- Email: [email protected]
Butyrylcholinesterase-knockout reduces brain deposition of fibrillar β-amyloid in an Alzheimer mouse model
Neuroscience 298 (2015) 424–435
BUTYRYLCHOLINESTERASE-KNOCKOUT REDUCES BRAIN DEPOSITION OF FIBRILLAR b-AMYLOID IN AN ALZHEIMER MOUSE MODEL G. ANDREW REID a AND SULTAN DARVESH a,b*
2003; Greig et al., 2008), may also be involved in AD pathology. In AD, both BChE and acetylcholinesterase (AChE), but particularly BChE, become associated with Ab plaques, neurofibrillary tangles and cerebral amyloid angiopathy (Mesulam and Geula, 1994; Geula and Mesulam, 1995; Guillozet et al., 1997). In fact, while AChE levels in the AD brain are significantly reduced, BChE levels have been found to remain the same or increase (Perry et al., 1978; Atack et al., 1987; Darvesh et al., 2010). In addition, it has been found that BChE is primarily associated with the ‘‘malignant’’, fibrillar Ab plaques characteristic of AD but not the ‘‘benign’’, non-fibrillar plaques which are often found in individuals without dementia (Mesulam and Geula, 1994). This association has led some to suggest that BChE may be involved in Ab transformation from the ‘‘benign’’, non-fibrillar form to the ‘‘malignant’’ fibrillar form characteristic of AD (Guillozet et al., 1997) but a mechanism for this process has not been elucidated. In contrast, other in vitro studies have suggested that BChE may decrease Ab fibril formation (Diamant et al., 2006). Consequently, the role of BChE in plaque deposition remains unclear. A number of polymorphisms in the BCHE gene have been described, the most common being the BCHE-K variant (Bartels et al., 1992), where there is an A539T substitution that is found in approximately one-third of the human population and exhibits a 30% reduction in the molecular concentration of BChE (Bartels et al., 1992). Investigations of this BCHE variant have observed that its presence pre-empts progression of AD (Sandbrink et al., 1998; O’Brien et al., 2003). However, other studies have suggested that this variant is associated with AD (Tilley et al., 1999; Wiebusch et al., 1999; Lehmann et al., 2000; Lehmann et al., 2001; McIlroy et al., 2000) and still others have observed no association of BCHE-K variant with AD (Hiltunen et al., 1998; Kehoe et al., 1998; Singleton et al., 1998; Grubber et al., 1999; Ki et al., 1999; Yamamoto et al., 1999). This suggests that the role(s) of BChE in AD may involve other components of the disease and requires further scrutiny. This notion is supported by a recent genome-wide association study, using 18F florbetapir PET imaging data to assess in vivo Ab levels in the brains of 555 patients of the Alzheimer Disease Neuroimaging Initiative. This study has demonstrated the BCHE gene is one of few identified, along with that for ApoE, that is associated with AD (Ramanan et al., 2014). This observation represents the largest known effect of the BCHE gene on AD-related phenotype. The study concluded that BChE-
a
Department of Medical Neuroscience, Dalhousie University, Halifax, NS, Canada b
Department of Medicine (Neurology and Geriatric Medicine), Dalhousie University, Halifax, NS, Canada
Abstract—In Alzheimer’s disease (AD), numerous b-amyloid (Ab) plaques are associated with butyrylcholinesterase (BChE) activity, the significance of which is unclear. A mouse model, containing five human familial AD genes (5XFAD), also develops Ab plaques with BChE activity. Knock-out of BChE in this model showed diminished fibrillar Ab plaque deposition, more so in males than females. This suggests that lack of BChE reduces deposition of fibrillar Ab in AD and this effect may be influenced by sex. Ó 2015 The Authors. Published by Elsevier Ltd. on behalf of IBRO. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Key words: Alzheimer’s disease, b-amyloid, butyrylcholinesterase, 5XFAD mouse, butyrylcholinesterase-knockout, cholinergic system.
INTRODUCTION The ‘‘amyloid hypothesis’’ suggests that this abnormally folded b-amyloid (Ab) protein may be one of the important pathological contributors to neuronal loss in Alzheimer’s disease (AD) (Lorenzen et al., 2010; Masters and Selkoe, 2012). A number of factors contribute to Ab accumulation, including genetic mutations in the amyloid precursor protein and cofactors that are involved in its processing, such as presenilins (Blennow et al., 2006; Querfurth and LaFerla, 2010). In addition, butyrylcholinesterase (BChE), a serine hydrolase that has a number of functions in health and disease (Mesulam et al., 2002; Giacobini, 2003; Darvesh et al., *Correspondence to: S. Darvesh, Room 1308, Camp Hill Veterans’ Memorial, 5955 Veterans’ Memorial Lane, Halifax, Nova Scotia B3H 2E1, Canada. Tel: +1-902-473-2490; fax: +1-902-473-7133. E-mail address: [email protected] (S. Darvesh). Abbreviations: 5XFAD, B6SJL-Tg(APPSwFlLon,PSEN1⁄M146L⁄ L286V)6799Vas/Mmjax; 5XFAD/BChE-KO, 5XFAD/BChE-knockout; AChE, acetylcholinesterase; AD, Alzheimer’s disease; Ab, b-amyloid; BChE, butyrylcholinesterase; BChE-KO, B6.129S1-Bchetn1Loc/J knockout mouse; DAB, 3,30 -diaminobenzidine tetrahydrochloride); EDTA, ethylenediaminetetraacetic acid; FAD, Familial Alzheimer’s disease; PCR, polymerase chain reaction; Th-S, thioflavin-S.
http://dx.doi.org/10.1016/j.neuroscience.2015.04.039 0306-4522/Ó 2015 The Authors. Published by Elsevier Ltd. on behalf of IBRO. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). 424
G. A. Reid, S. Darvesh / Neuroscience 298 (2015) 424–435
associated AD neuropathology, and genetic variation at the BCHE locus associated with Ab burden, may provide a means for BChE-modulating agents to alter disease progression (Ramanan et al., 2014). Further studies of the interaction of BChE and Ab in an animal model may provide insights into AD pathogenesis. The B6SJL-Tg(APPSwFlLon,PSEN1*M146L*L286V) 6799Vas/Mmjax mouse overexpresses mutant human APP695 with Swedish (K670N/M671L), Florida (I716V) and London (V717I) Familial Alzheimer’s disease (FAD) mutations along with human presenilin-1 harboring two FAD mutations, M146L and L286V (Oakley et al., 2006). This 5XFAD mouse is a useful model for studying Ab plaques as it rapidly develops this pathology, characteristically similar to plaques in human AD brains (Oakley et al., 2006). Accumulation of Ab42 begins as early as 1.5 months of age in the 5XFAD mouse, increases with age and female mice show higher Ab42 levels than males (Oakley et al., 2006). The B6.129S1-Bchetn1Loc/J mutant mouse is a BChE-knockout (BChE-KO) model that does not produce any BChE enzyme (Li et al., 2006) and is a useful model for studying the functions of this enzyme (Duysen et al., 2007). In this strain, the targeting vector contains an 891-bp deletion of the BCHE gene, removing the splice junction between intron 1 and exon 2. This deletion includes the entire signal peptide of which the translation start site and the first 102 amino acids of the mature BChE protein are also removed (Li et al., 2006). Homozygous BChE-KO mice have a complete lack of BChE in all tissues and plasma with no apparent anomalies in physical appearance or cognition (Li et al., 2008). To address the unresolved role of BChE in Ab plaque accumulation, the 5XFAD mouse was cross-bred with a BChE-KO strain producing a new 5XFAD/BChE-KO strain, that accumulates Ab plaques but does not synthesize BChE. Since in human AD (Corder et al., 2004; Barnes et al., 2005; Vest and Pike, 2013; Li and Singh, 2014; Mielke et al., 2014) and in AD mouse models (Oakley et al., 2006; Hirata-Fukae et al., 2008; Carroll et al., 2010) females have higher Ab plaque burden, females and males were analyzed separately in the present study. Comparison of 5XFAD/BChE-KO with age-matched 5XFAD mice revealed diminished fibrillar Ab plaque burden, especially in males.
425
bedding and covered by a metal cage top and microisolator filter. Food (Purina rodent chow, #5001) and tap water were available ad libitum. Animals were kept in normal light/dark cycle. It has been noted that female hemizygous 5XFAD mice are not suitable mothers due to the detrimental effects caused by the accumulation of Ab. Consequently, for the generation of 5XFAD and 5XFAD/ BChE-KO offspring, female 5XFAD or 5XFAD/BChE-KO mice were not used for breeding. Hemizygous 5XFAD mice, used for breeding and subsequent experiments, were produced from pairs of WT female mice bred with 5XFAD male mice. Homozygous BChE-knockout (BChE-KO) mice were produced from BChE-het males and females. A three generation breeding scheme was used to produce the desired transgenic hemizygous 5XFAD strain that were homozygous BChE-knockout (5XFAD/BChE-KO). Hemizygous male 5XFAD mice were bred with pairs of BChE-KO females to produce 5XFAD/BChE-het mice. Male 5XFAD/BChE-het mice were bred with female BChE-KO mice to produce 5XFAD/BChE-KO mice. To maintain the strain and produce mice for subsequent experiments 5XFAD/ BChE-KO males were bred with BChE-KO females. The number of animals used for these experiments were as follows; 5XFAD (3-month-old males n = 7, 6-month-old males n = 5, 3-month-old females n = 9, 6-month-old females n = 6) and 5XFAD/BChE-KO (3-month-old males n = 10, 6-month-old males n = 4, 3-month-old females n = 6, 6-month-old females n = 6). Genotyping An ear punch was used to identify mice and collect a skin sample for genotyping. For DNA isolation, 80 ll of 0.025 M sodium hydroxide and 0.2 mM EDTA disodium dihydrate was added to skin samples and was incubated at 98 °C for 1 h with periodic vortexing to digest tissue. Following tissue digestion, 80 ll of a neutralization solution containing 40 mM Tris HCl at pH 5.5 was added, vortexed and centrifuged at 4000 rpm for 3 min (Truett et al., 2000). The supernatant was removed and saved for polymerase chain reaction (PCR). Each mouse was genotyped for APP, PSEN1 and BCHE genes. To each PCR tube was added 2.5 ll PCR buffer (0.2 M Tris–HCl and 0.5 M KCl pH 8.4),
EXPERIMENTAL PROCEDURES Animals Formal approval to conduct these experiments was obtained from the Dalhousie University Committee on Laboratory Animals. Female wild-type (WT; C57BL/ 6J SJL/J F1; The Jackson Laboratories, Stock # 100012), male transgenic hemizygous 5XFAD (B6SJLTg(APPSwFlLon,PSEN1*M146L*L286V)6799Vas/Mmjax; Mutant Mouse Regional Resource Center, 034840-JAX) and heterozygous butyrylcholinesterase (B6.129S1Bchetm1Loc/J; The Jackson Laboratories, Stock # 008087), referred to here as BChE-het mice, were purchased. Mice were housed in same-sex groups of 1– 5, within polyethylene cages, containing a wood-chip
Table 1. Primers used for mouse genotyping (Jackson laboratories) BCHE mutant (oIMR7415) BCHE common (oIMR8093) BCHE wild-type (oIMR8094) APP forward APP reverse PSEN1 forward (oIMR1644) PSEN1 reverse (oIMR1645)
GCCAGAGGCCACTTGTGTAG CATGGAAAAGAGGAGGATGG TTCCACTTGGAAGAGAAACACA ACAGAATTCGCCCCGGCCTGGTAC TAAGCTTGGCACGGCTGTCCAAGGA AATAGAGAACGGCAGGAGCA GCCATGAGGGCACTAATCAT
426
G. A. Reid, S. Darvesh / Neuroscience 298 (2015) 424–435
0.5 ll 10 mM dNTP mixture (Invitrogen; 10297–018), 0.75 ll MgCl2, 0.625 ll primers (see Table 1 for primer sequences purchased from Sigma–Aldrich, St. Louis, MO, USA), 5 ll DNA isolate, 0.1 ll Taq (Invitrogen; 10342–020) and 14.9 ll ultrapure dH2O. PCR samples were amplified on a BIORAD C1000 Touchä thermal cycler. For BCHE the following protocol was used: 94 °C 2 min, 34 times (94 °C for 30 s, 59 °C for 30 s, 72 °C for 1 min), 4 °C for 5 min. For APP and PSEN1, 94 °C 2 min, 34 times (94 °C for 30 s, 65 °C for 30 s, 72 °C for 1 min), 4 °C for 5 min. PCR products were run on a 2% agarose gel made with TAE buffer, containing 0.04 M Tris–acetate and 0.001 M EDTA, with SYBRÓ safe DNA gel stain (Invitrogen; S33102, 1:10,000). Gels were run for 30 min and visualized on a Typhoon 9410 Molecular Imager (GE Healthcare). Brain preparation Mice were euthanized by a lethal intraperitoneal sodium pentobarbital injection, perfused transcardially with saline (25 mL, 0.9% NaCl, 0.1% NaNO3) and 50 mL of 4% formaldehyde in 0.1 M phosphate buffer (PB, pH 7.4), the brains removed and post-fixed for 1.5 h. Brains were then immersed in 30% sucrose in PB with 0.05% sodium azide and stored at 4 °C until used. Brains were frozen with dry ice and cut into 40 lm serial coronal sections on a Leica SM2000R microtome with Physitemp freezing stage and BFS-30TC controller. Sections were stored at 4 °C in PB with 0.08% sodium azide until used for analysis of BChE and AChE activity with histochemistry, fibrillar Ab with thioflavin-S (Th-S) histofluorescence and Ab using immunohistochemistry. Cholinesterase histochemistry Cholinesterase staining was performed using a modified (Darvesh et al., 2012) Karnovsky-Roots method (Karnovsky and Roots, 1964). All reagents were purchased from Sigma–Aldrich (St. Louis, MO, USA). The substrate used for visualization of BChE activity was butyrylthiocholine, where AChE activity was inhibited by BW 284 C 51 (1,5-bis [4-allyl dimethylammonium phenyl] pentan-3-one dibromide) at a final concentration of 0.01 mM. Briefly, tissue sections were rinsed in 0.1 M of maleate buffer (pH 7.4) for 30 min; they were then incubated for 2 h in 0.1 M maleate buffer (pH 6.8) containing 0.5 mM sodium citrate, 0.47 mM cupric sulfate, 0.05 mM potassium ferricyanide, 0.8 mM butyrylthiocholine iodide and 0.01 mM BW 284 C 51. All sections were then rinsed with gentle agitation for 30 min in dH2O and placed in 0.1% cobalt chloride in water for 10 min. After further rinsing in dH2O, sections were placed in PB containing 1.39 mM 3,30 -diaminobenzidine tetrahydrochloride (DAB). After 5 min in the DAB solution, 50 ll of 0.15% H2O2 in dH2O was added per ml of DAB solution, and the reaction was carried out for approximately 3 min. Sections were then washed in 0.01 M acetate buffer (pH 3.3), mounted on slides, coverslipped, and examined with brightfield microscopy. For AChE staining, the sections were incubated in 4% formaldehyde for approximately 10 h. The remaining
