- Email: [email protected]
TNF-related protein 1 links macrophage lipid metabolism to inflammation and atherosclerosis
Atherosclerosis 250 (2016) 38e45
Contents lists available at ScienceDirect
Atherosclerosis journal homepage: www.elsevier.com/locate/atherosclerosis
C1q/TNF-related protein 1 links macrophage lipid metabolism to inflammation and atherosclerosis Xiao Qun Wang a, b, 1, Zhu Hui Liu a, b, 1, Lu Xue c, Lin Lu a, b, Jie Gao a, Ying Shen a, Ke Yang b, Qiu Jing Chen b, Rui Yan Zhang a, b, Wei Feng Shen a, b, * a b c
Department of Cardiology, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, PR China Institute of Cardiovascular Diseases, Shanghai Jiao Tong University, Shanghai, PR China Department of Allergy, Renji Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, PR China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 29 December 2015 Received in revised form 24 April 2016 Accepted 26 April 2016 Available online 27 April 2016
Background and aims: Macrophage is a major contributor to the development of atherosclerosis by taking up deposited lipoprotein and eliciting local inflammation. Previously, we and others have shown C1q/ TNF-related proteins (CTRPs) play diverse roles in vascular functions. In this study, we sought to investigate the changes in CTRP expression levels during vital biological processes in macrophages and their relation to inflammatory responses. Methods: Western blot and real-time PCR were performed to analyze CTRPs expression levels in human peripheral blood mononuclear cells, primary macrophages and lipid-laden foam cells. Mechanisms that regulate CTPR1 expression were further investigated by bioinformatic analysis and chromatin immunoprecipitation. Enzyme-linked immunosorbent assay was performed to measure the concentration of inflammatory cytokines. Results: We found that almost all CTRPs were significantly increased in primary human macrophages after differentiation from peripheral blood mononuclear cells. In particular, CTRP1 was further upregulated upon exposure to oxidized low-density lipoprotein (oxLDL) in a peroxisome proliferatoractivated receptor (PPAR)-dependent manner. Chromatin immunoprecipitation also confirmed the presence of PPAR-g in the CTRP1 promoter after oxLDL treatment. Stimulation of CTRP1 led to markedly enhanced secretion of pro-atherogenic factors, including MCP-1, TNF-a, IL-1b, and IL-6, whereas oxLDLinduced inflammatory cytokine production was significantly attenuated after the treatment with CTRP1 neutralizing antibody. Conclusions: These data suggest an essential role of CTRP1 in linking dysregulation of lipid metabolism and inflammatory responses in macrophages. © 2016 Elsevier Ireland Ltd. All rights reserved.
Keywords: CTRP Macrophage Inflammation Atherosclerosis
1. Introduction Macrophages are central in the development of atherosclerosis by facilitating lipid retention in the arterial wall as well as amplification of local inflammatory responses [1e3]. Lipoproteins that invade into the subendothelial space in the lesion-prone area undergo further modification and lead to massive accumulation of oxidized low-density lipoprotein (oxLDL). Monocytes in circulation
* Corresponding author. Department of Cardiology, Rui Jin Hospital, 197 Rui Jin Road II, Shanghai, 200025, PR China. E-mail address: [email protected] (W.F. Shen). 1 These authors contributed equally to this manuscript. http://dx.doi.org/10.1016/j.atherosclerosis.2016.04.024 0021-9150/© 2016 Elsevier Ireland Ltd. All rights reserved.
were then recruited and differentiate into macrophages, take up oxLDL deposited within the arterial wall, and finally transform into lipid-laden foam cells [4,5]. The death of foam cells leads to the formation of lipid-rich necrotic core with fibrous cap that is recognized as hallmarks of advanced atherosclerotic lesions [3]. On the other hand, a variety of scavengers and pattern recognition receptors (PRR) recognize the altered modification present on oxLDL as a danger-associated-molecular-pattern (DAMP), thereby activating downstream pro-inflammatory signaling and promoting the production of inflammatory mediators, chemotactic cytokines, and extracellular matrix degrading enzymes [6e8]. This process dramatically enhances local inflammatory responses in the lesion area and ultimately contributes to plaque rupture and the onset of acute coronary syndrome (ACS) [9,10].
X.Q. Wang et al. / Atherosclerosis 250 (2016) 38e45
Accumulating evidence reveals reciprocal relations between pathways modulating lipid metabolism and inflammatory responses [11e14]. We previously reported that oxLDL stimulation of macrophages resulted in prominent changes in microRNA expression profiles including down-regulation of miR-146a, miR-155. Especially, miR-146a was found to decrease both intracellular cholesterol levels and inflammatory cytokine secretion via direct deactivation of TLR4-dependent signaling at post-transcriptional level [15]. Adiponectin, an adipocytokine whose circulating levels are reduced in patients with coronary artery diseases, was reported to suppress lipid accumulation [16] and promote macrophage polarization toward an anti-inflammatory phenotype [17,18]. However, the exact mechanism linking lipid metabolism and inflammation remains largely unknown. Recently, an expanding family of highly conserved adiponectin paralogs, designated as C1q/TNF-related protein, was identified based on the common structure that comprises 4 distinct domainsa signal peptide, a short N-terminal variable region, a collagen domain with Gly-X-Y repeats, and a C-terminal globular domain [19]. In contrast to adiponectin that is exclusively expressed in adipocytes, a much wider tissue distribution of CTRPs was detected [20]. For instance, CTRP1 is expressed in heart, liver, kidney, placenta and stromal vascular cells that include macrophages [19,21,22]. However, the expression levels and biological functions of CTRPs in macrophages are rarely discussed. In the present study, we show that most of CTRPs are up-regulated in mature macrophages after transformation from primary human monocytes in vitro. CTRP1 is further increased in a peroxisome proliferatoractivated receptor (PPAR) -g-dependent manner after exposure to oxLDL, thereby promoting local inflammation by enhancing the production of major pro-atherogenic factors including monocyte chemoattractant protein (MCP)-1, tumor necrosis factor (TNF) a, interleukin (IL) -1b, and IL-6 [23e25]. 2. Methods 2.1. Cell culture and reagents Primary human peripheral blood mononuclear cells (PBMC) were isolated from buffy coats derived from healthy donors. After cultivation for 1 h in complete RPMI 1640 medium containing 20% heat-inactivated fetal calf serum (FCS), 1% penicillin/streptomycin (all from Invitrogen, Carlsbad, CA, USA), and 2% L-glutamine (SigmaAldrich, San Jose, CA) at 37 C, the monocytes became adherent and were washed three times with phosphate-buffered saline (PBS, Gibco, Auckland, New Zealand) to remove contaminating lymphocytes. The remaining adherent cells were then maintained in the same media in the presence of 50 ng/ml recombinant human macrophage colony stimulating factor (M-CSF, R&D, Minneapolis, MN, USA) for 5 days. Mature macrophages were incubated with Rosiglitazone (Sigma-Aldrich, San Jose, CA), GW9662 (SigmaAldrich, San Jose, CA), or oxLDL (Serotec, Oxford, UK) for further studies. 2.2. Flow cytometric analysis Human monocyte-derived macrophages were washed with PBS and incubated with mouse anti-human CD68 antibodies (#ab955, Abcam, Cambridge, UK) or control mouse IgG (Santa Cruz Biotechnology, CA, USA) for 30 min on ice. After rinsing with ice cold PBS for 3 times, cells were incubated with Alexa Fluor® 488 Conjugated Rat Anti-Mouse Antibodies (Invitrogen, Carlsbad, CA, USA) for 15 min on ice. Flow cytometric measurements were performed with an Epics Elite flow cytometer (Beckman).
