C-C motif chemokine ligand (CCL) production in equine peripheral blood mononuclear cells identified by newly generated monoclonal antibodies

Veterinary Immunology and Immunopathology 204 (2018) 28–39

Contents lists available at ScienceDirect

Veterinary Immunology and Immunopathology journal homepage: www.elsevier.com/locate/vetimm

C-C motif chemokine ligand (CCL) production in equine peripheral blood mononuclear cells identified by newly generated monoclonal antibodies

T

Christiane L. Schnabela, Michelle Wemettea, Susanna Babasyana, Heather Freera, ⁎ Cynthia Baldwinb, Bettina Wagnera, a b

Department of Population Medicine and Diagnostic Sciences, College of Veterinary Medicine, Cornell University, Ithaca, NY, USA Paige Laboratory, Department of Veterinary and Animal Sciences, University of Massachusetts, Amherst, MA, USA

A R T I C LE I N FO

A B S T R A C T

Keywords: Horse Chemokine CCL Monoclonal antibody Flow cytometry

Chemokines are soluble molecules directing immune cell trafficking and homing, mediating inflammation, and initiating immune responses to infection. In horses, the analysis of chemokines has been limited by the lack of specific antibodies. We generated mAbs specific for the equine C-C motif chemokine ligands (CCL) CCL2 (MCP1), CCL3 (MIP-1α), CCL5 (RANTES) and CCL11 (eotaxin) using hybridoma technology. Antibody specificity was confirmed by intracellular staining of Chinese Hamster Ovary cells transfected with expression vectors encoding for CCL2, CCL3, CCL5, or CCL11. Transfectants were stained with the anti-CCL mAbs. Flow cytometric analysis confirmed the specificity of the different mAbs for the respective chemokine. In addition, equine PBMC were stained after isolation, culture in medium, or stimulation with LPS, or PMA and ionomycin. CCL2 was detected in few cluster of differentiation (CD)14+ monocytes in PBMC stimulated with PMA and ionomycin for 2 h. CCL3 was produced by CD14+ monocytes after 4–6 h culture in medium. After stimulation with PMA and ionomycin for 12–24 h, CCL3 was also expressed in lymphocytes, mainly in CD4+ T cells. Stimulation with LPS reduced the percentage of CCL3+ monocytes in PBMC. CCL5 was detected in PBMC ex vivo in CD4+ and CD8+ T cells. Culture of PBMC for longer than 6 h or stimulation with PMA and ionomycin reduced the percentage of CCL5+ cells. CCL11 was produced by CD4+ T cells in PBMC after stimulation with PMA and ionomycin for 4–24 h. After LPS stimulation of PBMC, CCL2, CCL5, and CCL11 production were comparable to culture in medium alone. ELISAs for each of the four chemokines were developed using pairs of anti-equine CCL mAbs. Supernatants from PMA and ionomycin stimulated PBMC contained detectable amounts of CCL2, CCL3 and CCL5, while CCL11 secretion could be stimulated from equine tracheal epithelial cells in response to IL-4. The newly generated mAbs for equine CCL chemokines facilitate the quantitative analysis of intracellular chemokine production by flow cytometry and soluble chemokines by ELISA. The CCL mAbs are valuable tools to improve the evaluation of innate immune responses in horses.

1. Introduction

leukocyte migration, particularly in mononuclear cells (MNC). CCLs are important early initiators of various immunological responses. The chemokines CCL2, CCL3, CCL5 and CCL11 have been designated (pro-) inflammatory chemokines according to their induction and effects in humans and laboratory animals (Mantovani et al., 2004). CCL2 (Macrophage Chemoattractant Protein 1, MCP-1) recruits monocytes into tissues in mice and people (Lu et al., 1998; Mantovani et al., 2004). It is furthermore chemotactic for human T cells (Carr et al.,

Chemokines are small molecules (7–15 kDD) that mediate tissue homeostasis, leukocyte recruitment and activation. Based on their amino acid structure they are divided into CXC, CX3C, C and CC chemokines. CC chemokines (C-C motif chemokine ligand, CCL) are characterized by two conserved, successive cysteine residues near the Nterminus (IUIS/WHO, 2002). Members of this group stimulate

Abbreviations: CCL, C-C motif chemokine ligand; CHO, Chinese hamster ovary cells; EEC, equine endothelial cells; ERU, equine recurrent uveitis; ETEC, equine tracheal respiratory epithelial cells; FPLC, Fast Protein Liquid Chromatography; MCP, Macrophage Chemoattractant Protein; MIP, Macrophage Inflammatory protein; MNC, mononuclear cells; mRNA, messenger ribonucleic acid; RANTES, Regulated on Activation, Normal T cell Expressed and Secreted ⁎ Corresponding author. E-mail address: [email protected] (B. Wagner). https://doi.org/10.1016/j.vetimm.2018.09.003 Received 27 April 2018; Received in revised form 4 September 2018; Accepted 10 September 2018 0165-2427/ © 2018 Elsevier B.V. All rights reserved.

Veterinary Immunology and Immunopathology 204 (2018) 28–39

C.L. Schnabel et al.

Wagner et al., 2012) (Supplementary Fig. 1a). After generation of stable transfectants of Chinese hamster ovary (CHO) cells (Wagner et al., 2005) rIL-4/CCL fusion proteins were purified from serum-free cell culture supernatants using an anti-IL-4 affinity column (Wagner et al., 2012) and an ÄKTA Fast Protein Liquid Chromatography (FPLC) instrument (GE Healthcare, Piscataway, NJ, USA).