procedure was as described above for BChE except the substrate was acetylthiocholine iodide at a concentration of 0.4 mM and BuChE activity was inhibited with 0.06 mM ethopropazine. The sections were incubated with the substrate for approximately 1 h. Control experiments for cholinesterase histochemistry were as described previously (Darvesh et al., 2012). Ab immunohistochemistry Ab plaque load, comprising both non-fibrillar and fibrillar, was visualized using immunohistochemistry for the Ab protein. Briefly, sections were rinsed for 30 min in PB pH 7.4, for 16 h in 4% formaldehyde, 30 min in PB pH 7.4, 5 min in 0.05 M PB, followed by distilled water (dH2O), and then gently shaken in 90% formic acid for 2 min for antigen retrieval. Sections were rinsed 5 times in dH2O for 1 min each and 2 times in PB for 15 min. Sections were then placed in 0.3% H2O2 in PB for 30 min to quench endogenous peroxidase activity and rinsed again for 30 min in PB. Sections were then incubated in PB containing 0.1% Triton X-100, normal goat serum (1:100), and a polyclonal rabbit anti-Ab antibody (1:400; 71–5800, Invitrogen, Camarillo, CA, USA), specific for the 4- to 5-kDa amyloid peptide, for approximately 16 h at room temperature. After rinsing in PB, sections were incubated in PB with 0.1% Triton X100, biotinylated goat anti-rabbit secondary antibody (1:500), and normal goat serum (1:1000) for 1 h. After another rinse in PB, sections were placed in PB with 0.1% Triton X-100 and Vectastain Elite ABC kit (1:182; PK-6100, Vector Laboratories, Burlingame, CA, USA), according to the manufacturer’s specifications, for 1 h. Sections were rinsed and developed in a solution of PB containing 1.39 mM DAB. After 5 min, 50 ll of 0.3% H2O2 in dH2O was added per mL of DAB solution, and the sections were incubated for 5 min. The reaction was stopped by rinsing the sections in 0.01 M acetate buffer (pH 3.3). Sections were mounted onto glass slides, airdried, and coverslipped. In control experiments, no staining was observed when Ab immunohistochemistry was done on brain tissue from wild-type mice. Th-S histochemistry Sections were rinsed in 0.05 M Tris-buffered saline pH 7.6 for 30 min, mounted onto glass slides, air-dried overnight, rehydrated in dH2O, dehydrated in a series of ethanol washes, cleared in xylene and rinsed in 50% ethanol. Sections were then incubated overnight in a solution of 0.05% Th-S (Sigma–Aldrich, St. Louis, MO, USA) in 50% ethanol, rinsed in 80% aqueous ethanol and dH2O and coverslipped with an aqueous mounting medium. Data analysis The stained mouse brain sections were analyzed and photographed using a Zeiss Axioplan 2 motorized microscope with a Zeiss Axiocam HRc digital camera using AxioVision 4.6 software (Carl Zeiss Canada Ltd., Toronto, Ontario, Canada). The photographs were assembled using Adobe Photoshop (CS 5 version 12.0).
G. A. Reid, S. Darvesh / Neuroscience 298 (2015) 424–435
The brightness of images was adjusted to match the background from different images. Each mouse was encoded with a random number to remove potential bias while measuring plaque load. Plaque loads were quantified using National Institutes of Health ImageJ 1.49d software and recorded as a percentage of the total area, as described elsewhere (Darvesh et al., 2012). Briefly, gray-scale images of sections stained for BChE activity, Ab and Th-S were taken throughout the brain. An intensity threshold level was set such that stained plaques, but not background, was selected. The cortex was outlined with the polygon selection tool and measured for the percent area covered by plaque staining. On average, eight Ab sections, twelve Th-S-stained sections and four BChE-stained sections were quantified per brain. For each mouse, data from each section were summed to give a cortical area and the total plaque area measured. This was used to determine the percent plaque load for each mouse. Within each strain, sex and age group, the percent area covered by plaque pathology was averaged. A two-tailed Mann–Whitney non-parametric statistical test was applied to determine the difference between means in the areas covered by Ab pathology in 5XFAD and 5XFAD/BChEKO mice using Graphpad Prism (version 5.1 Windows). Male and female mice were analyzed separately. Results were considered significant when the p-value was less than the 5% critical level (p < 0.05).
RESULTS This work was undertaken to examine the effect of BChE on the accumulation of Ab plaques in the brain. The 5XFAD mouse model was chosen for this study since it rapidly accumulates Ab pathology, beginning before 2 months of age (Oakley et al., 2006). The 5XFAD mouse, which normally produces BChE, was crossed with a BChE-knockout strain (BChE-KO) to generate a new strain (5XFAD/BChE-KO) that still accumulates Ab plaques but cannot synthesize BChE. To explore the effect of BChE on Ab accumulation over time, brain tissues from 5XFAD and 5XFAD/BChE-KO mice at 3 and 6 months of age were stained and analyzed for Ab, fibrillar Ab and BChE activity associated with plaques. Female and male mice were analyzed separately for pathology because it had been observed earlier in human AD (Corder et al., 2004; Barnes et al., 2005; Vest and Pike, 2013; Li and Singh, 2014; Mielke et al., 2014) and in the 5XFAD mouse model (Oakley et al., 2006) that females have higher plaque burden. Comparison of 5XFAD with 5XFAD/BChEKO mice should provide insights into possible role(s) of BChE in Ab accumulation. Comparison of immunostained Ab, fibrillar Ab and BChE plaque accumulation in 5XFAD mice As has been shown previously (Oakley et al., 2006), the 5XFAD mouse accumulates Ab plaques (Fig. 1A, B). In addition, as seen in human AD (Mesulam and Geula, 1994; Geula and Mesulam, 1995; Guillozet et al., 1997) and the 2XFAD mouse model (Darvesh et al., 2012), BChE activity was associated with many of these plaques
427
(Fig. 1C). There was no AChE activity visualized with cortical Ab plaques in the 5XFAD mice (Fig. 1D). The plaque pathology for female and male 5XFAD mice at 3 and 6 months of age was visualized as illustrated in Fig. 2. The plaque burden was quantified, expressed as a percentage of cerebral cortical area covered by pathology and averaged for each sex and age group (Fig. 3). The immunostained Ab, fibrillar Ab and BChE-associated plaque loads for female and male mice were shown to accumulate early, by 3 months of age, and increased with age. The area of the cerebral cortex covered by plaques stained with Th-S or BChE histochemistry was less than that by Ab immunostaining (Fig. 3). Female mice showed increased Ab plaque burden compared to males, which was a trend at 3 months and significantly higher at 6 months (p = 0.0173). In addition, the fibrillar Ab plaque burden was significantly higher in females relative to males at both 3 months (p = 0.0229) and 6 months (p = 0.0043). Similarly, females had higher BChE-associated plaque burden compared to males (p = 0.0164) at 3 months, a trend which continued at 6 months (p = 0.0519). Generation and characterization of the 5XFAD/BChEKO mouse To explore whether the presence of BChE modulates Ab deposition, a new strain of mouse was produced by breeding 5XFAD mice with a BChE-KO strain to generate the 5XFAD/BChE-KO strain. Comparison of the PCR products for APP, PSEN1 and BChE genotypes for various strains used in this study is shown in Fig. 4. This indicates the absence of BChE gene in the newly generated 5XFAD/BChE-KO mouse. The 5XFAD/BChE-KO mice are viable, fertile, eat appropriately, do not exhibit any overt phenotypic differences compared to the 5XFAD strain and do not produce BChE. Comparative cholinesterase staining in 5XFAD and 5XFAD/BChE-KO brains (Fig. 5) confirmed BChE plaque staining in the cerebral cortex of the 5XFAD mouse but no BChE staining in any brain structures of the 5XFAD/BChE-KO strain. No differences in AChE staining were observed in the two strains. Comparison of immunostained Ab and fibrillar Ab plaque accumulation in 5XFAD/BChE-KO Mice The 5XFAD/BChE-KO mice, like the 5XFAD strain (Fig. 3), were found to accumulate Ab plaques in the cerebral cortex, to show increased plaque immunostaining over time and to exhibit a greater burden of plaque pathology in females than males (Fig. 6). Compared to male mice, female 5XFAD/BChEKO mice had significantly more Ab plaque immunostaining at both 3 months (p = 0.028) and at 6 months (0.0095). The same was true for fibrillar Ab at 3 (p = 0.003) and 6 (p = 0.0095) months of age. Effect of lack of BChE on Ab plaque immunostaining In female mice, at 3 months, the 5XFAD/BChE-KO can be seen to have a lower immunostained Ab plaque burden relative to the 5XFAD mice (Fig. 7) but the difference
428
G. A. Reid, S. Darvesh / Neuroscience 298 (2015) 424–435
Fig. 1. Photomicrographs showing staining in a 6-month-old male 5XFAD mouse for Ab using immunohistochemistry (A), fibrillar Ab using thioflavin-S histofluorescence (B) and histochemical staining for butyrylcholinesterase (C) and acetylcholinesterase (D). Scale bar = 100 lm. Note BChE staining but not AChE staining of cortical plaques.
was not significant (Fig. 8). At 6 months, the Ab burden in females was the same in these two strains of mice. Overall, the absence of BChE did not have any significant effect on Ab plaques in female mice (Fig. 8). In male mice, on the other hand, the 5XFAD/BChE-KO mice appeared to have lower immunostained Ab plaques at 3 and 6 months, as illustrated in Figs. 7 and 8. This suggests that the absence of BChE has more effect in lowering Ab immunostaining in male mice than in females. Effect of lack of BChE on fibrillar Ab In female mice, at 3 and 6 months, the 5XFAD/BChE-KO can be seen to have lower fibrillar Ab compared to 5XFAD (Fig. 9), but the difference was not statistically significant (Fig. 10). On the other hand, in male 5XFAD/BChE-KO mice, there was significantly less fibrillar Ab accumulation at both 3 (p = 0.0247) and 6 (p = 0.0159) months of age compared to 5XFAD mice. In summary, comparison of the fibrillar Ab plaque burden in 5XFAD and 5XFAD/BChE-KO mice (Table 2) indicates that, in the absence of BChE, there is less pathology at the same time points, especially for male mice. The area covered by Th-S stained plaques in male 5XFAD/BChE-KO mice was 62% and 69% less than male 5XFAD mice at 3 and 6 months, respectively.
In female 5XFAD/BChE KO mice, compared to 5XFAD mice, the Th-S plaque load in the cerebral cortex was observed (Table 2) to be diminished by 17% and 22% at 3 and 6 months, respectively.
DISCUSSION Butyrylcholinesterase (BChE) is an enzyme that becomes associated with Ab plaques that are characteristic of AD (Mesulam and Geula, 1994) and in mouse models of AD such as the 2XFAD mouse (Darvesh et al., 2012) and the 5XFAD strain used in this study (Figs. 1–3). The reason for the interaction between Ab and BChE is uncertain but it is known that the presence of BChE in Ab plaques alters the catalytic activity of this enzyme, producing altered pH optimum and sensitivity to cholinesterase inhibitors (Geula and Mesulam, 1989). Conversely, it has been indicated that Ab is also affected in this interaction, being transformed from a ‘‘benign’’ form to a ‘‘malignant’’ fibrillar form (Guillozet et al., 1997). Development of the mouse model (5XFAD/BChE-KO) that does not produce BChE (Figs. 4–6), and comparison of the levels of pathology with the 5XFAD strain that does produce BChE (Figs. 7–10) has provided some insights into the effect BChE has on the accumulation of Ab pathology. Staining for Ab by immunohistochemistry provides a measure of Ab plaque burden in the cerebral cortex.