39
2.3. Fluorescence activated cell sorting (FACS) PBMC were isolated as described above and resuspended in PBS/ 1% FCS. 5 106 cells were stained with anti-CD16 FITC (#560996, BD Biosciences, Franklin Lakes, NJ, USA) and anti-CD64 PE (#561926, BD Biosciences, Franklin Lakes, NJ, USA). Samples were incubated on ice in dark for 30 min then washed with 5 ml PBS/1% FCS. PBMC were sorted into CD16þ/CD64þ and CD16-/CD64- populations. Cells were then collected by centrifugation and stored in liquid nitrogen for further experiments. 2.4. Oil Red O staining Human macrophages were fixed in 4% paraformaldehyde in PBS (pH 7.4) for 15 min. After rinsing with PBS for 3 times, cells were incubated with filtered Oil Red O (ORO) solution (0.6 g/L ORO in 60% isopropanol, Sigma-Aldrich, St. Louis, MO, USA) for 10 min. After another 3 rinses with PBS, images were acquired using an inverted microscope (IX70, Olympus). 2.5. Quantitative real-time polymerase chain reaction (PCR) Total RNA was extracted using a TRIzol reagent (Invitrogen, Carlsbad, CA). For reverse transcription, 1 mg of total RNA was converted into first strand complementary DNA (cDNA) in a 20 ml reaction volume using a reverse transcription kit (#A3500, Promega, Madison, WI) following the manufacturer's instruction. Quantitative real-time PCR analysis was performed (StepOne, Applied Biosystems) using SYBR Green (Takara, Dalian, China). The comparative cycle threshold method was used to determine the relative mRNA expression of target genes after normalization to housekeeping gene GAPDH. Following primers were used: 50 GAGTCCACTGGCGTCTTCA-30 for human GAPDH-F and 50 GAGTCCTTCCACGATACCAA -30 for human GAPDH-R. 50 -AGAACGAGGAGGAGGTGGTG -30 for human CTRP1-F and 50 -GCATCAGGCTCTGGCTTTG -30 for human CTRP1-R. 50 0 CTGTGCCCTCCCCTGTGCT -3 for human CTRP2-F and 50 CCCATTCGTCCCATCATTCC -30 for human CTRP2-R. 50 -ATGAAGGGCAAATCAGATACA -30 for human CTRP3-F and 50 -GGAGAAGCGTTGGTGGTC -30 for human CTRP3-R. 50 TGTCGGTTAAGCTGATGAAGAAC -30 for human CTRP4-F and 50 ACTTGCCGTGGTTGCTGTAG -30 for human CTRP4-R. 50 -GGGTCTACTACTTCGCCGTCCAT -30 for human CTRP5-F and 50 AAGGTGCTGTCTGTCTTGATGCTG -30 for human CTRP5-R. 50 CCCTGCGTGGCATCTACTTC -30 for human CTRP6-F and 50 GCCGCTGAAGGTGATGTAGGT -30 for human CTRP6-R. 50 -TAACAAGGTCCTCTTCAACGA -30 for human CTRP7-F and 50 -AGTCCGATTGCCAGATGC -30 for human CTRP7-R. 50 GCGTCTACTTCCTCAGCCTC -30 for human CTRP8-F and 50 -CGTAGATGGCGTTGTCCC -30 for human CTRP8-R. 50 -TGGTCAAAAATGGAGTAAAAATA -30 for human CTRP9-F and 50 GTGTCATCGTCCTCATCAGC -30 for human CTRP9-R. 2.6. Western blot Human PBMC and treated macrophages were harvested and lysed in ice-cold lysis buffer (#9803, Cell Signaling Technology, Beverly, MA) supplemented with protease inhibitor cocktail (#P8340, Sigma-Aldrich, St. Louis, MO). Cell lysates were subjected to SDS-polyacrylamide gel electrophoresis (PAGE), followed by electrophoretic transfer onto PVDF membranes (Millipore, Bedford, MA). The blots were incubated overnight at 4 C with specific primary antibodies and then exposed to secondary antibodies conjugated with horseradish peroxidase (1: 5000, Cell Signaling Technology, Beverly, MA) for 1 h at 4 C. The antibody was
40
X.Q. Wang et al. / Atherosclerosis 250 (2016) 38e45
Fig. 1. Different expression profiles of CTRP family members in PBMC, macrophages and lipid-laden foam cells. (A) The purity of macrophage was evaluated by flow cytometric analysis using an antibody to CD68 (specific to macrophages). (B) Shown is Oil Red O staining of control and oxLDL-loaded macrophages (foam cells). (C and D) Quantitative realtime PCR was performed to assess the differential expression of CTRP member transcripts during differentiation of PBMC into mature macrophages (C) and the subsequent transformation into foam cells after loading with 50 mg/ml oxLDL for 48 h (D). Results were normalized to their corresponding GAPDH RNA levels. **p < 0.01 and * p < 0.05 vs. control group. (EeG) CTRP1 protein levels in the conditioned media (E) and cell lysates (FeG) from PBMC, cultured macrophages and foam cells were analyzed by enzyme-linked immunosobent assay (ELISA) and Western blots. (G) Densitometric quantification of the Western results. **p < 0.01 and * p < 0.05 vs. PBMC. ##p < 0.01 and #p < 0.05 vs. macrophages. PBMC, peripheral blood mononuclear cells; MF, macrophages; FC, foam cells. Data are expressed as mean ± SD of at least 5 independent experiments. (For interpretation of the references to colour in this figure caption, the reader is referred to the web version of this article.)
visualized by incubating with Immobilon Western Chemiluminescent HRP Substrate (Millipore, Bedford, MA, USA). Densitometric analysis of membranes was performed using Image J software (version 1.36b, National Institutes of Health).
2.7. Immunofluorescence staining Human femoral arteries were obtained from human subjects who underwent leg amputation surgery, and the arteries were then embedded in paraffin. Immunofluorescence staining was
X.Q. Wang et al. / Atherosclerosis 250 (2016) 38e45
performed using anti-CTRP1, anti-CD68 and control IgG antibodies (1:200, all from Abcam, Cambridge, UK), followed by incubation with the fluorescence-conjugated secondary antibodies (1:1000 dilution, Alex Fluor 546 and 488, respectively; Invitrogen, Carlsbad, CA, USA). Images were acquired using an inverted epi-fluorescence microscope (IX70, Olympus). The subjects have given written informed consent. The Ethics Committee of Shanghai Jiao-Tong University approved the study. 2.8. Chromatin immunoprecipitation (ChIP) assay ChIP assays were performed as described previously [26]. In brief, primary human macrophages were either treated or incubated with different doses of CTRP1 for 48 h. Native protein-DNA complex were cross-linked by treatment with 1% formaldehyde for 10 min at room temperature. Equal aliquots of isolated chromatin were either left untreated (input) or subjected to immunoprecipitation with either anti-PPAR-g (#sc-7196, Santa Cruz, CA, USA), control IgG (Santa Cruz, CA, USA), or anti-RNA polymerase II antibody. Cross-linking was then reversed and the DNA samples were purified with a PCR purification kit. Real-time PCR was performed by using a pair of primers (forward: 50 - GCTCACCACTGTACTCGTGC -30 and reverse: 50 - GGGGAATCTGTGAACCCCCT -30 ) encompassing the potential PPAR-g binding site of the CTRP1 promoter (transcript variant 2 and transcript variant 3). The ratio of precipitated DNA to the total input DNA was analyzed.
41
2.9. Enzyme-linked immunosorbent assay (ELISA) Human macrophages were either untreated or exposed to 50 mg/ml oxLDL in the presence or absence of CTRP1 neutralizing antibody (10 mg/ml, #ab135582, Abcam, Cambridge, UK). Protein levels of MCP-1 (#559017, BD Biosciences, Milan, Italy), TNFa (#550610, BD Biosciences, Milan, Italy), IL-1b (#QLB00B, R&D Systems, Minneapolis, MN, USA) and IL-6 (#Q6000B, R&D Systems, Minneapolis, MN, USA) in the conditioned media were measured by ELISA kits following the manufacture's protocol. 2.10. Statistical analysis Data are expressed as mean ± SEM from 3 to 7 independent experiments. Differences were analyzed by two-tailed Student ttest. Probability values less than 0.05 were considered statistically significant. 3. Results 3.1. CTRP family members are differentially expressed in PBMC, macrophages, and lipid-laden foam cells To assess the role of CTRPs in macrophage differentiation and lipid metabolism, human PBMC were isolated from the blood of healthy donors and cultivated with M-CSF to induce differentiation
Fig. 2. CTRP1 expression is regulated in a PPAR-g-dependent manner. (A) The putative PPAR response element (PPRE) in the CTRP1 promoter was identified by computational analysis with the MatInspector program. Sequence conservation of the putative PPRE was demonstrated by cross-species alignment of the CTRP1 promoter from human, mouse and rat. The putative PPRE sequences in the CTRP1 promoter were further compared with experimentally validated PPREs from various PPAR-g-responsive genes. (B) Primary human macrophages were treated with indicated doses of PPAR agonist rosiglitazone for 12 h. CTRP1 protein levels were analyzed by Western blot and densitometric quantification is shown (C). (D) Primary human macrophages were pre-incubated with indicated doses of the PPAR antagonist GW9662 followed by oxLDL treatment for another 48 h. CTRP1 protein levels were analyzed by Western blot and densitometric quantification is shown (E). Data are expressed as mean ± SD of at least 3 independent experiments. **p < 0.01 and * p < 0.05 vs. untreated control group. #p < 0.05 vs. cells treated with oxLDL alone.