1994) and can activate basophils (Nickel et al., 1999). CCL3 (Macrophage Inflammatory protein 1 α, MIP-1α) is chemotactic for human monocytes, macrophages and to a lesser extent for T cells (Lee et al., 2000; Loetscher et al., 1994). CCL3 furthermore promotes human monocyte adhesion to endothelia (Vaddi and Newton, 1994), eosinophil migration (Rot et al., 1992) and it contributes to Th1 polarization (Nickel et al., 1999). CCL5 (Regulated on Activation, Normal T cell Expressed and Secreted, RANTES) is chemotactic for human monocytes, T memory cells (Schall et al., 1990) and eosinophils (Ebisawa et al., 1994; Kuna et al., 1998). CCL11 (Eotaxin-1) primarily mediates eosinophil chemotaxis in people (Ponath et al., 1996). It is furthermore chemotactic for human Th2 cells and basophils (Nickel et al., 1999) and promotes eosinophil release from the bone marrow in mice (Palframan et al., 1998). In horses, basal chemokine messenger ribonucleic acid (mRNA) expression has been demonstrated in skin, lung, liver, spleen, jejunum, colon, and kidney (Benarafa et al., 2000). Induction of chemokine mRNA was furthermore analyzed in pathogeneses of different immunemediated diseases, such as equine recurrent uveitis (ERU) (Gilger et al., 2002), insulin resistance (Burns et al., 2010), laminitis (Steelman et al., 2013), Culicoides hypersensitivity (Benarafa et al., 2002), equine herpesvirus type 1 infection (Johnstone et al., 2016; Wimer et al., 2011), and Equine Infectious Anemia Virus infection (Covaleda et al., 2010). However, biological effects are dependent on protein secretion, which can often be regulated beyond mRNA transcription (Wu and Brewer, 2012). Few reports have evaluated equine CCL chemokines at the protein level. Recently, equine CCL2 was measured by a custom fluorescent bead-based assay and was elevated in serum after LPS infusion (Bonelli et al., 2017). Equine CCL2 was also detected by bead-based assays in serum of horses with recurrent uveitis (Curto et al., 2016) or heaves (Lavoie-Lamoureux et al., 2012). CCL2 correlated positively with lung resistance in challenged heaves-affected horses while it was not indicative of the disease status itself (Lavoie-Lamoureux et al., 2012). In this report CCL2 was explored as a candidate marker of systemic inflammation, but its specific function in heaves pathogenesis was not analyzed. Equine CCL3 analyzed using a commercial bead-based assay could not be detected in serum or aqueous humor of healthy horses or horses with uveitis (Curto et al., 2016). Human rRANTES was shown to be bioactive in horses when applied intradermally. Equine CCL5 (RANTES) was then quantified by an ELISA for human RANTES. Its concentration was higher in aqueous humor of ERU affected than in healthy eyes (Gilger et al., 2002) and it was released from equine platelets after stimulation in vitro (Dunkel et al., 2012). Equine rCCL11 was biologically active and chemotactic for horse eosinophils in vitro (Benarafa et al., 2002; Weston et al., 2006). In summary, the knowledge about the protein expression of equine CCL chemokines is still limited, mainly due to the lack of equine CCLspecific reagents and assays with confirmed specificity for the respective equine chemokine. As a result, CCL chemokines in horses are poorly characterized regarding their cellular sources, induction pathways, and their functional roles during homeostasis and immune responses to infectious and inflammatory diseases. In this report, we describe the development of new mAbs specific for equine CCL2, CCL3, CCL5 and CCL11 and the expression of these chemokines in equine monocytes and T cells after different stimulation conditions.

2.2. Generation of mAbs specific for equine CCL chemokines One BALB/c mouse per recombinant chemokine was immunized with equine rCCL2, rCCL3 or rCCL11 produced in yeast (Table 2). Additionally, one mouse each was immunized with purified rIL-4/CCL3, or rIL-4/CCL5 (Table 2). The immunizations and subsequent cell fusions were performed as previously described (Wagner et al., 2012, 2008b, 2003) (Supplementary Fig. 1b, c). The supernatants of hybridoma clones were tested against respective rCCL proteins by ELISA as previously described for mAb development against other equine immune targets (Wagner et al., 2003). Briefly, ELISA plates (Nunc, Maxisorb, Sigma Aldrich, St. Louis, MO, USA) were either coated with rCCL produced in yeast or coated with polyclonal anti-equine-IL-4 antibody (R&D Systems, Minneapolis, MN, USA). The latter plates were subsequently incubated with CHO cell supernatants containing rIL-4/CCL fusion proteins. In the following steps, incubation with hybridoma supernatants and detection by peroxidase-conjugated goat anti-mouse (H + L) Ab (Jackson ImmunoResearch, West Grove, PA, USA) and tetramethylbenzidine substrate (Sigma Aldrich) were performed (Supplementary Fig. 1d). Equine CCL chemokine specific hybridomas were selected for mAb production by limiting dilution and the resulting anti-CCL mAb clones were adapted to serum free medium (Hybridoma-SFM, Gibco, ThermoFisher Scientific, Waltham, MA, USA). From serum-free hybridoma supernatants mAbs were purified using a HiTrap Protein G HP column (GE Healthcare) on an FPLC instrument (ÄKTA FPLC, GE Healthcare) as previously described (Schnabel et al., 2017; Wagner et al., 2003). The isotype of each anti-CCL mAb was determined using mouse monoclonal antibody isotyping reagents (Sigma Aldrich). 2.3. Chemokine expression by CHO cell transfectants For screening of mAb binding and specificity, CHO cells were transiently transfected with each of the four rIL-4/CCL expression vectors using Geneporter II transfection reagent (Gene Therapy Systems, San Diego, CA, USA) as previously described (Wagner et al., 2005). The transfected cells were harvested after 24 h of incubation and fixed in 2% (v/v) formaldehyde (Sigma Aldrich). 2.4. Horses and blood sampling Heparinized peripheral blood was repeatedly obtained from six healthy adult Icelandic horses (4–6 years old) by jugular venipuncture. Samples from four of the horses (two non-pregnant mares and two geldings) were used for flow cytometric detections of native equine chemokines. Samples from two pregnant mares (first trimester) were used for detection of secreted native CCLs by ELISA. The animal sampling procedure was approved by the Institutional Animal Care and Use Committee at Cornell University (protocol #2011-0011).

2. Materials and methods 2.5. PBMC isolation and stimulation 2.1. Recombinant CCL2, CCL3, CCL5 and CCL11 For the confirmation of anti-CCL mAb specificity for native equine chemokines, PBMC were isolated from peripheral blood by density gradient centrifugation (Ficoll-Paque Plus, GE Healthcare). PBMC were aliquoted and used under the following conditions: (i) immediately after isolation (PBMC ex vivo), or (ii) after incubation in tissue culture plates (Costar, Corning, Corning, NY, USA) with cell culture medium

Recombinant equine CCL2, CCL3, and CCL11 produced in yeast were kindly provided by Joanna LaBresh, Kingfisher, Saint Paul, MN, USA. Additionally, equine CCL2, CCL3, CCL5, and CCL11 chemokine genes were cloned (Table 1) and expressed as fusion proteins with equine IL-4 as previously described (rIL-4/CCL expression vectors, 29

Veterinary Immunology and Immunopathology 204 (2018) 28–39

C.L. Schnabel et al.

Table 1 Equine CCL chemokine cloning to produce rIL-4/CCL fusion proteins. Chemokine

Alternative name

GenBank accession number

Primera

RNA source

CCL2

MCP-1

NM_001081931

PBMC

CCL3

MIP-1α

NM_001114941

CCL5

RANTES

NM_001081863

CCL11

Eotaxin

NM_001081871

f GGATCCTCAGCCAGATGCAATTAATTCTC r AAGCTTTCAAGGCTTTGGAGTTTGGGCTT f GGATCCTGTACCATTCGGTGCCGACACC r AAGCTTTCAGGCGCTCAGCTCCAGGTC f GGATCC CTCCCCATATGCCTCGGACACCA r AAGCTTCTAGCTCATCTCCAAAGTGTTGATG f GGATCCTCAGCCAGTTTCTATCTCG r AAGCTTTCAAAAAGATGAATACTTTG

a

PBMC Thymus

Forward primers (f) with BamHI restriction site (underlined), reverse primers (r) with HindIII restriction site (underlined).