G. A. Reid, S. Darvesh / Neuroscience 298 (2015) 424–435
429
Fig. 2. Photomicrographs exemplifying plaque staining for Ab, fibrillar Ab (Th-S) and butyrylcholinesterase (BChE) enzyme activity in female and male 5XFAD mice at 3 and 6 months of age. Note the similarity in distribution and plaque burden stained for BChE and fibrillar Ab (Th-S). Scale bar = 250 lm.
Fig. 3. Bar graphs of the percentage of cerebral cortex area covered with plaques in 5XFAD mice at 3 and 6 months of age stained for butyrylcholinesterase (BChE) enzyme activity, fibrillar Ab (Th-S) and Ab immunostaining presented as mean ± SEM.
Staining with Th-S shows that a much smaller proportion (20–25%) of these Ab plaques are fibrillar. BChE also stains a similarly small proportion of the Ab plaque load (Fig. 3) suggesting that BChE also stains a selective pool of AD plaques. It has been shown that BChE is associated with fibrillar Ab in human AD (Guillozet et al., 1997) implying that BChE in the 5XFAD cerebral cortex may also be associated with fibrillar Ab.
In the 5XFAD/BChE-KO mice, there is a significant reduction (nearly 70% in males and 20% in females) of fibrillar Ab (Fig. 10, Table 2). This decrease in fibrillar Ab in 5XFAD/BChE-KO mice supports the previous suggestion (Guillozet et al., 1997) that BChE may be involved in the development of fibrillar Ab. It is evident in both 5XFAD and 5XFAD/BChE-KO strains examined here that females accumulate more
430
G. A. Reid, S. Darvesh / Neuroscience 298 (2015) 424–435
Fig. 4. Photograph of an agarose gel of the PCR gene products for APP, PSEN1 and BChE from: (A) 5XFAD; (B) 5XFAD/BChE-het; (C) 5XFAD/ BChE-KO; (D) BChE-WT; (E) BChE-KO. Note, in the 5XFAD/BChE-het mouse, upper band represents PCR product of BChE gene, lower band is that for the neomycin reporter gene that replaced the BChE gene. In 5XFAD/BCHE-KO strain, upper (BChE) band is absent.
Fig. 5. Staining for butyrylcholinesterase (BChE) and acetylcholinesterase (AChE) enzyme activity in 6-month male 5XFAD and 5XFAD/BChE-KO mice. The 5XFAD mouse has BChE associated with Ab plaques. There is no BChE staining in the 5XFAD/BChE-KO mouse. There is no AChE staining of plaques in the cerebral cortex of either strain. Scale bar = 0.5 mm.
Fig. 6. Bar graphs of the percentage of cerebral cortex area in 5XFAD/BChE-KO mice covered with plaque stained for fibrillar Ab (Th-S) and Ab immunostaining presented as mean ± SEM.
G. A. Reid, S. Darvesh / Neuroscience 298 (2015) 424–435
431
Fig. 7. Photomicrographs showing Ab immunostaining in female and male 5XFAD and 5XFAD/BChE-KO mice at 3 and 6 months of age. Scale bar = 200 lm.
Fig. 8. Bar graphs indicate percentage of the cerebral cortex area covered with Ab immunostaining presented as mean ± SEM. A two-tailed Mann–Whitney non-parametric statistical test was applied to determine the difference between means in the areas covered by Ab pathology in 5XFAD and 5XFAD/BChE-KO mice.
Ab plaque pathology than males (Figs. 2, 3 and 6–10), as shown in mouse models of AD (Oakley et al., 2006; Hirata-Fukae et al., 2008; Carroll et al., 2010) and in human studies (Henderson and Buckwalter, 1994; Corder et al., 2004; Barnes et al., 2005; Sinforiani et al., 2010; Vest and Pike, 2013; Li and Singh, 2014; Mielke et al., 2014). Some studies have reported more women than men have AD (Seshadri et al., 1997; Plassman et al., 2007; Irvine et al., 2012; Mielke et al., 2014), but this difference has often been attributed to the fact that women live longer than men (Alzheimer’s Association, 2014). However, an analysis of eight population-based studies, with 2 years of observation, indicated that in five of these studies there was a greater risk of AD in females, while in three of the studies no difference was observed (Barnes et al., 2005). On the other hand, a number of studies have demonstrated higher plaque pathology that is attendant with a greater cognitive decline in women
(Henderson and Buckwalter, 1994; Corder et al., 2004; Barnes et al., 2005; Sinforiani et al., 2010; Vest and Pike, 2013; Li and Singh, 2014; Mielke et al., 2014). These observations have been recapitulated in a number of animal models of AD that have demonstrated greater behavioral deficits and AD pathology in females (Oakley et al., 2006; Hirata-Fukae et al., 2008; Carroll et al., 2010). In addition, higher BChE levels have been observed in females than in males (Mundell, 1944; Illsley and Lamartiniere, 1981; Edwards and Brimijoin, 1983; Alves-Amaral et al., 2010). Furthermore, BChE levels in rat serum were observed to be three times higher in females than males, and that gonadectomy in both sexes abolished this difference. Androgen and estrogen replacement of gonadectomised animals reversed this effect, extending previous work that androgens and estrogens modulate synthesis of BChE (Illsley and Lamartiniere, 1981). Since sex hormones appear to
432
G. A. Reid, S. Darvesh / Neuroscience 298 (2015) 424–435
Fig. 9. Photomicrographs exemplifying thioflavin-S staining in female and male 5XFAD and 5XFAD/BChE-KO mice. Scale bar = 200 lm.
Fig. 10. Bar graphs indicate percentage of the cerebral cortex area covered with fibrillar Ab pathology presented as mean ± SEM. A two-tailed Mann–Whitney non-parametric statistical test was applied to determine the difference between means in the areas covered by Ab pathology in 5XFAD and 5XFAD/BChE-KO mice. *p < 0.05.
Table 2. Percent area of the cerebral cortex covered with Ab plaques visualized using immunohistochemistry and fibrillar Ab visualized with thioflavin-S, presented as mean ± SEM 3 Months
6 Months
Immunostained Ab
Fibrillar Ab
Immunostained Ab
Fibrillar Ab
5XFAD 5XFAD/BChE-KO
Female mice 5.32 ± 2.01 3.72 ± 2.26
1.11 ± 0.35 0.92 ± 0.41
16.85 ± 3.11 16.97 ± 2.98
4.88 ± 1.19 3.79 ± 0.53
5XFAD 5XFAD/BChE-KO
Male mice 3.08 ± 2.25 1.26 ± 0.77
0.6 ± 0.29 0.23 ± 0.17
10.01 ± 3.53 5.44 ± 2.14
2.76 ± 0.66 0.85 ± 0.27
modulate both Ab deposition and BChE levels, the question that arises is how these three factors interact in AD pathogenesis. Since the seminal work of Baulieu and Robel (1990), it is established that the brain synthesizes its own sex
steroid hormones (neurosteroids). All the enzymes for the synthesis of neurosteriods are found in certain populations of neurons and glia (Hojo et al., 2004). There is growing evidence that brain estrogens modulate brain development and behavior (Stanic´ et al., 2014), help
G. A. Reid, S. Darvesh / Neuroscience 298 (2015) 424–435
regulate cholinergic, serotonergic and dopaminergic transmitter subtypes (Do Rego et al., 2009; Gibbs, 2010), protect against age-related atrophy of the hippocampus (Eberling et al., 2003) and enhance outgrowth and survival of neurons in culture (Brinton et al., 1997). Testosterone and progesterone have also been shown to stimulate neurite growth, protect against neuronal death and enhance memory (Malsbury and McKay, 1994; Carroll et al., 2007; Rosario et al., 2010). Testosterone has also been shown to promote non-amyloidogenic processing of amyloid precursor protein (Gouras et al., 2000). Earlier investigations (Xing et al., 2013) have shown that estrogen influences BCHE gene expression and function while other work (Gibbs, 1994) indicated a gene–gene interaction between BCHE gene and estrogen-associated genes. For example, it has been shown that certain genetic polymorphisms in the P450C19 aromatase gene and in the estrogen receptor-a gene increase the risk of AD (Comborros et al., 2005, 2007). However, in women with BChE-K polymorphism, where there is 30% less BChE (Bartels et al., 1992), the increased risk of AD due to P450C19 aromatase or estrogen receptor-a genetic polymorphisms is overcome, suggesting that lower BChE levels are protective. Also, a recent genome-wide association study, using 18F florbetapir Ab PET imaging in 555 patients in the Alzheimer Disease Neuroimaging Initiative study has demonstrated that the BChE gene is one of the few genes identified, along with that for ApoE, that is associated with AD (Ramanan et al., 2014). This study found the largest known effect of the BChE gene on AD-related phenotype and concluded that BChE-associated AD neuropathology, and genetic variation at the BCHE locus associated with Ab burden, may provide a means for BChE-modulating agents to alter disease progression (Ramanan et al., 2014).
CONCLUSION BChE is consistently associated with AD pathology including in the 5XFAD mouse model. Diminished fibrillar Ab plaque deposition in the absence of BChE, particularly in males, suggests that this enzyme promotes Ab plaque pathology. Further comparative studies with 5XFAD and 5XFAD/BChE-KO, in both males and females, should help elucidate a mechanism for BChE-related promotion of fibrillar Ab plaques and provide a model for directly testing potential diseasemodifying therapeutics for AD. Acknowledgments—This work was supported in part by Canadian Institutes of Health Research (MOP-119343), Dalhousie Medical Research Foundation, Brain Repair Centre and Capital District Health Authority Research Fund. We would like to thank Professor Earl Martin and Drew Debay for critically reviewing this manuscript.
REFERENCES Alves-Amaral G, Pires-Oliveira M, Andrade-Lopes A, Chiavegatti T, Godinho RO (2010) Gender-related differences in circadian
433
rhythm of rat plasma acetyl- and butyrylcholinesterase: Effects of sex hormone withdrawal. Chem Biol Interact 186:9–15. Alzheimer’s Association (2014) Alzheimer’s disease facts and figures. Alzheimer’s Dement 10(2):e47–92. Atack JR, Perry EK, Bonham JR, Candy JM, Perry RH (1987) Molecular forms of butyrylcholinesterase in the human neocortex during development and degeneration of the cortical cholinergic system. J Neurochem 48:1687–1692. Barnes LL, Wilson RS, Bienias JL, Schneider JA, Evans DA, Bennett DA (2005) Sex differences in the clinical manifestations of Alzheimer disease pathology. Arch Gen Psychiatry 62(6):685–691. Bartels CF, Jensen FS, Lockridge O, van der Spek AFL, Rubinstein HM, Lubrano T, La Du BN (1992) DNA Mutation Associated with the Human Butyrylcholinesterase K-Variant and Its Linkage to the Atypical Variant Mutation and Other Polymorphic Sites. Am J Hum Genet 50:1086–1103. Baulieu EE, Robel P (1990) Neurosteroids: a new brain function? J Steroid Biochem Mol Biol 37(3):395–403. Blennow K, de Leon MJ, Zetterberg H (2006) Alzheimer’s disease. Lancet 368:387–403. Brinton RD, Tran J, Proffitt P, Montoya M (1997) 17 beta-Estradiol enhances the outgrowth and survival of neocortical neurons in culture. Neurochem Res 22(11):1339–1351. Carroll JC, Rosario ER, Kreimer S, Villamagna A, Gentzschein E, Stanczyk FZ, Pike CJ (2010) Sex differences in b-amyloid accumulation in 3xTg-AD mice: role of neonatal sex steroid hormone exposure. Brain Res 1366:233–245. Carroll JC, Rosario ER, Chang L, Stanczyk FZ, Oddo S, LaFerla FM, Pike CJ (2007) Progesterone and estrogen regulate Alzheimerlike neuropathology in female 3xTg-AD mice. J Neurosci 27(48):13357–13365. Combarros O, Riancho JA, Arozamena J, Mateo I, Llorca J, Infante J, Sa´nchez-Juan P, Zarrabeitia MT, Berciano J (2007) Interaction between estrogen receptor-alpha and butyrylcholinesterase genes modulates Alzheimer’s disease risk. J Neurol 254(9):1290–1292. Combarros O, Riancho JA, Infante J, San˜udo C, Llorca J, Zarrabeitia MT, Berciano J (2005) Interaction between CYP19 aromatase and butyrylcholinesterase genes increases Alzheimer’s disease risk. Dement Geriatr Cogn Disord 20(2–3):153–157. Corder EH, Ghebremedhin E, Taylor MG, Thal DR, Ohm TG, Braak H (2004) The biphasic relationship between regional brain senile plaque and neurofibrillary tangle distributions: modification by age, sex, and APOE polymorphism. Ann N Y Acad Sci 1019:24–28. Darvesh S, Geula G, Hopkins DA (2003) Neurobiology of butyrylcholinesterase. Nat Rev Neurosci 4:131–138. Darvesh S, Reid GA, Martin E (2010) Biochemical and histochemical comparison of cholinesterases in normal and Alzheimer brain tissues. Curr Alzheimer Res 7:386–400. Darvesh S, Cash MK, Reid GA, Martin E, Mitniski A, Geula C (2012) Butyrylcholinesterase, b-amyloid and Thioflavin-S Plaques in the Transgenic APPSWE/PSEN1dE9 mouse Model of Alzheimer’s Disease. J Neuropathol Exp Neurol 71(1):2–14. Diamant S, Podoly E, Friedler A, Ligumsky H, Livnah O, Soreq H (2006) Butyrylcholinesterase attenuates amyloid fibril formation in vitro. Proc Natl Acad Sci USA 103(23):8628–8633. Do Rego JL, Seong JY, Burel D, Leprince J, Luu-The V, Tsutsui K, Tonon MC, Pelletier G, Vaudry H (2009) Neurosteroid biosynthesis: enzymatic pathways and neuroendocrine regulation by neurotransmitters and neuropeptides. Front Neuroendocrinol 30(3):259–301. Duysen EG, Li B, Darvesh S, Lockridge O (2007) Sensitivity of butyrylcholinesterase knockout mice to (–)-huperzine A and donepezil suggests humans with butyrylcholinesterase deficiency may not tolerate these Alzheimer’s disease drugs and indicates butyrylcholinesterase function in neurotransmission. Toxicology 233(1–3):60–69. Eberling JL, Wu C, Haan MN, Mungas D, Buonocore M, Jagust WJ (2003) Preliminary evidence that estrogen protects against agerelated hippocampal atrophy. Neurobiol Aging 24(5):725–732.