42
X.Q. Wang et al. / Atherosclerosis 250 (2016) 38e45
into mature macrophages, with the purity of which over 98% as determined by flow cytometry (Fig. 1A). Expression levels of CTRP19 in PBMC, monocyte-derived macrophages and oxLDL-induced foam cells (Fig. 1B) were examined by real-time PCR and/or Western blot analysis. We found almost all the CTRPs, with the solo exception of CTRP6, were dramatically induced after differentiation of PBMC into macrophages in vitro (Fig. 1C, F and G). Transformation of human macrophages to foam cells upon oxLDL exposure led to a further increase in CTPR1 levels (p < 0.05 for mRNA, p < 0.01 for protein), with no significant effects on most CTRPs and decrease in CTRP4 (p < 0.01 for protein) and CTRP6 levels (p < 0.05 for mRNA and protein; Fig. 1D, F and G). Consistently, greater secretion of CTRP1 was detected in the conditioned media of human macrophages cultured with oxLDL as compared with untreated cells (Fig. 1E). Of note, analysis of CTRPs expression in different PBMC subsets by FACS and real-time PCR revealed that all the tested CTRPs were mainly enriched in CD16þ/CD64þ monocytes as compared to CD16-/CD64- subsets (Supplementary Fig. 1). 3.2. CTRP1 is regulated in a PPAR- g-dependent manner
macrophages. In this study, most of the CTRPs were significantly induced in mature macrophages, indicating that CTRP family may play important roles in modulating macrophage cellular functions. To date, at least 15 CTRPs have been identified based on their highly reserved common structures [20]. In particular, the threedimensional structure of globular domain highly resembles that of TNF and shares similar amino acid identity with each other [28,29]. In vivo and in vitro studies have also revealed some common features of the CTRP family, such as glucose-lowering effects possessed by CTRP1, 2, 3, 5, 13 [19,30e33]. We recently reported that CTRP1 is a proatherogenic factor by promoting adhesion molecules expression and inflammatory cytokines secretion in endothelial cells, whereas genetic deletion of CTRP1 substantially attenuated progression of atherosclerotic lesions in apoE/ mice [34]. In the present study, we further found that CTRP1, which is induced after transformation into macrophages, markedly amplifies local inflammatory response in atherosclerotic lesions. Different CTRP members may counterbalance with each other and coordinated expression of all the CTRPs
PPAR-g mediates macrophage differentiation and lipid metabolism by modulating a variety of downstream gene expression including adiponectin [27]. Thus we hypothesized that CTRP1, as a paralog of adiponectin, is also a downstream target gene under PPAR-g regulation. To test this, computational analysis was performed to identify potential PPAR-g binding sites in the CTRP1 promoter. A putative binding sequence with high identity to the consensus or other experimentally validated PPAR-g-responsive elements (PPRE) was detected at 396 to 384 bp upstream of transcriptional start site (TSS) in the human CTRP1 promoter. Sequences alignment displayed high conservation among different species (Fig. 2A). In accordance, a significant increase in CTRP1 protein expression was observed after treatment with PPAR-g agonist rosiglitazone (Fig. 2B and C), whereas oxLDL-induced CTRP1 expression was blunted by a synthetic PPAR-g antagonist (Fig. 2D and E). 3.3. Association of PPAR- g with CTRP1 promoter is increased by oxLDL Chromatin immunoprecipitation (ChIP) assay showed an association of PPAR-g with the CTRP1 promoter under basal condition, and the DNA-protein complex was significantly increased after oxLDL stimulation for 48 h (Fig. 3A and B). Additionally, knockdown of PPAR-g by specific siRNA abolished CTRP1 expression both under basal condition and in response to oxLDL (Fig. 3C). 3.4. CTRP1 is a pro-atherogenic factor in macrophages In line with in vitro findings, an evident expression of CTRP1 was detected in the infiltrated macrophages of human femoral arteries (Fig. 4). Secretion of pro-atherogenic factors, including TNFa, MCP1, IL-1b, and IL-6, were markedly amplified by CTRP1, whereas oxLDL-induced inflammatory cytokine production was significantly attenuated after the treatment with CTRP1 neutralizing antibody (Fig. 5). 4. Discussion The present study for the first time demonstrates that CTRP1 was greatly induced after oxLDL exposure by activating nuclear receptor PPAR-g, which promotes inflammatory cytokine secretion. These results suggest that CTRP1 may act as a key mediator in the integration of lipid metabolism and inflammatory responses in
Fig. 3. Association of PPAR-g with CTRP1 promoter is increased by oxLDL. Chromatin immunoprecipitation (ChIP) was performed to assess the interaction of PPAR-g with CTRP1 promoter. (A) Immunoprecipitated DNA fragments were analyzed by realtime PCR using a pair of primers flanking the putative PPRE site in the CTRP1 promoter. (B) Shown is the percentage of precipitated DNA relative to the input control. Results are expressed as mean ± SD of three independent experiments. **p < 0.01 and * p < 0.05 vs. untreated control group. (C) Human macrophages were either transfected with scramble control or PPAR-g-specific siRNA for 48 h. Cells were then treated with 50 mg/ml oxLDL for an additional 48 h. Protein expression of CTRP1 and PPAR-g was analyzed by Western blot. SC, scramble control.
X.Q. Wang et al. / Atherosclerosis 250 (2016) 38e45
should be important to maintain normal cell status and proper cellular functions. Surprisingly, in a very recent report, Yuasa et al. suggested that CTRP1 protects the heart from ischemia/reperfusion injury by reducing cardiomyocyte apoptosis and inflammatory response [35]. The seemingly conflicting role of CTRP1 in different inflammatory settings might be due to several reasons: 1) distinct post-translational modifications of the protein may endow the cytokine with different functional properties. 2) CTRPs were
43
reported to assemble into, homozygous or heterozygous, highorder oligomeric complex. Diverse expression profiles of CTRP family members in varied conditions may give rise to different high-order oligomeric complexes with totally different bioactivities. Further studies are needed to precisely define the specific structural and functional properties of CTRPs in different conditions. PPAR-g is a nuclear receptor with transcriptional activity
Fig. 4. Expression of CTRP1 in human atherosclerotic plaques. Human femoral arteries from amputation surgery were harvested for immunofluorescence analysis of CTRP1 expression in the vessel wall. Infiltrated macrophages were detected by CD68 staining and merge shows evident CTRP1 expression in the macrophages. Cell nuclei in merge were stained with DAPI. Box areas are shown at higher magnification in below panels. Region L indicates lumen and region I indicates intima. Arrowheads point to the infiltrated macrophages.
44
X.Q. Wang et al. / Atherosclerosis 250 (2016) 38e45
Fig. 5. CTRP1 facilitates the production of inflammatory cytokines. Primary human macrophages were treated with CTRP1 neutralizing antibodies or control IgG (pretreated for 1 h), human recombinant CTRP1 (1 mg/ml), or bovine serum albumin in the presence of 50 mg/ml oxLDL for 48 h. Protein levels of TNFa (A), MCP-1 (B), IL-1b (C), and IL-6 (D) in the conditioned media were detected by enzyme-linked immunosobent assay (ELISA). Data are expressed as mean ± SD of 4 independent experiments. *p < 0.05 and **p < 0.01 vs. cells treated with oxLDL alone.
involved various vital cell processes including cell differentiation and lipid metabolism [11]. Consistent with previous reports that thiazolidinediones (TZDs) up-regulates CTRP1 expression in adipocytes [19], we predicted a highly-conserved PPAR-g binding site in the CTRP1 promoter by using bioinformatic analysis. In addition, we found PPAR-g was required for oxLDL-induced CTRP1 production. This regulatory mechanism was further confirmed by chromatin immuoprecipitation assay that exhibited a direct association of PPAR-g with CTRP1 promoter. Interestingly, adiponectin and CTRP3, which also possess PPRE in their promoters [27,36], were either unchanged or even decreased by oxLDL exposure, suggesting that other mechanisms may be involved. For instance, different transcriptional co-activator or co-repressors might be recruited to the promoter simultaneously for differential expression of these CTPRs. We propose CTRP1 is an important mediator that links dysregulation in lipid metabolism and inflammatory responses. Internalization of oxLDL by macrophages not only contributes to lipid retention within the arterial wall but also enhances local inflammation [5]. In contrast to adiponectin that is reduced in obesity or in the presence of oxLDL [37,38], we found CTRP1 production was markedly increased in lipid-laden foam cells. Furthermore, the secretion of pro-atherosclerotic mediators was markedly decreased by blocking CTRP1 with its specific antibody. Therefore, it is conceivable that CTRP1 exerts its pro-inflammatory effects via autocrine/paracrine mechanisms upon oxLDL exposure. In summary, our study suggests CTRP1 represents a novel linkage between lipid metabolism and inflammatory responses. Strategies aimed to reduce CTRP1 production or inhibit its downstream signaling would be predicted to improve local inflammation and the progression of atherosclerosis. 5. Conflict of interest All authors have no conflict of interest.