2.7. Cell staining and flow cytometric analysis

Table 2 Anti-equine CCL mAbs generated. Target

Clone

CCL2

49 53 104 77 289 290 46 91 96 24 25

CCL3

CCL5

CCL11

Immunogen

Intracellular staining for flow cytometry

ELISA

(source) rCCL2 (yeast)

r CCLa + + # + + + + + + + +

coating + + +++ +++ + n.t. + +++ + + +++

rCCL3 (yeast) rIL-4/CCL3 (mammalian)a rIL-4/CCL5 (mammalian)a rCCL11 (yeast)

native CCLb + +++ n. t. + + +++ + + +++ +++ –

Intracellular staining of CHO cell transfectants with anti-CCL mAbs was performed in saponin buffer (PBS, supplemented with 0.5% (w/v) BSA, 0.5% (w/v) saponin and 0.02% (w/v) NaN3). All mAbs were used at 2 μg/ml. As controls, anti-equine IL-4 (clone 13G7) (Wagner et al., 2006) and an isotype control were included in each experiment. Binding of the mAbs was detected by a secondary goat-anti-mouse (H + L) antibody conjugated to Alexa Fluor 647 (Jackson ImmunoResearch) (Supplementary Fig. 1e). Intracellular staining of PBMC was performed in saponin buffer with anti-CCL mAbs or control mAbs directly conjugated with Alexa Fluor 647 (Invitrogen) (Supplementary Fig. 1f). For phenotyping of PBMC, double or triple staining with anti-CCL mAbs and different cell surface markers was performed. Equine cell surface marker mAbs were directed against CD4 (HB61A, Washington State University, Pullman, WA, USA), CD8 (CVS8) (Lunn et al., 2018), CD14 (clone 105) (Kabithe et al., 2010), or total Ig (Goat Anti-Horse IgG (H + L), Jackson ImmunoResearch). The cell surface markers were used conjugated to Alexa Fluor 488 (Invitrogen), FITC (Jackson ImmunoResearch), or biotin (Thermofisher) followed by incubation with phycoerythrin conjugated streptavidin (Jackson ImmunoResearch). Flow cytometric analyses of 10,000 (CHO cell transfectants) or 100,000 (PBMC) events per sample were performed on a FACS Canto II flow cytometer (BD Biosciences, San Diego, CA). For evaluation of the data FlowJo version 10.2 (FlowJO LLC, Ashland, OR, USA) was used. CHO cells were gated as a homogenous population (Fig. 1A), while PBMC were differentiated into lymphocytes and large MNC (Fig. 2A, B).

detection + +++ + + +++ + +++ + + +++ +

+ #

PBMC

Suitable, +++ preferred mAb, - no detection. Not suitable for this method, n.t. not tested. a r IL-4/CCL expressed by transfected CHO cells. b Native CCL detected in PBMC.

(DMEM supplemented with 1% (v/v) non-essential amino acids, 2 mM L-glutamine, 50 μM 2-mercaptoethanol, 50 μg/ml Gentamicin, 100 U/ml penicillin, 100 μg/ml streptomycin, all from all Thermo Fisher Scientific Waltham, MA, USA; and 10% FCS, Atlanta biological, Flowery Branch, GA, USA), or (iii) after stimulation in cell culture medium with LPS (12.5 μg/ml), or (iv) PMA (25 ng/ml) and ionomycin (1 μM; all Sigma Aldrich). For flow cytometric analyses ex vivo PBMC were fixed in 2% formaldehyde immediately after isolation. In cultured or stimulated PBMC, protein secretion was blocked by the addition of Brefeldin A (10 μg/ml, Sigma Aldrich) for the whole incubation time of 2–24 h. Then, PBMC were collected and fixed. For analyses of secreted CCL chemokines, PBMC (6 × 106/ml) were incubated for 24 h with or without PMA and ionomycin stimulation. Afterwards, cell-free supernatants were collected and stored at 4 °C.

2.8. ELISA Anti-CCL mAbs were tested by ELISAs as previously described for other soluble analytes (Wagner et al., 2008a,b) to identify the best coating and detection mAb pairs for chemokine quantification. For assay detection, aliquots of all mAbs were biotinylated using the EZLink Sulfo-NHS-Biotin Kit (Thermofisher). Briefly, all combinations of anti-CCL mAbs were tested for each chemokine assay. ELISA plates were coated with 4 μg/ml purified mAb, followed by incubation with buffer, medium, or cell culture supernatant samples containing recombinant rIL-4/CCL fusion proteins (from transfected CHO cells), or cell culture supernatants containing native chemokines from PBMC, EEC, or ETEC. Supernatants were used undiluted, except for diluting PBMC supernatants 1:5 for the CCL2 and CCL5 ELISAs. Next, the biotinylated mAbs were added at their optimal dilutions, followed by streptavidin-conjugated peroxidase (Jackson ImmunoResearch), and tetramethylbenzidine substrate (TMB, Sigma Aldrich) (Supplementary Fig. 1g). After stopping the reaction with sulfuric acid, the OD was recorded at 450 nm using a Synergy 2 reader (BioTek, Winooski, VT, USA).

2.6. Primary equine endothelial (EEC) and tracheal respiratory epithelial cell (ETEC) cultures EEC and ETEC were tested for CCL11 secretion. EEC were generated as previously described in detail (Moore et al., 2003, 2002) and were a kind gift of Dr. Udeni Balasuriya, University of Kentucky. ETEC were generated from a 5-year-old Thoroughbred mare as previously described by Shibeshi et al. (2008). EEC or ETEC were plated into 24-well tissue culture plates, grown to confluence, and incubated in 1 ml/well medium alone or in medium containing equine rIL-4/IgG1 expressed in CHO cells (Wagner et al., 2005). The rIL-4/IgG1 was used in concentrations of 73.2, 36.6, 18.3, 9.2, 4.6, or 2.3 ng/ml. PBMC (3 × 106/ ml) were used under the same conditions in comparison. Cell free supernatants were collected after 48 h and stored at 4 °C.

30

Veterinary Immunology and Immunopathology 204 (2018) 28–39

C.L. Schnabel et al.

Fig. 1. Specificity of anti-equine CCL mAbs for their corresponding recombinant protein. Chinese Hamster Ovary cells (CHO) were transfected with equine rIL-4/CCL2, rIL-4/CCL3, rIL-4/CCL5, or rIL-4/CCL11expression vectors, incubated for 24 h and stained intracellularly with single anti-CCL mAbs. (A) CHO were gated based on their forward scatter (FSC) and side scatter (SSC) characteristics (oval gate, left plot). Then, a gate was set based on the isotype control (middle plot). A positive control (anti-IL-4) was included for each transfectant (right plot). (B) Single stainings with the anti-CCL mAbs confirmed specificity for the corresponding CCL chemokine. Plots show the selected mAbs anti-CCL2 53, anti-CCL3 290, anti-CCL5 96, anti-CCL11 24.