434
G. A. Reid, S. Darvesh / Neuroscience 298 (2015) 424–435
Edwards JA, Brimijoin S (1983) Effects of hypophysectomy on acetylcholinesterase and butyrylcholinesterase in the rat. Biochem Pharmacol 32(7):1183–1189. Geula C, Mesulam MM (1995) Cholinesterases and the pathology of Alzheimer disease. Alzheimer Dis Assoc Disord 2:23–28. Geula C, Mesulam MM (1989) Special properties of cholinesterases in the cerebral cortex of Alzheimer’s disease. Brain Res 498:185–189. Giacobini E (2003) Butyrylcholinesterase: its function and inhibitors. Martin Dunitz: London and New York. Gibbs RB (1994) Estrogen and nerve growth factor-related systems in brain. Effects on basal forebrain cholinergic neurons and implications for learning and memory processes and aging. Ann N Y Acad Sci 743:156–196. Gibbs RB (2010) Estrogen therapy and cognition: a review of the cholinergic hypothesis. Endocr Rev 31(2):224–253. Gouras GK, Xu H, Gross RS, Greenfield JP, Hai B, Wang R, Greengard P (2000) Testosterone reduces neuronal secretion of Alzheimer’s beta-amyloid peptides. Proc Natl Acad Sci USA 97(3):1202–1205. Greig NH, Yu Q-S, Brossi A, Martin E, Lahiri DK Darvesh S (2008). Butyrylcholinesterase, the Cinderella cholinesterase, as a drug target for Alzheimer’s disease and related dementias. In: Medicinal chemistry of Alzheimer’s disease, (Gil AM ed.), pp. 79–109 Kerala, India: Transworld Research Network. Grubber JM, Saunders AM, Crane-Gatherum AR, Scott WK, Martin ER, Haynes CS, Conneally PM, Small GW, Roses AD, Haines JL, Pericak-Vance MA (1999) Analysis of association between Alzheimer disease and the K variant of butyrylcholinesterase (BCHE-K). Neurosci Lett 269:115–119. Guillozet AL, Smiley JF, Mash DC, Mesulam MM (1997) Butyrylcholinesterase in the life cycle of amyloid plaques. Ann Neurol 42:909–918. Henderson VW, Buckwalter JG (1994) Cognitive deficits of men and women with Alzheimer’s disease. Neurology 44:90–96. Hiltunen M, Mannermaa A, Helisalmi S, Koivisto A, Lehtovirta M, Ryyna¨nen M, Riekkinen PS, Soininen H (1998) Butyrylcholinesterase K variant and apolipoprotein E4 genes do not act in synergy in Finnish late-onset Alzheimer’s disease patients. Neurosci Lett 250(1):69–71. Hirata-Fukae C, Li HF, Hoe HS, Gray AJ, Minami SS, Hamada K, Niikura T, Hua F, Tsukagoshi-Nagai H, Horikoshi-Sakuraba Y, Mughal M, Rebeck GW, LaFerla FM, Mattson MP, Iwata N, Saido TC, Klein WL, Duff KE, Aisen PS, Matsuoka Y (2008) Females exhibit more extensive amyloid, but not tau, pathology in an Alzheimer transgenic model. Brain Res 1216:92–103. doi: 10.1016. Hojo Y, Hattori TA, Enami T, Furukawa A, Suzuki K, Ishii HT, Mukai H, Morrison JH, Janssen WG, Kominami S, Harada N, Kimoto T, Kawato S (2004) Adult male rat hippocampus synthesizes estradiol from pregnenolone by cytochromes P45017alpha and P450 aromatase localized in neurons. Proc Natl Acad Sci USA 101(3):865–870. Illsley NP, Lamartiniere CA (1981) Endocrine regulation of rat serum cholinesterase activity. Endocrinology 108(5):1737–1743. Irvine K, Laws KR, Gale TM, Kondel TK (2012) Greater cognitive deterioration in women than men with Alzheimer’s disease: a meta analysis. J Clin Exp Neuropsychol 34(9):989–998. Karnovsky MJ, Roots LA (1964) ‘‘Direct-coloring’’ thiocholine method for cholinesterases. J Histochem Cytochem 12:219–221. Kehoe PG, Williams H, Holmans P, Wilcock G, Cairns NJ, Neal J, Owen MJ (1998) The butyrylcholinesterase K variant and susceptibility to Alzheimer’s disease. J Med Genet 35:1034–1035. Ki C-S, Na DL, Kim J-W, Kim HJ, Kim DK, Yoon B-K (1999) No association between the genes for butyrylcholinesterase K variant and apolipoprotein E4 in late-onset Alzheimer’s disease. Am J Med Genet 88:113–115. Lehmann DJ, Nagy Z, Litchfield S, Borja C, Smith AD (2000) Association of butyrylcholinesterase K variant with cholinesterase-positive neuritic plaques in the temporal cortex in late-onset Alzheimer’s disease. Hum Genet 106:447–452.
Lehmann DJ, Williams J, Mcbroomc J, Smith AD (2001) Using metaanalysis to explain the diversity of results in genetic studies of late-onset Alzheimer’s disease and to identify high-risk subgroups. Neuroscience 108:541–554. Li B, Duysen EG, Saunders TL, Lockridge O (2006) Production of the butyrylcholinesterase knockout mouse. J Mol Neurosci 30(1– 2):193–195. Li B, Duysen EG, Carlson M, Lockridge O (2008) The butyrylcholinesterase knockout mouse as a model for human butyrylcholinesterase deficiency. J Pharmacol Exp Ther 324(3):1146–1154. Li R, Singh M (2014) Sex differences in cognitive impairment and Alzheimer’s disease. Front Neuroendocrinol 35(3):385–403. Lorenzen A, Samosh J, Vandewark K, Anborgh PH, Seah C, Magalhaes AC, Cregan SP, Ferguson SS, Pasternak SH (2010) Rapid and direct transport of cell surface APP to the lysosome defines a novel selective pathway. Mol Brain 3:11. Malsbury CW, McKay K (1994) Neurotrophic effects of testosterone on the medial nucleus of the amygdala in adult male rats. J Neuroendocrinol 6(1):57–69. Masters CL, Selkoe DJ (2012) Biochemistry of amyloid b-protein and amyloid deposits in Alzheimer disease. Cold Spring Harb Perspect Med. http://dx.doi.org/10.1101/cshperspect.a006262. McIlroy SP, Crawford VLS, Dynan KB, McGleenon BM, Vahidassr MD, Lawson JT, Passmore AP (2000) Butyrylcholinesterase K variant is genetically associated with late-onset Alzheimer’s disease in Northern Ireland. J Med Genet 37:182–185. Mesulam MM, Guillozet A, Shaw P, Quinn B (2002) Widely spread butyrylcholinesterase can hydrolyze acetylcholine in the normal and Alzheimer brain. Neurobiol Dis 9(1):88–93. Mesulam MM, Geula C (1994) Butyrylcholinesterase reactivity differentiates the amyloid plaques of aging from those of dementia. Ann Neurol 36:722–727. Mielke MM, Vemuri P, Rocca WA (2014) Clinical epidemiology of Alzheimer’s disease: assessing sex and gender differences. Clin Epidemiol 6:37–48. Mundell DB (1944) Plasma cholinesterase in male and female rats. Nature 3888(153):557–558. O’Brien KK, Saxby BK, Ballard CG, et al. (2003) Regulation of attention and response to therapy in dementia by butyrylcholinesterase. Pharmacogenetics 13:231–239. Oakley H, Cole SL, Logan S, Maus E, Shao P, Craft J, GuillozetBongaarts A, Ohno M, Disterhoft J, Van Eldik L, Berry R, Vassar R (2006) Intraneuronal beta-amyloid aggregates, neurodegeneration, and neuron loss in transgenic mice with five familial Alzheimer’s disease mutations: potential factors in amyloid plaque formation. J Neurosci 26:10129–10140. Perry EK, Perry RH, Blessed G, Tomlinson BE (1978) Changes in brain cholinesterases in senile dementia of the Alzheimer type. Neuropathol Appl Neurobiol 4:273–277. Plassman BL, Langa KM, Fisher GG, Heeringa SG, Weir DR, Ofstedal MB, et al. (2007) Prevalence of dementia in the United States: the aging, demographics, and memory study. Neuroepidemiology 29:125–132. Querfurth HW, LaFerla FM (2010) Alzheimer’s disease. N Engl J Med 362(4):329–344. Ramanan VK, Risacher SL, Nho K, Kim S, Swaminathan S, Shen L, Foroud TM, Hakonarson H, Huentelman MJ, Aisen PS, Petersen RC, Green RC, Jack CR, Koeppe RA, Jagust WJ, Weiner MW, Saykin AJ, Alzheimer’s Disease Neuroimaging Initiative (2014) APOE and BCHE as modulators of cerebral amyloid deposition: a florbetapir PET genome-wide association study. Mol Psychiatry 19(3):351–357. http://dx.doi.org/10.1038/mp.2013.19. Rosario ER, Carroll J, Pike CJ (2010) Testosterone regulation of Alzheimer-like neuropathology in male 3xTg-AD mice involves both estrogen and androgen pathways. Brain Res 1359:281–290. Sandbrink R, Gasperina A, Zerfass R, Weber B, Masters CL, Beyreuther K, Heuser I (1998) Butyrylcholinesterase K variant (BCHE-K): association with late-onset Alzheimer’s disease. Neurobiol Aging 19:S69.
G. A. Reid, S. Darvesh / Neuroscience 298 (2015) 424–435 Seshadri S, Wolf PA, Beiser A, Au R, McNulty K, White R, D’Agostino RB (1997) Lifetime risk of dementia and Alzheimer’s disease. The impact of mortality on risk estimates in the Framingham study. Neurology 49(6):1498–1504. Sinforiani E, Citterio A, Zucchella C, Bono G, Corbetta S, Merlo P, Mauri M (2010) Impact of gender differences on the outcome of Alzheimer’s disease. Dement Geriatr Cogn Disord 30(2):147–154. Singleton AB, Smith G, Gibson AM, Woodward R, Perry RH, Ince PG, Edwardson JA, Morris CM (1998) No association between the K variant of the butyrylcholinesterase gene and pathologically confirmed Alzheimer’s disease. Hum Mol Genet 7:937–939. Stanic´ D, Dubois S, Chua HK, Tonge B, Rinehart N, Horne MK, Boon WC (2014) Characterization of aromatase expression in the adult male and female mouse brain. I. Coexistence with oestrogen receptors a and b, and androgen receptors. PLoS One 9(3):e90451. Tilley L, Morgan K, Grainger J, Marsters P, Morgan L, Lowe J, Xuereb J, Wischik C, Harrington C, Kalsheker N (1999) Evaluation of polymorphisms in the presenilin-1 gene and the
435
butyrylcholinesterase gene as risk factors in sporadic Alzheimer’s disease. Eur J Hum Genet 7:659–663. Truett GE, Heeger P, Mynatt RL, Truett AA, Walker JA, Warman ML (2000) Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). Biotechniques 29:52–54. Vest RS, Pike CJ (2013) Gender, sex steroid hormones, and Alzheimer’s disease. Horm Behav 63:301–307. Wiebusch H, Poirier J, Se´vigny P, Schappert K (1999) Further evidence for a synergistic association between APOEe4 and BCHE-K in confirmed Alzheimer’s disease. Hum Genet 104:158–163. Xing Y, Jia JP, Ji XJ, Tian T (2013) Estrogen associated gene polymorphisms and their interactions in the progress of Alzheimer’s disease. Prog Neurobiol 111:53–74. Yamamoto Y, Yasuda M, Mori E, Maeda K (1999) Failure to confirm a synergistic effect between the K-variant of the butyrylcholinesterase gene and the e4 allele of the apolipoprotein gene in Japanese patients with Alzheimer’s disease. J Neurol Neurosurg Psychiatry 67:94–96.