Acknowledgments This work was supported by grant from Chinese National Nature Science Foundation (No. 81400211). Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.atherosclerosis.2016.04.024. References [1] R. Ross, The pathogenesis of atherosclerosisean update, N. Engl. J. Med. 314 (1986) 488e500. [2] J.A. Berliner, M. Navab, A.M. Fogelman, J.S. Frank, L.L. Demer, P.A. Edwards, A.D. Watson, A.J. Lusis, Atherosclerosis: basic mechanisms: oxidation, inflammation, and genetics, Circulation 91 (1995) 2488e2496. [3] P. Libby, P.M. Ridker, A. Maseri, Inflammation and atherosclerosis, Circulation 105 (2002) 1135e1143. [4] D.C. Schwenke, T.E. Carew, Initiation of atherosclerotic lesions in cholesterolfed rabbits. II. Selective retention of LDL vs. selective increases in LDL permeability in susceptible sites of arteries, Arterioscler. Thromb. Vasc. Biol. 9 (1989) 908e918. [5] T. Kita, N. Kume, M. Minami, K. Hayashida, T. Murayama, H. Sano, H. Moriwaki, H. Kataoka, E. Nishi, H. Horiuchi, H. Arai, M. Yokode, Role of oxidized LDL in atherosclerosis, Ann. N. Y. Acad. Sci. 947 (2001) 199e206. [6] Y.I. Miller, S.-H. Choi, P. Wiesner, L. Fang, R. Harkewicz, K. Hartvigsen, A. Boullier, A. Gonen, C.J. Diehl, X. Que, E. Montano, P.X. Shaw, S. Tsimikas, C.J. Binder, J.L. Witztum, Oxidation-specific epitopes are danger-associated molecular patterns recognized by pattern recognition receptors of innate immunity, Circ. Res. 108 (2011) 235e248. [7] X. Zhang, D.M. Mosser, Macrophage activation by endogenous danger signals, J. Pathol. 214 (2008) 161e178. [8] K. Hartvigsen, M.-Y. Chou, L.F. Hansen, P.X. Shaw, S. Tsimikas, C.J. Binder, J.L. Witztum, The role of innate immunity in atherogenesis, J. Lipid Res. 50 (2009) S388eS393. [9] P.R. Moreno, E. Falk, I.F. Palacios, J.B. Newell, V. Fuster, J.T. Fallon, Macrophage infiltration in acute coronary syndromes. Implications for plaque rupture, Circulation 90 (1994) 775e778. [10] P. Libby, Molecular bases of the acute coronary syndromes, Circulation 91 (1995) 2844e2850. [11] S.J. Bensinger, P. Tontonoz, Integration of metabolism and inflammation by
X.Q. Wang et al. / Atherosclerosis 250 (2016) 38e45 lipid-activated nuclear receptors, Nature 454 (2008) 470e477. [12] T. Varga, Z. Czimmerer, L. Nagy, PPARs are a unique set of fatty acid regulated transcription factors controlling both lipid metabolism and inflammation, Biochim. Biophys. Acta BBA - Mol. Basis Dis. 1812 (2011) 1007e1022. [13] L. Tornatore, A.K. Thotakura, J. Bennett, M. Moretti, G. Franzoso, The nuclear factor kappa B signaling pathway: integrating metabolism with inflammation, Trends Cell Biol. 22 (2012) 557e566. [14] A.F. McGettrick, L.A.J. O'Neill, How metabolism generates signals during Innate Immunity and Inflammation, J. Biol. Chem. 288 (2013) 22893e22898. [15] K. Yang, Y.S. He, X.Q. Wang, L. Lu, Q.J. Chen, J. Liu, Z. Sun, W.F. Shen, MiR-146a inhibits oxidized low-density lipoprotein-induced lipid accumulation and inflammatory response via targeting toll-like receptor 4, FEBS Lett. 585 (2011) 854e860. [16] N. Ouchi, S. Kihara, Y. Arita, M. Nishida, A. Matsuyama, Y. Okamoto, M. Ishigami, H. Kuriyama, K. Kishida, H. Nishizawa, K. Hotta, M. Muraguchi, Y. Ohmoto, S. Yamashita, T. Funahashi, Y. Matsuzawa, Adipocyte-derived plasma protein, adiponectin, suppresses lipid accumulation and class A scavenger receptor expression in human monocyte-derived macrophages, Circulation 103 (2001) 1057e1063. [17] F. Lovren, Y. Pan, A. Quan, P.E. Szmitko, K.K. Singh, P.C. Shukla, M. Gupta, L. Chan, M. Al-Omran, H. Teoh, S. Verma, Adiponectin primes human monocytes into alternative anti-inflammatory M2 macrophages, Am. J. Physiol. Heart Circ. Physiol. 299 (2010) H656eH663. [18] K. Ohashi, J.L. Parker, N. Ouchi, A. Higuchi, J.A. Vita, N. Gokce, A.A. Pedersen, C. Kalthoff, S. Tullin, A. Sams, R. Summer, K. Walsh, Adiponectin promotes macrophage polarization toward an anti-inflammatory phenotype, J. Biol. Chem. 285 (2010) 6153e6160. [19] G.W. Wong, S.A. Krawczyk, C. Kitidis-Mitrokostas, T. Revett, R. Gimeno, H.F. Lodish, Molecular, biochemical and functional characterizations of C1q/ TNF family members: adipose-tissue-selective expression patterns, regulation by PPAR-gamma agonist, cysteine-mediated oligomerizations, combinatorial associations and metabolic functions, Biochem. J. 416 (2008) 161e177. [20] A. Schaffler, C. Buechler, CTRP family: linking immunity to metabolism, Trends Endocrinol. Metab. TEM 23 (2012) 194e204. [21] G. Innamorati, M.I. Whang, R. Molteni, C. Le Gouill, M. Birnbaumer, GIP, a Gprotein-coupled receptor interacting protein, Regul. Pept. 109 (2002) 173e179. [22] K.Y. Kim, H.Y. Kim, J.H. Kim, C.H. Lee, D.H. Kim, Y.H. Lee, S.H. Han, J.S. Lim, D.H. Cho, M.S. Lee, S. Yoon, K.I. Kim, D.Y. Yoon, Y. Yang, Tumor necrosis factoralpha and interleukin-1beta increases CTRP1 expression in adipose tissue, FEBS Lett. 580 (2006) 3953e3960. [23] H. Kirii, T. Niwa, Y. Yamada, H. Wada, K. Saito, Y. Iwakura, M. Asano, H. Moriwaki, M. Seishima, Lack of Interleukin-1b decreases the severity of atherosclerosis in ApoE-deficient mice, Arterioscler. Thromb. Vasc. Biol. 23 (2003) 656e660. [24] A.F. Saad, G. Virella, C. Chassereau, R.J. Boackle, M.F. Lopes-Virella, OxLDL immune complexes activate complement and induce cytokine production by MonoMac 6 cells and human macrophages, J. Lipid Res. 47 (2006) 1975e1983. [25] M. Furuhashi, G. Tuncman, C.Z. Gorgun, L. Makowski, G. Atsumi, E. Vaillancourt, K. Kono, V.R. Babaev, S. Fazio, M.F. Linton, R. Sulsky, J.A. Robl, R.A. Parker, G.S. Hotamisligil, Treatment of diabetes and atherosclerosis by inhibiting fatty-acid-binding protein aP2, Nature 447 (2007) 959e965.
