Bypass of DNA Heterologies During RuvAB-mediated Three- and Four-strand Branch Migration

J. Mol. Biol. (1996) 263, 582–596

Bypass of DNA Heterologies During RuvAB-mediated Three- and Four-strand Branch Migration David E. Adams and Stephen C. West* Imperial Cancer Research Fund, Clare Hall Laboratories, South Mimms Herts, EN6 3LD, UK

During general genetic recombination and recombinational DNA repair, DNA damages and heterologies are often encountered which must be efficiently processed by the cellular recombination machinery. In RecA-mediated three-strand exchange reactions between single-stranded circular and linear duplex DNA, or four-strand exchange reactions between gapped circular and linear duplex DNA, heterologies can only be bypassed in vitro when they are short in length and are followed by homologous DNA downstream. Larger DNA inserts block RecA-mediated strand exchange, indicating that effective bypass requires other components of the recombination machinery. The RuvA and RuvB proteins of Escherichia coli form an important part of this machinery. In this work, we have analysed the ability of RuvA and RuvB to bypass large tracts of DNA heterology in both three- and four-strand exchange reactions, using recombination intermediates made by the E. coli RecA protein. Under optimal reaction conditions for RuvAB, up to 1000 bp of DNA heterology can by bypassed in three-strand reactions and 300 bp of DNA heterology can be bypassed in four-strand reactions. Whereas high concentrations of RuvB (in the absence of RuvA) can promote homologous branch migration, we find that RuvB alone is unable to catalyse heterologous bypass, indicating an essential role for both proteins in homologous recombination and recombinational DNA repair processes. Under certain conditions, the bypass of heterology is stimulated by the single-strand binding protein SSB. 7 1996 Academic Press Limited

*Corresponding author

Keywords: genetic recombination; DNA repair; Holliday junctions; branch migration; protein–DNA interactions

Introduction General genetic recombination and recombinational DNA repair are essential cellular processes. A critical problem in both processes is the promotion of strand exchange, or branch point migration, through heterologous and damaged DNA sequences. Branch migration, i.e. the formation of heteroduplex DNA by the movement of a Holliday junction along DNA, requires the activity of specialised recombination proteins. DNA lesions, mismatches, insertions and deletions Present address: D. E. Adams, Institute Ge´ne´tique et Microbiologie, URA 1354 CNRS, Universite´ Paris-Sud, 91405 Orsay, France. Abbreviations used: dsDNA, double-stranded DNA; gDNA, gapped DNA; NTP, nucleoside triphosphate; SSB protein, single-stranded binding protein; ssDNA, single-stranded DNA. 0022–2836/96/440582–15 $25.00/0

can all potentially disrupt the normal exchange of DNA strands. The mechanism(s) by which enzymes like the Escherichia coli RecA, RuvAB or RecG proteins promote the movement of junction points during recombination repair are largely unknown and are of great biological interest (Bianchi & Radding, 1983; Hahn et al., 1988; Iype et al., 1994; Livneh & Lehman, 1982; Morel et al., 1994; Parsons et al., 1995b; Tsaneva et al., 1992b; Whitby et al., 1993). Homologous pairing and strand exchange reactions catalysed by RecA have been extensively studied in vitro (for reviews see Kowalczykowski, 1991; Radding 1991; Roca & Cox, 1990; West, 1992). Two model systems have been particularly useful and serve as excellent model systems for recombination repair (Figure 1): (a) the three-strand reaction between single-stranded circular and linear duplex DNA, and (b) the four-strand reaction between gapped circular and linear duplex DNA. 7 1996 Academic Press Limited

Bypass of DNA Heterologies by RuvA and RuvB

583

Figure 1. Schematic diagram of recombination assays used to investigate RuvAB-mediated branch migration through DNA heterologies. Strand exchange reactions between (a) circular ssDNA, or (b) gapped duplex DNA, and 32P-labelled linear duplex DNA containing a heterologous DNA insert (shaded boxes) were carried out with RecA to produce recombination intermediates. The position of the branch point in the intermediates is approximately 1.5 kb into the substrate, near the start site of DNA heterology. Three- and four-strand intermediates were purified from RecA protein, and subsequently used in RuvAB-mediated branch migration reactions. Reverse branch migration through DNA homology results in re-formation of the starting substrates (circular ssDNA and 32P-labelled linear duplex DNA in (a), or gapped duplex DNA and 32P-labelled linear duplex DNA in (b)). Forward branch migration through DNA heterology results in either (a) 32P-labelled linear ssDNA and a 32P-labelled nicked circular duplex containing a looped region, or (b) 32P-labelled linear duplex DNA and 32P-labelled nicked circular DNA, both of which contain unpaired loops. The sizes of the heterologous DNA inserts were 117 bp, 256 bp, 297 bp, 939 bp or 1485 bp in length. Asterisks indicate 3'-32P-end labels.

To initiate DNA pairing, RecA binds to singlestranded circular DNA (ssDNA), or gapped duplex DNA (gDNA), and forms an extended nucleoprotein filament. Following a search for homology, a complementary strand of DNA from the linear duplex is transferred to either the ssDNA or gDNA. RecA-mediated branch migration is relatively slow (approx. 2 to 10 bp/second) and occurs with a defined polarity (5' to 3' relative to the strand on which the nucleoprotein filament formation was initiated). The products of the three-strand exchange reaction are nicked circular duplex and linear single-stranded DNA, and the four-strand reaction gives rise to a nicked circular duplex and a linear duplex (with single-stranded ends). When a block of DNA heterology exists in one of the starting DNA substrates, the strand exchange products contain single-stranded loops (Figure 1). Although RecA requires homology for DNA pairing, it can promote efficient strand exchange

through regions of DNA damage and DNA heterology, provided the DNA damage is not too extensive and the size of the DNA heterology is not too great (Bianchi & Radding, 1983; Hahn et al., 1988; Livneh & Lehman, 1982; Tsaneva et al., 1992b). Originally, it was thought that RecA could promote strand exchange through DNA heterologies of up to 1000 bp in three-strand reactions, but more recent data suggest that bypass is limited to insertions (or deletions) of <250 bp in size (Iype et al., 1994; Morel et al., 1994). In four-strand exchange reactions, RecA-mediated bypass is even more limited, being blocked by heterologies of <100 bp in size (Hahn et al., 1988). This is probably due to the greater steric constraints imposed by the DNA double helix on loop size during four-strand exchange. Genetic evidence suggests that extensive tracts of DNA damage and DNA heterologies can be bypassed efficiently in vivo during conjugative

584 recombination and interspecies gene exchange (Lloyd et al., 1988; Matic et al., 1995; Rupp et al., 1971). These data, coupled with biochemical data on the strand exchange properties of RecA protein, suggest that RecA is unlikely to be the major recombination enzyme in vivo responsible for heterology bypass. This role is probably reserved for the SOS-inducible RuvA and RuvB proteins. Cells carrying mutations in the three ruv genes (ruvA, ruvB and ruvC) are sensitive to UV light and ionising radiation (Otsuji et al., 1974), and exhibit reduced recombination frequencies between duplicated genes (Benson et al., 1991; Stacey & Lloyd, 1976). The ruv genes have been cloned and sequenced, and the three proteins have been over-expressed and purified (Dunderdale et al., 1991, 1994; Iwasaki et al., 1989; Sharples et al., 1990; Shiba et al., 1991; Shinagawa et al., 1988; Tsaneva et al., 1992a). The 19 kDa RuvC protein interacts specifically with Holliday junctions and resolves them in a reaction that is influenced by local DNA sequence (Bennett et al., 1993; Bennett & West, 1995a,b; Connolly et al., 1991; Dunderdale et al., 1991; Iwasaki et al., 1991; Shah et al., 1994; Shiba et al., 1994). The crystal structure of RuvC was recently solved, revealing a compact protein with structural resemblance to the E. coli RNaseH1 and HIV integrase proteins (Ariyoshi et al., 1994). The 22 kDa RuvA and 37 kDa RuvB proteins can act independently of RuvC and catalyse the branch migration of Holliday junctions, leading to the formation of heteroduplex DNA during strand exchange (Iwasaki et al., 1992; Mu¨ller et al., 1993a; Parsons et al., 1992; Shiba et al., 1991; Tsaneva et al., 1992b). Electron microscopic studies of RuvA and RuvB bound to the crossovers in Holliday junction-containing molecules indicate that tetramers of RuvA bind directly to the Holliday junction, and hexamers of RuvB (in the form of closed circular rings) assemble on two of the four junction arms (Parsons et al., 1995a; Stasiak et al., 1994). RuvAB-junction complexes have also been detected by DNase I footprinting and gel retardation studies making use of small synthetic Holliday junctions (Hiom & West, 1995; Parsons & West, 1993). Double-stranded DNA is thought to pass through the centres of two opposing RuvB rings, with individual rings co-ordinating to translocate DNA through the RuvAB complex (Hiom & West, 1995; Parsons et al., 1995a). DNA unwinding by RuvB is thought to provide the DNA twisting force, or mechanical torque, necessary to drive fork movement (Adams & West, 1995a,b). The RuvAB proteins therefore appear to act as a molecular pump (West, 1996). The above model for RuvAB action is supported by observations indicating that at saturating protein concentrations, RuvB can promote branch migration in the absence of other proteins (Mitchell & West, 1996; Mu¨ller et al., 1993a). However, addition of RuvA greatly stimulates the RuvB-mediated reaction implying that the two proteins work