Fig. 2. Gating strategy for equine PBMC in flow cytometric experiments. PBMC were fixed directly after isolation (ex vivo, 0 h), after culture in medium alone, or after stimulation with LPS or PMA/ionomycin for 2–24 h. Representative examples (0 h or 17 h incubation) are shown. (A) Singlets were gated based on their FSC-A and FSC-H. (B) Within singlets, small lymphocyte and large mononuclear cells (MNC) gates (arrows) were set based on FSC and SSC characteristics. All PBMC [merged lymphocytes OR large MNC] were analyzed for the expression of intracellular CCLs using single anti-CCL mAbs. Lymphocytes and large MNC were also analyzed separately for the phenotypes of CCL producing cells in PBMC after double-staining or triple-staining for cell surface markers and intracellular CCLs. 31

Veterinary Immunology and Immunopathology 204 (2018) 28–39

C.L. Schnabel et al.

3. Results and discussion

(Fig. 3C). Similarly, monocytes have been described as the main source of CCL2 in human PBMC (Krakauer, 1999). In vitro stimulation of PBMC with LPS did not result in detectable intracellular CCL2 (Fig. 3A). This is noteworthy as LPS has been described to stimulate CCL2 production in a variety of murine cells (Bandow et al., 2012) and soluble CCL2 in serum was induced by LPS infusion in horses (Bonelli et al., 2017). In contrast, Lechner et al. (2017) showed unaffected CCL2 secretion from PBMC of healthy people after LPS stimulation, matching our findings in equine PBMC.

3.1. Generation of mAbs detecting equine CCL chemokines Immunization of mice with equine rCCLs and subsequent hybridoma production yielded mAbs specific for CCL2, CCL3, CCL5, or CCL11 as identified by ELISA (data not shown). Two to three anti-CCL mAbs per chemokine with the best native chemokine recognition were further characterized and described in this article (Table 2). All antiCCL mAbs shown in Table 2 are murine IgG1 isotypes. Yeast expressed rCCL2 and rCCL11 induced mAbs specific for the respective native equine cytokines (Table 2). For CCL3, yeast expressed rCCL3 only resulted in a single anti-CCL3 mAb and immunization of a second mouse with mammalian expressed rIL-4/CCL3 was required to generate a pair of anti-CCL3 mAbs for ELISA. Immunization with yeast expressed CCL5 did not result in any mAb recognizing native equine CCL5 with sufficient affinity (data not shown), while immunization with mammalian expressed rIL-4/CCL5 yielded several anti-CCL5 mAbs.

3.3.2. CCL3 All three anti-CCL3 mAbs detected CCL3 in PBMC. The strongest signal and best separation of stained from unstained cells was achieved with anti-CCL3 mAb 290 (Table 2). Large MNC produced CCL3 after incubation of PBMC in medium for 4–6 h or 17–24 h (Fig. 4A, B). These CCL3+ MNC were identified as CD14+ monocytes (Fig. 4C), which agrees with monocytes as the main producers of CCL3 in human PBMC (Krakauer, 1999). Detection of CCL3 in non-stimulated PBMC confirms the observation by Wimer et al. (2011) that culturing of equine PBMC without additional stimulation induced CCL mRNA expression. All PBMC samples used by Wimer et al. (2011) and in the current experiments originated from clinically healthy horses. This suggests that in vitro culture of the cells prompted subpopulations of CD14+ cells to secrete CCL3 chemokines. LPS stimulation decreased the percentages of CCL3 producing large MNC at several time points compared to cells cultured in medium (Fig. 4A, B). Similarly, CCL3 was not induced by LPS in human PBMC, while it was detected in human macrophage cell lines after LPS stimulation (Sharif et al., 2007). Nevertheless, in addition to the cultureinduced CCL3 production in monocytes, stimulation of PBMC with PMA and ionomycin for 12–24 h induced CCL3 production in a few CD4+ lymphocytes (Fig. 4C). In contrast, murine and human CCL3 were detected in CD8+, but only to a low extend in CD4+ T cells after culture with or without PMA and ionomycin (Dorner et al., 2003; Grob et al., 2003). However, equine CCL3+CD4+ lymphocytes could be Th2 or regulatory T cells. These subsets were described to secrete CCL3 in people (Wang and Liu, 2003). The detailed phenotype and function of the equine CCL3-producing cells remain to be determined in future studies. Compared to the other three CCLs analyzed, intracellular CCL3 expression in PBMC displayed the highest inter-individual variability (data not shown).

3.2. Detection of equine recombinant chemokines by flow cytometry The specificity of the different anti-CCL mAbs was confirmed by intracellular staining of rIL-4/CCL CHO transfectants. All anti-CCL mAbs, detected their corresponding recombinant chemokine (Table 2), while CHO cells expressing the other three chemokines were not stained (Fig. 1B). Anti-CCL2 mAb 104 showed minimal cross-reactivity with rCCL11 (data not shown). This cross-reactivity likely occurred because of an epitope in the C-terminal regions of CCL2 and CCL11, which are identical in the first 25 amino acids. Accordingly, anti-CCL2 mAb 104 should not be used for intracellular staining and flow cytometric analysis of CCL2, but it is a valuable reagent as coating antibody for the CCL2 ELISA as described below. 3.3. Flow cytometric detection of native chemokine expression in PBMC Next, the reactivity of the anti-CCL mAbs with native chemokines was confirmed by intracellular staining of PBMC. We identified the preferred mAb for intracellular staining and flow cytometric analysis of the native CCL chemokines (Table 2). Furthermore, optimal incubation times and PBMC stimulation conditions were determined for each chemokine (Table 3). B lymphocytes were identified by Ig surface staining as previously described (Wagner et al., 2013). CCL production was not detected in Ig + cells (data not shown).

3.3.3. CCL5 All three anti-CCL5 mAbs detected CCL5 in PBMC. Anti-CCL5 mAb 96 resulted in the best separation of stained from unstained cells (Table 2). CCL5 was detected in lymphocytes and in few large MNC in PBMC ex vivo or after culture in medium (Fig. 5A, B). Detection of CCL5 in PBMC ex vivo indicated a high baseline expression and storage of CCL5 in equine T cells. CCL5 expression in non-stimulated equine PBMC was also confirmed previously by CCL5 mRNA detection (Wimer et al., 2011) and was similarly reported for human T cells (Schall et al.,

3.3.1. CCL2 Anti-CCL2 mAb 53 detected a small percentage of CCL2 producing cells within the population of large MNC after stimulation of PBMC with PMA and ionomycin for 2–4 h or 17 h (Fig. 3A, B). Overall, the proportion of CCL2+ cells in cultured PBMC was remarkably low (Table 3). CCL2 producing cells were identified as CD14+ monocytes Table 3 Optimized incubation conditions for CCL chemokine production in equine PBMC. CCL chemokine

Stimulus, cell culture condition

Incubation time (h)

Incubation time for maximum CCL+ cell proportion

Mean percentage of CCL+ cells at maximum (% PBMC)a

Cellular source of CCL

CCL2 CCL3

PMA/ionomycin incubation in medium PMA/ionomycin

2–4 h, 17 h 2-6 h, 17–24 h 12–24 h

2h 6h 12 h

0.3 2.2 2.8

CCL5

PBMC ex vivo or incubation in medium PMA/ionomycin

0–24 h

0h

13.2

CD14+ monocytes CD14+ monocytes CD14+ monocytes, CD4+ T cells CD4+, CD8+ T cells

4–24 h

17 h

1.9

CD4+ T cells

CCL11 a

PBMC of four healthy adult Icelandic horses were analyzed. 32

Veterinary Immunology and Immunopathology 204 (2018) 28–39

C.L. Schnabel et al.