45
[26] X.Q. Wang, P. Nigro, C. World, K. Fujiwara, C. Yan, B.C. Berk, Thioredoxin interacting protein promotes endothelial cell inflammation in response to disturbed flow by increasing leukocyte adhesion and repressing kruppel-like factor 2, Circ. Res. 110 (2012) 560e568. [27] M. Iwaki, M. Matsuda, N. Maeda, T. Funahashi, Y. Matsuzawa, M. Makishima, I. Shimomura, Induction of adiponectin, a fat-derived antidiabetic and antiatherogenic factor, by nuclear receptors, Diabetes 52 (2003) 1655e1663. [28] L. Shapiro, P.E. Scherer, The crystal structure of a complement-1q family protein suggests an evolutionary link to tumor necrosis factor, Curr. Biol. CB 8 (1998) 335e338. [29] G.W. Wong, S.A. Krawczyk, C. Kitidis-Mitrokostas, G. Ge, E. Spooner, C. Hug, R. Gimeno, H.F. Lodish, Identification and characterization of CTRP9, a novel secreted glycoprotein, from adipose tissue that reduces serum glucose in mice and forms heterotrimers with adiponectin, FASEB J. 23 (2009) 241e258. [30] H. Li, X. Gao, Y. Zhou, N. Li, C. Ge, X. Hui, Y. Wang, A. Xu, S. Jin, D. Wu, High level expression, purification and characterization of active fusion human C1q and tumor necrosis factor related protein 2 (hCTRP2) in Escherichia coli, Protein Expr. Purif. 79 (2011) 1e6. [31] J.M. Peterson, Z. Wei, G.W. Wong, C1q/TNF-related protein-3 (CTRP3), a novel adipokine that regulates hepatic glucose output, J. Biol. Chem. 285 (2010) 39691e39701. [32] S.Y. Park, J.H. Choi, H.S. Ryu, Y.K. Pak, K.S. Park, H.K. Lee, W. Lee, C1q tumor necrosis factor alpha-related protein isoform 5 is increased in mitochondrial DNA-depleted myocytes and activates AMP-activated protein kinase, J. Biol. Chem. 284 (2009) 27780e27789. [33] Z. Wei, J.M. Peterson, G.W. Wong, Metabolic regulation by C1q/TNF-related protein-13 (CTRP13): activation OF AMP-activated protein kinase and suppression of fatty acid-induced JNK signaling, J. Biol. Chem. 286 (2011) 15652e15665. [34] L. Lu, R.Y. Zhang, X.Q. Wang, Z.H. Liu, Y. Shen, F.H. Ding, H. Meng, L.J. Wang, X.X. Yan, K. Yang, H.B. Wang, L.J. Pu, Q. Zhang, Q.J. Chen, R. De Caterina, W.F. Shen, C1q/TNF-related protein-1: an adipokinemarking and promoting atherosclerosis, Eur. Heart J (2015), http://dx.doi.org/10.1093/eurheartj/ ehv649. Epub Dec. 24. [35] D. Yuasa, K. Ohashi, R. Shibata, N. Mizutani, Y. Kataoka, T. Kambara, Y. Uemura, K. Matsuo, N. Kanemura, S. Hayakawa, M. Hiramatsu-Ito, M. Ito, H. Ogawa, T. Murate, T. Murohara, N. Ouchi, C1q/TNF-related protein-1 functions to protect against acute ischemic injury in the heart, FASEB J. 30 (2016) 1065e1075. [36] A. Schaffler, J. Weigert, M. Neumeier, J. Scholmerich, C. Buechler, Regulation and function of collagenous repeat containing sequence of 26-kDa protein gene product “cartonectin”, Obesity 15 (2007) 303e313. [37] Y. Arita, S. Kihara, N. Ouchi, M. Takahashi, K. Maeda, J. Miyagawa, K. Hotta, I. Shimomura, T. Nakamura, K. Miyaoka, H. Kuriyama, M. Nishida, S. Yamashita, K. Okubo, K. Matsubara, M. Muraguchi, Y. Ohmoto, T. Funahashi, Y. Matsuzawa, Paradoxical decrease of an adipose-specific protein, adiponectin, in obesity, Biochem. Biophys. Res. Commun. 257 (1999) 79e83. €ki, T. Ro €nnemaa, R. Huupponen, T. Lehtim€ [38] R. Lautama aki, P. Iozzo, K.E.J. Airaksinen, J. Knuuti, P. Nuutila, Low serum adiponectin is associated with high circulating oxidized low-density lipoprotein in patients with type 2 diabetes mellitus and coronary artery disease, Metabolism 56 (2007) 881e886.
Contents lists available at ScienceDirect
Atherosclerosis journal homepage: www.elsevier.com/locate/atherosclerosis
C1q/TNF-related protein 1 links macrophage lipid metabolism to inflammation and atherosclerosis Xiao Qun Wang a, b, 1, Zhu Hui Liu a, b, 1, Lu Xue c, Lin Lu a, b, Jie Gao a, Ying Shen a, Ke Yang b, Qiu Jing Chen b, Rui Yan Zhang a, b, Wei Feng Shen a, b, * a b c
Department of Cardiology, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, PR China Institute of Cardiovascular Diseases, Shanghai Jiao Tong University, Shanghai, PR China Department of Allergy, Renji Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, PR China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 29 December 2015 Received in revised form 24 April 2016 Accepted 26 April 2016 Available online 27 April 2016
Background and aims: Macrophage is a major contributor to the development of atherosclerosis by taking up deposited lipoprotein and eliciting local inflammation. Previously, we and others have shown C1q/ TNF-related proteins (CTRPs) play diverse roles in vascular functions. In this study, we sought to investigate the changes in CTRP expression levels during vital biological processes in macrophages and their relation to inflammatory responses. Methods: Western blot and real-time PCR were performed to analyze CTRPs expression levels in human peripheral blood mononuclear cells, primary macrophages and lipid-laden foam cells. Mechanisms that regulate CTPR1 expression were further investigated by bioinformatic analysis and chromatin immunoprecipitation. Enzyme-linked immunosorbent assay was performed to measure the concentration of inflammatory cytokines. Results: We found that almost all CTRPs were significantly increased in primary human macrophages after differentiation from peripheral blood mononuclear cells. In particular, CTRP1 was further upregulated upon exposure to oxidized low-density lipoprotein (oxLDL) in a peroxisome proliferatoractivated receptor (PPAR)-dependent manner. Chromatin immunoprecipitation also confirmed the presence of PPAR-g in the CTRP1 promoter after oxLDL treatment. Stimulation of CTRP1 led to markedly enhanced secretion of pro-atherogenic factors, including MCP-1, TNF-a, IL-1b, and IL-6, whereas oxLDLinduced inflammatory cytokine production was significantly attenuated after the treatment with CTRP1 neutralizing antibody. Conclusions: These data suggest an essential role of CTRP1 in linking dysregulation of lipid metabolism and inflammatory responses in macrophages. © 2016 Elsevier Ireland Ltd. All rights reserved.
Keywords: CTRP Macrophage Inflammation Atherosclerosis
1. Introduction Macrophages are central in the development of atherosclerosis by facilitating lipid retention in the arterial wall as well as amplification of local inflammatory responses [1e3]. Lipoproteins that invade into the subendothelial space in the lesion-prone area undergo further modification and lead to massive accumulation of oxidized low-density lipoprotein (oxLDL). Monocytes in circulation
* Corresponding author. Department of Cardiology, Rui Jin Hospital, 197 Rui Jin Road II, Shanghai, 200025, PR China. E-mail address: [email protected] (W.F. Shen). 1 These authors contributed equally to this manuscript. http://dx.doi.org/10.1016/j.atherosclerosis.2016.04.024 0021-9150/© 2016 Elsevier Ireland Ltd. All rights reserved.
were then recruited and differentiate into macrophages, take up oxLDL deposited within the arterial wall, and finally transform into lipid-laden foam cells [4,5]. The death of foam cells leads to the formation of lipid-rich necrotic core with fibrous cap that is recognized as hallmarks of advanced atherosclerotic lesions [3]. On the other hand, a variety of scavengers and pattern recognition receptors (PRR) recognize the altered modification present on oxLDL as a danger-associated-molecular-pattern (DAMP), thereby activating downstream pro-inflammatory signaling and promoting the production of inflammatory mediators, chemotactic cytokines, and extracellular matrix degrading enzymes [6e8]. This process dramatically enhances local inflammatory responses in the lesion area and ultimately contributes to plaque rupture and the onset of acute coronary syndrome (ACS) [9,10].
X.Q. Wang et al. / Atherosclerosis 250 (2016) 38e45
Accumulating evidence reveals reciprocal relations between pathways modulating lipid metabolism and inflammatory responses [11e14]. We previously reported that oxLDL stimulation of macrophages resulted in prominent changes in microRNA expression profiles including down-regulation of miR-146a, miR-155. Especially, miR-146a was found to decrease both intracellular cholesterol levels and inflammatory cytokine secretion via direct deactivation of TLR4-dependent signaling at post-transcriptional level [15]. Adiponectin, an adipocytokine whose circulating levels are reduced in patients with coronary artery diseases, was reported to suppress lipid accumulation [16] and promote macrophage polarization toward an anti-inflammatory phenotype [17,18]. However, the exact mechanism linking lipid metabolism and inflammation remains largely unknown. Recently, an expanding family of highly conserved adiponectin paralogs, designated as C1q/TNF-related protein, was identified based on the common structure that comprises 4 distinct domainsa signal peptide, a short N-terminal variable region, a collagen domain with Gly-X-Y repeats, and a C-terminal globular domain [19]. In contrast to adiponectin that is exclusively expressed in adipocytes, a much wider tissue distribution of CTRPs was detected [20]. For instance, CTRP1 is expressed in heart, liver, kidney, placenta and stromal vascular cells that include macrophages [19,21,22]. However, the expression levels and biological functions of CTRPs in macrophages are rarely discussed. In the present study, we show that most of CTRPs are up-regulated in mature macrophages after transformation from primary human monocytes in vitro. CTRP1 is further increased in a peroxisome proliferatoractivated receptor (PPAR) -g-dependent manner after exposure to oxLDL, thereby promoting local inflammation by enhancing the production of major pro-atherogenic factors including monocyte chemoattractant protein (MCP)-1, tumor necrosis factor (TNF) a, interleukin (IL) -1b, and IL-6 [23e25]. 2. Methods 2.1. Cell culture and reagents Primary human peripheral blood mononuclear cells (PBMC) were isolated from buffy coats derived from healthy donors. After cultivation for 1 h in complete RPMI 1640 medium containing 20% heat-inactivated fetal calf serum (FCS), 1% penicillin/streptomycin (all from Invitrogen, Carlsbad, CA, USA), and 2% L-glutamine (SigmaAldrich, San Jose, CA) at 37 C, the monocytes became adherent and were washed three times with phosphate-buffered saline (PBS, Gibco, Auckland, New Zealand) to remove contaminating lymphocytes. The remaining adherent cells were then maintained in the same media in the presence of 50 ng/ml recombinant human macrophage colony stimulating factor (M-CSF, R&D, Minneapolis, MN, USA) for 5 days. Mature macrophages were incubated with Rosiglitazone (Sigma-Aldrich, San Jose, CA), GW9662 (SigmaAldrich, San Jose, CA), or oxLDL (Serotec, Oxford, UK) for further studies. 2.2. Flow cytometric analysis Human monocyte-derived macrophages were washed with PBS and incubated with mouse anti-human CD68 antibodies (#ab955, Abcam, Cambridge, UK) or control mouse IgG (Santa Cruz Biotechnology, CA, USA) for 30 min on ice. After rinsing with ice cold PBS for 3 times, cells were incubated with Alexa Fluor® 488 Conjugated Rat Anti-Mouse Antibodies (Invitrogen, Carlsbad, CA, USA) for 15 min on ice. Flow cytometric measurements were performed with an Epics Elite flow cytometer (Beckman).