(Accepted 20 April 2015) (Available online 27 April 2015)
BUTYRYLCHOLINESTERASE-KNOCKOUT REDUCES BRAIN DEPOSITION OF FIBRILLAR b-AMYLOID IN AN ALZHEIMER MOUSE MODEL G. ANDREW REID a AND SULTAN DARVESH a,b*
2003; Greig et al., 2008), may also be involved in AD pathology. In AD, both BChE and acetylcholinesterase (AChE), but particularly BChE, become associated with Ab plaques, neurofibrillary tangles and cerebral amyloid angiopathy (Mesulam and Geula, 1994; Geula and Mesulam, 1995; Guillozet et al., 1997). In fact, while AChE levels in the AD brain are significantly reduced, BChE levels have been found to remain the same or increase (Perry et al., 1978; Atack et al., 1987; Darvesh et al., 2010). In addition, it has been found that BChE is primarily associated with the ‘‘malignant’’, fibrillar Ab plaques characteristic of AD but not the ‘‘benign’’, non-fibrillar plaques which are often found in individuals without dementia (Mesulam and Geula, 1994). This association has led some to suggest that BChE may be involved in Ab transformation from the ‘‘benign’’, non-fibrillar form to the ‘‘malignant’’ fibrillar form characteristic of AD (Guillozet et al., 1997) but a mechanism for this process has not been elucidated. In contrast, other in vitro studies have suggested that BChE may decrease Ab fibril formation (Diamant et al., 2006). Consequently, the role of BChE in plaque deposition remains unclear. A number of polymorphisms in the BCHE gene have been described, the most common being the BCHE-K variant (Bartels et al., 1992), where there is an A539T substitution that is found in approximately one-third of the human population and exhibits a 30% reduction in the molecular concentration of BChE (Bartels et al., 1992). Investigations of this BCHE variant have observed that its presence pre-empts progression of AD (Sandbrink et al., 1998; O’Brien et al., 2003). However, other studies have suggested that this variant is associated with AD (Tilley et al., 1999; Wiebusch et al., 1999; Lehmann et al., 2000; Lehmann et al., 2001; McIlroy et al., 2000) and still others have observed no association of BCHE-K variant with AD (Hiltunen et al., 1998; Kehoe et al., 1998; Singleton et al., 1998; Grubber et al., 1999; Ki et al., 1999; Yamamoto et al., 1999). This suggests that the role(s) of BChE in AD may involve other components of the disease and requires further scrutiny. This notion is supported by a recent genome-wide association study, using 18F florbetapir PET imaging data to assess in vivo Ab levels in the brains of 555 patients of the Alzheimer Disease Neuroimaging Initiative. This study has demonstrated the BCHE gene is one of few identified, along with that for ApoE, that is associated with AD (Ramanan et al., 2014). This observation represents the largest known effect of the BCHE gene on AD-related phenotype. The study concluded that BChE-
a
Department of Medical Neuroscience, Dalhousie University, Halifax, NS, Canada b
Department of Medicine (Neurology and Geriatric Medicine), Dalhousie University, Halifax, NS, Canada
Abstract—In Alzheimer’s disease (AD), numerous b-amyloid (Ab) plaques are associated with butyrylcholinesterase (BChE) activity, the significance of which is unclear. A mouse model, containing five human familial AD genes (5XFAD), also develops Ab plaques with BChE activity. Knock-out of BChE in this model showed diminished fibrillar Ab plaque deposition, more so in males than females. This suggests that lack of BChE reduces deposition of fibrillar Ab in AD and this effect may be influenced by sex. Ó 2015 The Authors. Published by Elsevier Ltd. on behalf of IBRO. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Key words: Alzheimer’s disease, b-amyloid, butyrylcholinesterase, 5XFAD mouse, butyrylcholinesterase-knockout, cholinergic system.
INTRODUCTION The ‘‘amyloid hypothesis’’ suggests that this abnormally folded b-amyloid (Ab) protein may be one of the important pathological contributors to neuronal loss in Alzheimer’s disease (AD) (Lorenzen et al., 2010; Masters and Selkoe, 2012). A number of factors contribute to Ab accumulation, including genetic mutations in the amyloid precursor protein and cofactors that are involved in its processing, such as presenilins (Blennow et al., 2006; Querfurth and LaFerla, 2010). In addition, butyrylcholinesterase (BChE), a serine hydrolase that has a number of functions in health and disease (Mesulam et al., 2002; Giacobini, 2003; Darvesh et al., *Correspondence to: S. Darvesh, Room 1308, Camp Hill Veterans’ Memorial, 5955 Veterans’ Memorial Lane, Halifax, Nova Scotia B3H 2E1, Canada. Tel: +1-902-473-2490; fax: +1-902-473-7133. E-mail address: [email protected] (S. Darvesh). Abbreviations: 5XFAD, B6SJL-Tg(APPSwFlLon,PSEN1⁄M146L⁄ L286V)6799Vas/Mmjax; 5XFAD/BChE-KO, 5XFAD/BChE-knockout; AChE, acetylcholinesterase; AD, Alzheimer’s disease; Ab, b-amyloid; BChE, butyrylcholinesterase; BChE-KO, B6.129S1-Bchetn1Loc/J knockout mouse; DAB, 3,30 -diaminobenzidine tetrahydrochloride); EDTA, ethylenediaminetetraacetic acid; FAD, Familial Alzheimer’s disease; PCR, polymerase chain reaction; Th-S, thioflavin-S.
http://dx.doi.org/10.1016/j.neuroscience.2015.04.039 0306-4522/Ó 2015 The Authors. Published by Elsevier Ltd. on behalf of IBRO. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). 424
G. A. Reid, S. Darvesh / Neuroscience 298 (2015) 424–435
associated AD neuropathology, and genetic variation at the BCHE locus associated with Ab burden, may provide a means for BChE-modulating agents to alter disease progression (Ramanan et al., 2014). Further studies of the interaction of BChE and Ab in an animal model may provide insights into AD pathogenesis. The B6SJL-Tg(APPSwFlLon,PSEN1*M146L*L286V) 6799Vas/Mmjax mouse overexpresses mutant human APP695 with Swedish (K670N/M671L), Florida (I716V) and London (V717I) Familial Alzheimer’s disease (FAD) mutations along with human presenilin-1 harboring two FAD mutations, M146L and L286V (Oakley et al., 2006). This 5XFAD mouse is a useful model for studying Ab plaques as it rapidly develops this pathology, characteristically similar to plaques in human AD brains (Oakley et al., 2006). Accumulation of Ab42 begins as early as 1.5 months of age in the 5XFAD mouse, increases with age and female mice show higher Ab42 levels than males (Oakley et al., 2006). The B6.129S1-Bchetn1Loc/J mutant mouse is a BChE-knockout (BChE-KO) model that does not produce any BChE enzyme (Li et al., 2006) and is a useful model for studying the functions of this enzyme (Duysen et al., 2007). In this strain, the targeting vector contains an 891-bp deletion of the BCHE gene, removing the splice junction between intron 1 and exon 2. This deletion includes the entire signal peptide of which the translation start site and the first 102 amino acids of the mature BChE protein are also removed (Li et al., 2006). Homozygous BChE-KO mice have a complete lack of BChE in all tissues and plasma with no apparent anomalies in physical appearance or cognition (Li et al., 2008). To address the unresolved role of BChE in Ab plaque accumulation, the 5XFAD mouse was cross-bred with a BChE-KO strain producing a new 5XFAD/BChE-KO strain, that accumulates Ab plaques but does not synthesize BChE. Since in human AD (Corder et al., 2004; Barnes et al., 2005; Vest and Pike, 2013; Li and Singh, 2014; Mielke et al., 2014) and in AD mouse models (Oakley et al., 2006; Hirata-Fukae et al., 2008; Carroll et al., 2010) females have higher Ab plaque burden, females and males were analyzed separately in the present study. Comparison of 5XFAD/BChE-KO with age-matched 5XFAD mice revealed diminished fibrillar Ab plaque burden, especially in males.
425
bedding and covered by a metal cage top and microisolator filter. Food (Purina rodent chow, #5001) and tap water were available ad libitum. Animals were kept in normal light/dark cycle. It has been noted that female hemizygous 5XFAD mice are not suitable mothers due to the detrimental effects caused by the accumulation of Ab. Consequently, for the generation of 5XFAD and 5XFAD/ BChE-KO offspring, female 5XFAD or 5XFAD/BChE-KO mice were not used for breeding. Hemizygous 5XFAD mice, used for breeding and subsequent experiments, were produced from pairs of WT female mice bred with 5XFAD male mice. Homozygous BChE-knockout (BChE-KO) mice were produced from BChE-het males and females. A three generation breeding scheme was used to produce the desired transgenic hemizygous 5XFAD strain that were homozygous BChE-knockout (5XFAD/BChE-KO). Hemizygous male 5XFAD mice were bred with pairs of BChE-KO females to produce 5XFAD/BChE-het mice. Male 5XFAD/BChE-het mice were bred with female BChE-KO mice to produce 5XFAD/BChE-KO mice. To maintain the strain and produce mice for subsequent experiments 5XFAD/ BChE-KO males were bred with BChE-KO females. The number of animals used for these experiments were as follows; 5XFAD (3-month-old males n = 7, 6-month-old males n = 5, 3-month-old females n = 9, 6-month-old females n = 6) and 5XFAD/BChE-KO (3-month-old males n = 10, 6-month-old males n = 4, 3-month-old females n = 6, 6-month-old females n = 6). Genotyping An ear punch was used to identify mice and collect a skin sample for genotyping. For DNA isolation, 80 ll of 0.025 M sodium hydroxide and 0.2 mM EDTA disodium dihydrate was added to skin samples and was incubated at 98 °C for 1 h with periodic vortexing to digest tissue. Following tissue digestion, 80 ll of a neutralization solution containing 40 mM Tris HCl at pH 5.5 was added, vortexed and centrifuged at 4000 rpm for 3 min (Truett et al., 2000). The supernatant was removed and saved for polymerase chain reaction (PCR). Each mouse was genotyped for APP, PSEN1 and BCHE genes. To each PCR tube was added 2.5 ll PCR buffer (0.2 M Tris–HCl and 0.5 M KCl pH 8.4),
EXPERIMENTAL PROCEDURES Animals Formal approval to conduct these experiments was obtained from the Dalhousie University Committee on Laboratory Animals. Female wild-type (WT; C57BL/ 6J SJL/J F1; The Jackson Laboratories, Stock # 100012), male transgenic hemizygous 5XFAD (B6SJLTg(APPSwFlLon,PSEN1*M146L*L286V)6799Vas/Mmjax; Mutant Mouse Regional Resource Center, 034840-JAX) and heterozygous butyrylcholinesterase (B6.129S1Bchetm1Loc/J; The Jackson Laboratories, Stock # 008087), referred to here as BChE-het mice, were purchased. Mice were housed in same-sex groups of 1– 5, within polyethylene cages, containing a wood-chip
Table 1. Primers used for mouse genotyping (Jackson laboratories) BCHE mutant (oIMR7415) BCHE common (oIMR8093) BCHE wild-type (oIMR8094) APP forward APP reverse PSEN1 forward (oIMR1644) PSEN1 reverse (oIMR1645)
GCCAGAGGCCACTTGTGTAG CATGGAAAAGAGGAGGATGG TTCCACTTGGAAGAGAAACACA ACAGAATTCGCCCCGGCCTGGTAC TAAGCTTGGCACGGCTGTCCAAGGA AATAGAGAACGGCAGGAGCA GCCATGAGGGCACTAATCAT
426
G. A. Reid, S. Darvesh / Neuroscience 298 (2015) 424–435
0.5 ll 10 mM dNTP mixture (Invitrogen; 10297–018), 0.75 ll MgCl2, 0.625 ll primers (see Table 1 for primer sequences purchased from Sigma–Aldrich, St. Louis, MO, USA), 5 ll DNA isolate, 0.1 ll Taq (Invitrogen; 10342–020) and 14.9 ll ultrapure dH2O. PCR samples were amplified on a BIORAD C1000 Touchä thermal cycler. For BCHE the following protocol was used: 94 °C 2 min, 34 times (94 °C for 30 s, 59 °C for 30 s, 72 °C for 1 min), 4 °C for 5 min. For APP and PSEN1, 94 °C 2 min, 34 times (94 °C for 30 s, 65 °C for 30 s, 72 °C for 1 min), 4 °C for 5 min. PCR products were run on a 2% agarose gel made with TAE buffer, containing 0.04 M Tris–acetate and 0.001 M EDTA, with SYBRÓ safe DNA gel stain (Invitrogen; S33102, 1:10,000). Gels were run for 30 min and visualized on a Typhoon 9410 Molecular Imager (GE Healthcare). Brain preparation Mice were euthanized by a lethal intraperitoneal sodium pentobarbital injection, perfused transcardially with saline (25 mL, 0.9% NaCl, 0.1% NaNO3) and 50 mL of 4% formaldehyde in 0.1 M phosphate buffer (PB, pH 7.4), the brains removed and post-fixed for 1.5 h. Brains were then immersed in 30% sucrose in PB with 0.05% sodium azide and stored at 4 °C until used. Brains were frozen with dry ice and cut into 40 lm serial coronal sections on a Leica SM2000R microtome with Physitemp freezing stage and BFS-30TC controller. Sections were stored at 4 °C in PB with 0.08% sodium azide until used for analysis of BChE and AChE activity with histochemistry, fibrillar Ab with thioflavin-S (Th-S) histofluorescence and Ab using immunohistochemistry. Cholinesterase histochemistry Cholinesterase staining was performed using a modified (Darvesh et al., 2012) Karnovsky-Roots method (Karnovsky and Roots, 1964). All reagents were purchased from Sigma–Aldrich (St. Louis, MO, USA). The substrate used for visualization of BChE activity was butyrylthiocholine, where AChE activity was inhibited by BW 284 C 51 (1,5-bis [4-allyl dimethylammonium phenyl] pentan-3-one dibromide) at a final concentration of 0.01 mM. Briefly, tissue sections were rinsed in 0.1 M of maleate buffer (pH 7.4) for 30 min; they were then incubated for 2 h in 0.1 M maleate buffer (pH 6.8) containing 0.5 mM sodium citrate, 0.47 mM cupric sulfate, 0.05 mM potassium ferricyanide, 0.8 mM butyrylthiocholine iodide and 0.01 mM BW 284 C 51. All sections were then rinsed with gentle agitation for 30 min in dH2O and placed in 0.1% cobalt chloride in water for 10 min. After further rinsing in dH2O, sections were placed in PB containing 1.39 mM 3,30 -diaminobenzidine tetrahydrochloride (DAB). After 5 min in the DAB solution, 50 ll of 0.15% H2O2 in dH2O was added per ml of DAB solution, and the reaction was carried out for approximately 3 min. Sections were then washed in 0.01 M acetate buffer (pH 3.3), mounted on slides, coverslipped, and examined with brightfield microscopy. For AChE staining, the sections were incubated in 4% formaldehyde for approximately 10 h. The remaining
procedure was as described above for BChE except the substrate was acetylthiocholine iodide at a concentration of 0.4 mM and BuChE activity was inhibited with 0.06 mM ethopropazine. The sections were incubated with the substrate for approximately 1 h. Control experiments for cholinesterase histochemistry were as described previously (Darvesh et al., 2012). Ab immunohistochemistry Ab plaque load, comprising both non-fibrillar and fibrillar, was visualized using immunohistochemistry for the Ab protein. Briefly, sections were rinsed for 30 min in PB pH 7.4, for 16 h in 4% formaldehyde, 30 min in PB pH 7.4, 5 min in 0.05 M PB, followed by distilled water (dH2O), and then gently shaken in 90% formic acid for 2 min for antigen retrieval. Sections were rinsed 5 times in dH2O for 1 min each and 2 times in PB for 15 min. Sections were then placed in 0.3% H2O2 in PB for 30 min to quench endogenous peroxidase activity and rinsed again for 30 min in PB. Sections were then incubated in PB containing 0.1% Triton X-100, normal goat serum (1:100), and a polyclonal rabbit anti-Ab antibody (1:400; 71–5800, Invitrogen, Camarillo, CA, USA), specific for the 4- to 5-kDa amyloid peptide, for approximately 16 h at room temperature. After rinsing in PB, sections were incubated in PB with 0.1% Triton X100, biotinylated goat anti-rabbit secondary antibody (1:500), and normal goat serum (1:1000) for 1 h. After another rinse in PB, sections were placed in PB with 0.1% Triton X-100 and Vectastain Elite ABC kit (1:182; PK-6100, Vector Laboratories, Burlingame, CA, USA), according to the manufacturer’s specifications, for 1 h. Sections were rinsed and developed in a solution of PB containing 1.39 mM DAB. After 5 min, 50 ll of 0.3% H2O2 in dH2O was added per mL of DAB solution, and the sections were incubated for 5 min. The reaction was stopped by rinsing the sections in 0.01 M acetate buffer (pH 3.3). Sections were mounted onto glass slides, airdried, and coverslipped. In control experiments, no staining was observed when Ab immunohistochemistry was done on brain tissue from wild-type mice. Th-S histochemistry Sections were rinsed in 0.05 M Tris-buffered saline pH 7.6 for 30 min, mounted onto glass slides, air-dried overnight, rehydrated in dH2O, dehydrated in a series of ethanol washes, cleared in xylene and rinsed in 50% ethanol. Sections were then incubated overnight in a solution of 0.05% Th-S (Sigma–Aldrich, St. Louis, MO, USA) in 50% ethanol, rinsed in 80% aqueous ethanol and dH2O and coverslipped with an aqueous mounting medium. Data analysis The stained mouse brain sections were analyzed and photographed using a Zeiss Axioplan 2 motorized microscope with a Zeiss Axiocam HRc digital camera using AxioVision 4.6 software (Carl Zeiss Canada Ltd., Toronto, Ontario, Canada). The photographs were assembled using Adobe Photoshop (CS 5 version 12.0).
G. A. Reid, S. Darvesh / Neuroscience 298 (2015) 424–435
The brightness of images was adjusted to match the background from different images. Each mouse was encoded with a random number to remove potential bias while measuring plaque load. Plaque loads were quantified using National Institutes of Health ImageJ 1.49d software and recorded as a percentage of the total area, as described elsewhere (Darvesh et al., 2012). Briefly, gray-scale images of sections stained for BChE activity, Ab and Th-S were taken throughout the brain. An intensity threshold level was set such that stained plaques, but not background, was selected. The cortex was outlined with the polygon selection tool and measured for the percent area covered by plaque staining. On average, eight Ab sections, twelve Th-S-stained sections and four BChE-stained sections were quantified per brain. For each mouse, data from each section were summed to give a cortical area and the total plaque area measured. This was used to determine the percent plaque load for each mouse. Within each strain, sex and age group, the percent area covered by plaque pathology was averaged. A two-tailed Mann–Whitney non-parametric statistical test was applied to determine the difference between means in the areas covered by Ab pathology in 5XFAD and 5XFAD/BChEKO mice using Graphpad Prism (version 5.1 Windows). Male and female mice were analyzed separately. Results were considered significant when the p-value was less than the 5% critical level (p < 0.05).
RESULTS This work was undertaken to examine the effect of BChE on the accumulation of Ab plaques in the brain. The 5XFAD mouse model was chosen for this study since it rapidly accumulates Ab pathology, beginning before 2 months of age (Oakley et al., 2006). The 5XFAD mouse, which normally produces BChE, was crossed with a BChE-knockout strain (BChE-KO) to generate a new strain (5XFAD/BChE-KO) that still accumulates Ab plaques but cannot synthesize BChE. To explore the effect of BChE on Ab accumulation over time, brain tissues from 5XFAD and 5XFAD/BChE-KO mice at 3 and 6 months of age were stained and analyzed for Ab, fibrillar Ab and BChE activity associated with plaques. Female and male mice were analyzed separately for pathology because it had been observed earlier in human AD (Corder et al., 2004; Barnes et al., 2005; Vest and Pike, 2013; Li and Singh, 2014; Mielke et al., 2014) and in the 5XFAD mouse model (Oakley et al., 2006) that females have higher plaque burden. Comparison of 5XFAD with 5XFAD/BChEKO mice should provide insights into possible role(s) of BChE in Ab accumulation. Comparison of immunostained Ab, fibrillar Ab and BChE plaque accumulation in 5XFAD mice As has been shown previously (Oakley et al., 2006), the 5XFAD mouse accumulates Ab plaques (Fig. 1A, B). In addition, as seen in human AD (Mesulam and Geula, 1994; Geula and Mesulam, 1995; Guillozet et al., 1997) and the 2XFAD mouse model (Darvesh et al., 2012), BChE activity was associated with many of these plaques
427
(Fig. 1C). There was no AChE activity visualized with cortical Ab plaques in the 5XFAD mice (Fig. 1D). The plaque pathology for female and male 5XFAD mice at 3 and 6 months of age was visualized as illustrated in Fig. 2. The plaque burden was quantified, expressed as a percentage of cerebral cortical area covered by pathology and averaged for each sex and age group (Fig. 3). The immunostained Ab, fibrillar Ab and BChE-associated plaque loads for female and male mice were shown to accumulate early, by 3 months of age, and increased with age. The area of the cerebral cortex covered by plaques stained with Th-S or BChE histochemistry was less than that by Ab immunostaining (Fig. 3). Female mice showed increased Ab plaque burden compared to males, which was a trend at 3 months and significantly higher at 6 months (p = 0.0173). In addition, the fibrillar Ab plaque burden was significantly higher in females relative to males at both 3 months (p = 0.0229) and 6 months (p = 0.0043). Similarly, females had higher BChE-associated plaque burden compared to males (p = 0.0164) at 3 months, a trend which continued at 6 months (p = 0.0519). Generation and characterization of the 5XFAD/BChEKO mouse To explore whether the presence of BChE modulates Ab deposition, a new strain of mouse was produced by breeding 5XFAD mice with a BChE-KO strain to generate the 5XFAD/BChE-KO strain. Comparison of the PCR products for APP, PSEN1 and BChE genotypes for various strains used in this study is shown in Fig. 4. This indicates the absence of BChE gene in the newly generated 5XFAD/BChE-KO mouse. The 5XFAD/BChE-KO mice are viable, fertile, eat appropriately, do not exhibit any overt phenotypic differences compared to the 5XFAD strain and do not produce BChE. Comparative cholinesterase staining in 5XFAD and 5XFAD/BChE-KO brains (Fig. 5) confirmed BChE plaque staining in the cerebral cortex of the 5XFAD mouse but no BChE staining in any brain structures of the 5XFAD/BChE-KO strain. No differences in AChE staining were observed in the two strains. Comparison of immunostained Ab and fibrillar Ab plaque accumulation in 5XFAD/BChE-KO Mice The 5XFAD/BChE-KO mice, like the 5XFAD strain (Fig. 3), were found to accumulate Ab plaques in the cerebral cortex, to show increased plaque immunostaining over time and to exhibit a greater burden of plaque pathology in females than males (Fig. 6). Compared to male mice, female 5XFAD/BChEKO mice had significantly more Ab plaque immunostaining at both 3 months (p = 0.028) and at 6 months (0.0095). The same was true for fibrillar Ab at 3 (p = 0.003) and 6 (p = 0.0095) months of age. Effect of lack of BChE on Ab plaque immunostaining In female mice, at 3 months, the 5XFAD/BChE-KO can be seen to have a lower immunostained Ab plaque burden relative to the 5XFAD mice (Fig. 7) but the difference
428
G. A. Reid, S. Darvesh / Neuroscience 298 (2015) 424–435
Fig. 1. Photomicrographs showing staining in a 6-month-old male 5XFAD mouse for Ab using immunohistochemistry (A), fibrillar Ab using thioflavin-S histofluorescence (B) and histochemical staining for butyrylcholinesterase (C) and acetylcholinesterase (D). Scale bar = 100 lm. Note BChE staining but not AChE staining of cortical plaques.
was not significant (Fig. 8). At 6 months, the Ab burden in females was the same in these two strains of mice. Overall, the absence of BChE did not have any significant effect on Ab plaques in female mice (Fig. 8). In male mice, on the other hand, the 5XFAD/BChE-KO mice appeared to have lower immunostained Ab plaques at 3 and 6 months, as illustrated in Figs. 7 and 8. This suggests that the absence of BChE has more effect in lowering Ab immunostaining in male mice than in females. Effect of lack of BChE on fibrillar Ab In female mice, at 3 and 6 months, the 5XFAD/BChE-KO can be seen to have lower fibrillar Ab compared to 5XFAD (Fig. 9), but the difference was not statistically significant (Fig. 10). On the other hand, in male 5XFAD/BChE-KO mice, there was significantly less fibrillar Ab accumulation at both 3 (p = 0.0247) and 6 (p = 0.0159) months of age compared to 5XFAD mice. In summary, comparison of the fibrillar Ab plaque burden in 5XFAD and 5XFAD/BChE-KO mice (Table 2) indicates that, in the absence of BChE, there is less pathology at the same time points, especially for male mice. The area covered by Th-S stained plaques in male 5XFAD/BChE-KO mice was 62% and 69% less than male 5XFAD mice at 3 and 6 months, respectively.
In female 5XFAD/BChE KO mice, compared to 5XFAD mice, the Th-S plaque load in the cerebral cortex was observed (Table 2) to be diminished by 17% and 22% at 3 and 6 months, respectively.
DISCUSSION Butyrylcholinesterase (BChE) is an enzyme that becomes associated with Ab plaques that are characteristic of AD (Mesulam and Geula, 1994) and in mouse models of AD such as the 2XFAD mouse (Darvesh et al., 2012) and the 5XFAD strain used in this study (Figs. 1–3). The reason for the interaction between Ab and BChE is uncertain but it is known that the presence of BChE in Ab plaques alters the catalytic activity of this enzyme, producing altered pH optimum and sensitivity to cholinesterase inhibitors (Geula and Mesulam, 1989). Conversely, it has been indicated that Ab is also affected in this interaction, being transformed from a ‘‘benign’’ form to a ‘‘malignant’’ fibrillar form (Guillozet et al., 1997). Development of the mouse model (5XFAD/BChE-KO) that does not produce BChE (Figs. 4–6), and comparison of the levels of pathology with the 5XFAD strain that does produce BChE (Figs. 7–10) has provided some insights into the effect BChE has on the accumulation of Ab pathology. Staining for Ab by immunohistochemistry provides a measure of Ab plaque burden in the cerebral cortex.