Fig. 3. Detection of equine CCL2 in PBMC stimulated in vitro. PBMC of four healthy adult Icelandic horses were used ex vivo (0 h incubation), cultured in vitro in medium alone, or stimulated with LPS, or PMA/ionomycin for 2–24 h. The cells were fixed and stained intracellularly with anti-CCL2 mAb 53. (A, B) CCL2 expression was analyzed within all PBMC and compared to the isotype control. (A) Percentages (mean and SEM) of CCL2+ cells in PBMC are displayed over time. The dotted line shows the mean percentage of the isotype control. (B) Examples of representative CCL2 detection in PBMC cultured for 2 h (upper panel) and occasional findings of higher percentages of CCL2+ large MNC in PBMC of individual horses cultured for 17 h (lower panel). (C) Representative example of PBMC stimulated with PMA/ionomycin for 2 h, double stained for CCL2 and CD14, gated on large MNC and analyzed by quadrant gates.

with PMA and ionomycin likely triggered the release of pre-formed CCL5 from these equine cells through a Golgi-independent mechanism that was effective in the presence of Brefeldin A in vitro. This finding is paralleled by observations on human T cells releasing CCL5 and down-

1988). LPS stimulation did not alter CCL5 production in PBMC compared to culture in medium. In vitro culture of equine PBMC for more than 6 h, or most strikingly, stimulation with PMA and ionomycin decreased the proportion of CCL5+ lymphocytes (Fig. 5A, B). Stimulation 33

Veterinary Immunology and Immunopathology 204 (2018) 28–39

C.L. Schnabel et al.

Fig. 4. Detection of equine CCL3 in PBMC cultured in vitro. PBMC of four healthy adult Icelandic horses were used ex vivo, cultured in vitro in medium alone, or stimulated with LPS, or PMA/ionomycin for 2–24 h. Cells were fixed and stained intracellularly with anti-CCL3 mAb 290. (A, B) CCL3 expression was analyzed within all PBMC in comparison to the isotype control. (A) Percentages (mean and SEM) of CCL3+ cells in PBMC are graphed over time. The dotted line shows the mean percentage of the isotype control. (B) Examples of representative CCL3 detection in PBMC incubated with different stimuli for 6 h. (C) PBMC were double stained for CCL3 and CD14, CD4, or CD8. Representative examples are shown for CD14 staining on large MNC cultured in medium for 6 h and for CD4 and CD8 staining on lymphocytes stimulated with PMA/ionomycin for 17 h.

34

Veterinary Immunology and Immunopathology 204 (2018) 28–39

C.L. Schnabel et al.

Fig. 5. Detection of equine CCL5 in PBMC ex vivo. PBMC of four healthy horses were used ex vivo, cultured in vitro in medium, or were stimulated with LPS, or PMA/ionomycin for different time points. Cells were harvested, fixed and stained intracellularly with anti-CCL5 mAb 96. (A, B) CCL5 expression was analyzed within all PBMC. (A) Percentages (mean and SEM) of CCL5+ cells in PBMC are displayed over time. (B) Examples of representative CCL5 detection in PBMC incubated with different stimuli for 2 h. (C, D) PBMC were fixed and stained ex vivo. Gates were set on large MNC or lymphocytes, separately. Representative examples are shown. (C) PBMC were double-stained for CCL5 and CD14 (large MNC), or CD4 or CD8 (lymphocytes). (D) Ex vivo PBMC were triple-stained, for CCL5, CD14, and CD4; or CCL5, CD14, and CD8. Within large MNC, quadrant gates of CD14 and CCL5 were set. CCL5+CD14− cells in quadrants Q1 were analyzed for CD4 or CD8 expression in histograms. 35

Veterinary Immunology and Immunopathology 204 (2018) 28–39

C.L. Schnabel et al.

Fig. 6. Detection of equine CCL11 in PBMC stimulated in vitro. PBMC of four healthy adult horses were used ex vivo, cultured in vitro in medium alone, or stimulated with LPS, or PMA/ionomycin for 2–24 hours. After harvesting, the cells were fixed and intracellular staining was performed with anti-CCL11 mAb 24. (A, B) CCL11 was analyzed within all PBMC and a gate determined by the isotype control. (A) Percentages (mean and SEM) of CCL11+ expressing cells in PBMC are shown. The dotted line displays the mean percentages of the isotype control. (B) Examples of representative CCL11 detection in PBMC cultured with different stimuli for 12 h. (C) PBMC stimulated with PMA/ionomycin for 17 h were double-stained for CCL11 and CD4, gated on lymphocytes, and analyzed. A representative example is shown.

identified as large CD4+ or CD8+ T cells included in the large MNC gate (Fig. 5D). The phenotype of the remaining CCL5+CD14−CD4−CD8− large MNC could not be identified with the available markers.

regulating CCL5 expression after exposure to different stimuli in vitro (reviewed in Schall, 1991). In PBMC ex vivo, equine CCL5 was similarly produced by both CD4+ and CD8+ lymphocytes, and CCL5 producing large MNC were CD14− (Fig. 5C). Portions of the CD14− cells were 36

Veterinary Immunology and Immunopathology 204 (2018) 28–39

C.L. Schnabel et al.