39
2.3. Fluorescence activated cell sorting (FACS) PBMC were isolated as described above and resuspended in PBS/ 1% FCS. 5 106 cells were stained with anti-CD16 FITC (#560996, BD Biosciences, Franklin Lakes, NJ, USA) and anti-CD64 PE (#561926, BD Biosciences, Franklin Lakes, NJ, USA). Samples were incubated on ice in dark for 30 min then washed with 5 ml PBS/1% FCS. PBMC were sorted into CD16þ/CD64þ and CD16-/CD64- populations. Cells were then collected by centrifugation and stored in liquid nitrogen for further experiments. 2.4. Oil Red O staining Human macrophages were fixed in 4% paraformaldehyde in PBS (pH 7.4) for 15 min. After rinsing with PBS for 3 times, cells were incubated with filtered Oil Red O (ORO) solution (0.6 g/L ORO in 60% isopropanol, Sigma-Aldrich, St. Louis, MO, USA) for 10 min. After another 3 rinses with PBS, images were acquired using an inverted microscope (IX70, Olympus). 2.5. Quantitative real-time polymerase chain reaction (PCR) Total RNA was extracted using a TRIzol reagent (Invitrogen, Carlsbad, CA). For reverse transcription, 1 mg of total RNA was converted into first strand complementary DNA (cDNA) in a 20 ml reaction volume using a reverse transcription kit (#A3500, Promega, Madison, WI) following the manufacturer's instruction. Quantitative real-time PCR analysis was performed (StepOne, Applied Biosystems) using SYBR Green (Takara, Dalian, China). The comparative cycle threshold method was used to determine the relative mRNA expression of target genes after normalization to housekeeping gene GAPDH. Following primers were used: 50 GAGTCCACTGGCGTCTTCA-30 for human GAPDH-F and 50 GAGTCCTTCCACGATACCAA -30 for human GAPDH-R. 50 -AGAACGAGGAGGAGGTGGTG -30 for human CTRP1-F and 50 -GCATCAGGCTCTGGCTTTG -30 for human CTRP1-R. 50 0 CTGTGCCCTCCCCTGTGCT -3 for human CTRP2-F and 50 CCCATTCGTCCCATCATTCC -30 for human CTRP2-R. 50 -ATGAAGGGCAAATCAGATACA -30 for human CTRP3-F and 50 -GGAGAAGCGTTGGTGGTC -30 for human CTRP3-R. 50 TGTCGGTTAAGCTGATGAAGAAC -30 for human CTRP4-F and 50 ACTTGCCGTGGTTGCTGTAG -30 for human CTRP4-R. 50 -GGGTCTACTACTTCGCCGTCCAT -30 for human CTRP5-F and 50 AAGGTGCTGTCTGTCTTGATGCTG -30 for human CTRP5-R. 50 CCCTGCGTGGCATCTACTTC -30 for human CTRP6-F and 50 GCCGCTGAAGGTGATGTAGGT -30 for human CTRP6-R. 50 -TAACAAGGTCCTCTTCAACGA -30 for human CTRP7-F and 50 -AGTCCGATTGCCAGATGC -30 for human CTRP7-R. 50 GCGTCTACTTCCTCAGCCTC -30 for human CTRP8-F and 50 -CGTAGATGGCGTTGTCCC -30 for human CTRP8-R. 50 -TGGTCAAAAATGGAGTAAAAATA -30 for human CTRP9-F and 50 GTGTCATCGTCCTCATCAGC -30 for human CTRP9-R. 2.6. Western blot Human PBMC and treated macrophages were harvested and lysed in ice-cold lysis buffer (#9803, Cell Signaling Technology, Beverly, MA) supplemented with protease inhibitor cocktail (#P8340, Sigma-Aldrich, St. Louis, MO). Cell lysates were subjected to SDS-polyacrylamide gel electrophoresis (PAGE), followed by electrophoretic transfer onto PVDF membranes (Millipore, Bedford, MA). The blots were incubated overnight at 4 C with specific primary antibodies and then exposed to secondary antibodies conjugated with horseradish peroxidase (1: 5000, Cell Signaling Technology, Beverly, MA) for 1 h at 4 C. The antibody was
40
X.Q. Wang et al. / Atherosclerosis 250 (2016) 38e45
Fig. 1. Different expression profiles of CTRP family members in PBMC, macrophages and lipid-laden foam cells. (A) The purity of macrophage was evaluated by flow cytometric analysis using an antibody to CD68 (specific to macrophages). (B) Shown is Oil Red O staining of control and oxLDL-loaded macrophages (foam cells). (C and D) Quantitative realtime PCR was performed to assess the differential expression of CTRP member transcripts during differentiation of PBMC into mature macrophages (C) and the subsequent transformation into foam cells after loading with 50 mg/ml oxLDL for 48 h (D). Results were normalized to their corresponding GAPDH RNA levels. **p < 0.01 and * p < 0.05 vs. control group. (EeG) CTRP1 protein levels in the conditioned media (E) and cell lysates (FeG) from PBMC, cultured macrophages and foam cells were analyzed by enzyme-linked immunosobent assay (ELISA) and Western blots. (G) Densitometric quantification of the Western results. **p < 0.01 and * p < 0.05 vs. PBMC. ##p < 0.01 and #p < 0.05 vs. macrophages. PBMC, peripheral blood mononuclear cells; MF, macrophages; FC, foam cells. Data are expressed as mean ± SD of at least 5 independent experiments. (For interpretation of the references to colour in this figure caption, the reader is referred to the web version of this article.)
visualized by incubating with Immobilon Western Chemiluminescent HRP Substrate (Millipore, Bedford, MA, USA). Densitometric analysis of membranes was performed using Image J software (version 1.36b, National Institutes of Health).
2.7. Immunofluorescence staining Human femoral arteries were obtained from human subjects who underwent leg amputation surgery, and the arteries were then embedded in paraffin. Immunofluorescence staining was
X.Q. Wang et al. / Atherosclerosis 250 (2016) 38e45
performed using anti-CTRP1, anti-CD68 and control IgG antibodies (1:200, all from Abcam, Cambridge, UK), followed by incubation with the fluorescence-conjugated secondary antibodies (1:1000 dilution, Alex Fluor 546 and 488, respectively; Invitrogen, Carlsbad, CA, USA). Images were acquired using an inverted epi-fluorescence microscope (IX70, Olympus). The subjects have given written informed consent. The Ethics Committee of Shanghai Jiao-Tong University approved the study. 2.8. Chromatin immunoprecipitation (ChIP) assay ChIP assays were performed as described previously [26]. In brief, primary human macrophages were either treated or incubated with different doses of CTRP1 for 48 h. Native protein-DNA complex were cross-linked by treatment with 1% formaldehyde for 10 min at room temperature. Equal aliquots of isolated chromatin were either left untreated (input) or subjected to immunoprecipitation with either anti-PPAR-g (#sc-7196, Santa Cruz, CA, USA), control IgG (Santa Cruz, CA, USA), or anti-RNA polymerase II antibody. Cross-linking was then reversed and the DNA samples were purified with a PCR purification kit. Real-time PCR was performed by using a pair of primers (forward: 50 - GCTCACCACTGTACTCGTGC -30 and reverse: 50 - GGGGAATCTGTGAACCCCCT -30 ) encompassing the potential PPAR-g binding site of the CTRP1 promoter (transcript variant 2 and transcript variant 3). The ratio of precipitated DNA to the total input DNA was analyzed.