Bypass of DNA Heterologies by RuvA and RuvB

together to promote branch migration. RuvA also stimulates RuvB’s ATPase activity, especially when RuvB is bound to UV-irradiated DNA (Mitchell & West, 1994; Shiba et al., 1991). Biochemical characterisation of the RuvAB proteins revealed a DNA helicase activity (Tsaneva et al., 1993) that can be selectively targeted to DNA crossovers (Tsaneva & West, 1994). The 5' to 3' polarity of unwinding is opposite to that exhibited by the E. coli RecG protein. RecG, like RuvAB, catalyses ATP-dependent branch migration and shares sequence homology with RuvB and other E. coli DNA helicases (Adams & West, 1995a; Lloyd & Sharples, 1993a,b; Sharples et al., 1994; Whitby et al., 1995). Although the functions of RuvAB and RecG may overlap in some aspects of homologous recombination in vivo, they are quite dissimilar when it comes to DNA repair (Lloyd et al., 1988; Mahdi et al., 1996; Mandal et al., 1993). ruvAB mutants are much more sensitive to UV irradiation than are recG mutants, implying a unique role for the RuvAB proteins in recombinational DNA repair. The finding that RuvAB exhibit junction-selective DNA helicase activity (Tsaneva et al., 1993) is thought to be significant since a specialised DNA helicase activity would be especially useful in promoting branch migration through DNA lesions and DNA heterologies during recombinational DNA repair. In this regard it is noteworthy that addition of RuvAB to an ongoing RecA reaction between UV-damaged linear duplex DNA and gDNA, stimulates the kinetics of strand exchange between the irradiated substrates (Tsaneva et al., 1992b). Recent evidence suggests that RuvAB play a critical role in the bypass of DNA heterologies during genetic exchange and recombinational repair. In crosses between Escherichia coli and Salmonella typhimurium cells, it was found that mutations in ruvA and ruvB severely decrease the efficiency of interspecies gene exchange (Matic et al., 1995). Biochemical data also support the idea that RuvAB promote more efficient strand exchange than RecA alone. In three-strand reactions involving RecA, RuvA and RuvB, heterologous inserts of >1000 bp in size were bypassed. However, in the absence of RuvAB, RecA failed to promote strand exchange through inserts >190 bp in length (Iype et al., 1994). In another recent study, RuvAB were found to unwind long tracts of DNA heterology in x-shaped plasmid molecules which were made using the E. coli cer site-specific recombination system followed by DNA restriction (Parsons et al., 1995b). This RuvAB-mediated heterologous branch migration reaction was greatly stimulated by the presence of E. coli single-stranded binding (SSB) protein. In these four-strand exchange reactions, RuvAB unwound heterologies up to 1800 bp in length over a 60 minute incubation period. However, the rate of heterologous branch migration was significantly slower than that observed

Bypass of DNA Heterologies by RuvA and RuvB

585

Figure 2. RuvAB-mediated bypass of heterologous inserts during three-strand exchange reactions. Three-strand recombination intermediates (see Figure 1(a)) were prepared and deproteinised as described in Materials and Methods, and then incubated with RuvA and RuvB proteins as described. The 32 P-labelled products of branch migration were analysed by agarose gel electrophoresis followed by autoradiography. The sizes of the heterologous DNA inserts (0 bp, 117 bp, 256 bp, 297 bp, 939 bp, or 1485 bp) are indicated. The gel migration positions of the recombination intermediates, linear duplex DNA, and heterologous branch migration products (nicked circle, looped circle and single-stranded linear DNA) are indicated.

with fully homologous DNA substrates. These differences in branch migration kinetics prompted us to investigate RuvAB-mediated bypass of DNA heterologies using recombination intermediates made by RecA, which presumably are the ‘‘natural’’ substrates for RuvAB action in vivo. Here we report on the ability of RuvAB to promote threeand four-strand exchange reactions through DNA heterologies up to 1485 bp in length. Medially located inserts up to 1000 bp in length were bypassed in three-strand reactions and up to 300 bp in length could be bypassed in four-strand reactions. E. coli SSB protein stimulated the three-strand RuvAB reaction under certain conditions, suggesting an ancillary role for SSB in RuvAB-mediated recombinational repair.

Results Experimental design To determine the effect of insert size on RuvAB-mediated heterology bypass, we constructed a series of phagemid-based substrates (see Material and Methods), which could be paired and exchanged by RecA up to the site of internal DNA heterology (Figure 1). The location of the DNA heterology was such that RecA catalyses approximately 1.5 kb of homologous strand exchange before encountering the heterology. If strand exchange continued beyond the DNA heterology, an additional 2.0 kb of homologous strand exchange would take place before the branch point reaches the free end. These lengths of flanking DNA homology help stabilise the RecA-made intermediates from dissociation due to spontaneous branch migration. Three- and four-stranded inter-

mediates were prepared, deproteinised and isolated from RecA protein by gel filtration. They were then used as substrates for RuvAB-mediated branch migration reactions. In all of the experiments described below, the single-stranded and gapped DNAs were derived from the 3438 bp phagemid, pDEAB1 (see Materials and Methods). The 32P-end-labelled linear duplex DNAs containing heterologies were derivatives of pDEAB1, with inserts of 117 bp (pDEAB2), 256 bp (pDEAB3), 297 bp (pDEAB4), 939 bp (pDEAB5) or 1485 bp (pDEAB6). All were cut with PstI. RuvAB-mediated recombinational bypass in three-strand reactions The first set of experiments involved addition of purified RuvA and RuvB to three-strand intermediates made in large-scale preparative RecA reactions (see Materials and Methods). These intermediates contained medially located heterologous inserts, which were either 0 bp, 117 bp or 256 bp in length (Figure 2, upper panel). At time t = 0 minutes, RuvA and RuvB were added to the reaction mixtures containing deproteinised recombination intermediates, and at the indicated times, aliquots were taken and the branch migration reactions stopped using SDS, EDTA and proteinase K (see Material and Methods). At the end of the proteolytic digests, the branch migration products were run on an agarose gel and the 32P-labelled DNAs were visualised by autoradiography. For the case of complete DNA homology (0 bp insert), RuvAB-mediated branch migration occurred rapidly and was complete by five minutes (Figure 2 upper panel). Both ‘‘forward’’ ( 32Plabelled nicked circular and 32P-labelled linear