with anti-CCL2 mAb 53 for detection resulted in a CCL2-specific ELISA without cross-reactivity with other chemokines. The detection of native equine CCL chemokines by the CCL ELISAs was confirmed using equine PBMC supernatants (Fig. 7B). CCL2 secretion from non-stimulated PBMC resulted in higher CCL2 amounts than stimulation with PMA and ionomycin. The same expression pattern was observed for CCL2 RNA after in vitro culture and stimulation of PBMC (Wimer et al., 2011). The high CCL2 secretion was contrary to the small percentage of CCL2 producing cells detected by intracellular staining of PBMC after culture in medium (Fig. 3). The discrepancy between CCL2 secretion and intracellular detection may have originated from monocytes adherent to the tissue culture plates. These adherent cells likely contributed majorly to CCL2 secretion but may not have been recovered from the plates for flow cytometric analysis. Interestingly, this effect was only observed for CCL2, but not for CCL3, which are both produced by equine monocytes. This suggests that different equine monocyte populations, which also differ in their ability to adhere to plastic, may produce CCL2 and CCL3. In contrast, CCL3 and CCL5 secretion were increased after PMA and ionomycin stimulation of PBMC compared to cells in medium. Discrepancies between CCL chemokine detection by flow cytometry and ELISA can be based on the different culture conditions for the assays and different aspects of the analyses. First, incubation times seem critical for the optimized detection of chemokines, as shown in the flow cytometric experiments (Figs. 3A, 4 A, 5 A, 6 A). For the ELISAs the standardized harvest of supernatants after 24 h may conceive the dynamics of chemokine secretion, uptake and degradation in PBMC cultures. Second, the secretion blocker Brefeldin A, added for intracellular

3.3.4. CCL11 Anti-CCL11 mAb 24 detected CCL11 production in lymphocytes after stimulation with PMA and ionomycin for 4–24 h (Fig. 6A, B). AntiCCL11 mAb 25 did not detect native CCL11 in PBMC by flow cytometry despite detection of rIL-4/CCL11 in CHO transfectants (Table 2). CD4+ T cells were the source of CCL11 in stimulated PBMC (Fig. 6C). The detection of CCL11 in these cells was unexpected as CCL11 induction in PBMC of other species is typically low and the production of this chemokine in mice and people is linked to epithelial and endothelial cells, eosinophils, macrophages, or fibroblasts after stimulation with IL-4 (Benarafa et al., 2000; Nickel et al., 1999; Schröder and Mochizuki, 1999). It is, however, not unusual to find soluble or cell surface marker expression in equine cells not reported for other species. An example of this is the constitutive expression of MHCII by equine T cells (Crepaldi et al., 1986; Lunn et al., 1993). The CCL11 induction in PMA and ionomycin stimulated CD4+ cells observed here represents an example of chemokine production by a subset of equine cells without a counterpart in humans or rodents. It suggests that activated equine CD4+ cells may have a function in regulating immune responses via CCL11 production. 3.4. Quantification of equine chemokines by ELISA ELISAs were established using pairs of anti-CCL mAbs for each of the chemokines (Table 2). The four rIL-4/CCLs were tested in each chemokine ELISA and confirmed the specificity of each assay for the respective soluble chemokine (Fig. 7A). Despite the minor cross-reactivity of anti-CCL2 mAb 104 with the IL-4/CCL11 transfectant described above, capture by coated anti-CCL2 mAb 104 in combination

Fig. 7. Detection of soluble equine CCL chemokines by ELISA. ELISAs targeting equine CCL2, CCL3, CCL5, or CCL11 were based on pairs of anti-CCL mAbs using unconjugated coating and biotinylated detection mAbs. (A) The four chemokine ELISAs were tested for specificity to the respective chemokine by testing all four chemokines in each ELISA. The r IL-4/chemokines were used at 100 ng/ml (in CHO cell supernatants). (B) Native chemokines were detected in supernatants of PBMC cultured with or without stimulation with PMA/ ionomycin for 24 h. (C) Equine endothelial cells (EEC), equine tracheal epithelial cells (ETEC), PBMC, or cellfree controls were stimulated with varying concentrations of rIL-4 for 48 h. Their supernatants were used as samples in the CCL11 ELISA.

37

Veterinary Immunology and Immunopathology 204 (2018) 28–39

C.L. Schnabel et al.

accumulation and detection of chemokines by flow cytometry, differentiates the culture conditions from those for ELISA experiments. Thirdly, not all cells are recovered for flow cytometric analysis after culture of PBMC due to adhesion and cell death of a subset of cells, while secretion of CCLs by these cells into the supernatants would still be detected by ELISA. CCL11 could not be detected in PBMC supernatants by ELISA. This might be due to low CCL11 secretion from PBMC. As discussed above, CCL11 is predominately produced by epithelial cells and cells of other tissues in humans and mice. We thus stimulated ETEC, EEC, and equine PBMC with different concentrations of equine rIL-4. ETEC secreted CCL11 in a dose-dependent manner. EEC also secreted CCL11 after stimulation with high concentrations of rIL-4 (18.3–73.2 ng/ml). PBMC did not secrete detectable CCL11 in response to IL-4 (Fig. 7C). The dose dependent CCL11 response of ETEC agrees with descriptions for different mouse models of asthma (Teran, 2000). CCL11 detection in ETEC and EEC supernatants by the anti-CCL11 mAb pair confirmed that the ELISA detected native CCL11 in a wide detection range. The establishment of ELISAs specific for equine CCL chemokines enables quantitative analyses of these soluble mediators. Future experiments are required to evaluate the assays for chemokine quantification in different samples including equine body fluids.