41
2.9. Enzyme-linked immunosorbent assay (ELISA) Human macrophages were either untreated or exposed to 50 mg/ml oxLDL in the presence or absence of CTRP1 neutralizing antibody (10 mg/ml, #ab135582, Abcam, Cambridge, UK). Protein levels of MCP-1 (#559017, BD Biosciences, Milan, Italy), TNFa (#550610, BD Biosciences, Milan, Italy), IL-1b (#QLB00B, R&D Systems, Minneapolis, MN, USA) and IL-6 (#Q6000B, R&D Systems, Minneapolis, MN, USA) in the conditioned media were measured by ELISA kits following the manufacture's protocol. 2.10. Statistical analysis Data are expressed as mean ± SEM from 3 to 7 independent experiments. Differences were analyzed by two-tailed Student ttest. Probability values less than 0.05 were considered statistically significant. 3. Results 3.1. CTRP family members are differentially expressed in PBMC, macrophages, and lipid-laden foam cells To assess the role of CTRPs in macrophage differentiation and lipid metabolism, human PBMC were isolated from the blood of healthy donors and cultivated with M-CSF to induce differentiation
Fig. 2. CTRP1 expression is regulated in a PPAR-g-dependent manner. (A) The putative PPAR response element (PPRE) in the CTRP1 promoter was identified by computational analysis with the MatInspector program. Sequence conservation of the putative PPRE was demonstrated by cross-species alignment of the CTRP1 promoter from human, mouse and rat. The putative PPRE sequences in the CTRP1 promoter were further compared with experimentally validated PPREs from various PPAR-g-responsive genes. (B) Primary human macrophages were treated with indicated doses of PPAR agonist rosiglitazone for 12 h. CTRP1 protein levels were analyzed by Western blot and densitometric quantification is shown (C). (D) Primary human macrophages were pre-incubated with indicated doses of the PPAR antagonist GW9662 followed by oxLDL treatment for another 48 h. CTRP1 protein levels were analyzed by Western blot and densitometric quantification is shown (E). Data are expressed as mean ± SD of at least 3 independent experiments. **p < 0.01 and * p < 0.05 vs. untreated control group. #p < 0.05 vs. cells treated with oxLDL alone.
42
X.Q. Wang et al. / Atherosclerosis 250 (2016) 38e45
into mature macrophages, with the purity of which over 98% as determined by flow cytometry (Fig. 1A). Expression levels of CTRP19 in PBMC, monocyte-derived macrophages and oxLDL-induced foam cells (Fig. 1B) were examined by real-time PCR and/or Western blot analysis. We found almost all the CTRPs, with the solo exception of CTRP6, were dramatically induced after differentiation of PBMC into macrophages in vitro (Fig. 1C, F and G). Transformation of human macrophages to foam cells upon oxLDL exposure led to a further increase in CTPR1 levels (p < 0.05 for mRNA, p < 0.01 for protein), with no significant effects on most CTRPs and decrease in CTRP4 (p < 0.01 for protein) and CTRP6 levels (p < 0.05 for mRNA and protein; Fig. 1D, F and G). Consistently, greater secretion of CTRP1 was detected in the conditioned media of human macrophages cultured with oxLDL as compared with untreated cells (Fig. 1E). Of note, analysis of CTRPs expression in different PBMC subsets by FACS and real-time PCR revealed that all the tested CTRPs were mainly enriched in CD16þ/CD64þ monocytes as compared to CD16-/CD64- subsets (Supplementary Fig. 1). 3.2. CTRP1 is regulated in a PPAR- g-dependent manner
macrophages. In this study, most of the CTRPs were significantly induced in mature macrophages, indicating that CTRP family may play important roles in modulating macrophage cellular functions. To date, at least 15 CTRPs have been identified based on their highly reserved common structures [20]. In particular, the threedimensional structure of globular domain highly resembles that of TNF and shares similar amino acid identity with each other [28,29]. In vivo and in vitro studies have also revealed some common features of the CTRP family, such as glucose-lowering effects possessed by CTRP1, 2, 3, 5, 13 [19,30e33]. We recently reported that CTRP1 is a proatherogenic factor by promoting adhesion molecules expression and inflammatory cytokines secretion in endothelial cells, whereas genetic deletion of CTRP1 substantially attenuated progression of atherosclerotic lesions in apoE/ mice [34]. In the present study, we further found that CTRP1, which is induced after transformation into macrophages, markedly amplifies local inflammatory response in atherosclerotic lesions. Different CTRP members may counterbalance with each other and coordinated expression of all the CTRPs
PPAR-g mediates macrophage differentiation and lipid metabolism by modulating a variety of downstream gene expression including adiponectin [27]. Thus we hypothesized that CTRP1, as a paralog of adiponectin, is also a downstream target gene under PPAR-g regulation. To test this, computational analysis was performed to identify potential PPAR-g binding sites in the CTRP1 promoter. A putative binding sequence with high identity to the consensus or other experimentally validated PPAR-g-responsive elements (PPRE) was detected at 396 to 384 bp upstream of transcriptional start site (TSS) in the human CTRP1 promoter. Sequences alignment displayed high conservation among different species (Fig. 2A). In accordance, a significant increase in CTRP1 protein expression was observed after treatment with PPAR-g agonist rosiglitazone (Fig. 2B and C), whereas oxLDL-induced CTRP1 expression was blunted by a synthetic PPAR-g antagonist (Fig. 2D and E). 3.3. Association of PPAR- g with CTRP1 promoter is increased by oxLDL Chromatin immunoprecipitation (ChIP) assay showed an association of PPAR-g with the CTRP1 promoter under basal condition, and the DNA-protein complex was significantly increased after oxLDL stimulation for 48 h (Fig. 3A and B). Additionally, knockdown of PPAR-g by specific siRNA abolished CTRP1 expression both under basal condition and in response to oxLDL (Fig. 3C). 3.4. CTRP1 is a pro-atherogenic factor in macrophages In line with in vitro findings, an evident expression of CTRP1 was detected in the infiltrated macrophages of human femoral arteries (Fig. 4). Secretion of pro-atherogenic factors, including TNFa, MCP1, IL-1b, and IL-6, were markedly amplified by CTRP1, whereas oxLDL-induced inflammatory cytokine production was significantly attenuated after the treatment with CTRP1 neutralizing antibody (Fig. 5). 4. Discussion The present study for the first time demonstrates that CTRP1 was greatly induced after oxLDL exposure by activating nuclear receptor PPAR-g, which promotes inflammatory cytokine secretion. These results suggest that CTRP1 may act as a key mediator in the integration of lipid metabolism and inflammatory responses in
Fig. 3. Association of PPAR-g with CTRP1 promoter is increased by oxLDL. Chromatin immunoprecipitation (ChIP) was performed to assess the interaction of PPAR-g with CTRP1 promoter. (A) Immunoprecipitated DNA fragments were analyzed by realtime PCR using a pair of primers flanking the putative PPRE site in the CTRP1 promoter. (B) Shown is the percentage of precipitated DNA relative to the input control. Results are expressed as mean ± SD of three independent experiments. **p < 0.01 and * p < 0.05 vs. untreated control group. (C) Human macrophages were either transfected with scramble control or PPAR-g-specific siRNA for 48 h. Cells were then treated with 50 mg/ml oxLDL for an additional 48 h. Protein expression of CTRP1 and PPAR-g was analyzed by Western blot. SC, scramble control.
X.Q. Wang et al. / Atherosclerosis 250 (2016) 38e45
should be important to maintain normal cell status and proper cellular functions. Surprisingly, in a very recent report, Yuasa et al. suggested that CTRP1 protects the heart from ischemia/reperfusion injury by reducing cardiomyocyte apoptosis and inflammatory response [35]. The seemingly conflicting role of CTRP1 in different inflammatory settings might be due to several reasons: 1) distinct post-translational modifications of the protein may endow the cytokine with different functional properties. 2) CTRPs were
43
reported to assemble into, homozygous or heterozygous, highorder oligomeric complex. Diverse expression profiles of CTRP family members in varied conditions may give rise to different high-order oligomeric complexes with totally different bioactivities. Further studies are needed to precisely define the specific structural and functional properties of CTRPs in different conditions. PPAR-g is a nuclear receptor with transcriptional activity
Fig. 4. Expression of CTRP1 in human atherosclerotic plaques. Human femoral arteries from amputation surgery were harvested for immunofluorescence analysis of CTRP1 expression in the vessel wall. Infiltrated macrophages were detected by CD68 staining and merge shows evident CTRP1 expression in the macrophages. Cell nuclei in merge were stained with DAPI. Box areas are shown at higher magnification in below panels. Region L indicates lumen and region I indicates intima. Arrowheads point to the infiltrated macrophages.