G. A. Reid, S. Darvesh / Neuroscience 298 (2015) 424–435
429
Fig. 2. Photomicrographs exemplifying plaque staining for Ab, fibrillar Ab (Th-S) and butyrylcholinesterase (BChE) enzyme activity in female and male 5XFAD mice at 3 and 6 months of age. Note the similarity in distribution and plaque burden stained for BChE and fibrillar Ab (Th-S). Scale bar = 250 lm.
Fig. 3. Bar graphs of the percentage of cerebral cortex area covered with plaques in 5XFAD mice at 3 and 6 months of age stained for butyrylcholinesterase (BChE) enzyme activity, fibrillar Ab (Th-S) and Ab immunostaining presented as mean ± SEM.
Staining with Th-S shows that a much smaller proportion (20–25%) of these Ab plaques are fibrillar. BChE also stains a similarly small proportion of the Ab plaque load (Fig. 3) suggesting that BChE also stains a selective pool of AD plaques. It has been shown that BChE is associated with fibrillar Ab in human AD (Guillozet et al., 1997) implying that BChE in the 5XFAD cerebral cortex may also be associated with fibrillar Ab.
In the 5XFAD/BChE-KO mice, there is a significant reduction (nearly 70% in males and 20% in females) of fibrillar Ab (Fig. 10, Table 2). This decrease in fibrillar Ab in 5XFAD/BChE-KO mice supports the previous suggestion (Guillozet et al., 1997) that BChE may be involved in the development of fibrillar Ab. It is evident in both 5XFAD and 5XFAD/BChE-KO strains examined here that females accumulate more
430
G. A. Reid, S. Darvesh / Neuroscience 298 (2015) 424–435
Fig. 4. Photograph of an agarose gel of the PCR gene products for APP, PSEN1 and BChE from: (A) 5XFAD; (B) 5XFAD/BChE-het; (C) 5XFAD/ BChE-KO; (D) BChE-WT; (E) BChE-KO. Note, in the 5XFAD/BChE-het mouse, upper band represents PCR product of BChE gene, lower band is that for the neomycin reporter gene that replaced the BChE gene. In 5XFAD/BCHE-KO strain, upper (BChE) band is absent.
Fig. 5. Staining for butyrylcholinesterase (BChE) and acetylcholinesterase (AChE) enzyme activity in 6-month male 5XFAD and 5XFAD/BChE-KO mice. The 5XFAD mouse has BChE associated with Ab plaques. There is no BChE staining in the 5XFAD/BChE-KO mouse. There is no AChE staining of plaques in the cerebral cortex of either strain. Scale bar = 0.5 mm.
Fig. 6. Bar graphs of the percentage of cerebral cortex area in 5XFAD/BChE-KO mice covered with plaque stained for fibrillar Ab (Th-S) and Ab immunostaining presented as mean ± SEM.
G. A. Reid, S. Darvesh / Neuroscience 298 (2015) 424–435
431
Fig. 7. Photomicrographs showing Ab immunostaining in female and male 5XFAD and 5XFAD/BChE-KO mice at 3 and 6 months of age. Scale bar = 200 lm.
Fig. 8. Bar graphs indicate percentage of the cerebral cortex area covered with Ab immunostaining presented as mean ± SEM. A two-tailed Mann–Whitney non-parametric statistical test was applied to determine the difference between means in the areas covered by Ab pathology in 5XFAD and 5XFAD/BChE-KO mice.
Ab plaque pathology than males (Figs. 2, 3 and 6–10), as shown in mouse models of AD (Oakley et al., 2006; Hirata-Fukae et al., 2008; Carroll et al., 2010) and in human studies (Henderson and Buckwalter, 1994; Corder et al., 2004; Barnes et al., 2005; Sinforiani et al., 2010; Vest and Pike, 2013; Li and Singh, 2014; Mielke et al., 2014). Some studies have reported more women than men have AD (Seshadri et al., 1997; Plassman et al., 2007; Irvine et al., 2012; Mielke et al., 2014), but this difference has often been attributed to the fact that women live longer than men (Alzheimer’s Association, 2014). However, an analysis of eight population-based studies, with 2 years of observation, indicated that in five of these studies there was a greater risk of AD in females, while in three of the studies no difference was observed (Barnes et al., 2005). On the other hand, a number of studies have demonstrated higher plaque pathology that is attendant with a greater cognitive decline in women
(Henderson and Buckwalter, 1994; Corder et al., 2004; Barnes et al., 2005; Sinforiani et al., 2010; Vest and Pike, 2013; Li and Singh, 2014; Mielke et al., 2014). These observations have been recapitulated in a number of animal models of AD that have demonstrated greater behavioral deficits and AD pathology in females (Oakley et al., 2006; Hirata-Fukae et al., 2008; Carroll et al., 2010). In addition, higher BChE levels have been observed in females than in males (Mundell, 1944; Illsley and Lamartiniere, 1981; Edwards and Brimijoin, 1983; Alves-Amaral et al., 2010). Furthermore, BChE levels in rat serum were observed to be three times higher in females than males, and that gonadectomy in both sexes abolished this difference. Androgen and estrogen replacement of gonadectomised animals reversed this effect, extending previous work that androgens and estrogens modulate synthesis of BChE (Illsley and Lamartiniere, 1981). Since sex hormones appear to
432
G. A. Reid, S. Darvesh / Neuroscience 298 (2015) 424–435
Fig. 9. Photomicrographs exemplifying thioflavin-S staining in female and male 5XFAD and 5XFAD/BChE-KO mice. Scale bar = 200 lm.
Fig. 10. Bar graphs indicate percentage of the cerebral cortex area covered with fibrillar Ab pathology presented as mean ± SEM. A two-tailed Mann–Whitney non-parametric statistical test was applied to determine the difference between means in the areas covered by Ab pathology in 5XFAD and 5XFAD/BChE-KO mice. *p < 0.05.
Table 2. Percent area of the cerebral cortex covered with Ab plaques visualized using immunohistochemistry and fibrillar Ab visualized with thioflavin-S, presented as mean ± SEM 3 Months
6 Months
Immunostained Ab
Fibrillar Ab
Immunostained Ab
Fibrillar Ab
5XFAD 5XFAD/BChE-KO
Female mice 5.32 ± 2.01 3.72 ± 2.26
1.11 ± 0.35 0.92 ± 0.41
16.85 ± 3.11 16.97 ± 2.98
4.88 ± 1.19 3.79 ± 0.53
5XFAD 5XFAD/BChE-KO
Male mice 3.08 ± 2.25 1.26 ± 0.77
0.6 ± 0.29 0.23 ± 0.17
10.01 ± 3.53 5.44 ± 2.14
2.76 ± 0.66 0.85 ± 0.27
modulate both Ab deposition and BChE levels, the question that arises is how these three factors interact in AD pathogenesis. Since the seminal work of Baulieu and Robel (1990), it is established that the brain synthesizes its own sex
steroid hormones (neurosteroids). All the enzymes for the synthesis of neurosteriods are found in certain populations of neurons and glia (Hojo et al., 2004). There is growing evidence that brain estrogens modulate brain development and behavior (Stanic´ et al., 2014), help
G. A. Reid, S. Darvesh / Neuroscience 298 (2015) 424–435
regulate cholinergic, serotonergic and dopaminergic transmitter subtypes (Do Rego et al., 2009; Gibbs, 2010), protect against age-related atrophy of the hippocampus (Eberling et al., 2003) and enhance outgrowth and survival of neurons in culture (Brinton et al., 1997). Testosterone and progesterone have also been shown to stimulate neurite growth, protect against neuronal death and enhance memory (Malsbury and McKay, 1994; Carroll et al., 2007; Rosario et al., 2010). Testosterone has also been shown to promote non-amyloidogenic processing of amyloid precursor protein (Gouras et al., 2000). Earlier investigations (Xing et al., 2013) have shown that estrogen influences BCHE gene expression and function while other work (Gibbs, 1994) indicated a gene–gene interaction between BCHE gene and estrogen-associated genes. For example, it has been shown that certain genetic polymorphisms in the P450C19 aromatase gene and in the estrogen receptor-a gene increase the risk of AD (Comborros et al., 2005, 2007). However, in women with BChE-K polymorphism, where there is 30% less BChE (Bartels et al., 1992), the increased risk of AD due to P450C19 aromatase or estrogen receptor-a genetic polymorphisms is overcome, suggesting that lower BChE levels are protective. Also, a recent genome-wide association study, using 18F florbetapir Ab PET imaging in 555 patients in the Alzheimer Disease Neuroimaging Initiative study has demonstrated that the BChE gene is one of the few genes identified, along with that for ApoE, that is associated with AD (Ramanan et al., 2014). This study found the largest known effect of the BChE gene on AD-related phenotype and concluded that BChE-associated AD neuropathology, and genetic variation at the BCHE locus associated with Ab burden, may provide a means for BChE-modulating agents to alter disease progression (Ramanan et al., 2014).
CONCLUSION BChE is consistently associated with AD pathology including in the 5XFAD mouse model. Diminished fibrillar Ab plaque deposition in the absence of BChE, particularly in males, suggests that this enzyme promotes Ab plaque pathology. Further comparative studies with 5XFAD and 5XFAD/BChE-KO, in both males and females, should help elucidate a mechanism for BChE-related promotion of fibrillar Ab plaques and provide a model for directly testing potential diseasemodifying therapeutics for AD. Acknowledgments—This work was supported in part by Canadian Institutes of Health Research (MOP-119343), Dalhousie Medical Research Foundation, Brain Repair Centre and Capital District Health Authority Research Fund. We would like to thank Professor Earl Martin and Drew Debay for critically reviewing this manuscript.
REFERENCES Alves-Amaral G, Pires-Oliveira M, Andrade-Lopes A, Chiavegatti T, Godinho RO (2010) Gender-related differences in circadian
433
rhythm of rat plasma acetyl- and butyrylcholinesterase: Effects of sex hormone withdrawal. Chem Biol Interact 186:9–15. Alzheimer’s Association (2014) Alzheimer’s disease facts and figures. Alzheimer’s Dement 10(2):e47–92. Atack JR, Perry EK, Bonham JR, Candy JM, Perry RH (1987) Molecular forms of butyrylcholinesterase in the human neocortex during development and degeneration of the cortical cholinergic system. J Neurochem 48:1687–1692. Barnes LL, Wilson RS, Bienias JL, Schneider JA, Evans DA, Bennett DA (2005) Sex differences in the clinical manifestations of Alzheimer disease pathology. Arch Gen Psychiatry 62(6):685–691. Bartels CF, Jensen FS, Lockridge O, van der Spek AFL, Rubinstein HM, Lubrano T, La Du BN (1992) DNA Mutation Associated with the Human Butyrylcholinesterase K-Variant and Its Linkage to the Atypical Variant Mutation and Other Polymorphic Sites. Am J Hum Genet 50:1086–1103. Baulieu EE, Robel P (1990) Neurosteroids: a new brain function? J Steroid Biochem Mol Biol 37(3):395–403. Blennow K, de Leon MJ, Zetterberg H (2006) Alzheimer’s disease. Lancet 368:387–403. Brinton RD, Tran J, Proffitt P, Montoya M (1997) 17 beta-Estradiol enhances the outgrowth and survival of neocortical neurons in culture. Neurochem Res 22(11):1339–1351. Carroll JC, Rosario ER, Kreimer S, Villamagna A, Gentzschein E, Stanczyk FZ, Pike CJ (2010) Sex differences in b-amyloid accumulation in 3xTg-AD mice: role of neonatal sex steroid hormone exposure. Brain Res 1366:233–245. Carroll JC, Rosario ER, Chang L, Stanczyk FZ, Oddo S, LaFerla FM, Pike CJ (2007) Progesterone and estrogen regulate Alzheimerlike neuropathology in female 3xTg-AD mice. J Neurosci 27(48):13357–13365. Combarros O, Riancho JA, Arozamena J, Mateo I, Llorca J, Infante J, Sa´nchez-Juan P, Zarrabeitia MT, Berciano J (2007) Interaction between estrogen receptor-alpha and butyrylcholinesterase genes modulates Alzheimer’s disease risk. J Neurol 254(9):1290–1292. Combarros O, Riancho JA, Infante J, San˜udo C, Llorca J, Zarrabeitia MT, Berciano J (2005) Interaction between CYP19 aromatase and butyrylcholinesterase genes increases Alzheimer’s disease risk. Dement Geriatr Cogn Disord 20(2–3):153–157. Corder EH, Ghebremedhin E, Taylor MG, Thal DR, Ohm TG, Braak H (2004) The biphasic relationship between regional brain senile plaque and neurofibrillary tangle distributions: modification by age, sex, and APOE polymorphism. Ann N Y Acad Sci 1019:24–28. Darvesh S, Geula G, Hopkins DA (2003) Neurobiology of butyrylcholinesterase. Nat Rev Neurosci 4:131–138. Darvesh S, Reid GA, Martin E (2010) Biochemical and histochemical comparison of cholinesterases in normal and Alzheimer brain tissues. Curr Alzheimer Res 7:386–400. Darvesh S, Cash MK, Reid GA, Martin E, Mitniski A, Geula C (2012) Butyrylcholinesterase, b-amyloid and Thioflavin-S Plaques in the Transgenic APPSWE/PSEN1dE9 mouse Model of Alzheimer’s Disease. J Neuropathol Exp Neurol 71(1):2–14. Diamant S, Podoly E, Friedler A, Ligumsky H, Livnah O, Soreq H (2006) Butyrylcholinesterase attenuates amyloid fibril formation in vitro. Proc Natl Acad Sci USA 103(23):8628–8633. Do Rego JL, Seong JY, Burel D, Leprince J, Luu-The V, Tsutsui K, Tonon MC, Pelletier G, Vaudry H (2009) Neurosteroid biosynthesis: enzymatic pathways and neuroendocrine regulation by neurotransmitters and neuropeptides. Front Neuroendocrinol 30(3):259–301. Duysen EG, Li B, Darvesh S, Lockridge O (2007) Sensitivity of butyrylcholinesterase knockout mice to (–)-huperzine A and donepezil suggests humans with butyrylcholinesterase deficiency may not tolerate these Alzheimer’s disease drugs and indicates butyrylcholinesterase function in neurotransmission. Toxicology 233(1–3):60–69. Eberling JL, Wu C, Haan MN, Mungas D, Buonocore M, Jagust WJ (2003) Preliminary evidence that estrogen protects against agerelated hippocampal atrophy. Neurobiol Aging 24(5):725–732.
434
G. A. Reid, S. Darvesh / Neuroscience 298 (2015) 424–435
Edwards JA, Brimijoin S (1983) Effects of hypophysectomy on acetylcholinesterase and butyrylcholinesterase in the rat. Biochem Pharmacol 32(7):1183–1189. Geula C, Mesulam MM (1995) Cholinesterases and the pathology of Alzheimer disease. Alzheimer Dis Assoc Disord 2:23–28. Geula C, Mesulam MM (1989) Special properties of cholinesterases in the cerebral cortex of Alzheimer’s disease. Brain Res 498:185–189. Giacobini E (2003) Butyrylcholinesterase: its function and inhibitors. Martin Dunitz: London and New York. Gibbs RB (1994) Estrogen and nerve growth factor-related systems in brain. Effects on basal forebrain cholinergic neurons and implications for learning and memory processes and aging. Ann N Y Acad Sci 743:156–196. Gibbs RB (2010) Estrogen therapy and cognition: a review of the cholinergic hypothesis. Endocr Rev 31(2):224–253. Gouras GK, Xu H, Gross RS, Greenfield JP, Hai B, Wang R, Greengard P (2000) Testosterone reduces neuronal secretion of Alzheimer’s beta-amyloid peptides. Proc Natl Acad Sci USA 97(3):1202–1205. Greig NH, Yu Q-S, Brossi A, Martin E, Lahiri DK Darvesh S (2008). Butyrylcholinesterase, the Cinderella cholinesterase, as a drug target for Alzheimer’s disease and related dementias. In: Medicinal chemistry of Alzheimer’s disease, (Gil AM ed.), pp. 79–109 Kerala, India: Transworld Research Network. Grubber JM, Saunders AM, Crane-Gatherum AR, Scott WK, Martin ER, Haynes CS, Conneally PM, Small GW, Roses AD, Haines JL, Pericak-Vance MA (1999) Analysis of association between Alzheimer disease and the K variant of butyrylcholinesterase (BCHE-K). Neurosci Lett 269:115–119. Guillozet AL, Smiley JF, Mash DC, Mesulam MM (1997) Butyrylcholinesterase in the life cycle of amyloid plaques. Ann Neurol 42:909–918. Henderson VW, Buckwalter JG (1994) Cognitive deficits of men and women with Alzheimer’s disease. Neurology 44:90–96. Hiltunen M, Mannermaa A, Helisalmi S, Koivisto A, Lehtovirta M, Ryyna¨nen M, Riekkinen PS, Soininen H (1998) Butyrylcholinesterase K variant and apolipoprotein E4 genes do not act in synergy in Finnish late-onset Alzheimer’s disease patients. Neurosci Lett 250(1):69–71. Hirata-Fukae C, Li HF, Hoe HS, Gray AJ, Minami SS, Hamada K, Niikura T, Hua F, Tsukagoshi-Nagai H, Horikoshi-Sakuraba Y, Mughal M, Rebeck GW, LaFerla FM, Mattson MP, Iwata N, Saido TC, Klein WL, Duff KE, Aisen PS, Matsuoka Y (2008) Females exhibit more extensive amyloid, but not tau, pathology in an Alzheimer transgenic model. Brain Res 1216:92–103. doi: 10.1016. Hojo Y, Hattori TA, Enami T, Furukawa A, Suzuki K, Ishii HT, Mukai H, Morrison JH, Janssen WG, Kominami S, Harada N, Kimoto T, Kawato S (2004) Adult male rat hippocampus synthesizes estradiol from pregnenolone by cytochromes P45017alpha and P450 aromatase localized in neurons. Proc Natl Acad Sci USA 101(3):865–870. Illsley NP, Lamartiniere CA (1981) Endocrine regulation of rat serum cholinesterase activity. Endocrinology 108(5):1737–1743. Irvine K, Laws KR, Gale TM, Kondel TK (2012) Greater cognitive deterioration in women than men with Alzheimer’s disease: a meta analysis. J Clin Exp Neuropsychol 34(9):989–998. Karnovsky MJ, Roots LA (1964) ‘‘Direct-coloring’’ thiocholine method for cholinesterases. J Histochem Cytochem 12:219–221. Kehoe PG, Williams H, Holmans P, Wilcock G, Cairns NJ, Neal J, Owen MJ (1998) The butyrylcholinesterase K variant and susceptibility to Alzheimer’s disease. J Med Genet 35:1034–1035. Ki C-S, Na DL, Kim J-W, Kim HJ, Kim DK, Yoon B-K (1999) No association between the genes for butyrylcholinesterase K variant and apolipoprotein E4 in late-onset Alzheimer’s disease. Am J Med Genet 88:113–115. Lehmann DJ, Nagy Z, Litchfield S, Borja C, Smith AD (2000) Association of butyrylcholinesterase K variant with cholinesterase-positive neuritic plaques in the temporal cortex in late-onset Alzheimer’s disease. Hum Genet 106:447–452.
Lehmann DJ, Williams J, Mcbroomc J, Smith AD (2001) Using metaanalysis to explain the diversity of results in genetic studies of late-onset Alzheimer’s disease and to identify high-risk subgroups. Neuroscience 108:541–554. Li B, Duysen EG, Saunders TL, Lockridge O (2006) Production of the butyrylcholinesterase knockout mouse. J Mol Neurosci 30(1– 2):193–195. Li B, Duysen EG, Carlson M, Lockridge O (2008) The butyrylcholinesterase knockout mouse as a model for human butyrylcholinesterase deficiency. J Pharmacol Exp Ther 324(3):1146–1154. Li R, Singh M (2014) Sex differences in cognitive impairment and Alzheimer’s disease. Front Neuroendocrinol 35(3):385–403. Lorenzen A, Samosh J, Vandewark K, Anborgh PH, Seah C, Magalhaes AC, Cregan SP, Ferguson SS, Pasternak SH (2010) Rapid and direct transport of cell surface APP to the lysosome defines a novel selective pathway. Mol Brain 3:11. Malsbury CW, McKay K (1994) Neurotrophic effects of testosterone on the medial nucleus of the amygdala in adult male rats. J Neuroendocrinol 6(1):57–69. Masters CL, Selkoe DJ (2012) Biochemistry of amyloid b-protein and amyloid deposits in Alzheimer disease. Cold Spring Harb Perspect Med. http://dx.doi.org/10.1101/cshperspect.a006262. McIlroy SP, Crawford VLS, Dynan KB, McGleenon BM, Vahidassr MD, Lawson JT, Passmore AP (2000) Butyrylcholinesterase K variant is genetically associated with late-onset Alzheimer’s disease in Northern Ireland. J Med Genet 37:182–185. Mesulam MM, Guillozet A, Shaw P, Quinn B (2002) Widely spread butyrylcholinesterase can hydrolyze acetylcholine in the normal and Alzheimer brain. Neurobiol Dis 9(1):88–93. Mesulam MM, Geula C (1994) Butyrylcholinesterase reactivity differentiates the amyloid plaques of aging from those of dementia. Ann Neurol 36:722–727. Mielke MM, Vemuri P, Rocca WA (2014) Clinical epidemiology of Alzheimer’s disease: assessing sex and gender differences. Clin Epidemiol 6:37–48. Mundell DB (1944) Plasma cholinesterase in male and female rats. Nature 3888(153):557–558. O’Brien KK, Saxby BK, Ballard CG, et al. (2003) Regulation of attention and response to therapy in dementia by butyrylcholinesterase. Pharmacogenetics 13:231–239. Oakley H, Cole SL, Logan S, Maus E, Shao P, Craft J, GuillozetBongaarts A, Ohno M, Disterhoft J, Van Eldik L, Berry R, Vassar R (2006) Intraneuronal beta-amyloid aggregates, neurodegeneration, and neuron loss in transgenic mice with five familial Alzheimer’s disease mutations: potential factors in amyloid plaque formation. J Neurosci 26:10129–10140. Perry EK, Perry RH, Blessed G, Tomlinson BE (1978) Changes in brain cholinesterases in senile dementia of the Alzheimer type. Neuropathol Appl Neurobiol 4:273–277. Plassman BL, Langa KM, Fisher GG, Heeringa SG, Weir DR, Ofstedal MB, et al. (2007) Prevalence of dementia in the United States: the aging, demographics, and memory study. Neuroepidemiology 29:125–132. Querfurth HW, LaFerla FM (2010) Alzheimer’s disease. N Engl J Med 362(4):329–344. Ramanan VK, Risacher SL, Nho K, Kim S, Swaminathan S, Shen L, Foroud TM, Hakonarson H, Huentelman MJ, Aisen PS, Petersen RC, Green RC, Jack CR, Koeppe RA, Jagust WJ, Weiner MW, Saykin AJ, Alzheimer’s Disease Neuroimaging Initiative (2014) APOE and BCHE as modulators of cerebral amyloid deposition: a florbetapir PET genome-wide association study. Mol Psychiatry 19(3):351–357. http://dx.doi.org/10.1038/mp.2013.19. Rosario ER, Carroll J, Pike CJ (2010) Testosterone regulation of Alzheimer-like neuropathology in male 3xTg-AD mice involves both estrogen and androgen pathways. Brain Res 1359:281–290. Sandbrink R, Gasperina A, Zerfass R, Weber B, Masters CL, Beyreuther K, Heuser I (1998) Butyrylcholinesterase K variant (BCHE-K): association with late-onset Alzheimer’s disease. Neurobiol Aging 19:S69.
G. A. Reid, S. Darvesh / Neuroscience 298 (2015) 424–435 Seshadri S, Wolf PA, Beiser A, Au R, McNulty K, White R, D’Agostino RB (1997) Lifetime risk of dementia and Alzheimer’s disease. The impact of mortality on risk estimates in the Framingham study. Neurology 49(6):1498–1504. Sinforiani E, Citterio A, Zucchella C, Bono G, Corbetta S, Merlo P, Mauri M (2010) Impact of gender differences on the outcome of Alzheimer’s disease. Dement Geriatr Cogn Disord 30(2):147–154. Singleton AB, Smith G, Gibson AM, Woodward R, Perry RH, Ince PG, Edwardson JA, Morris CM (1998) No association between the K variant of the butyrylcholinesterase gene and pathologically confirmed Alzheimer’s disease. Hum Mol Genet 7:937–939. Stanic´ D, Dubois S, Chua HK, Tonge B, Rinehart N, Horne MK, Boon WC (2014) Characterization of aromatase expression in the adult male and female mouse brain. I. Coexistence with oestrogen receptors a and b, and androgen receptors. PLoS One 9(3):e90451. Tilley L, Morgan K, Grainger J, Marsters P, Morgan L, Lowe J, Xuereb J, Wischik C, Harrington C, Kalsheker N (1999) Evaluation of polymorphisms in the presenilin-1 gene and the
435
butyrylcholinesterase gene as risk factors in sporadic Alzheimer’s disease. Eur J Hum Genet 7:659–663. Truett GE, Heeger P, Mynatt RL, Truett AA, Walker JA, Warman ML (2000) Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). Biotechniques 29:52–54. Vest RS, Pike CJ (2013) Gender, sex steroid hormones, and Alzheimer’s disease. Horm Behav 63:301–307. Wiebusch H, Poirier J, Se´vigny P, Schappert K (1999) Further evidence for a synergistic association between APOEe4 and BCHE-K in confirmed Alzheimer’s disease. Hum Genet 104:158–163. Xing Y, Jia JP, Ji XJ, Tian T (2013) Estrogen associated gene polymorphisms and their interactions in the progress of Alzheimer’s disease. Prog Neurobiol 111:53–74. Yamamoto Y, Yasuda M, Mori E, Maeda K (1999) Failure to confirm a synergistic effect between the K-variant of the butyrylcholinesterase gene and the e4 allele of the apolipoprotein gene in Japanese patients with Alzheimer’s disease. J Neurol Neurosurg Psychiatry 67:94–96.
(Accepted 20 April 2015) (Available online 27 April 2015)