Benarafa, C., Cunningham, F.M., Hamblin, A.S., Horohov, D.W., Collins, M.E., 2000. Cloning of equine chemokines eotaxin, monocyte chemoattractant protein (MCP)-1, MCP-2 and MCP-4, mRNA expression in tissues and induction by IL-4 in dermal fibroblasts. Vet. Immunol. Immunopathol. 76, 283–298. Benarafa, C., Collins, M.E., Hamblin, A.S., Sabroe, I., Cunningham, F.M., 2002. Characterisation of the biological activity of recombinant equine eotaxin in vitro. Cytokine 19, 27–30. Bonelli, F., Meucci, V., Divers, T.J., Wagner, B., Intorre, L., Sgorbini, M., 2017. Kinetics of plasma procalcitonin, soluble CD14, CCL2 and IL-10 after a sublethal infusion of lipopolysaccharide in horses. Vet. Immunol. Immunopathol. 184, 29–35. Burns, T.A., Geor, R.J., Mudge, M.C., McCutcheon, L.J., Hinchcliff, K.W., Belknap, J.K., 2010. Proinflammatory cytokine and chemokine gene expression profiles in subcutaneous and visceral adipose tissue depots of insulin-resistant and insulin-sensitive light breed horses: adipose tissue gene expression. J. Vet. Intern. Med. 24, 932–939. Carr, M.W., Roth, S.J., Luther, E., Rose, S.S., Springer, T.A., 1994. Monocyte chemoattractant protein 1 acts as a T-lymphocyte chemoattractant. Proc. Natl. Acad. Sci. U. S. A. 91, 3652–3656. Covaleda, L., Fuller, F.J., Payne, S.L., 2010. EIAV S2 enhances pro-inflammatory cytokine and chemokine response in infected macrophages. Virology 397, 217–223. Crepaldi, T., Crump, A., Newman, M., Ferrone, S., Antczak, D.F., 1986. Equine T lymphocytes express MHC class II antigens. J. Immunogenet. 13, 349–360. Curto, E., Messenger, K.M., Salmon, J.H., Gilger, B.C., 2016. Cytokine and chemokine profiles of aqueous humor and serum in horses with uveitis measured using multiplex bead immunoassay analysis. Vet. Immunol. Immunopathol. 182, 43–51. Dorner, B.G., Steinbach, S., Hüser, M.B., Kroczek, R.A., Scheffold, A., 2003. Single-cell analysis of the murine chemokines MIP-1alpha, MIP-1beta, RANTES and ATAC/ lymphotactin by flow cytometry. J. Immunol. Methods 274, 83–91. Dunkel, B., Bolt, D.M., Smith, R.K., Cunningham, F.M., 2012. Stimulus-dependent release of tissue-regenerating factors by equine platelets: growth factor and CCL5 release from platelets. Equine Vet. J. 44, 346–354. Ebisawa, M., Yamada, T., Bickel, C., Klunk, D., Schleimer, R.P., 1994. Eosinophil transendothelial migration induced by cytokines. III. Effect of the chemokine RANTES. J. Immunol. Baltim. Md. 1950 (153), 2153–2160. Gilger, B.C., Yang, P., Salmon, J.H., Jaffe, G.J., Allen, J.B., 2002. Expression of a chemokine by ciliary body epithelium in horses with naturally occurring recurrent uveitis and in cultured ciliary body epithelial cells. Am. J. Vet. Res. 63, 942–947. Grob, M., Schmid-Grendelmeier, P., Joller-Jemelka, H.I., Ludwig, E., Dubs, R.W., Grob, P.J., Wüthrich, B., Bisset, L.R., 2003. Altered intracellular expression of the chemokines MIP-1alpha, MIP-1beta and IL-8 by peripheral blood CD4+ and CD8+ T cells in mild allergic asthma. Allergy 58, 239–245. IUIS/WHO, S.O.C.N., 2002. Chemokine/chemokine receptor nomenclature. J. Interferon Cytokine Res. 22, 1067–1068. Johnstone, S., Barsova, J., Campos, I., Frampton, A.R., 2016. Equine herpesvirus type 1 modulates inflammatory host immune response genes in equine endothelial cells. Vet. Microbiol. 192, 52–59. Kabithe, E., Hillegas, J., Stokol, T., Moore, J., Wagner, B., 2010. Monoclonal antibodies to equine CD14. Vet. Immunol. Immunopathol. 138, 149–153. Krakauer, T., 1999. Induction of CC chemokines in human peripheral blood mononuclear cells by staphylococcal exotoxins and its prevention by pentoxifylline. J. Leukoc. Biol. 66, 158–164. Kuna, P., Alam, R., Ruta, U., Gorski, P., 1998. RANTES induces nasal mucosal inflammation rich in eosinophils, basophils, and lymphocytes in vivo. Am. J. Respir. Crit. Care Med. 157, 873–879. Lavoie-Lamoureux, A., Leclere, M., Lemos, K., Wagner, B., Lavoie, J.-P., 2012. Markers of systemic inflammation in horses with heaves. J. Vet. Intern. Med. 26, 1419–1426. Lechner, J., Chen, M., Hogg, R.E., Toth, L., Silvestri, G., Chakravarthy, U., Xu, H., 2017. Peripheral blood mononuclear cells from neovascular age-related macular degeneration patients produce higher levels of chemokines CCL2 (MCP-1) and CXCL8 (IL8). J. Neuroinflamm. 14. Lee, S.C., Brummet, M.E., Shahabuddin, S., Woodworth, T.G., Georas, S.N., Leiferman, K.M., Gilman, S.C., Stellato, C., Gladue, R.P., Schleimer, R.P., Beck, L.A., 2000. Cutaneous injection of human subjects with macrophage inflammatory protein-1 alpha induces significant recruitment of neutrophils and monocytes. J. Immunol. Baltim. Md. 1950 (164), 3392–3401. Loetscher, P., Seitz, M., Clark-Lewis, I., Baggiolini, M., Moser, B., 1994. Monocyte chemotactic proteins MCP-1, MCP-2, and MCP-3 are major attractants for human CD4+ and CD8+ T lymphocytes. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 8, 1055–1060. Lu, B., Rutledge, B.J., Gu, L., Fiorillo, J., Lukacs, N.W., Kunkel, S.L., North, R., Gerard, C., Rollins, B.J., 1998. Abnormalities in monocyte recruitment and cytokine expression in monocyte chemoattractant protein 1-deficient mice. J. Exp. Med. 187, 601–608. Lunn, D.P., Holmes, M.A., Duffus, W.P., 1993. Equine T-lymphocyte MHC II expression: variation with age and subset. Vet. Immunol. Immunopathol. 35, 225–238. Lunn, D.P., Holmes, M.A., Antczak, D.F., Agerwal, N., Baker, J., Bendali-Ahcene, S., Blanchard-Channell, M., Byrne, K.M., Cannizzo, K., Davis, W., Hamilton, M.J., Hannant, D., Kondo, T., Kydd, J.H., Monier, M.C., Moore, P.F., O’Neil, T., Schram, B.R., Sheoran, A., Stott, J.L., Sugiura, T., Vagnoni, K.E., 1998. Report of the second equine leucocyte antigen workshop, Squaw valley, California, July 1995. Vet. Immunol. Immunopathol. 62, 101–143. Mantovani, A., Sica, A., Sozzani, S., Allavena, P., Vecchi, A., Locati, M., 2004. The chemokine system in diverse forms of macrophage activation and polarization. Trends Immunol. 25, 677–686. Moore, B.D., Balasuriya, U.B., Hedges, J.F., MacLachlan, N.J., 2002. Growth characteristics of a highly virulent, a moderately virulent, and an avirulent strain of equine arteritis virus in primary equine endothelial cells are predictive of their virulence to horses. Virology 298, 39–44. Moore, B.D., Balasuriya, U.B.R., Nurton, J.P., McCollum, W.H., Timoney, P.J., Guthrie,

4. Conclusions We generated mAbs specific for equine chemokines CCL2, CCL3, CCL5 and CCL11 and tested them by flow cytometric analysis and ELISA. Using the new anti-CCL mAbs, we characterized chemokine production in cultured and stimulated equine PBMC, and, for antiCCL11 mAbs, also in ETEC and EEC. The new anti-CCL mAbs will be valuable tools to characterize chemokine expression particularly during innate immune responses and for quantification of CCL chemokines during various infectious and inflammatory diseases of the horse. CCL chemokines could become potential pro-inflammatory biomarkers during pathogeneses of different diseases and for the evaluation of treatment success. Acknowledgements Immune Reagents described in this article were developed with funding from Agriculture and Food Research Initiative Competitive Grants no. #2005-01812 (The US Veterinary Immune Reagent Network) and #2015-67015-23072 (Equine Immune Reagents: development of monoclonal antibodies to improve the analysis of immunity in horses) supported by the USDA National Institute of Food and Agriculture. The horses providing blood samples for this project were supported by funds from the Harry M. Zweig Memorial Fund for Equine Research. We thank Joanna LaBresh (Kingfisher Biotech Inc.) for kindly providing yeast expressed rCCLs for mouse immunizations and mAb evaluation. We also thank Fahad Raza, Elizabeth Larson, Laura E. Keller and Naya Eady for assistance with blood collection and processing. We furthermore thank Svenja Maier for assistance with anti-CCL3 mAb production and evaluation. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at https://doi.org/10.1016/j.vetimm.2018.09.003. References Bandow, K., Kusuyama, J., Shamoto, M., Kakimoto, K., Ohnishi, T., Matsuguchi, T., 2012. LPS-induced chemokine expression in both MyD88-dependent and -independent manners is regulated by Cot/Tpl2-ERK axis in macrophages. FEBS Lett. 586, 1540–1546.

38

Veterinary Immunology and Immunopathology 204 (2018) 28–39

C.L. Schnabel et al.

217–226. Teran, L.M., 2000. CCL chemokines and asthma. Immunol. Today 21, 235–242. Vaddi, K., Newton, R.C., 1994. Regulation of monocyte integrin expression by beta-family chemokines. J. Immunol. Baltim. Md. 1950 (153), 4721–4732. Wagner, B., Radbruch, A., Rohwer, J., Leibold, W., 2003. Monoclonal anti-equine IgE antibodies with specificity for different epitopes on the immunoglobulin heavy chain of native IgE. Vet. Immunol. Immunopathol. 92, 45–60. Wagner, B., Robeson, J., McCracken, M., Wattrang, E., Antczak, D.F., 2005. Horse cytokine/IgG fusion proteins – mammalian expression of biologically active cytokines and a system to verify antibody specificity to equine cytokines. Vet. Immunol. Immunopathol. 105, 1–14. Wagner, B., Hillegas, J.M., Antczak, D.F., 2006. A monoclonal antibody to equine interleukin-4. Vet. Immunol. Immunopathol. 110, 363–367. Wagner, B., Hillegas, J.M., Brinker, D.R., Horohov, D.W., Antczak, D.F., 2008a. Characterization of monoclonal antibodies to equine interleukin-10 and detection of T regulatory 1 cells in horses. Vet. Immunol. Immunopathol. 122, 57–64. Wagner, B., Hillegas, J.M., Flaminio, M.J.B.F., Wattrang, E., 2008b. Monoclonal antibodies to equine interferon-α (IFN-α): New tools to neutralize IFN-activity and to detect secreted IFN-α. Vet. Immunol. Immunopathol. 125, 315–325. Wagner, B., Hillegas, J.M., Babasyan, S., 2012. Monoclonal antibodies to equine CD23 identify the low-affinity receptor for IgE on subpopulations of IgM+ and IgG1+ Bcells in horses. Vet. Immunol. Immunopathol. 146, 125–134. Wagner, B., Ainsworth, D.M., Freer, H., 2013. Analysis of soluble CD14 and its use as a biomarker in neonatal foals with septicemia and horses with recurrent airway obstruction. Vet. Immunol. Immunopathol. 155, 124–128. Wang, C.R., Liu, M.F., 2003. Regulation of CCR5 expression and MIP-1alpha production in CD4+ T cells from patients with rheumatoid arthritis. Clin. Exp. Immunol. 132, 371–378. Weston, M.C., Cunningham, F.M., Collins, M.E., 2006. Distribution of CCR3 mRNA expression in horse tissues. Vet. Immunol. Immunopathol. 114, 238–246. Wimer, C.L., Damiani, A., Osterrieder, N., Wagner, B., 2011. Equine herpesvirus type-1 modulates CCL2, CCL3, CCL5, CXCL9, and CXCL10 chemokine expression. Vet. Immunol. Immunopathol. 140, 266–274. Wu, X., Brewer, G., 2012. The regulation of mRNA stability in mammalian cells: 2.0. Gene 500, 10–21.

A.J., MacLachlan, N.J., 2003. Differentiation of strains of equine arteritis virus of differing virulence to horses by growth in equine endothelial cells. Am. J. Vet. Res. 64, 779–784. Nickel, R., Beck, L.A., Stellato, C., Schleimer, R.P., 1999. Chemokines and allergic disease. J. Allergy Clin. Immunol. 104, 723–742. Palframan, R.T., Collins, P.D., Williams, T.J., Rankin, S.M., 1998. Eotaxin induces a rapid release of eosinophils and their progenitors from the bone marrow. Blood 91, 2240–2248. Ponath, P.D., Qin, S., Ringler, D.J., Clark-Lewis, I., Wang, J., Kassam, N., Smith, H., Shi, X., Gonzalo, J.A., Newman, W., Gutierrez-Ramos, J.C., Mackay, C.R., 1996. Cloning of the human eosinophil chemoattractant, eotaxin. Expression, receptor binding, and functional properties suggest a mechanism for the selective recruitment of eosinophils. J. Clin. Invest. 97, 604–612. Rot, A., Krieger, M., Brunner, T., Bischoff, S.C., Schall, T.J., Dahinden, C.A., 1992. RANTES and macrophage inflammatory protein 1 alpha induce the migration and activation of normal human eosinophil granulocytes. J. Exp. Med. 176, 1489–1495. Schall, T.J., 1991. Biology of the RANTES/SIS cytokine family. Cytokine 3, 165–183. Schall, T.J., Jongstra, J., Dyer, B.J., Jorgensen, J., Clayberger, C., Davis, M.M., Krensky, A.M., 1988. A human T cell-specific molecule is a member of a new gene family. J. Immunol. Baltim. Md. 1950 (141), 1018–1025. Schall, T.J., Bacon, K., Toy, K.J., Goeddel, D.V., 1990. Selective attraction of monocytes and T lymphocytes of the memory phenotype by cytokine RANTES. Nature 347, 669–671. Schnabel, C.L., Babasyan, S., Freer, H., Wagner, B., 2017. Quantification of equine immunoglobulin A in serum and secretions by a fluorescent bead-based assay. Vet. Immunol. Immunopathol. 188, 12–20. Schröder, J.M., Mochizuki, M., 1999. The role of chemokines in cutaneous allergic inflammation. Biol. Chem. 380, 889–896. Sharif, O., Bolshakov, V.N., Raines, S., Newham, P., Perkins, N.D., 2007. Transcriptional profiling of the LPS induced NF-kappaB response in macrophages. BMC Immunol. 8, 1. Shibeshi, W., Abraham, G., Kneuer, C., Ellenberger, C., Seeger, J., Schoon, H.-A., Ungemach, F.R., 2008. Isolation and culture of primary equine tracheal epithelial cells. Vitro Cell. Dev. Biol.—Anim. 44, 179–184. Steelman, S.M., Johnson, D., Wagner, B., Stokes, A., Chowdhary, B.P., 2013. Cellular and humoral immunity in chronic equine laminitis. Vet. Immunol. Immunopathol. 153,

39