44
X.Q. Wang et al. / Atherosclerosis 250 (2016) 38e45
Fig. 5. CTRP1 facilitates the production of inflammatory cytokines. Primary human macrophages were treated with CTRP1 neutralizing antibodies or control IgG (pretreated for 1 h), human recombinant CTRP1 (1 mg/ml), or bovine serum albumin in the presence of 50 mg/ml oxLDL for 48 h. Protein levels of TNFa (A), MCP-1 (B), IL-1b (C), and IL-6 (D) in the conditioned media were detected by enzyme-linked immunosobent assay (ELISA). Data are expressed as mean ± SD of 4 independent experiments. *p < 0.05 and **p < 0.01 vs. cells treated with oxLDL alone.
involved various vital cell processes including cell differentiation and lipid metabolism [11]. Consistent with previous reports that thiazolidinediones (TZDs) up-regulates CTRP1 expression in adipocytes [19], we predicted a highly-conserved PPAR-g binding site in the CTRP1 promoter by using bioinformatic analysis. In addition, we found PPAR-g was required for oxLDL-induced CTRP1 production. This regulatory mechanism was further confirmed by chromatin immuoprecipitation assay that exhibited a direct association of PPAR-g with CTRP1 promoter. Interestingly, adiponectin and CTRP3, which also possess PPRE in their promoters [27,36], were either unchanged or even decreased by oxLDL exposure, suggesting that other mechanisms may be involved. For instance, different transcriptional co-activator or co-repressors might be recruited to the promoter simultaneously for differential expression of these CTPRs. We propose CTRP1 is an important mediator that links dysregulation in lipid metabolism and inflammatory responses. Internalization of oxLDL by macrophages not only contributes to lipid retention within the arterial wall but also enhances local inflammation [5]. In contrast to adiponectin that is reduced in obesity or in the presence of oxLDL [37,38], we found CTRP1 production was markedly increased in lipid-laden foam cells. Furthermore, the secretion of pro-atherosclerotic mediators was markedly decreased by blocking CTRP1 with its specific antibody. Therefore, it is conceivable that CTRP1 exerts its pro-inflammatory effects via autocrine/paracrine mechanisms upon oxLDL exposure. In summary, our study suggests CTRP1 represents a novel linkage between lipid metabolism and inflammatory responses. Strategies aimed to reduce CTRP1 production or inhibit its downstream signaling would be predicted to improve local inflammation and the progression of atherosclerosis. 5. Conflict of interest All authors have no conflict of interest.
Acknowledgments This work was supported by grant from Chinese National Nature Science Foundation (No. 81400211). Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.atherosclerosis.2016.04.024. References [1] R. Ross, The pathogenesis of atherosclerosisean update, N. Engl. J. Med. 314 (1986) 488e500. [2] J.A. Berliner, M. Navab, A.M. Fogelman, J.S. Frank, L.L. Demer, P.A. Edwards, A.D. Watson, A.J. Lusis, Atherosclerosis: basic mechanisms: oxidation, inflammation, and genetics, Circulation 91 (1995) 2488e2496. [3] P. Libby, P.M. Ridker, A. Maseri, Inflammation and atherosclerosis, Circulation 105 (2002) 1135e1143. [4] D.C. Schwenke, T.E. Carew, Initiation of atherosclerotic lesions in cholesterolfed rabbits. II. Selective retention of LDL vs. selective increases in LDL permeability in susceptible sites of arteries, Arterioscler. Thromb. Vasc. Biol. 9 (1989) 908e918. [5] T. Kita, N. Kume, M. Minami, K. Hayashida, T. Murayama, H. Sano, H. Moriwaki, H. Kataoka, E. Nishi, H. Horiuchi, H. Arai, M. Yokode, Role of oxidized LDL in atherosclerosis, Ann. N. Y. Acad. Sci. 947 (2001) 199e206. [6] Y.I. Miller, S.-H. Choi, P. Wiesner, L. Fang, R. Harkewicz, K. Hartvigsen, A. Boullier, A. Gonen, C.J. Diehl, X. Que, E. Montano, P.X. Shaw, S. Tsimikas, C.J. Binder, J.L. Witztum, Oxidation-specific epitopes are danger-associated molecular patterns recognized by pattern recognition receptors of innate immunity, Circ. Res. 108 (2011) 235e248. [7] X. Zhang, D.M. Mosser, Macrophage activation by endogenous danger signals, J. Pathol. 214 (2008) 161e178. [8] K. Hartvigsen, M.-Y. Chou, L.F. Hansen, P.X. Shaw, S. Tsimikas, C.J. Binder, J.L. Witztum, The role of innate immunity in atherogenesis, J. Lipid Res. 50 (2009) S388eS393. [9] P.R. Moreno, E. Falk, I.F. Palacios, J.B. Newell, V. Fuster, J.T. Fallon, Macrophage infiltration in acute coronary syndromes. Implications for plaque rupture, Circulation 90 (1994) 775e778. [10] P. Libby, Molecular bases of the acute coronary syndromes, Circulation 91 (1995) 2844e2850. [11] S.J. Bensinger, P. Tontonoz, Integration of metabolism and inflammation by
X.Q. Wang et al. / Atherosclerosis 250 (2016) 38e45 lipid-activated nuclear receptors, Nature 454 (2008) 470e477. [12] T. Varga, Z. Czimmerer, L. Nagy, PPARs are a unique set of fatty acid regulated transcription factors controlling both lipid metabolism and inflammation, Biochim. Biophys. Acta BBA - Mol. Basis Dis. 1812 (2011) 1007e1022. [13] L. Tornatore, A.K. Thotakura, J. Bennett, M. Moretti, G. Franzoso, The nuclear factor kappa B signaling pathway: integrating metabolism with inflammation, Trends Cell Biol. 22 (2012) 557e566. [14] A.F. McGettrick, L.A.J. O'Neill, How metabolism generates signals during Innate Immunity and Inflammation, J. Biol. Chem. 288 (2013) 22893e22898. [15] K. Yang, Y.S. He, X.Q. Wang, L. Lu, Q.J. Chen, J. Liu, Z. Sun, W.F. Shen, MiR-146a inhibits oxidized low-density lipoprotein-induced lipid accumulation and inflammatory response via targeting toll-like receptor 4, FEBS Lett. 585 (2011) 854e860. [16] N. Ouchi, S. Kihara, Y. Arita, M. Nishida, A. Matsuyama, Y. Okamoto, M. Ishigami, H. Kuriyama, K. Kishida, H. Nishizawa, K. Hotta, M. Muraguchi, Y. Ohmoto, S. Yamashita, T. Funahashi, Y. Matsuzawa, Adipocyte-derived plasma protein, adiponectin, suppresses lipid accumulation and class A scavenger receptor expression in human monocyte-derived macrophages, Circulation 103 (2001) 1057e1063. [17] F. Lovren, Y. Pan, A. Quan, P.E. Szmitko, K.K. Singh, P.C. Shukla, M. Gupta, L. Chan, M. Al-Omran, H. Teoh, S. Verma, Adiponectin primes human monocytes into alternative anti-inflammatory M2 macrophages, Am. J. Physiol. Heart Circ. Physiol. 299 (2010) H656eH663. [18] K. Ohashi, J.L. Parker, N. Ouchi, A. Higuchi, J.A. Vita, N. Gokce, A.A. Pedersen, C. Kalthoff, S. Tullin, A. Sams, R. Summer, K. Walsh, Adiponectin promotes macrophage polarization toward an anti-inflammatory phenotype, J. Biol. Chem. 285 (2010) 6153e6160. [19] G.W. Wong, S.A. Krawczyk, C. Kitidis-Mitrokostas, T. Revett, R. Gimeno, H.F. Lodish, Molecular, biochemical and functional characterizations of C1q/ TNF family members: adipose-tissue-selective expression patterns, regulation by PPAR-gamma agonist, cysteine-mediated oligomerizations, combinatorial associations and metabolic functions, Biochem. J. 416 (2008) 161e177. [20] A. Schaffler, C. Buechler, CTRP family: linking immunity to metabolism, Trends Endocrinol. Metab. TEM 23 (2012) 194e204. [21] G. Innamorati, M.I. Whang, R. Molteni, C. Le Gouill, M. Birnbaumer, GIP, a Gprotein-coupled receptor interacting protein, Regul. Pept. 109 (2002) 173e179. [22] K.Y. Kim, H.Y. Kim, J.H. Kim, C.H. Lee, D.H. Kim, Y.H. Lee, S.H. Han, J.S. Lim, D.H. Cho, M.S. Lee, S. Yoon, K.I. Kim, D.Y. Yoon, Y. Yang, Tumor necrosis factoralpha and interleukin-1beta increases CTRP1 expression in adipose tissue, FEBS Lett. 580 (2006) 3953e3960. [23] H. Kirii, T. Niwa, