Phospho switch triggers Brd4 chromatin binding and activator recruitment for gene-specific targeting. Mol. Cell 49, 843–857. Xiao, Y., Liang, L., Huang, M., Qiu, Q., Zeng, S., Shi, M., Zou, Y., Ye, Y., Yang, X., Xu, H., 2016. Bromodomain and extra-terminal domain bromodomain inhibition prevents synovial inflammation via blocking IkappaB kinase-dependent NF-kappaB activation in rheumatoid fibroblast-like synoviocytes. Rheumatology 55, 173–184. Xing, B., Bachstetter, A.D., Van Eldik, L.J., 2011. Microglial p38alpha MAPK is critical for LPS-induced neuron degeneration, through a mechanism involving TNFalpha. Mol. Neurodegener. 6, 84. Yao, L., Pan, J., Setiadi, H., Patel, K.D., McEver, R.P., 1996. Interleukin 4 or oncostatin M induces a prolonged increase in P-selectin mRNA and protein in human endothelial cells. J. Exp. Med. 184, 81–92. Zhu, Y., Soderblom, C., Krishnan, V., Ashbaugh, J., Bethea, J.R., Lee, J.K., 2014. Hematogenous macrophage depletion reduces the fibrotic scar and increases axonal growth after spinal cord injury. Neurobiol. Dis. 74C, 114–125. Zong, S., Zeng, G., Wei, B., Xiong, C., Zhao, Y., 2012. Beneficial effect of interleukin-1 receptor antagonist protein on spinal cord injury recovery in the rat. Inflammation 35, 520–526.

BET151 suppresses expression of inflammatory genes and matrix degrading enzymes in rheumatoid arthritis synovial fibroblasts. Ann. Rheum. Dis. 75 (2), 422–429. Klein, K., Kabala, P.A., Grabiec, A.M., Gay, R.E., Kolling, C., Lin, L.L., Gay, S., Tak, P.P., Prinjha, R.K., Ospelt, C., Reedquist, K.A., 2016. The bromodomain protein inhibitor IBET151 suppresses expression of inflammatory genes and matrix degrading enzymes in rheumatoid arthritis synovial fibroblasts. Ann. Rheum. Dis. 75, 422–429. Korb, E., Herre, M., Zucker-Scharff, I., Darnell, R.B., Allis, C.D., 2015. BET protein Brd4 activates transcription in neurons and BET inhibitor Jq1 blocks memory in mice. Nat. Neurosci. 18, 1464–1473. Leal, A.S., Williams, C.R., Royce, D.B., Pioli, P.A., Sporn, M.B., Liby, K.T., 2017. Bromodomain inhibitors, JQ1 and I-BET 762, as potential therapies for pancreatic cancer. Cancer Lett. 394, 76–87. Lee, S.M., Yune, T.Y., Kim, S.J., Park, D.W., Lee, Y.K., Kim, Y.C., Oh, Y.J., Markelonis, G.J., Oh, T.H., 2003. Minocycline reduces cell death and improves functional recovery after traumatic spinal cord injury in the rat. J. Neurotrauma 20, 1017–1027. Li, J., Ma, J., Meng, G., Lin, H., Wu, S., Wang, J., Luo, J., Xu, X., Tough, D., Lindon, M., Rioja, I., Zhao, J., Mei, H., Prinjha, R., Zhong, Z., 2016. BET bromodomain inhibition promotes neurogenesis while inhibiting gliogenesis in neural progenitor cells. Stem Cell Res. 17, 212–221. Liu, Y., Wang, X., Zhang, J., Huang, H., Ding, B., Wu, J., Shi, Y., 2008. Structural basis and binding properties of the second bromodomain of Brd4 with acetylated histone tails. Biochemistry 47, 6403–6417. Ma, M., Wei, T., Boring, L., Charo, I.F., Ransohoff, R.M., Jakeman, L.B., 2002. Monocyte recruitment and myelin removal are delayed following spinal cord injury in mice with CCR2 chemokine receptor deletion. J. Neurosci. Res. 68, 691–702. Matzuk, M.M., McKeown, M.R., Filippakopoulos, P., Li, Q., Ma, L., Agno, J.E., Lemieux, M.E., Picaud, S., Yu, R.N., Qi, J., Knapp, S., Bradner, J.E., 2012. Small-molecule inhibition of BRDT for male contraception. Cell 150, 673–684. Mele, D.A., Salmeron, A., Ghosh, S., Huang, H.R., Bryant, B.M., Lora, J.M., 2013. BET bromodomain inhibition suppresses TH17-mediated pathology. J. Exp. Med. 210, 2181–2190. Meng, S., Zhang, L., Tang, Y., Tu, Q., Zheng, L., Yu, L., Murray, D., Cheng, J., Kim, S.H., Zhou, X., Chen, J., 2014. BET inhibitor JQ1 blocks inflammation and bone destruction. J. Dent. Res. 93, 657–662. Minty, A., Chalon, P., Derocq, J.M., Dumont, X., Guillemot, J.C., Kaghad, M., Labit, C., Leplatois, P., Liauzun, P., Miloux, B., et al., 1993. Interleukin-13 is a new human lymphokine regulating inflammatory and immune responses. Nature 362, 248–250. Nesic, O., Xu, G.Y., McAdoo, D., High, K.W., Hulsebosch, C., Perez-Pol, R., 2001. IL-1 receptor antagonist prevents apoptosis and caspase-3 activation after spinal cord injury. J. Neurotrauma 18, 947–956. Nicholls, S.J., Ray, K.K., Johansson, J.O., Gordon, A., Sweeney, M., Halliday, C., Kulikowski, E., Wong, N., Kim, S.W., Schwartz, G.G., 2018. Selective BET protein inhibition with apabetalone and cardiovascular events: a pooled analysis of trials in patients with coronary artery disease. Am. J. Cardiovasc. Drugs 18, 109–115. Nicodeme, E., Jeffrey, K.L., Schaefer, U., Beinke, S., Dewell, S., Chung, C.W., Chandwani, R., Marazzi, I., Wilson, P., Coste, H., White, J., Kirilovsky, J., Rice, C.M., Lora, J.M., Prinjha, R.K., Lee, K., Tarakhovsky, A., 2010. Suppression of inflammation by a synthetic histone mimic. Nature 468, 1119–1123. Oppmann, B., Lesley, R., Blom, B., Timans, J.C., Xu, Y., Hunte, B., Vega, F., Yu, N., Wang, J., Singh, K., Zonin, F., Vaisberg, E., Churakova, T., Liu, M., Gorman, D., Wagner, J.,

192