Butyrate-inserted Ni–Ti layered double hydroxide film for H2O2-mediated tumor and bacteria killing

Materials Today  Volume 00, Number 00  July 2017

RESEARCH: Original Research

RESEARCH

Butyrate-inserted Ni–Ti layered double hydroxide film for H2O2-mediated tumor and bacteria killing Donghui Wang1,2, Feng Peng1,2, Jinhua Li1,2, Yuqin Qiao1, Qianwen Li1,2 and Xuanyong Liu1,* 1

State Key Laboratory of High Performance Ceramics and Superfine Microstructure, Shanghai Institute of Ceramics, Chinese Academy of Sciences, Shanghai 200050, China 2 University of Chinese Academy of Sciences, Beijing 100049, China

The selective tumor- and bacteria-killing property is promising for biomedical implants in directly contact with tumor tissue but still presents a considerable challenge. In this study, a butyrate-inserted Ni–Ti layered double hydroxide film (LDH/Butyrate) is prepared on the surface of nitinol alloy via a simple hydrothermal treatment. The prepared film can selectively inhibit tumor growth and metastasis and bacterial infection by taking advantage of the overproduced H2O2 in tumor and infection microenvironments: the pro-tumor and pro-infection molecule H2O2 can be consumed by LDH/ Butyrate, and cytotoxic butyrate inserted in LDH/Butyrate is subsequently exchanged out. Such a novel endogenous stimuli-responsive platform is expected to prevent tumor overgrowth, metastasis and bacterial infection and will find a promising application in the design of localized drug-eluting systems.

Introduction Nitinol (NiTi), with its unique shape memory effect and favorable biocompatibility, can be used to fabricate different biomedical devices helpful for the palliative treatment of many types of cancers. For example, for patients suffering from bone cancer, the cancerous bone is commonly replaced by an orthopedic implant [1,2]; in the case of cervical cancer, nitinol and other titanium alloys have been suggested as a tool to help with local drug delivery or radiation treatment [3,4]; most notably, nitinol stent implantation is still the most commonly used clinical strategy to address malignant obstructions caused by different types of cancers [5–8]. However, current nitinol biomedical devices lack anticancer properties. There is still a high risk of cancer recurrence after implantation due to the latency of cancer cells. Another serious issue related to these implants is bacterial infection, which is one of the biggest complications following surgery and may lead to implant failure [9]. Therefore, developing new nitinol implants with anticancer and antibacterial abilities is highly desirable.

*Corresponding author:. Liu, X. ([email protected])

The strategy most often used to endow metal biomaterials with a tumor or bacterial inhibition effect is to load a drug onto the surface of the implants made from such materials [10,11]. Many drug-loading techniques have been recently developed, of which incorporating therapeutic agents into a polymer coating seems to be one of the most effective. However, long-term contact between tissues and polymer films usually leads to serious inflammatory responses [12–15]. Drugs can also be directly loaded into the deep sculptures or inorganic layers such as hydroxyapatite, titanium dioxide, or silica constructed on the implant surfaces [16,17]. However, the drug-release kinetics of these drug-loading systems is unstable. In addition, a common drawback of the drug-eluting system mentioned above is that the drug release can hardly be controlled and will harm non-targeted tissues. Recently, stimuli-responsive materials have attracted significant attention in the field of drug delivery due to their ability to change drug-eluting amounts in response to small external stimuli, such as pH, redox, light, ionic strength, and temperature [18–23]. Designing drug eluting systems that are responsive to the tumorand bacterial infection-related inflammation microenvironment is very desirable. Previous studies have shown that both cancer

1369-7021/ß 2017 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.mattod.2017.05.001

1 Please cite this article in press as: D. Wang, et al., Mater. Today (2017), http://dx.doi.org/10.1016/j.mattod.2017.05.001

MATTOD 938 1–20 RESEARCH

RESEARCH: Original Research

cells and inflammatory cells produce large amounts of hydrogen peroxide (H2O2) [24–26]. The accumulation of H2O2 has thus been exploited as a spontaneous trigger for responsive drug release in the treatment of cancers or bacteria-related infections [27–30]. Noh et al. reported a dual stimuli-responsive hybrid anticancer drug QCA, which can be activated by H2O2 and acidic pH [31]. Deng et al. [28] prepared a mitochondria-targeted H2O2 reactive polymersome for efficient intracellular drug delivery. Chuang et al. [27] presented a H2O2-responsive gas-generating hollow microsphere for inflammation inhibition. However, all of these drug-eluting systems were prepared in the form of nanoparticles, which cannot be used in localized drug delivery systems. Layered double hydroxides (LDHs) are a class of ionic lamellar compounds made up of positively charged brucite-like layers with an interlayer region containing charge-compensating anions [32,33]. LDHs are highly biocompatible, and anionic drugs can be easily exchanged into the interlayer of LDHs, so LDHs are widely used as drug-loading systems [34,35]. In addition, LDHs can easily be grown on many kinds of metals [36–40], making them a suitable surface modification layer for implants. Lin et al. [41] directly grew Mg-Fe LDHs on pure magnesium and found that the LDH layers can improve the substrate’s resistance to corrosion. Peng et al. [42] modified the JDBM alloy with a Mg-Al LDH film, which showed high biocompatibility. In our previous work [37,43], Ni–Ti LDH films were successfully constructed on nitinol alloy and showed excellent tumor-killing ability. Given their sensitivity to pH, LDHs can also be used in a pH-responsive drug release system [44], but few studies focus on their possible sensitivity to H2O2. LDHs mostly consist of valence-variable elements such as Fe, Co, Ni, Mn, and Cu [45,46]. These elements are extraordinarily reactive to hydrogen peroxide. In an environment rich in H2O2, LDHs will react with H2O2; the lattice structure of LDHs may change accordingly, and any drug inserted in the lattice of LDHs will be released. In this study, we inserted butyrate, an agent with anticancer and antibacterial abilities [47,48], into the interlayer of Ni–Ti LDHs constructed on the surface of nitinol via a simple hydrothermal treatment. As illustrated in Scheme 1, the prepared films can revert

Materials Today  Volume 00, Number 00  July 2017

H2O2 to hydroxyl ions (OH). With a high affinity to LDH layers, the produced OH will exchange with the interlayer butyrate ions, resulting in H2O2-reponsive butyrate release. Therefore, the designed system can function as an ‘‘air conditioner’’; it will clear away the pro-tumor and pro-inflammatory molecule H2O2, and release the ‘‘good guy’’ butyrate. An environment that inhibits tumor growth, metastasis and bacterial infection is thus created. To test the effectiveness of the newly designed H2O2-reponsive drug-eluting system, in vitro and in vivo evaluations were conducted. The results showed that the prepared films could effectively inhibit the growth and metastasis of tumors and bacterial infection but have relatively low toxicity to normal tissues.

Materials and methods Preparation of Ni–Ti LDH and butyrate-inserted LDH films The Ni–Ti LDH films were directly grown on the surface of nitinol via hydrothermal treatment. Briefly, a commercially available nitinol (50.8 at.% Ni) stick with a diameter of 12 mm was cut into plates with a thickness of 1 mm. The nitinol plates were thoroughly cleaned in water and ethanol by ultrasonic treatment. The precursor solution of Ni–Ti LDHs was prepared by mixing NiCl2.6H2O (1.43 g, Sinopharm Chemical Reagent, China), TiCl4 (0.25 ml, Sinopharm Chemical Reagent, China), HCl (0.25 ml, 36%–38%, Sinopharm Chemical Reagent, China), and urea (6.5 g, Aladdin, China) with ultrapure water (1000 ml). Next, the nitinol plates were placed into a 100 ml Teflon-lined stainless vessel, and the precursor solution (35 ml) was poured into the vessel and sealed. The vessel was put into a convective oven with the temperature pre-heated to 120 8C. After an elapsed time of 24 h, the vessel was taken out, washed with copious of ultrapure water, and dried in the air. The Ni–Ti LDHs modified substrates were designated LDH. To prepare butyrate-inserted Ni–Ti LDH films, sodium butyrate (66 g, Aladdin, China) was added into the precursor solution. The other treatment conditions were the same as in the preparation processes of sample LDH, and the resulting specimens were designated LDH/Butyrate.

Surface characterization The prepared specimens were characterized by scanning electron microscopy (SEM; S-4800, Hitachi, Japan), transmission electron microscopy (TEM, Tecnai G2 F20, Japan), X-ray diffraction (XRD; Rigaku, Japan), Fourier transform infrared spectroscopy (FTIR; FTIR-7600, Lambda Scientific, Australia), and X-ray photoelectron spectroscopy (XPS; RBD upgraded PHI-5000C ESCA system, USA). Samples were directly characterized by all of the above instruments except for TEM and FTIR, for which powders were scraped from the samples for better characterization.

Butyrate release Samples were immersed in 1 ml phosphate buffered saline (PBS, HyClone, USA) at 37 8C without stirring for various periods of time. The amounts of released butyrate were determined by analyzing the resulting solutions using ultraviolet and visible spectrophotometry (UV–vis; Lambada 750, PerkinElmer, USA). SCHEME 1

Illustration of H2O2-mediated tumor- and bacteria-killing, metastasisinhibiting and inflammation response-resisting abilities of LDH/Butyrate.

Electrochemical analysis The electrochemical properties of the prepared films were acquired with an electrochemical workstation (Chenhua CHI760C, China).

2 Please cite this article in press as: D. Wang, et al., Mater. Today (2017), http://dx.doi.org/10.1016/j.mattod.2017.05.001

MATTOD 938 1–20

A conventional three-electrode system comprised the electrochemical cell with a saturated calomel electrode (SCE) as the reference electrode, a graphite rod as the counter electrode and the tested samples as the work electrodes. Except in special cases, all of the electrochemical tests were conducted at room temperature in physiological saline solution (0.9% NaCl solution). Prior to the tests, samples were exposed to physiological saline for 400 s to establish a relatively steady open circuit. The chronoamperometry measurement lasted for 0.25 s, with the high potential set to 0.6 V while the low potential was 0.2 V. For the electrochemical impedance spectroscopy (EIS) test, the amplitude of the sinusoidal perturbing signal was 5 mV and the frequency varied from 100 kHz to 10 mHz. The EIS results were analyzed with the help of the ZView software package. The voltammetric measurement was performed in a 0.5 M NaOH solution with a scanning rate of 10 mV/min.

RESEARCH

spectra. As the mitochondrial membrane potential decrease is an important marker of apoptotic cells, JC-1 is particularly useful for apoptosis studies. In apoptotic cells, the dye stays in the cytoplasm and fluoresces green, while in healthy cells, the dye aggregates in the mitochondria and fluoresces red. The JC-1 assay was performed based on the manufacturer’s instructions. Briefly, 5  104 cells were seeded on each specimen. Cells were then stained by the JC-1 kit for 15 min and observed with confocal laser scanning microscopy (CLSM, Leica SP8, Germany). For quantitative analysis, the stained cells were dissociated from the films and examined by the enzyme labeling instrument with an excitation wavelength of 510 nm.

Live/dead cell staining Cells were seeded on the films with a density of 5  104 cells/ specimen and cultured for 4 days. Next, the cells were stained by a live/dead cell staining kit (Biovaision, USA) for 15 min and observed with CLSM.

Hydroxyl radical detection Hydroxyl radicals were detected by the pure terephthalic acid (PTA, Aladdin, China) method. The PTA reagent was prepared by mixing 5 mmol PTA and 10 mmol NaOH in 1000 ml PBS. Each sample was immersed in 5 ml PTA reagent for 24 h. The photoluminescence spectrum of the resulting solution was then examined by an enzyme-labeling instrument (BIO-TEK Synergy H4, USA) with an excitation wavelength of 310 nm.

Cell culture The cholangiocarcinoma cell line RBE, hepatoma carcinoma cell line SMMC-7721 and breast cancer cell line MCF-7 were purchased from the Cell Bank of the Chinese Academy of Science. Human intrahepatic biliary epithelial cells (HIBEpic) were obtained from Sciencell (USA). The cancer cells were cultured in the RPMI 1640 medium (Gibco, USA) containing 10% fetal bovine serum (FBS, Gibco, USA) and 1% of the antimicrobials penicillin and streptomycin (Antibiotic-Antimycotic, Gibco, USA), while normal cells were cultured in the epithelial cell medium (EpiCM, Sciencell, USA) containing 2% FBS and 1% Antibiotic-Antimycotic. All cells were cultivated in a humidified atmosphere of 5% CO2 at 37 8C. Based on the cell conditions, cells were passaged at a ratio of 1:2– 1:4 every 2–4 days.

Cell viability The proliferation rate of cells cultured on different samples were measured by the alamarBlueTM assay (AbD Serotec Ltd., UK). The cytotoxicity of samples to different cells was measured by the lactate dehydrogenase release assay kit (Naijing Jiancheng Bioengineering Institute, China). The early apoptosis of cells cultured on different samples was tested by a JC-1 kit (Beyotime, China). In all of the above tests, cells were seeded on top of the prepared films with a density of 5  104 cells/specimen. The alamarBlueTM assay was performed after cells had cultured for 1, 4 and 7 days, while the lactate dehydrogenase release assay kit and JC-1 kit were only applied four days after the cells were seeded. The membrane-permeant JC-1 dye can be used to monitor the membrane potential of mitochondria. JC-1 is a green-fluorescent (lex = 520 nm) monomer at low membrane potential. At higher potentials, JC-1 forms red-fluorescent (lem = 596 nm) ‘‘J-aggregates,’’ which exhibit broad excitation and very narrow emission

Intracellular reactive oxygen radical (ROS) contents 5  104 cells were planted on each sample and cultured for 4 days. Next, cells were detached from the samples by trypsin/ethylenediaminetetraacetic acid (EDTA) solution (0.25% trypsin and 1 mM EDTA; HyClone, USA). A solution of 20 ,70 -dichlorodihydrofluorescein diacetate (DCFH-DA, final concentration of 10 mM, Sigma– Aldrich, USA) was added to the detached cells and maintained for 30 min at 37 8C. DCFH-DA reacts with reactive oxygen species (ROS) and transforms to fluorescent 20 ,70 -dichlorescein (DCF). The detached cells were then stained by 40 ,6-diamidino-2-phenylindole (DAPI; Sigma, USA), centrifuged at 1000 rpm for 5 min and resuspended in PBS. An enzyme-labeling instrument was used to measure the fluorescence intensity of DCF and DAPI in the resuspended cell solution. The intracellular ROS contents were computed as FDCF/FDAPI, in which FDCF is the fluorescence intensity of DCF and FDAPI is the fluorescence intensity of DAPI.

Cell adhesion To detect the expression of cell-adhesion-related protein, hemidesmosome, cells with a density of 5  104 cells per well were seeded on the samples in 24-well plates. Four days later, the cells were fixed, permeabilized and blocked successively by 4% paraformaldehyde (PFA, Bio Basic Inc., China) diluent, 0.1% (v/v) Triton X-100 (Amresco, USA) and 1 wt% bovine serum protein (BSA, Sigma, USA), respectively. A specific primary antibody targeting integrin beta 4 (Abcam, U.K.) and a FITC-phalloidin antibody (Sigam–Aldrich, USA) were then added and incubated overnight at 4 8C. Next, a red fluorescently labeled goat antimouse secondary antibody was used for 1 h at 37 8C in the dark. The nuclei were stained with DAPI, and the samples were then observed with CLSM. The quantitative data were obtained with the image processing software Image-Pro-Plus 6. Ten images were used for the quantitative analysis for each sample, and the hemidesmosome expression was normalized to the hemidesmosome expression of cells cultured on NiTi. Ten images were used for the quantitative analyze for each sample.

Cell migration Samples were immersed in 1 ml cell culture medium without addition of fetal bovine serum. After one day, the culture medium 3

Please cite this article in press as: D. Wang, et al., Mater. Today (2017), http://dx.doi.org/10.1016/j.mattod.2017.05.001

RESEARCH: Original Research

Materials Today  Volume 00, Number 00  July 2017

MATTOD 938 1–20 RESEARCH

Materials Today  Volume 00, Number 00  July 2017

RESEARCH: Original Research

was collected as leach liquor for further use. Cells were directly planted into a 24-well plate with a density of 5  104 cells/well. Four days later, a line was drawn across each well with a 100 ml pipette to make a cell-free area. After rinsing twice with PBS, 1 ml leach liquor was added to the well. After culturing for different time periods, the cytoskeletons of cells cultured in the leach liquor were stained and observed with CLSM. The cells that migrated into the blank area were counted, and the migration rate was calculated according to the following Eq. (1): N B =AB 100% N F =AF

(1)

in which NB and NF represent the numbers of cells migrating into the blank region and remaining in their original region, respectively, while AB and AF represent the areas of the different regions accordingly.

The inoculated samples were also stained with a LIVE/DEAD BacLight Bacterial Viability Kit (Molecular Probes, USA) and observed with CLSM. To characterize the antibacterial ability of the prepared samples, a bacterial counting method was applied. Briefly, 60 ml bacterium solution with a density of 107 cfu/ml was seeded on each sample and incubated at 37 8C. One day later, the bacteria were dissociated from the sample surface and inoculated into a standard agar culture medium. After culturing for 16 h in the incubator, pictures of the bacterial colonies were taken by a gel imaging system (ProteinSimple, USA).

In vivo antibacterial activity

Cells were cultured on substrates in regular cell growth medium with an initial density of 1  105 cells/well, and the total RNA was extracted using TRIzol reagent (Roche) after 1 and 4 days. The cDNA was generated from 1 mg RNA using a Transcriptor First Strand cDNA Synthesis Kit (Roche). Real-time PCR (RT-PCR) was conducted on the LightCycler480 system (Roche) using a SYBR Green I master (Roche). Data were analyzed using the 2DDCT method. The relative expression of apoptosis-related genes Caspase-3 and Bcl-2 were normalized to that of the reference gene bactin. The primers for RT-PCR are listed in Table A1. All of the primers were purchased from Sangon Biotech.

These experiments were approved by the Animal Care and Experiment Committee of Eastern Hepatobiliary Surgery Hospital Affiliated with The Second Military Medical University. To develop the bacterial infection model, 100 ml bacterial solution of E. coli with a concentration of 107 cfu/ml was added to the sample surface. The bacteria-bearing sample was then immediately implanted into a subcutaneous pocket made on the back of a 129S4 mouse and harvested 7 days later. The mice were sacrificed, and the tissue contacting the sample surface was dissected. The tissues were fixed, dehydrated, embedded in paraffin, sliced and stained by H&E. A bright-field microscope and SEM were used to get the tissue images. To further characterize the antibacterial ability of the prepared films, the harvested samples were slid onto a standard agar culture medium. After culturing for 16 h, pictures of the bacterial colonies were taken by a gel imaging system.

In vivo antitumor activity

Data analysis

These experiments were approved by the Animal Care and Experiment Committee of Eastern Hepatobiliary Surgery Hospital Affiliated with The Second Military Medical University. To develop the tumor model, MCF-7 cells (3  106) suspended in 100 ml PBS were injected into the back of each of 12 mouse. Two weeks later, the tumor-bearing BALB/c nude mice were anesthetized with pentobarbital sodium (40 mg/kg) by intraperitoneal injection. One subcutaneous pocket was made at the tumor site, and the material (radius: 3 mm; thickness: 0.8 mm) was implanted into the pocket, contacting the tumor directly. The incision was then sutured. The tumor dimensions were measured with a caliper, and the tumor volume (V) was calculated according to the equation: volume = tumor length  (tumor width)2/2, then normalized to its initial volume (V0) to obtain the relative tumor volume (V/V0). The mice were sacrificed 3 weeks after sample implantation, and the tumor and organs (including lung, liver, spleen, kidney and heart) were subsequently dissected, fixed, dehydrated and embedded in paraffin. Histological cross-sections (5 mm) were stained with hematoxylin-eosin (H&E). Images were obtained with a bright-field microscope (Olympus, Japan) and SEM.

All statistical analyses were conducted with a GraphPad Prism 5 statistical software package. All of the data were expressed as the mean  standard deviation (SD). Statistically significant differences (P) were analyzed by one-way variance and Tukey’s multiple comparison tests. A value of p < 0.05 was considered statically significant and was represented by the symbol ‘‘*’’, a value of p < 0.01 was represented by ‘‘**’’, and p < 0.001 was ‘‘***’’.

Real-time quantitative PCR analysis

In vitro antibacterial ability test Staphylococcus aureus and Escherichia coli were used in this experiment. The original bacterial solution was diluted in physiological saline to a final concentration of 107 cfu/ml, and 60 ml bacterium solution was dipped on the sample surface. One day later, the viability of the bacteria was detected by an alamarBlueTM assay.

Results and discussion Design and characterization of LDH/Butyrate Ni–Ti LDHs have a layered structure with a relatively large interlayer space, which is beneficial for loading drugs. With the same chemical composition as NiTi alloy, Ni–Ti LDH may be one of the most suitable modification layers to be constructed on NiTi. In this study, the butyrate-inserted Ni–Ti LDH films were grown on the substrate through a one-step urea-assisted hydrothermal treatment. As illustrated in Fig. 1a, four steps (activation of the substrate, nucleation, crystal growth and ion exchange) were involved in the formation of LDH/Butyrate. The details of each step are discussed in Appendix A. For comparison, a Ni–Ti LDH film without butyrate insertion was also constructed on a NiTi substrate and designated LDH. The prepared LDH and LDH/Butyrate showed a similar plateletlike structures. The width and length of the platelets were approximately 2 mm, but the thickness was only approximately 30 nm (Fig. 1b-1,b-2,b-5,b-6). Part b-3 and b-7 in Fig. 1 show the SEM images of the cross-sectional view of LDH and LDH/Butyrate in

4 Please cite this article in press as: D. Wang, et al., Mater. Today (2017), http://dx.doi.org/10.1016/j.mattod.2017.05.001

MATTOD 938 1–20 RESEARCH

RESEARCH: Original Research

Materials Today  Volume 00, Number 00  July 2017

FIGURE 1

Preparation and characterization of LDH/Butyrate. (a) Schematic diagram depicting the formation of LDH/Butyrate. (b) SEM and TEM images of LDH and LDH/Butyrate: (b-1) top view of LDH; (b-2) cross-sectional view of LDH; (b-3) cross-sectional view of LDH at high magnification; (b-4) TEM images of LDH; (b5) top view of LDH/Butyrate; (b-6) cross-sectional view of LDH/Butyrate; (b-7) cross-sectional view of LDH/Butyrate at high magnification; (b-8) TEM image of LDH/Butyrate. (c) XRD patterns of LDH and LDH/Butyrate. d) FTIR spectra of LDH and LDH/Butyrate.

large magnification, in which a dense layer approximately 400 nm exists between the large platelet-like structure and the NiTi substrate. The intermediate layer bound the nitinol and the prepared films together, making the films have a strong adhesion to the substrate, which was verified in the tape tests shown in Fig. A1. From the high-resolution transmission electron microscope (TEM) images, lattice fringes corresponding to the (0 0 6) crystal face of the Ni–Ti LDHs were detected (Fig. 1b-4,b-8). The interplanar spacing of LDH/Butyrate was slightly larger than that of LDH, which was induced by the butyrate ion insertion. X-ray diffraction (XRD) patterns are shown in Fig. 1c. A strong reflection peak centered approximately 118, the most characteristic peak corresponding to the (0 0 3) crystal face, was detected. The reflection peaks corresponding to (0 0 6), (0 0 9), and (0 1 5) were also found. All of these peaks could be indexed to typical Ni–Ti LDHs. After butyrate insertion, the location of peak (0 0 3) changed from 11.468 to 11.298, indicating that the basal spacing of LDHs changed from 0.762 nm to 0.783 nm. This result matched well with the high-resolution TEM images. Based on the elemental analysis results (Table A2 and Fig. A2), the Ni/Ti atomic ratios of LDH and LDH/Butyrate were approxi-

mately 2.6, which was slightly different from that of the starting solution. The lack of coincidence between the initial ratio of the cations in the solution and the ratio in the final film was predictable and indicated that the nitinol substrate had taken part in the formation of the Ni–Ti LDH films. Therefore, the film and substrate were better combined. Fourier transform infrared spectroscopy (FTIR) tests were conducted to characterize the interlayer anions (Fig. 1d). A strong band centered at 2225 cm1 was assigned to the C–N stretching of the cyanate anion (CNO), which resulted from the incomplete decomposition of urea [49]. Peaks corresponding to the vibration of CO32 could be detected approximately 1384, 2852 and 2929 cm1 in the pattern of sample LDH, indicating the coexistence of CNO and CO32 in the LDH gallery [50]. In the case of LDH/Butyrate, two sharp bands at 1405 and 1558 cm1 corresponding to the symmetry and asymmetry vibration of C=O in carboxylate could be detected, while bands approximately 2939, 2878 and 2964 cm1 could be assigned to nCH2(as), nCH3(s), and nCH3(as), respectively [51]. These results demonstrated that butyrate ions had successfully been inserted into the interlayer of the prepared LDH/Butyrate. 5

Please cite this article in press as: D. Wang, et al., Mater. Today (2017), http://dx.doi.org/10.1016/j.mattod.2017.05.001

MATTOD 938 1–20 RESEARCH

H2O2-responsive butyrate release of LDH/Butyrate

RESEARCH: Original Research

The designed butyrate-eluting platform has a high sensitivity to H2O2. Fig. A3 shows the XRD patterns of LDH and LDH/Butyrate after immersion in different concentrations of H2O2 for 24 h. As the concentration of H2O2 increased, the crystallinity of the prepared films decreased. The crystallinity decrease could be more clearly observed in LDH/Butyrate than in LDH. A PTA (pure terephthalic acid) method was additionally applied to characterize the reaction between H2O2 and the prepared films. Hydrogen peroxide is effective in hydroxyl radical production, while PTA can react with hydroxyl radicals and become fluorescent hydroxyl

Materials Today  Volume 00, Number 00  July 2017

PTA. The H2O2 concentration can be obtained by measuring the fluorescence intensity of the resulting solution. Samples were immersed in PTA solutions containing different amounts of H2O2, and 24 h later, the fluorescence spectra of the PTA solutions were tested. The results are shown in Fig. 2a,b. Both LDH and LDH/ Butyrate lowered the fluorescence intensity of the PTA solutions, and the LDH/Butyrate-immersed solutions presented the lowest fluorescence intensity, illustrating that the prepared films, especially the LDH/Butyrate sample, could effectively consume H2O2. To test whether the H2O2 reactive capacity of the films worked in cells, the RBE cancer cells and HIBEpiC normal cells were cultured

FIGURE 2

H2O2 sensitivity of LDH/Butyrate. (a) Photoluminescence spectra of the PTA solutions with no H2O2 after soaking different samples in them for 24 h; the inset image shows the corresponding quantitative data. (b) Photoluminescence spectra of the PTA solutions containing 125 mM H2O2 after soaking different samples in them for 24 h; the inset image shows the corresponding quantitative data. (c) CLSM images showing the intracellular reactive oxygen species content of cancer cells cultured on different samples, and (e) the corresponding quantitative data. (d) CLSM images showing the intracellular reactive oxygen species content of normal cells cultured on different samples, and (f ) the corresponding quantitative data. 6 Please cite this article in press as: D. Wang, et al., Mater. Today (2017), http://dx.doi.org/10.1016/j.mattod.2017.05.001

MATTOD 938 1–20

on the surface of different samples, and the intracellular radical amounts were measured. The results are displayed in Fig. 2c–f. The prepared films reduced the radical contents in both types of cells, and the LDH/Butyrate sample showed a higher efficiency in intracellular radical clearance. To gain insight into the reaction between the prepared films and H2O2, we conducted electrochemical tests. The EIS Nyquist plots of the prepared films (Fig. 3a) consisted of a depressed semicircle in the high-frequency region (corresponding to charge transfer resistance, Rct) and a quasi-sloping line in the low-frequency region (corresponding to mass transfer resistance, Rmt). Obviously, LDH/ Butyrate exhibited a lower Rct than did LDH (28 kV for LDH/ Butyrate versus 56 kV for LDH, calculated in Appendix A; refer to

RESEARCH

Figs A4 and A5 and Table A3), suggesting a higher charge transport efficiency in LDH/Butyrate. Such enhanced kinetics may be ascribed to the larger interlayer space of LDH/Butyrate, resulting in a smaller electron density, giving protons less hindrance in moving through this specimen. It can be deduced that the low Rct may be responsible for the high reactivity of LDH/Butyrate to H2O2. Fig. A6 shows the CVs of the prepared films after different numbers of cycles. The quasi-reversible oxidation and reduction peaks corresponding to the interconversion of Ni2+/Ni3+ were observed in both samples [52]. The position of the anodic peak in LDH/ Butyrate was lower but the peak intensity was stronger than that of LDH, indicating that the conversion of Ni2+ to Ni3+ was easier in LDH/Butyrate. After 10 CV cycles, the oxidation/reduction waves

FIGURE 3

H2O2-responsive butyrate release of LDH/Butyrate. (a) EIS Nyquist plots of LDH and LDH/Butyrate. b) CV curves of LDH before and after immersion in 125 mM H2O2 solution. (c) CV curves of LDH/Butyrate before and after immersion in 125 mM H2O2 solution. (d) The pH value of the ultrapure water and 125 mM H2O2 solution after immersion of different samples. (e) Cumulative butyrate release of LDH/Butyrate in the environments with and without H2O2. (f ) The butyrate release amounts of LDH/Butyrate after immersion in different concentrations of H2O2 solution for 4 h. (g) Illustration of the mechanism of the H2O2-responsive butyrate release. 7 Please cite this article in press as: D. Wang, et al., Mater. Today (2017), http://dx.doi.org/10.1016/j.mattod.2017.05.001

RESEARCH: Original Research

Materials Today  Volume 00, Number 00  July 2017

MATTOD 938 1–20 RESEARCH

Materials Today  Volume 00, Number 00  July 2017

RESEARCH: Original Research

approached a stable value. Samples were then immersed in 125 mM H2O2 solution for 24 h, and the CV tests were re-conducted in the same condition. The oxidation and reduction peaks were clearly attenuated (Fig. 3b,c), suggesting that H2O2 had directly oxidized the Ni2+ to Ni3+. A more dramatic peak decline could be detected from the LDH/Butyrate sample owing to its higher reactivity to H2O2. The oxidation of Ni2+ by H2O2 was also confirmed by chronoamperometric tests, shown in Fig. A7. The pH values of the leach liquor of different samples were tested, and results are presented in Fig. 3d. When samples were immersed in pure water, the leach liquor of LDH/Butyrate showed the lowest pH value. However, when samples were immersed in 125 mM H2O2, the pH value tested from the LDH/Butyrate sample became the highest. These results indicated that hydroxyl ions were produced during the reaction between the prepared films and H2O2. Based on the above discussions, the reaction between the prepared films and H2O2 can be described by Eqs. (2) and (3). H2 O2 ! 2  OH

(2)



(3)

OH þ Ni2 ! Ni3þ þ OH

Previous reports have noted that there is an ion exchange order in LDHs; the produced OH has a higher affinity to the LDH layers and will enter the interlayer of LDH/Butyrate to replace butyrate [53]. The ion exchange process can be illustrated by Eq. (4). LDHButyrate þ OH ! LDHOH þ Butyrate

(4)

It should be noted that this ion exchange can also occur in pure water. Some of the hydroxyl ions in water will enter the interlayer of the prepared films, resulting in a pH decrease as shown in Fig. 3d. The interlayer anions of the LDH sample are composed of CO32 and CNO, which are hardly exchanged out, so LDH is not as effective as LDH/Butyrate in lowering pH. After adding H2O2, numerous hydroxyl ions will be produced and subsequently replace the interlayer anions, resulting a burst release of butyrate from the LDH/Butyrate sample. As shown in Fig. 3e, after adding 125 mM H2O2, the release of butyrate was dramatically improved. However, when the leach liquor was replaced by phosphate buffer saline (PBS), the butyrate release returned to the normal level again. The amount of butyrate released increased linearly with the concentration of H2O2 (Fig. 3f). Based on the above discussion, the whole process of the H2O2-controlled butyrate release is illustrated in Fig. 3g.

In vitro selective tumor cell inhibition effect of LDH/Butyrate To verify the effectiveness of the designed system, many cellular behaviors of tumor cells (RBE) and normal cells (HIBEpiC) cultured on different samples were assayed. The proliferation rates of different cells are presented in Fig. 4a-1,a-2. The LDH sample inhibited the growth of both types of cells compared to NiTi, but the proliferation rate of cells cultured on its surface kept increasing, indicating that it had little toxicity to cells. In contrast, the LDH/Butyrate sample could selectively kill cancer cells but had little adverse effect to normal cells. The proliferation rate of cancer cells cultured on LDH/Butyrate decreased with time, while that of normal cells increased with time. Fig. 4a-3,a-4 presents the CLSM images of live-dead stained cells and SEM images of cells on various surfaces after 4 days of cultivation. For cancer cells, dead cells

(stained to red) could hardly be detected on the surface of NiTi, started to appear on the surface of LDH, and covered the whole surface of LDH/Butyrate. From the SEM images at high magnification, it can be seen that cancer cells on NiTi spread well and had a polygon shape. Some spindle-shaped cells (pointed to by red arrows) appeared on the surface of LDH, indicating that the cells were in an apoptosis state. All of the cells on the surface of LDH/ Butyrate were in a dying state; most of them presented a spindle shape, and some cells showed a ruptured membrane. As for the normal cells, only live cells (stained to green) could be detected on all of the sample surfaces, but the cell viability of cells cultured on LDH and LDH/Butyrate decreased compared to that of cells cultured on NiTi. From the SEM images, normal cells cultured on all of the samples presented fibrous structures, indicating that all of the normal cells were in good condition. Two other types of cancer cells (hepatoma carcinoma cell 7721 and breast cancer cell MCF-7) were also cultured on the prepared films; their proliferation rates and corresponding SEM images are presented in Figs A9 and A10. It was found that these two kinds of cancer cells were also effectively inhibited by LDH/Butyrate samples. To further evaluate the cytotoxicity of different samples to cancer cells and normal cells, a lactate dehydrogenase release assay was conducted (Fig. 4b), which can be used to characterize the cell membrane permeability. After cells die, the cell membrane permeability will increase, and the intracellular lactate dehydrogenase will release accordingly. Cancer cells cultured on LDH had a higher membrane permeability than those cultured on NiTi, and LDH/Butyrate even further increased the cell membrane permeability. However, the cell membrane permeability of normal cells cultured on all of the samples remained at a low level. These results illustrated that LDH/Butyrate had a high cytotoxicity to cancer cells but showed little cytotoxicity to normal cells. Cells mainly die through apoptosis; the early apoptosis of cells was detected by a JC-1 assay. In this test, cells are stained to green or red based on their apoptosis condition. A strong green fluorescence intensity means cells are in an early apoptosis state, while red fluorescence can be seen when cells are in a survival state. The early apoptosis rate can be represented by the ratio between the fluorescence intensities of green and red light. Fig. 4c-1 presents the fluorescence spectra and the corresponding CLSM images of cells stained with JC-1. For cancer cells, a strong red light could be detected from cells cultured on NiTi, while the red light intensity decreased when cells were cultured on LDH and nearly dropped to zero when cells were cultured on LDH/Butyrate. In contrast, the red light intensity of normal cells cultured on LDH and LDH/ Butyrate did not drop very much. From the above data, it can be deduced that the prepared Ni–Ti LDH films, especially the LDH/ Butyrate samples, effectively promoted the early apoptosis of cancer cells but had relatively low ability to enhance the apoptosis of normal cells. The expressions of the apoptosis-related genes Caspase-3 and Bcl-2 of cells cultured on different samples for 1 and 4 d were evaluated by real-time polymerase chain reaction (RT-PCR). The results are presented in Fig. 4c-2. A high expression of the proapoptotic gene Caspase-3 in cancer cells cultured on LDH could be observed after 1 day of incubation. LDH/Butyrate could further improve the Caspase-3 expression by one order of magnitude. The expression of the anti-apoptotic gene Bcl-2 was also improved by

8 Please cite this article in press as: D. Wang, et al., Mater. Today (2017), http://dx.doi.org/10.1016/j.mattod.2017.05.001

MATTOD 938 1–20 RESEARCH

RESEARCH: Original Research

Materials Today  Volume 00, Number 00  July 2017

FIGURE 4

In vitro selective cancer cell inhibition ability of LDH/Butyrate. (a) Proliferation of cancer cells and normal cells: (a-1) proliferation rate of RBE cells cultured on different samples, represented by the reduction of alamarBlue; (a-2) proliferation rate of HIBEpiC cells cultured on different samples, represented by the reduction of alamarBlue; (a-3) CLSM images of the live-dead stained RBE cells and SEM morphology of RBE cells after 4 days culturing on various surfaces; (a-4) CLSM images of the live-dead stained HIBEpiC cells and SEM morphology of HIBEpiC cells after 4 days culturing on various surfaces. (b) Cytotoxicity of different samples to RBE cells and HIBEpiC cells, represented by the release amounts of lactic dehydrogenase from cells cultured on various surfaces. (c) Apoptosis of cancer cells and normal cells cultured on different samples: (c-1) photoluminescence spectra of JC-1-stained RBE cells and HIBEpiC cells cultured on various surfaces and the corresponding CLSM images; (c-2) relative mRNA expression of apoptosis-related genes Caspase-3 and Bcl-2 in RBE cells and HIBEpiC cells cultured on different samples.

the prepared films, but the increase was much less than that of Caspase-3, which meant that pro-apoptotic behaviors occupied a leading position in cancer cells cultured on the prepared films. The overexpression of Bcl-2 might be induced by an antagonism effect. After 4 days of incubation, the overexpression of Caspase-3 and Bcl-2 vanished from the cells cultured on LDH but still existed in the cells cultured on LDH/Butyrate. Compared to the gene expression on day one, a larger gap in expression amounts could be observed between Caspase-3 and Bcl-2 on day four in cells cultured on LDH/Butyrate. The results above indicate that LDH could only promote cancer cell apoptosis in the early stage of cell cultivation, while LDH/Butyrate had a lasting pro-apoptotic effect to cancer cells. In normal cells, the expression levels of the apoptosis-related genes of cells cultured on different samples showed little difference, implying that the prepared films had no influence on the apoptosis of normal cells. The inhibition effect of LDH samples to cancer cells may arise from their large nickel release in the acidic tumor microenvironment [37]. However, after a burst release in the first few days, the

nickel release amounts of LDH decrease significantly (Fig. A11). Therefore, LDH samples do not possess a lasting cancer inhibition effect, as verified by the PCR results. The nickel release of LDH/Butyrate samples is lower than that of LDH; its anticancer ability generally comes from its H2O2-controlled butyrate release. In the presence of H2O2, a high dose of butyrate will release from LDH/Butyrate and can be maintained for a long time (Fig. A12). As the tumor microenvironment is rich in H2O2, abundant butyrate will exchange out from the interlayer of LDH/Butyrate. Butyrate is effective in cancer cell-killing and will induce cell apoptosis and death. In contrast, when normal cells culture on LDH/Butyrate, less nickel and butyrate will release out from the specimens, so the samples show little adverse effect to normal cells. Fig. 5a shows the migration of cancer cells and normal cells cultured in the leach liquor of different samples. LDH had no effect on the migration of cancer cells but could improve the migration of normal cells. LDH/Butyrate could inhibit the migration of cancer cells but still showed a small enhancement to normal cells. 9

Please cite this article in press as: D. Wang, et al., Mater. Today (2017), http://dx.doi.org/10.1016/j.mattod.2017.05.001

MATTOD 938 1–20 RESEARCH

Materials Today  Volume 00, Number 00  July 2017

RESEARCH: Original Research FIGURE 5

In vitro cell migration inhibition effect of LDH/Butyrate. (a) CLSM images showing the migration of RBE cells (stained to red) and HIBEpiC cells (stained to green) in the leach liquor of different samples and the corresponding quantitative data. (b) Expression of hemidesmosome (stained to red) in RBE cells and HIBEpiC cells cultured on different samples observed by CLSM and the corresponding quantitative data.

Migration ability is reported to be related to the expression of hemidesmosome [54], so the immunofluorescent staining of hemidesmosome was performed. The results are shown in Fig. 5b; both cancer cells and normal cells cultured on LDH presented the highest hemidesmosome expression, while inserting butyrate in LDH lowered the hemidesmosome expression. These results suggest a positive correlation between the expression of hemidesmosome and cell migration. The migration-promotion ability of LDH may also result from the release of the nickel ions, which are considered a carcinogenic element [55]. LDH/Butyrate’s nickel release is relative low; besides, it can effectively consume the pro-migration molecule H2O2 and release the anti-migration butyrate, leading to decreased hemidesmosome expression and cell migration.

In vivo tumor-inhibition effect of LDH/Butyrate The anticancer abilities of the prepared samples were also evaluated in vivo. Three groups of tumor-bearing male nude mice (n = 4) were used. Compared to bare NiTi, both of the groups implanted with LDH and LDH/Butyrate shown inhibited tumor growth (Fig. 6a,b). In particular, the LDH/Butyrate samples could almost

completely prevent tumor growth, which was visually confirmed by comparing the tumor sizes shown in Fig. 6c. In addition, the body weight of the mice in different groups did not have any noticeable changes (Fig. A13), illustrating satisfactory in vivo biocompatibility and biosafety of the prepared films. The hematoxylin and eosin (H&E) staining of spleen, lung, liver, kidney and heart was conducted 21 days after the sample implantation (Fig. 6d). Few differences could be detected between the healthy mice (marked as Control) and the LDH/Butyrate group, indicating that LDH/Butyrate possessed no systemic toxicity to normal tissues. However, serious metastasis in liver (pointed to by green arrows) was found in the mice implanted with NiTi and LDH. A low-magnification image of H&E-stained liver was pictured for a better characterization of the metastasis (Fig. A14). Many tumor foci could be detected in the NiTi group, while more serious metastasis could be found in the LDH-implanted mice. However, only one tumor focus was formed in the LDH/Butyrate group, demonstrating the material’s good tumor metastasis-inhibition ability, in accordance with the in vitro cell migration results. Tumors were also taken out for H&E staining (Fig. 6e). A compact distribution of tumor cells could be observed from the

10 Please cite this article in press as: D. Wang, et al., Mater. Today (2017), http://dx.doi.org/10.1016/j.mattod.2017.05.001

MATTOD 938 1–20 RESEARCH

RESEARCH: Original Research

Materials Today  Volume 00, Number 00  July 2017

FIGURE 6

In vivo tumor-inhibition effect of LDH/Butyrate. (a) The relative tumor volumes of mice implanted with different samples. (b) Digital photos show the tumors taken out of mice implanted with different samples. (c) Representative photos of tumor-bearing mice after being implanted with different samples for various time periods. (d) Histological changes in various tissues of mice without any treatment (Control) and tumor-bearing mice implanted with different samples. (e) H&E-stained tumor tissues of mice implanted with different samples.

tumor tissue contacting NiTi, while tumor cells contacting LDH and LDH/Butyrate were relatively sparsely distributed. Notably, in the LDH/Butyrate group, most of the tumor cell nucleus had fractured into small debris (pointed to by red arrows), indicating the apoptosis of tumor cells. The in vivo tests indicated that although LDH had some tumor growth-inhibition ability, it promoted tumor metastasis, which is more dangerous than a tumor itself. However, LDH/Butyrate could effectively inhibit the growth and metastasis of a tumor at the same time, making it a desirable surface modification for implants in contact with tumor tissues.

Anti-infection effect of LDH/Butyrate Bacteria-related postoperative infection is a major problem leading to the failure of implants. Endowing biomedical devices with

antibacterial abilities is very necessary. The gram-positive bacteria S. aureus and gram-negative bacteria E. coli were used to characterize the antibacterial capacity of different samples. The results are shown in Fig. 7a. LDH samples could effectively kill S. aureus with an inhibition ratio close to 100%, but only had 70% inhibition ability to E. coli, while the butyrate-inserted samples had a nearly 100% antibacterial ability to both types of bacteria. Fig. 7b presents typical photos of the re-cultivated bacteria colonies dissociated from different samples. Nearly no bacteria colonies of S. aureus could be found on LDH, but a large amount of E. coli colonies could still be detected. On LDH/Butyrate, both types of bacteria were killed, and no colonies could be observed. The CLSM images of live-dead stained bacteria are presented in Fig. 7c. Only live bacteria (green) could be detected on NiTi samples. After modification by LDH, numerous dead bacteria (red) appeared. Further 11

Please cite this article in press as: D. Wang, et al., Mater. Today (2017), http://dx.doi.org/10.1016/j.mattod.2017.05.001

MATTOD 938 1–20 RESEARCH

Materials Today  Volume 00, Number 00  July 2017

RESEARCH: Original Research FIGURE 7

In vitro and in vivo anti-bacterial activity of LDH/Butyrate. (a) Inhibition ratio of different samples to S. aureus and E. coli. (b) Photos of re-cultivated S. aureus and E. coli which had previously been dissociated from different samples. (c) CLSM images of live-dead stained S. aureus and E. coli cultured on different samples. (d) SEM images of S. aureus and E. coli cultured on different samples. (e) Photos of the incisions made on mice for the implantation of the bacteriainoculated samples (these photos were taken one week after the implantation), and photos of the re-cultivated E. coli left on the surface of the implanted samples. f ) H&E-stained tissues in direct contact with different samples.

inserting butyrate into the interlayer of LDH induced little change to S. aureus but effectively decreased the amount of live E. coli. SEM images of S. aureus and E. coli (Fig. 7d) further confirmed the results above. Few S. aureus could be found on the surface of LDH, but a lot of E. coli could still be detected. However, it was very hard to find the existence of both types of bacteria on the surface of LDH/ Butyrate; besides, both of the found bacteria showed a broken membrane (pointed to by red arrows), indicating that they were in a dying state. To further evaluate the antibacterial effect of the prepared samples, in vivo tests were conducted. The same amount of E. coli was directly dipped on each sample, and the inoculated samples were then implanted subcutaneously. Fig. 7e shows the photos of the tested mice one week after the implantation. The incision on the mouse implanted with NiTi had not healed yet, and fester induced by bacterial infection could be found around the wound. In the LDH-implanted mouse, the incision was not healed, either, but no fester could be observed. The incision on the mouse implanted with LDH/Butyrate had almost healed. The implanted samples were then taken out and slid onto the agar plates. After 16 h culturing, images of the agar plates were taken. A large amount of bacterial colonies appeared on the trace of NiTi, the amount of bacterial colonies on that of LDH were

dramatically reduced, and no bacterial colonies could be detected on that of LDH/Butyrate. The extracted samples were also examined by SEM (Fig. A15). Some tissues were found adhered to the sample surfaces in the low-magnification images of SEM. Thus, different parts of the sample surfaces were observed (the bare sample surface, the boundary of the adhered tissues, and the tissue surface). Many bacteria could be observed everywhere on the surface of NiTi. On LDH, large amounts of bacteria could only be detected on the adhered tissues, while on LDH/Butyrate nearly no bacteria could be found on the whole surface, and the observed bacteria were all in a dying state with ruptured membranes, suggesting that LDH/Butyrate had a long-range antibacterial ability. The tissues in contact with the sample surface were stained by H&E and observed by optical microscope (Fig. 7f). A large amount of neutrophils and many folliculus pili (pointed to by yellow arrows) could be observed in the tissues directly contacting NiTi, indicating a serious inflammatory response. Additionally, many erythrocytes (pointed to by the red arrow) could also be found, suggesting bad wound healing of the tissues around NiTi. In contrast, nearly no neutrophils could be detected in the tissues around LDH and LDH/Butyrate, illustrating the excellent antiinflammation ability of the prepared films. The tissue sections

12 Please cite this article in press as: D. Wang, et al., Mater. Today (2017), http://dx.doi.org/10.1016/j.mattod.2017.05.001

MATTOD 938 1–20 Materials Today  Volume 00, Number 00  July 2017

Conclusions Hydrogen peroxide will affect a number of cellular behaviors, such as cell proliferation, apoptosis and migration. Both tumor tissues and inflammatory environments feature a high H2O2 concentration, which can be used as a trigger to control drug release. In this study, a butyrate-inserted Ni–Ti LDH film was prepared on the surface of nitinol via a simple hydrothermal treatment. Because of the specific chemical and crystalline phase compositions, the prepared films show a H2O2-responsive butyrate release. They can effectively consume the ‘‘bad’’ molecule H2O2 and release the ‘‘good’’ guy butyrate, creating an environment that inhibits tumors, bacteria and inflammatory response. Many in vitro and in vivo tests have been conducted, which show that the butyrate-inserted LDH films are effective at killing tumors and bacteria, inhibiting metastasis and resisting inflammation. The newly designed butyrateeluting films thus show great potential to be used in the surface modification of implants in contact with tumor tissues.

Acknowledgements This work was supported by the National Science Foundation for Distinguished Young Scholars of China (51525207), National Natural Science Foundation of China (31570973), Shanghai

TABLE A1

Primers for RT-PCR. Gene

Forward primer sequence (50 –30 )

Reverse primer sequence (50 –30 )

Caspase-3

AGATGGTTTGAGCCTGAGCA

CAGTGCGTATGGAGAAATGG

Bcl-2

CAACACAGACCCACCCAGA

TGGCTTCATACCACAGGTTTC

Committee of Science and Technology, China (15441904900, 14XD1403900).

Appendix A Formation of LDH/Butyrate. The formation of LDH/Butyrate starts from the pyrolysis of urea as presented in the following Eqs.: COðNH2 Þ2 ! NH4 CNO

(A1)

NH4 CNO þ H2 O ! 2NH3 þ CO2

(A2)

NH3 þ H2 O $ NH4 þ þ OH

(A3)

Thus, numerous hydroxyl ions will appear and attack the nitinol substrate, leading to the activation of nitinol. The substrate will start to react with hydroxyl ions in the solution, resulting in the formation of a Ni–Ti LDH nucleus. The crystal will then start to grow, with the help of nickel and titanium ions in the precursor solution, and finally form a compact Ni–Ti LDH film. CO32 ions can more easily enter into the interlayer of LDHs than butyrate, so the interlayer anions in the initially formed LDHs are mainly composed of CO32. However, the concentration of butyrate (600 mM) in the precursor solution is higher than that of urea (approximately 100 mM), and only a small part of urea can totally pyrolyze to produce CO32. Therefore, the concentration of butyrate is much higher than carbonate, and butyrate will exchange with the interlayer carbonate, leading to the formation of LDH/ Butyrate. The adhesion between the prepared film and substrate was characterized by tape test. Briefly, a rectangle tape with a dimension of 0.5 cm  1.0 cm was pasted on the surface of the prepared sample. The tape was removed 24 h later, and the sample was observed under SEM. The surface morphology of the sample LDH/

FIGURE A1

(a) The surface morphology of an LDH/Butyrate before the tape test. (b) The surface morphology of sample LDH/Butyrate sample after the tape test. 13 Please cite this article in press as: D. Wang, et al., Mater. Today (2017), http://dx.doi.org/10.1016/j.mattod.2017.05.001

RESEARCH: Original Research

were also observed by SEM (Fig. A16). The bacteria amounts decreased in the sequence of NiTi > LDH > LDH/Butyrate, which was consistent with the in vitro results. The bacterial inhibition effect of the LDH samples mainly comes from the release of nickel ions. With different cell wall structures, S. aureus and E. coli have different sensitivities to nickel ions. S. aureus is more sensitive to nickel, so it can be more effectively inhibited by LDH [43]. LDH/Butyrate is effective in the killing of both types of bacteria mainly owing to its butyrate release. In the in vivo tests, bacterially induced infection places the implants in an inflammatory infiltration environment, where the inflammatory cells will produce considerable H2O2 [25]. Both LDH and LDH/ Butyrate can kill bacteria and consume H2O2, so they can effectively alleviate the inflammatory response. Additionally, the H2O2-triggered butyrate release endows LDH/Butyrate with a higher bacteria-killing ability in vivo.

RESEARCH

MATTOD 938 1–20 RESEARCH

Materials Today  Volume 00, Number 00  July 2017

RESEARCH: Original Research FIGURE A2

(a) XPS spectra of O 1s. (b) XPS spectra of Ni 2p. (c) XPS spectra of Ti 2p.

Butyrate before and after the tape test is presented in Fig. A1. The nanoplates leant toward the substrate because of the tape test, but they still show intact plate morphology and were not stuck out by the tape, indicating good adhesion between the LDH/Butyrate film and the nitinol substrate. O1s XPS spectra are presented in Fig. A2a, where three peaks can be identified, with the one centered at 532.1 eV corresponding to

TABLE A2

Elemental compositions of different samples. Sample

C (at.%)

O (at.%)

Ni (at.%)

Ti (at.%)

Ni/Ti

LDH

29.56

59.39

7.9

3.15

2.51

LDH/Butyrate

26.76

59.43

10.09

3.71

2.72

FIGURE A3

(a) XRD patterns of LDH after immersing in H2O2 with different concentrations for 24 h. (b) XRD patterns of LDH/Butyrate after immersing in H2O2 with different concentrations for 24 h. 14 Please cite this article in press as: D. Wang, et al., Mater. Today (2017), http://dx.doi.org/10.1016/j.mattod.2017.05.001

MATTOD 938 1–20 RESEARCH

RESEARCH: Original Research

Materials Today  Volume 00, Number 00  July 2017

FIGURE A4

(a) Bode plots of LDH. (b) Bode plots of LDH/Butyrate. The experimental data are represented by squares, and the simulated data are represented by circles.

FIGURE A5

Equivalent electrical circuit used for the fitting of impedance spectra represented in Fig. 3a and the bode plots in Fig. A4.

O in the interlayer H2O. Compared to free water molecules, the peak has moved to the low energy region owing to the high electron density in the LDH gallery. The peak centered at 531.1 eV corresponds to the M-O bonding (M represent metal

element), and the peak centered approximately 530 eV corresponds to O in the interlayer anions. Oxygen in butyrate has a lower electron density than in carbonate, so the corresponding O1s binding energy in LDH/Butyrate is slightly larger than that in LDH. Fig. A2b shows the Ni 2p XPS spectra; besides two shakeup satellites (indicated as ‘‘Sat’’), there are two major peaks at 855.8 and 873.4 eV, corresponding to Ni 2p3/2 and Ni 2p1/2, respectively. The spin-energy separation of 17.6 eV is characteristic of Ni2+ in Ni(OH)2. Ti 2p XPS spectra present two peaks centered at 458.2 eV (Ti 2p3/2) and 464.0 eV (Ti 2p1/2) due to the presence of Ti4+. It should be noted that the tested value is slightly lower than the reported value of Ti4+ in TiO2. The binding energy of a metal is determined by the positive potential that results from the specific arrangement of the ion core and electrons. The decrease in the binding energy of Ti 2p3/2 and 2p1/2 for the LDH materials is due to a weak bonding situation from the introduction of Ni relative to the Ti-O-Ti bonding in TiO2.

FIGURE A6

(a) CV curves of the LDH sample recorded for the first 10 cycles. (b) CV curves of the LDH/Butyrate sample recorded for the first 10 cycles. 15 Please cite this article in press as: D. Wang, et al., Mater. Today (2017), http://dx.doi.org/10.1016/j.mattod.2017.05.001

MATTOD 938 1–20 RESEARCH

Materials Today  Volume 00, Number 00  July 2017

RESEARCH: Original Research FIGURE A7

(a) Chronoamperometric plots of the LDH sample in H2O2 solutions of different concentrations. (b) Chronoamperometric plots of sample LDH/Butyrate in H2O2 solutions of different concentrations.

TABLE A3

Parameter values obtained from the fitting of the impedance spectra represented in Fig. 3. Sample LDH LDH/Butyrate

Rs (V) 172.0 130.0

Cf (F)

Rf (V) 8

6.3  10

8

8.3  10

320.4 139.0

Cdl (F)

RCT 5

5.6  104

5

2.8  104

3.3  10 3.6  10

prepared film, Cdl represents the capacity of the double layer, and RCT represents the charge transfer resistance.The calculated value of each component is presented in Table A3. The results of the chronoamperometry tests are presented in Fig. A7, where higher current can be observed from the curve of sample LDH/Butyrate. Based on the Cottrell (Eq. (A4)), i¼

After immersing in H2O2, the characteristic peaks corresponding to (0 0 3) in both LDH and LDH/Butyrate were weakened, but a more obvious peak intensity decrease was detected in sample LDH/ Butyrate, indicating its higher sensitivity to H2O2. The impedance spectra were analyzed by the software package Zsim. Fig. A5 presents the used equivalent electrical circuit, in which Rs represents the resistance of the solution, Rf represents the resistance of the prepared film, Cf represents the capacity of the

nFAD1=2 c0 ðptÞ1=2

(A4)

in which i represents the limiting current, n represents the electron transfer number, F is Faraday’s constant, A is the electrode area, D represents the diffusion coefficient of the active material, c0 represents the initial concentration of the active material, and t represents the reaction time, it can be found that the limiting current is proportional to the concentration of the active material. In this study, the active material is Ni3+ ions, and the limiting current of LDH/Butyrate is higher than that of LDH, indicating

FIGURE A9 FIGURE A8

Tafel plots of different samples.

The inhibition effect of the prepared films to breast cancer cell MCF-7 and liver cancer cell 7721.

16 Please cite this article in press as: D. Wang, et al., Mater. Today (2017), http://dx.doi.org/10.1016/j.mattod.2017.05.001

MATTOD 938 1–20 RESEARCH

RESEARCH: Original Research

Materials Today  Volume 00, Number 00  July 2017

FIGURE A10

SEM images of breast cancer cell MCF-7 and liver cancer cell 7721 after 4 days of cultivation on different samples.

FIGURE A11

Nickel release profiles of different samples.

FIGURE A12

Butyrate release profile of an LDH/Butyrate sample in different conditions. 17

Please cite this article in press as: D. Wang, et al., Mater. Today (2017), http://dx.doi.org/10.1016/j.mattod.2017.05.001

MATTOD 938 1–20 RESEARCH

RESEARCH: Original Research FIGURE A13

The relative body weight of mice implanted with different samples, measured three weeks after implantation.

Materials Today  Volume 00, Number 00  July 2017

that more Ni3+ ions exist on the surface of LDH/Butyrate. After immersion in different concentrations of H2O2, the limiting current of LDH/Butyrate was increased accordingly, verifying that H2O2 will react with the prepared film and lead to the production of Ni3+ ions. However, the limiting current of LDH was not increased after H2O2 immersion, owning to its lower reactivity. Compared to the nitinol substrate, the prepared films presented a decreased corrosion potential and an increased corrosion current, indicating a decreased anticorrosion property (Fig. A8). This result can be used to explain the high activity of the prepared films. To further evaluate the effectiveness of the prepared film in tumor killing, another two kinds of tumor cell lines, human breast cancer cell line MCF-7 and human liver cancer cell line 7721, were cultured on the surface of the prepared films, and the viability of the cultured cells was tested by alamarBlue assay. The results are present in Fig. A9, where it can be seen that both of these kinds of cancer cells can also be effectively inhibited by LDH/Butyrate. The corresponding SEM images are shown in Fig. A10. Cells cultured on LDH/Butyrate could hardly spread and showed a spherical morphology, indicating that they were in a dying state.

FIGURE A14

The H&E stained liver of a healthy mouse (Control) and the tumor-bearing mice implanted with different samples (green arrows show the metastatic tumors). 18 Please cite this article in press as: D. Wang, et al., Mater. Today (2017), http://dx.doi.org/10.1016/j.mattod.2017.05.001

MATTOD 938 1–20 RESEARCH

RESEARCH: Original Research

Materials Today  Volume 00, Number 00  July 2017

FIGURE A15

SEM images of different samples implanted into the bacteria-bearing mice. (a) NiTi. (b) LDH. (c) LDH/Butyrate. (0 represents the low-magnification SEM images; 1, 2, 3 represent the high-magnification SEM images showing the bare sample surface, the boundary of the adhered tissues and the adhered tissues’ surfaces, respectively.)

FIGURE A16

The SEM images of the histological section shown in Fig. 8f at low and high magnification. 19 Please cite this article in press as: D. Wang, et al., Mater. Today (2017), http://dx.doi.org/10.1016/j.mattod.2017.05.001

MATTOD 938 1–20 RESEARCH

References

RESEARCH: Original Research

[1] K.N. Weilbaecher, T.A. Guise, L.K. McCauley, Nat. Rev. Cancer 11 (6) (2011) 411– 425. [2] Y. Zheng, et al. J. Bone Oncol. 2 (1) (2013) 47–57. [3] Y. Kim, et al. Int. J. Radiat. Oncol. Biol. Phys. 80 (3) (2011) 947–955. [4] A.M. Owrangi, et al. J. Contemp. Brachyther. 7 (5) (2015) 417–422. [5] J. Liu, et al. Biomaterials 53 (2015) 592–599. [6] M.Y.V. Homs, et al. Lancet 364 (9444) (2004) 1497–1504. [7] A.C. Smith, et al. Lancet 344 (8938) (1994) 1655–1660. [8] B. Rapp, Mater. Today 7 (5) (2004) 13. [9] J. Raphel, et al. Biomaterials 84 (2016) 301–314. [10] R. Chen, et al. Biomaterials 85 (2016) 142–151. [11] G. Kaur, et al. Biomaterials 101 (2016) 176–188. [12] R. Guillot, et al. Acta Biomater. 36 (2016) 310–322. [13] K.S. Lim, et al. Macromol. Res. 22 (6) (2014) 639–646. [14] C.J. Pan, et al. J. Control. Release 116 (1) (2006) 42–49. [15] W.C. Carlyle, et al. J. Control. Release 162 (3) (2012) 561–567. [16] N. Caliskan, et al. Mater. Sci. Eng. C 35 (2014) 100–105. [17] M. Bariana, et al. Nanomedicine (London, U.K.) 9 (8) (2014) 1263–1275. [18] L. Dai, et al. Biomaterials 104 (2016) 1–17. [19] V.G. Deepagan, et al. Biomaterials 103 (2016) 56–66. [20] K. Tamarov, et al. J. Control. Release 241 (2016) 220–228. [21] Y. Chen, et al. Adv. Funct. Mater. 24 (28) (2014) 4386–4396. [22] X. Hu, et al. Adv. Mater. 28 (4) (2016) 715–721. [23] Y. Wang, et al. Adv. Funct. Mater. 24 (27) (2014) 4206–4220. [24] M. Lopez-Lazaro, Cancer Lett. (N. Y., NY, U.S.) 252 (1) (2007) 1–8. [25] R. Liu-Bryan, R. Terkeltaub, Nat. Rev. Rheumatol. 11 (1) (2015) 35–44. [26] F.J. Blanco, I. Rego, C. Ruiz-Romero, Nat. Rev. Rheumatol. 7 (3) (2011) 161–169. [27] M.-F. Chung, et al. J. Am. Chem. Soc. 137 (39) (2015) 12462–12465. [28] Z. Deng, et al. J. Am. Chem. Soc. 138 (33) (2016) 10452–10466.

Materials Today  Volume 00, Number 00  July 2017

[29] [30] [31] [32] [33] [34] [35] [36] [37] [38] [39] [40] [41] [42] [43] [44] [45] [46] [47] [48] [49] [50] [51] [52] [53] [54] [55]

R.D. Hanna, et al. J. Am. Chem. Soc. 138 (40) (2016) 13353–13360. C. Zhang, et al. Angew. Chem. Int. Ed. 55 (6) (2016) 2101–2106. J. Noh, et al. Nat. Commun. 6 (2015). Q. Wang, D. O’Hare, Chem. Rev. 112 (7) (2012) 4124–4155. P.J. Sideris, et al. Science 321 (5885) (2008) 113–117. R. Kurapati, et al. Adv. Mater. 28 (29) (2016) 6052–6074. D.-H. Park, et al. Angew. Chem. Int. Ed. 55 (14) (2016) 4582–4586. T. Yoon, K.S. Kim, Adv. Funct. Mater. 26 (41) (2016) 7386–7393. D. Wang, et al. ACS Appl. Mater. Interfaces 7 (15) (2015) 7843–7854. F. Yao, et al. ACS Appl. Mater. Interfaces 7 (7) (2015) 3882–3887. S.-M. Xu, et al. Adv. Funct. Mater. 26 (9) (2016) 1365–1374. H. Chen, et al. Adv. Mater. 18 (23) (2006) 3089. J.-K. Lin, et al. J. Mater. Chem. 21 (13) (2011) 5011–5020. P. Feng, et al. ACS Appl. Mater. Interfaces (2016), http://dx.doi.org/10.1021/ acsami.6b12974. D. Wang, et al. RSC Adv. 5 (129) (2015) 106848–106859. N. Ge, et al. ACS Appl. Mater. Interfaces 8 (37) (2016) 24491–24501. Y. Zhao, et al. Chem. Sci. 5 (3) (2014) 951–958. Y. Zhao, et al. Nanoscale 7 (16) (2015) 7168–7173. J.Y. Chou, J.C. Robinson, S.S. Wang, Nature (London, U.K.) 268 (5620) (1977) 543– 544. N. Alva-Murillo, et al. Mol. Immunol. 68 (2) (2015) 445–455. Y. Zhao, et al. Chem. Eur. J. 18 (38) (2012) 11949–11958. T. Zhang, et al. Ind. Eng. Chem. Res. 51 (35) (2012) 11490–11498. G. Kavitha, et al. Int. J. Biol. Macromol. 93 (Pt A) (2016) 1304–1316. Y. Miao, et al. Biosens. Bioelectron. 53 (2014) 428–439. J.K. Lin, C.L. Hsia, J.Y. Uan, Scr. Mater. 56 (11) (2007) 927–930. I. Turcan, M.F. Jonkman, Cell Tissue Res. 360 (3) (2015) 545–569. B. Zambelli, V.N. Uversky, S. Ciurli, Biochim. Biophys. Acta Proteins Proteomics 1864 (12) (2016) 1714–1731.

20 Please cite this article in press as: D. Wang, et al., Mater. Today (2017), http://dx.doi.org/10.1016/j.mattod.2017.05.001