586 single-stranded DNA) and ‘‘reverse’’ branch migration products ( 32P-labelled linear duplex and unlabelled circular ssDNA) formed during this period, as shown diagrammatically in Figure 1(a)). The descriptive forward used here refers to the original direction, or polarity, of RecA-mediated strand exchange, i.e., 5' to 3' with respect to the circular single-strand (see Figure 1(a)). The descriptive reverse indicates the opposite direction, i.e. branch migration away from the DNA heterology in insert-containing DNAs. In the homologous strand exchange reaction (Figure 2), a bias is suggested for forward branch migration, but this is not the case in general. In other reactions where three-strand intermediates were isolated at earlier time points in the preparative RecA reaction (and thus had junction points nearer to the starting DNA end), the products of reverse branch migration predominated (data not shown). Indeed, in experiments with fully homologous substrates, we routinely observe that any polarity bias tends to relate to the efficiency of the RecA reaction. The way in which RuvAB processed three-strand intermediates with heterologies of 117 bp or 256 bp in size was examined in parallel (Figure 2, top panel). Heterologous bypass occurred quite efficiently through both lengths of insert, with 36 and 24% of the intermediates being converted to forward branch migration products, respectively. In these reactions, the three-strand intermediates disappeared more slowly over time compared with the homologous control, implying that RuvAB find it more difficult to process heterology-containing intermediates, as does RecA protein (Iype et al., 1994). The lower half of Figure 2 shows the results obtained with heterologies of either 297 bp, 939 bp or 1485 bp in length. Forward branch migration through the 297 bp insert was relatively efficient (>12%), but it was quite inefficient (3%) for inserts e939 bp in size. In these more challenging bypass reactions, the major branch migration product was the completely homologous one, 32P-labelled linear duplex DNA (plus unlabelled circular ssDNA), consistent with the observations of other workers (Iype et al., 1995). With these large insertions, a substantial fraction of the starting DNA substrates remained at the end of the period of incubation, indicating that they were not fully processed by RuvA and RuvB (Figure 2, lower panel). Effects of protein concentration and nucleotide cofactors on three-strand exchange RuvAB-mediated branch migration of RecAmade intermediates isolated from a three-strand reaction involving circular single-stranded pDEAB1 and 32P-labelled linear duplex pDEAB3 (with a 256 bp insert relative to pDEAB1) was examined (Figure 3) for the effect of (a) RuvAB protein concentration, (b) RuvB protein concentration, (c) ATP concentration, and (d) the type of nucleotide cofactor used. The starting

Bypass of DNA Heterologies by RuvA and RuvB

Figure 3. Effect of protein concentration, ATP concentration and nucleotide cofactors on three-strand recombinational bypass. Reactions contained 32P-labelled three-strand recombination intermediates containing a heterologous insert of 256 bp. Incubations were carried out under standard conditions (Materials and Methods) except that the nucleotide concentrations were as follows: (a) and (b) 1 mM ATP; (c), 0 to 5 mM ATP; (d), 1 mM ATP, dATP, dCTP, CTP, GTP or UTP. RuvAB ((a), (c) and (d)) or (b) RuvB were included at the indicated protein concentrations (where 1 × RuvAB = 30 nM RuvA and 100 nM RuvB; 1 × RuvB = 100 nM). The products of branch migration were analysed by gel electrophoresis and the forward (r) and reverse (Q) products were quantified by phosphorimaging.

DNA concentration in these incubations was 0.5 mM. Reactions were quantified for both forward (heterologous) and reverse (homologous) branch migration. Optimal reverse branch migration (Figure 3(a), filled squares) occurred at RuvA = 30 nM and RuvB = 100 nM (designated = 1 × standard level) or at RuvA = 100 nM and RuvB = 300 nM (=3 × standard level). Higher or lower amounts of RuvAB resulted in less efficient branch migration overall. The optimal protein concentration for heterologous branch migration (Figure 3(a), open diamonds) was slightly lower (two to threefold), although this may be slightly deceptive, due to loss of substrate DNA from competing homologous branch migration. RuvB, on its own, can catalyse homologous branch migration, provided it is used at 10 to 20× higher protein levels than that required for RuvAB-mediated reactions (Mitchell & West, 1996; Mu¨ller et al., 1993a). We therefore determined whether RuvB, in the absence of RuvA, could catalyse branch migration through a region of DNA heterology. Even at RuvB protein levels that allowed for >70% homologous strand exchange

Bypass of DNA Heterologies by RuvA and RuvB

587

Figure 4. RuvAB-mediated bypass of heterologous inserts during four-strand exchange reactions. Four-strand recombination intermediates (see Figure 1(b)) were prepared and deproteinised as described in Materials and Methods, and then incubated with RuvA and RuvB proteins as described. The 32 P-labelled products of branch migration were analysed by agarose gel electrophoresis followed by autoradiography. The sizes of the heterologous DNA inserts (0 bp, 117 bp, 256 bp, 297 bp, 939 bp, or 1485 bp) are indicated. The gel migration positions of the recombination intermediates, reverse branch migration products ( 32Plabelled linear duplex DNA) and forward branch migration products ( 32P-labelled nicked circular and 32 P-labelled linear duplex DNA, both containing a loop) are indicated. Note that some linear duplex DNA is present at t = 0, due to incomplete RecA strand transfer and/or spontaneous branch migration of the intermediates prior to gel electrophoresis.

(Figure 3(b), filled squares), we detected little or no bypass of a 256 bp insert (Figure 3(b), open diamonds). We conclude that RuvA and RuvB are both required for the bypass of DNA heterologies in three-strand reactions. The ATP dependence of the RuvAB-mediated branch migration reaction was examined next (Figure 3(c)). Homologous strand exchange was optimal at ATP levels e0.5 mM, whereas heterologous strand exchange continued to increase in efficiency up to the highest ATP concentration tested (5 mM). The results of substitution of ATP with other nucleoside triphosphates are shown in Figure 3(d). Both dATP and dCTP serve as excellent substitutes for ATP, while CTP gave only about half the normal amount of branch migration. Substitution of ATP with either GTP or UTP gives only a very small amount of homologous branch migration and no recombinational bypass. These results are in accord with earlier observations on the relative effects of various nucleoside triphosphates on RuvAB-mediated dissociation of small synthetic Holliday junctions (Parsons et al., 1992; Parsons & West, 1993). RuvAB-mediated recombinational bypass in four-strand reactions We next investigated the effect of heterologous insertions on four-stranded branch migration (Figure 4). With complete DNA homology (0 bp insert), RuvAB branch migrated the four-way junctions rapidly, completing strand exchange

within five minutes. Both forward ( 32P-labelled nicked circular and 32P-labelled linear duplex DNA) and reverse ( 32P-labelled linear duplex and unlabelled gDNA) branch migration products were formed during this period. Quantification of the data by phosphorimaging showed that there was no inherent bias for RuvAB to catalyse branch migration in either the forward or reverse directions under these conditions. When reactions containing 117 bp or 256 bp inserts were examined in parallel, we observed that heterologous bypass occurred quite efficiently through the 117 bp insert (>27%, taking into account the amount of starting linear DNA duplex) and at about two-thirds this level (>20%) through the 256 bp insert (Figure 4, upper panel). These efficiencies are slightly lower than those obtained in the three-strand reactions involving the same inserts (Figure 2, upper panel). The lower panel of Figure 4 shows the results obtained with substrates containing inserts of 297 bp, 939 bp or 1485 bp. RuvAB-mediated recombinational bypass occurred through the 297 bp insert (at about the 5 to 10% level), but no bypass was detected for substrates with larger DNA inserts. The only branch migration product seen in these latter reactions was the fully homologous one, 32 P-labelled linear duplex DNA (plus unlabelled gDNA). Unlike the three-stranded reactions, we found that the starting intermediates in the four-strand reactions disappeared completely during the period of incubation, suggesting that RuvAB process stalled four-strand intermediates more efficiently than three-strand intermediates. In

588

Bypass of DNA Heterologies by RuvA and RuvB

Figure 6. Efficiency of three-strand and four-strand bypass as a function of heterologous insert size. Quantification of the RuvAB-mediated bypass reactions was carried out as described in Materials and Methods. The ATP, DNA, RuvA and RuvB concentrations were 1 mM, 0.25 to 0.5 mM, 30 nM and 100 nM, respectively. Figure 5. Effect of protein concentration, ATP concentration and nucleotide cofactors on four-strand recombinational bypass. Reactions were carried out as described in Figure 3 legend except that 32P-labelled four-strand recombination intermediates were used as DNA substrate. RuvAB ((a), (c) and (d)) or (b) RuvB were included at the indicated protein concentrations (where 1 × RuvAB = 30 nM RuvA and 100 nM RuvB; 1 × RuvB = 100 nM). The products of branch migration were analysed by gel electrophoresis and the forward (r) and reverse (Q) products were quantified by phosphorimaging.

the case where heterology blocks the forward reaction, RuvAB preferentially promote reverse branch migration. Effects of protein concentration and nucleotide cofactors on four-strand exchange As in the three-strand reactions, we next examined the effects of protein concentration and cofactors on the RuvAB-mediated four-strand branch migration reaction (Figure 5). Again we used an insert of 256 bp in the linear substrate. The starting DNA concentration in these reactions was 0.25 mM. Optimal reverse, or homologous, branch migration (Figure 5(a), filled squares) occurred at 10 and 30 nM of RuvA and RuvB, respectively, and greater amounts of enzyme had little effect. This latter result differs from our earlier results, in which we observed that excess RuvAB had an inhibitory effect on three-strand branch migration (Figure 3(a), filled squares). The optimal RuvA and RuvB concentrations for heterologous four-strand exchange were 30 and 100 nM RuvA and RuvB, respectively (Figure 5, open diamonds). Higher or lower amounts of protein resulted in less efficient heterologous bypass.

High concentrations of RuvB alone were found to catalyse homologous four-strand exchange (Figure 5(b), filled squares), but were unable to bypass a 256 bp DNA insert (Figure 5(b), open diamonds). Thus RuvA and RuvB are both required for threeand four-strand heterologous bypass. These data are in accord with previous observations indicating that RuvA and RuvB are both required for RuvAB DNA helicase (Tsaneva et al., 1993) and (efficient) duplex DNA unwinding (Adams & West, 1995b) activities. The nucleotide requirements for four-strand reactions were also examined using the 256 bp insert (Figure 5(c) and (d)). The results obtained were similar to those observed with three-stranded intermediates, with slightly lower levels of ATP (around 0.1 mM) supporting homologous fourstrand exchange by RuvAB (Figure 5(c)), filled squares). Again, dATP and dCTP were found to serve as excellent substitutes for ATP, while CTP supported about half the normal amount of branch migration. GTP was a poor substitute for ATP, whereas UTP supported a low level of branch migration (around three to five times greater than that observed in comparable three-strand reactions). A summary of the length dependence of threeand four-strand RuvAB bypass reactions is shown in Figure 6. Heterologous strand exchange was greatest when the DNA insert was small, and declined thereafter in an approximately linear fashion. Overall, three-strand recombinational bypass was more efficient than four-strand bypass, with inserts up to 1200 bp being bypassed in the three-strand reactions and inserts up to 500 bp being unwound in the four-strand reactions (based on a linear extrapolation of the data).

Bypass of DNA Heterologies by RuvA and RuvB

Figure 7. Time course of RuvAB-mediated three-strand exchange. RuvA (13 nM) and RuvB (40 nM) were added to prewarmed mixtures containing 0.25 mM 32P-labelled three-strand RecA-made recombination intermediates harbouring a 256 bp insert, starting at time t = 0 minutes. Reaction aliquots were removed at the indicated times and branch migration stopped as described. (a) 32P-labelled branch migration products were analysed by agarose gel electrophoresis and autoradiography. Ethidium bromide was included in the gel and electrophoresis buffer. (b) The data were quantified as described in Materials and Methods and the percentage of total DNA present as recombination intermediates, forward (r) and reverse (Q) branch migration products are plotted with time. The reaction was carried out under standard conditions.

Kinetics of RuvAB-mediated branch migration To probe for other possible differences in the three- and four-strand RuvAB-mediated branch migration reactions, we sampled the products of strand exchange (using an insert of 256 bp) at early time points in a parallel set of reactions. As early as one minute into the three-strand RuvAB reaction (Figure 7(a)), 32P-labelled linear duplex DNA (and unlabelled ssDNA) were formed, due to reverse branch migration away from the site of DNA

589

Figure 8. Time course of RuvAB-mediated four-strand exchange. RuvA (13 nM) and RuvB (40 nM) were added to prewarmed mixtures containing 0.25 mM 32P-labelled four-strand exchange intermediates harbouring a 256 bp insert. Aliquots were removed at the indicated times and branch migration stopped as described in the legend to Figure 7. (a) 32P-labelled products were visualised by agarose gel electrophoresis and autoradiography. (b) Forward (r) and reverse (Q) branch migration products were quantified as described. The reaction was carried out under standard conditions.

heterology. Quantification by phosphorimaging indicated that the linear duplex product increased steadily over time during the first ten minutes, and accounted for about 70% of the final DNA products (Figure 7(b)). The heterologous branch migration products ( 32P-labelled looped circle and 32P-labelled single-stranded DNA) also increased over time, exhibiting a similar rise and levelling off, and made up about 12% of the final DNA products. As noted earlier, the three-stranded substrate did not completely disappear during the 30 minute incubation, remaining at about the 25% level. In the analogous four-strand reaction (Figure 8(a)), performed under an identical set of conditions, we observed that >35% of the fourstrand intermediates were branch migrated within

590 one minute to give fully homologous strand exchange products, 32P-labelled linear duplex DNA (plus unlabelled gDNA). The reaction was essentially completed within five minutes, with all the starting DNA intermediates having been consumed. The forward branch migration products ( 32P-labelled looped circular and 32P-labelled double-stranded DNA) made up about 14% of the final DNA products (Figure 8(b)). Comparison of the four-strand time course (Figure 8) with the three-strand time course (Figure 7), revealed that the four-strand branch migration reaction went further towards completion and was more rapid than in the three-strand reaction. These findings are surprising, given that the overall efficiency, or length of the heterologous insert, that can be bypassed in a three-strand RuvAB reaction is greater than that in four-strand reactions (Figure 6). Effect of SSB protein In previous experiments, it was shown that single-stranded binding protein stimulates RuvABmediated heterologous branch migration (Parsons et al., 1995b) and DNA helicase activity (Tsaneva et al., 1993; Tsaneva & West, 1994). SSB protein is thought to assist RuvAB-mediated DNA unwinding by binding to the looped, or unwound, regions of single-stranded DNA, which form as the result of RuvAB action. We therefore determined whether addition of SSB protein would also exhibit a stimulatory effect on RuvAB-mediated heterologous bypass, using the RecA-made recombination intermediates. Under optimal reaction conditions for RuvAB (100 nM RuvA, 300 nM RuvB for 0.25 to 0.5 mM DNA), we observed little or no effect of 30 to

Bypass of DNA Heterologies by RuvA and RuvB

300 nM SSB protein on either the three- or four-strand branch migration reactions (data not shown). However, at sub-optimal RuvB concentrations (125 nM RuvA and 185 nM RuvB), addition of 100 nM SSB protein stimulated recombinational bypass with three-strand intermediates containing 117 bp or 297 bp inserts (Figure 9). Stimulation of the rate of homologous (i.e. reverse) RuvAB-mediated three-strand exchange was also observed. In contrast to these results with three-stranded intermediates, we did not observe stimulation of four-strand reactions by SSB protein under identical reaction conditions (data not shown).

Discussion In previous studies which looked at the effects of RuvA and RuvB on strand exchange reactions mediated by RecA, it was noted that addition of RuvAB stimulated the kinetics of strand exchange through both non-damaged and UV-irradiated substrates (Tsaneva et al., 1992a,b). Further work established that RuvAB possess an ATP-dependent branch migration activity (Iwasaki et al., 1992; Parsons et al., 1992; Parsons & West, 1993; Tsaneva et al., 1992a,b) and intrinsic DNA helicase activity (Tsaneva et al., 1993; Tsaneva & West, 1994). These findings, coupled with observations indicating that RuvAB are able to displace RecA nucleoprotein filaments bound to duplex DNA (Adams et al., 1994), led to the proposal that RuvAB serve a dual role in genetic recombination and DNA repair: (1) to clear the DNA of the proteins used to create the Holliday junction; and (2) to catalyse branch migration. The results obtained here point to a third role for RuvAB: (3) to unwind long tracts of DNA heterology during recombinational repair.

Figure 9. Effect of E. coli SSB protein on RuvAB-mediated threestranded recombinational bypass. Reactions were carried out as described in the legend to Figure 2 using recombination intermediates (0.5 mM) containing heterologous inserts of 117 bp or 297 bp, as indicated. SSB protein (100 nM) was added as indicated, prior to addition of RuvA (125 nM) and RuvB (185 nM) at t = 0 minutes. Samples were withdrawn at the indicated times and the products of forward ( 32P-labelled single-stranded and 32 P-labelled nicked circular DNA containing a loop) and reverse ( 32P-labelled linear duplex) branch migration reactions were analysed by agarose gel electrophoresis followed by autoradiography.

591

Bypass of DNA Heterologies by RuvA and RuvB

RuvAB actively bypass DNA heterologies The main conclusion from the current set of experiments is that RuvA and RuvB, in the absence of other proteins, are able to promote branch migration through large DNA heterologies, in both three- and four-strand reactions. Efficient heterologous bypass requires RuvA, RuvB and a hydrolysable nucleoside triphosphate (Figures 3 and 5). Inserts of approximately 1000 bp were bypassed in three-strand RuvAB reactions and 300 bp in four-strand reactions (Figure 6). The three-strand RuvAB reaction was stimulated by the E. coli SSB protein under sub-optimal reaction conditions (Figure 9), suggesting that SSB protein plays an ancillary role in RuvAB-mediated recombinational repair. Synergism between RecA, RuvAB and SSB protein Previously, RuvAB and SSB protein were observed to stimulate RecA-mediated heterologous exchange in three-strand reactions involving all four proteins (Iype et al., 1994). However, it was not clear from these studies whether RuvAB, RecA and SSB protein were working together, or acting separately, to promote efficient recombinational bypass. In recent work, RuvAB were found to unwind long (approximately 1800 bp) tracts of DNA heterology, in a reaction that was greatly stimulated in the presence of SSB protein (Parsons et al., 1995b). In these experiments, however, homologous strand exchange was not resumed downstream of the region of heterology. The data presented here show that RuvAB promote an efficient heterology bypass reaction, encouraging us to suggest that RuvAB recognise Holliday junctions made by RecA and promote branch migration during genetic recombination and postreplicational repair. The role of SSB protein in these reactions is probably a generic one, i.e. that of binding to single-stranded DNA and preventing its reannealing. At this time however, we cannot rule out the possibility of specific protein-protein interactions between SSB protein, RuvAB and/or RecA which might enhance the synergism between these enzymes. Three-versus four-strand recombinational bypass The size of the (medially located) DNA insert that could be bypassed in a three-strand RuvAB reaction was about three times that in a four-strand reaction (Figures 2, 4 and 6). Despite this difference, the four-strand bypass reaction catalysed by RuvAB (limit 300 to 500 bp) appears significantly more efficient than similar reactions driven by RecA (limit <100 bp; Hahn et al., 1988). Indeed, kinetic data (Figures 7 and 8) suggest that RuvAB catalyse very efficient four-strand exchange, especially through homologous DNA, since four-strand

branch migration is more rapid than three-strand branch migration (Figures 7 and 8), and also appears to exhibit a lower ATP requirement (Figures 3 and 5). Role(s) for junction structure during homologous branch migration and heterologous bypass Early model building studies indicated that base-pairs could be exchanged at the crossover point of the Holliday junction without extensive DNA unwinding and/or base-pair disruption (Sigal & Alberts, 1972), indicating that, at least in principle, branch migration though homologous DNA sequences (i.e. substrates lacking DNA mismatches, lesions, insertions or deletions) can proceed without distortion of the DNA helix. More recent studies, however, indicate that the Holliday junction adopts a DNA structure that is quite different from that proposed by Sigal and Alberts, since it takes the form of an anti-parallel structure in which pairs of arms stack coaxially (Lilley & Clegg, 1993). Moreover, junction structure is dependent on salt and buffer conditions (Duckett et al., 1988, 1990), and is modified upon protein binding. For example, the binding of a Holliday junction by RuvA causes it to adopt an unfolded open-square configuration in which the four arms are extended away from each other (Parsons et al., 1995a). These protein-directed structural changes are independent of ionic conditions. The opensquare structure is thought to be more conducive to rapid branch migration than other junction geometries, e.g. parallel or antiparallel (Panyutin et al., 1995), and may be particularly well suited to allow for the bypass of DNA heterologies, without topological entanglement of the DNA. Recombinational bypass models for RuvAB To rationalise the ability of RuvAB to unwind and bypass large DNA heterologies in both threeand four-strand exchange reactions, we propose the following events (Figure 10). Recombination intermediates made by RecA are recognised by RuvA tetramers (not shown) which bind specifically to the point of strand exchange (Figure 10(a) and (b), I). RuvA binding causes the junctions to adopt an open square configuration as indicated (II). RuvB proteins (indicated as thick dark lines) bind to the flanking DNA arms, forming hexameric rings that encircle the DNA. In the case of the four-stranded intermediate, hexameric rings assemble on two opposing duplex arms (Figure 10 (b), III), whereas with the three-strand intermediate (Figure 10 (a), III), one RuvB ring binds to a double-stranded DNA arm while the other binds to a single-stranded DNA arm. Alternatively, since the binding affinity of RuvB for double-stranded DNA is greater than that for single-stranded DNA (Mu¨ller et al., 1993b), it is possible that a single RuvB ring binds to only one arm of the three-strand junction, as has been

592

Bypass of DNA Heterologies by RuvA and RuvB

Figure 10. Model for RuvAB-mediated recombinational bypass of heterologous DNA in three- and four-stranded reactions ((a) and (b), respectively). In both schemes, junctions in the three- or four-strand intermediates (I) are proposed to adopt an open square configuration following RuvA binding (II). RuvB protein (thick dark lines) binds to two of the four junction arms, to form hexameric rings that completely encircle the DNA (III). Heterologous DNA (hatched box) is pulled into the branch migration complex, due to RuvB-mediated DNA translocation, and singlestranded DNA loops are generated as they exit from the protein complex (IV). Once the DNA heterology is completely unwound, homologous branch migration can resume again (V). Strand exchange terminates when the junction reaches the free DNA end (VI). For further details see Discussion.

observed with a three-stranded Y-structure (Hiom et al., 1996). For recombinational bypass, unwinding of the duplex DNA heterology (indicated by the hatched box) is accomplished by individual DNA strands being drawn through the central holes in the RuvB rings, with single-strand DNA loops being spooled out the opposite side (IV and V). In this reaction, the RuvB rings promote heterologous branch migration by DNA helicase action. When the DNA heterology is fully unwound, homologous branch migration can resume again downstream. Re-establishment of homologous branch migration may require idling of one RuvB ring relative to the other, or some form of strand slippage. Alternatively,

branch migration might continue with the DNA sequences out of alignment, such that homologous contacts are established by strand reannealing. SSB protein may enhance heterologous bypass, either by binding to the single-stranded linear DNA product in the three-strand reaction (Figure 10(a), IV) and/or to the single-stranded heteroduplex DNA loops in the three- or four-strand branch migration reactions (V). In both recombinational bypass models (Figure 10(a) and (b)), the RuvB rings are depicted as binding to the heteroduplex DNA arms. This mode of junction arm binding is the one most consistent with DNase I footprinting studies of RuvAB protein bound to synthetic three- and four-armed junctions,

593

Bypass of DNA Heterologies by RuvA and RuvB

and the observed directionality of branch migration (Hiom et al., 1996; Hiom & West, 1995). However, one alternative would be to place the RuvB rings on the opposite pair of arms. This latter arrangement has the advantage that during heterologous DNA unwinding, the DNA insert would be unwound as it passes into the RuvB ring. A similar DNA unwinding mechanism has been proposed for the SV40 large T-antigen which, like RuvB, forms rings that encircle duplex DNA (Dean et al., 1992; Mastrangelo et al., 1989). In the case of SV40 large T-antigen, two hexameric rings sit at the palindromic viral replication origin, and generate single-stranded DNA loops in between the rings (Wessel et al., 1992). It is possible that loop formation during DNA replication and recombinational repair occur by similar mechanisms, and further work will be required to distinguish between these two possible mechanisms for RuvAB-mediated recombinational bypass. Topology of strand exchange The observed ease with which large inserts are bypassed in the three-strand reaction, compared with the four-strand reaction, suggests that reactions involving single-stranded DNA suffer fewer topological constraints than equivalent reactions between two duplex molecules. However, the in vivo situation is likely to be quite different since cells contain a variety of enzymes that affect the topological structure of DNA (Bliska & Cozzarelli, 1987). The effect that they will have on the structure and reactivity of recombination intermediates, especially those containing looped out regions of single-stranded DNA is unknown, and further progress towards understanding the mechanics of strand exchange during genetic recombination and recombinational repair will require the reconstitution of more complete biochemical systems.

Materials and Methods Enzymes and reagents E. coli RecA, RuvA, and RuvB proteins were purified as previously described (Cox et al., 1981; Tsaneva et al., 1992a). Creatine kinase (Sigma), exonuclease III (Promega), Klenow fragment of DNA polymerase I (Promega), proteinase K (Boehringer-Mannheim), S1 nuclease (Promega) and E. coli single-stranded binding protein (Pharmacia) were purchased from the indicated suppliers. Restriction enzymes (BsaI, EcoRI, NsiI, PstI, ScaI and SphI) were purchased from New England Biolabs, bovine serum albumin from BioRad Labs, and terminal transferase from Amersham. Nucleoside triphosphates (ATP, dATP, dCTP, CTP, GTP and UTP) were purchased from Sigma and Pharmacia. Concentrations of nucleotide stocks were determined by spectroscopy. Protein concentrations were determined by standard procedures (Bradford, 1976) using bovine serum albumin as a standard, and are expressed in moles of protein monomers.

DNA substrates The parent phagemid pDEA5.2 f(+) was made by ligating the 2189 bp SphI-EcoRI fragment from pACYC184 to the 2983 SphI-EcoRI fragment from pDEA-7Z f(+) (Shah et al., 1994). To prepare a series of branch migration substrates that differ in their overall length, dsDNA from pDEA5.2 f(+) was digested with exonuclease III, starting from the unique EcoRI site. This EcoRI site lies in a non-essential region of the phagemid, within a few base-pairs from a unique NsiI site. Following NsiI and EcoRI restriction, linearised pDEA5.2 f(+) was reacted with exonuclease III for variable periods of time to generate a series of linear DNA fragments that differ in their overall length. Exonuclease III digestion of the EcoRI-NsiI cleaved pDEA5.2 f(+) DNA proceeds unidirectional away from the EcoRI site, due to protection of the other DNA end by the 3' overhang generated by NsiI. Small aliquots were taken out of the exonuclease III digestion at timed intervals and the nuclease reactions stopped using SDS and proteinase K. The digestion products were then reacted with S1 nuclease to create blunt DNA ends. These DNAs were recircularised using T4 DNA ligase and transformed into E. coli JM109 F+ cells. Plasmid-containing cells were propagated on minimal medium plates containing 100 mg/ml carbenicillin. Six derivatives of pDEA5.2 f(+) were generated in this manner: pDEAB1 (3438 bp), pDEAB2 (3555 bp), pDEAB3 (3694 bp), pDEAB4 (3735 bp), pDEAB5 (4377 bp) and pDEAB6 (4923 bp). The pDEABx DNAs were completely homologous with each other, except for a variable length of heterologous, non-essential DNA derived from pACYC184. The purity and identity of each DNA was verified by restriction mapping and dideoxy sequencing using a PRISMTM Ready Reaction DyeDeoxyTM Terminator Cycle Sequencing Kit, purchased from Perkin Elmer. Analyses of the DNA sequencing products were carried out on an ABI Model 373A DNA Sequencer using software supplied by the manufacturer (Perkin Elmer). The pUC/M13 Reverse Sequencing Primer 5'-d[TCACACAGGAAACAGCTATGAC]-3' and the pUC/M13 Forward Sequencing Primer 5'-d[CGCCAGGGTTTTCCCAGTCACGAC]-3' (Promega) were used in PCR reactions prior to sequencing across the pACYC184-derived inserts. Circular (+) single-stranded pDEAB1 DNA was prepared using the helper phage M13K07 (Promega), according to the supplier’s instructions. Supercoiled plasmid DNA was purified using a Qiagen column (Hybaid). To prepare gapped duplex DNA, the complementary 3263 bp BsaI-PstI fragment of pDEAB1 was purified through two neutral sucrose gradients, and annealed to homologous circular ssDNA by heating to 95°C, followed by slow cooling to room temperature. The resultant gapped duplex DNA (gDNA) contained a defined 175 nucleotide single-stranded gap, and was isolated from excess ssDNA by preparative agarose gel electrophoresis. Linear duplex DNAs containing either 0 bp (pDEAB1), 117 bp (pDEAB2), 256 bp (pDEAB3), 297 bp (pDEAB4), 939 bp (pDEAB5) or 1485 bp (pDEAB6) DNA inserts (relative to pDEAB1) were prepared by PstI digestion of the indicated dsDNA. The PstI-linearised DNAs were 3'-end-labelled using [a-32P] ddATP (Amersham) and terminal transferase, and purified away from free label by ethanol precipitation. To protect the labelled DNAs from radiolysis, they were dialysed against 10 mM Tris-HCl (pH 8.0), 1 mM EDTA containing 10% (v/v) ethanol. 32P-labelled DNAs stored in this manner could be used for periods up to four

594 weeks. DNA concentrations given in the text are expressed in moles of nucleotide residues. Preparation of recombination intermediates Strand exchange reactions (5.4 ml) between either circular single-stranded pDEAB1 DNA (12 mM) or circular gapped duplex pDEAB1 DNA (17 mM) and 3'-32P-labelled linear duplex pDEABx DNA (1 to 3 mM) were carried out in 20 mM Tris-HCl (pH 7.5), 13 mM MgCl2 , 2 mM dithiothreitol, 2 mM ATP, 20 mM phosphocreatine, 3.2 units/ml phosphocreatine kinase, and 100 mg/ml bovine serum albumin. For three-strand reactions, E. coli SSB protein was added to 1.6 mM. Strand exchange was initiated by incubation of the ssDNA or gDNA with RecA (20 mM) for five minutes at 37°C, followed by addition of the linear duplex DNA. After a set period of time (i.e. usually between 5 and 45 minutes, shorter time periods for completely homologous DNAs), the RecA reactions were stopped and the branch migration intermediates deproteinised by the addition of SDS (0.2%), EDTA (40 mM) and proteinase K (0.2 mg/ ml). These digests were carried out at 37°C for 15 minutes. Recombination intermediates were then purified away from degraded RecA (−/+SSB) protein by passage through a 3.5 ml Sepharose CL-2B column, previously equilibrated with 20 mM Tris-HCl (pH 8.0), 5 mM MgCl2 , 1 mM dithiothreitol and 100 mg/ml bovine serum albumin. The final concentration of recombination intermediates was determined by quantification of the 32 P-label. Generally, three-strand intermediates were used within ten working days of preparation and four-strand intermediates were used within two working days. Branch migration assays Unless otherwise stated, reaction mixtures (200 ml) contained 20 mM Tris-HCl (pH 7.5), 1 mM ATP, 0.25 to 0.5 mM RecA-made recombination intermediates, 2 mM dithiothreitol, 100 mg/ml bovine serum albumin, 50 mM NaCl and 12.5 mM MgCl2 . In the indicated experiments, 30 to 300 nM of E. coli single-stranded binding protein was added to the reactions. Branch migration was initiated by the addition of RuvA (30 nM) and RuvB (100 nM), premixed and prewarmed to 37°C. At set times thereafter, small aliquots (10 ml) were removed from the main reaction, and branch migration stopped by the addition of 5 × stop buffer: 100 mM Tris-HCl (pH 7.5), 1.0% (w/v) SDS, 200 mM EDTA, 1 mg/ml proteinase K. After a further incubation at 37°C for 15 minutes the proteinase-treated reactions were set at room temperature. Glycerol load buffer (3 ml) was added to each sample prior to electrophoresis. Gel electrophoresis DNA samples were analysed by electrophoresis through 1.0% to 1.2% (w/v) agarose gels in a TAE buffer system (Sambrook et al., 1989). Electrophoresis was for three hours at 4.3 V/cm, with constant buffer recirculation. Ethidium bromide (0.5 mg/ml) was included in the gels and electrophoresis buffer to stabilise the four-strand intermediates from dissociation. Unless otherwise stated, ethidium bromide was not used when analysing three-strand reaction products. After completion of electrophoresis, the agarose gels were dried and the 32P-labelled DNAs visualised by

Bypass of DNA Heterologies by RuvA and RuvB

exposure of the dried gels to Kodak XAR film. The data were quantified using a Molecular Dynamics Phosphorimager. The percentage of branch migration intermediates converted to the double-labelled linear product or single-labelled open circular, looped, or single-stranded circular product was calculated, taking into account the gel background noise and the amount of branch migration intermediates and products present at the beginning of the reactions.

Acknowledgements We thank Alison Mitchell for providing RuvB protein, Berndt Mu¨ller for advice on purification of RecA-made intemediates, John Nicholson for photography, and other members of the West laboratory for helpful advice and encouragement.

References Adams, D. E., Tsaneva, I. R. & West, S. C. (1994). Dissociation of RecA filaments from duplex DNA by the RuvA and RuvB DNA repair proteins. Proc. Natl Acad. Sci. USA, 91, 9901–9905. Adams, D. E. & West, S. C. (1995a). Relaxing and unwinding on Holliday: DNA helicase-mediated branch migration. Mutat. Res. DNA Repair, 337, 149–159. Adams, D. E. & West, S. C. (1995b). Unwinding of closed circular DNA by the Escherichia coli RuvA and RuvB recombination/repair proteins. J. Mol. Biol. 247, 404–417. Ariyoshi, M., Vassylyev, D. G., Iwasaki, H., Nakamura, H., Shinagawa, H. & Morikawa, K. (1994). Atomic structure of the RuvC resolvase: a Holliday junction-specific endonuclease from E. coli. Cell, 78, 1063–1072. Bennett, R. J. & West, S. C. (1995a). RuvC protein resolves Holliday junctions via cleavage of the continuous (non-crossover) strands. Proc. Natl Acad. Sci. USA, 92, 5635–5639. Bennett, R. J. & West, S. C. (1995b). Structural analysis of the RuvC-Holliday junction complex reveals an unfolded junction. J. Mol. Biol. 252, 213–226. Bennett, R. J., Dunderdale, H & West, S. C. (1993). Resolution of Holliday junctions by RuvC resolvase: cleavage specificity and DNA distortion. Cell, 74, 1021–1031. Benson, F., Collier, S. & Lloyd, R. G. (1991). Evidence of abortive recombination in ruv mutants of Escherichia coli K-12. Mol. Gen. Genet. 225, 266–272. Bianchi, M. E. & Radding, C. M. (1983). Insertions, deletions and mismatches in heteroduplex DNA made by recA protein. Cell, 35, 511–520. Bliska, J. B. & Cozzarelli, N. R. (1987). Use of site-specific recombination as a probe of DNA structure and metabolism in vivo. J. Mol. Biol. 194, 205–218. Bradford, M. M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. Connolly, B., Parsons, C. A., Benson, F. E., Dunderdale, H. J., Sharples, G. J., Lloyd, R. G. & West, S. C. (1991). Resolution of Holliday junctions in vitro requires Escherichia coli ruvC gene product. Proc. Natl Acad. Sci. USA, 88, 6063–6067.

Bypass of DNA Heterologies by RuvA and RuvB

Cox, M. M., McEntee, K. & Lehman, I. R. (1981). A simple and rapid procedure for the large scale purification of the RecA protein of Escherichia coli. J. Biol. Chem. 256, 4676–4678. Dean, F. B., Borowiec, J. A., Eki, T. & Hurwitz, J. (1992). The simian virus-40 T-antigen double hexamer assembles around the DNA at the replication origin. J. Biol. Chem. 267, 14129–14137. Duckett, D. R., Murchie, A. I. H., Diekmann, S., Von Kitzing, E., Kemper, B. & Lilley, D. M. J. (1988). The structure of the Holliday junction and its resolution. Cell, 55, 79–89. Duckett, D. R., Murchie, A. I. H. & Lilley, D. M. J. (1990). The role of metal ions in the conformation of the four-way junction. EMBO J. 9, 583–590. Dunderdale, H. J., Benson, F. E., Parsons, C. A., Sharples, G. J., Lloyd, R. G. & West, S. C. (1991). Formation and resolution of recombination intermediates by E. coli RecA and RuvC proteins. Nature, 354, 506–510. Dunderdale, H. J., Sharples, G. J., Lloyd, R. G. & West, S. C. (1994). Cloning, over-expression, purification and characterization of the Escherichia coli RuvC Holliday junction resolvase. J. Biol. Chem. 269, 5187–5194. Hahn, T. R., West, S. C. & Howard-Flanders, P. (1988). RecA-mediated strand exchange reactions between duplex DNA molecules containing damaged bases, deletions and insertions. J. Biol. Chem. 263, 7431– 7436. Hiom, K. & West, S. C. (1995). The mechanism of branch migration in homologous recombination: Assembly of a RuvAB-Holliday junction complex in vitro. Cell, 80, 787–793. Hiom, K., Tsaneva, I. R. & West, S. C. (1996). The directionality of RuvAB-mediated branch migration: in vitro studies with three-armed junctions. Genes Cells, 1, 443–451. Iwasaki, H., Shiba, T., Makino, K., Nakata, A. & Shinagawa, H. (1989). Overproduction, purification, and ATPase activity of the Escherichia coli RuvB protein involved in DNA repair. J. Bacteriol. 171, 5276–5280. Iwasaki, H., Takahagi, M., Shiba, T., Nakata, A. & Shinagawa, H. (1991). Escherichia coli RuvC protein is an endonuclease that resolves the Holliday structure. EMBO J. 10, 4381–4389. Iwasaki, H., Takahagi, M., Nakata, A. & Shinagawa, H. (1992). Escherichia coli RuvA and RuvB proteins specifically interact with Holliday junctions and promote branch migration. Genes Dev. 6, 2214–2220. Iype, L. E., Wood, E. A., Inman, R. B. & Cox, M. M. (1994). RuvA and RuvB proteins facilitate the bypass of heterologous DNA insertions during RecA proteinmediated strand exchange. J. Biol. Chem. 269, 24967–24978. Iype, L. E., Inman, R. B. & Cox, M. M. (1995). Blocked RecA protein-mediated DNA strand exchange reactions are reversed by the RuvA and RuvB proteins. J. Biol. Chem. 270, 19473–19480. Kowalczykowski, S. C. (1991). Biochemistry of genetic recombination: energetics and mechanism of DNA strand exchange. Annu. Rev. Biophys. Biophys. Chem. 20, 539–575. Lilley, D. M. J. & Clegg, R. M. (1993). The structure of the four-way junction in DNA. Annu. Rev. Biophys. Biomol. Struct. 22, 299–328. Livneh, Z. & Lehman, I. R. (1982). Recombinational bypass of pyrimidine dimers promoted by the RecA

595 protein of Escherichia coli. Proc. Natl Acad. Sci. USA, 79, 3171–3175. Lloyd, R. G. & Sharples, G. J. (1993a). Dissociation of synthetic Holliday junctions by E. coli RecG protein. EMBO J. 12, 17–22. Lloyd, R. G. & Sharples, G. J. (1993b). Processing of recombination intermediates by the RecG and RuvAB proteins of Escherichia coli. Nucl. Acids Res. 21, 1719–1725. Lloyd, R. G., Porton, M. C. & Buckman, C. (1988). Effect of recF, recJ, recN, recO and ruv mutations on ultraviolet survival and genetic recombination in a recD strain of Escherichia coli. Mol. Gen. Genet. 212, 317–324. Mahdi, A. A., Sharples, G. J., Mandal, T. N. & Lloyd, R. G. (1996). Holliday junction resolvases encoded by homologous rusA genes in Escherichia coli K-12 and phage-82. J. Mol. Biol. 257, 561–573. Mandal, T. N., Mahdi, A. A., Sharples, G. J. & Lloyd, R. G. (1993). Resolution of Holliday intermediates in recombination and DNA repair: indirect suppression of ruvA, ruvB, and ruvC mutations. J. Bacteriol. 175, 4325–4334. Mastrangelo, I. A., Hough, P. V. C., Wall, J. S., Dobson, M., Dean, F. B. & Hurwitz, J. (1989). ATP-dependent assembly of double hexamers of SV40 T antigen at the viral origin of DNA replication. Nature, 338, 658–662. Matic, I., Rayssiguier, C. & Radman, M. (1995). Interspecies gene exchange in bacteria: the role of SOS and mismatch repair systems in evolution of species. Cell, 80, 507–515. Mitchell, A. H. & West, S. C. (1994). Hexameric rings of Escherichia coli RuvB protein: Cooperative assembly, processivity, and ATPase activity. J. Mol. Biol. 243, 208–215. Mitchell, A. H. & West, S. C. (1996). Role of RuvA in branch migration reactions catalyzed by the RuvA and RuvB proteins of Escherichia coli. J. Biol. Chem., 271, 19497–19502. Morel, P., Stasiak, A., Ehrlich, S. D. & Cassuto, E. (1994). Effect of length and location of heterologous sequences on RecA-mediated strand exchange. J. Biol. Chem. 269, 19830–19835. Mu¨ller, B., Tsaneva, I. R. & West, S. C. (1993a). Branch migration of Holliday junctions promoted by the Escherichia coli RuvA and RuvB proteins: I. Comparison of the RuvAB- and RuvB-mediated reactions. J. Biol. Chem. 268, 17179–17184. Mu¨ller, B., Tsaneva, I. R. & West, S. C. (1993b). Branch migration of Holliday junctions promoted by the Escherichia coli RuvA and RuvB proteins: II. Interaction of RuvB with DNA. J. Biol. Chem. 268, 17185–17189. Otsuji, N., Iyehara, H. & Hideshima, Y. (1974). Isolation and characterisation of an Escherichia coli ruv mutant which forms nonseptate filaments after low doses of ultraviolet irradiation. J. Bacteriol. 117, 337–344. Panyutin, I. G., Biswas, I. & Hsieh, P. (1995). A pivotal role for the structure of the Holliday junction in DNA branch migration. EMBO J. 14, 1819–1826. Parsons, C. A. & West, S. C. (1993). Formation of a RuvAB-Holliday junction complex in vitro. J. Mol. Biol. 232, 397–405. Parsons, C. A., Tsaneva, I., Lloyd, R. G. & West, S. C. (1992). Interaction of Escherichia coli RuvA and RuvB proteins with synthetic Holliday junctions. Proc. Natl Acad. Sci. USA, 89, 5452–5456.

596

Bypass of DNA Heterologies by RuvA and RuvB

Parsons, C. A., Stasiak, A., Bennett, R. J. & West, S. C. (1995a). Structure of a multisubunit complex that promotes DNA branch migration. Nature, 374, 375–378. Parsons, C. A., Stasiak, A. & West, S. C. (1995b). The E. coli RuvAB proteins branch migrate Holliday junctions through heterologous DNA sequences in a reaction facilitated by SSB. EMBO J. 14, 5736–5744. Radding, C. M. (1991). Helical interactions in homologous pairing and strand exchange driven by RecA protein. J. Biol. Chem. 266, 5355–5358. Roca, A. I. & Cox, M. M. (1990). The RecA protein: structure and function. Crit. Rev. Biochem. Mol. Biol. 25, 415–456. Rupp, W. D., Wilde, C. E., Reno, D. L. & Flanders, P. (1971). Exchanges between DNA strands in ultraviolet-irradiated Escherichia coli. J. Mol. Biol. 61, 25–44. Sambrook, E. F., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Shah, R., Bennett, R. J. & West, S. C. (1994). Genetic recombination in E. coli: RuvC protein cleaves Holliday junctions at resolution hotspots in vitro. Cell, 79, 853–864. Sharples, G. J., Benson, F. E., Illing, G. T. & Lloyd, R. G. (1990). Molecular and functional analysis of the ruv region of Escherichia coli K-12 reveals three genes involved in DNA repair and recombination. Mol. Gen. Genet. 221, 219–226. Sharples, G. J., Whitby, M. C., Ryder, L. & Lloyd, R. G. (1994). A mutation in helicase motif-III of Escherichia coli RecG protein abolishes branch migration of Holliday junctions. Nucl. Acids Res. 22, 308–313. Shiba, T., Iwasaki, H., Nakata, A. & Shinagawa, H. (1991). SOS-inducible DNA repair proteins, RuvA and RuvB, of Escherichia coli: Functional interactions between RuvA and RuvB for ATP hydrolysis and renaturation of the cruciform structure in supercoiled DNA. Proc. Natl Acad. Sci. USA, 88, 8445–8449. Shiba, T., Iwasaki, H., Shinagawa, H. & Kyogoku, Y. (1994). Binding of cleavage of synthetic Holliday junctions by RuvC protein. Nucl. Acids Symp. Series, 31, 221–222. Shinagawa, H., Makino, K., Amemura, M., Kimura, S., Iwasaki, H. & Nakata, A. (1988). Structure and regulation of the Escherichia coli ruv operon involved in DNA repair and recombination. J. Bacteriol. 170, 4322–4329.

Sigal, N. & Alberts, B. (1972). Genetic recombination: The nature of a crossed strand exchange between two homologous DNA molecules. J. Mol. Biol. 71, 789–793. Stacey, K. A. & Lloyd, R. G. (1976). Isolation of Rec− mutants from an F-prime merodiploid strain of Escherichia coli K-12. Mol. Gen. Genet. 143, 223–232. Stasiak, A., Tsaneva, I. R., West, S. C., Benson, C. J. B., Yu, X. & Egelman, E. H. (1994). The Escherichia coli RuvB branch migration protein forms double hexameric rings around DNA. Proc. Natl Acad. Sci. USA, 91, 7618–7622. Tsaneva, I. R. & West, S. C. (1994). Targeted versus non-targeted DNA helicase activity of the RuvA and RuvB proteins of Escherichia coli. J. Biol. Chem. 269, 26552–26558. Tsaneva, I. R., Illing, G. T., Lloyd, R. G. & West, S. C. (1992a). Purification and properties of the RuvA and RuvB proteins of Escherichia coli. Mol. Gen. Genet. 235, 1–10. Tsaneva, I. R., Mu¨ller, B. & West, S. C. (1992b). ATP-dependent branch migration of Holliday junctions promoted by the RuvA and RuvB proteins of E. coli. Cell, 69, 1171–1180. Tsaneva, I. R., Mu¨ller, B. & West, S. C. (1993). The RuvA and RuvB proteins of Escherichia coli exhibit DNA helicase activity in vitro. Proc. Natl Acad. Sci. USA, 90, 1315–1319. Wessel, R., Schwizer, J. & Stahl, H. (1992). Simian virus 40 T-antigen DNA helicase is a hexamer which forms a binary complex during bidirectional unwinding from the viral origin of DNA replication. J. Virol. 66, 804–815. West, S. C. (1992). Enzymes and molecular mechanisms of homologous recombination. Annu. Rev. Biochem. 61, 603–640. West, S. C. (1996). DNA helicases: new breeds of translocating motors and molecular pumps. Cell, 86, 177–180. Whitby, M. C., Ryder, L. & Lloyd, R. G. (1993). Reverse branch migration of Holliday junctions by RecG protein: A new mechanism for resolution of intermediates in recombination and DNA repair. Cell, 75, 341–350. Whitby, M. C., Sharples, G. J. & Lloyd, R. G. (1995). The RuvAB and RecG proteins of Escherichia coli. In Nucleic Acids and Molecular Biology (Eckstein, F. & Lilley, D. M. J., eds), vol. 9, pp. 66–83, SpringerVerlag, Berlin.

Edited by J. Karn (Received 13 June 1996; received in revised form 27 August 1996; accepted 29 August 1996)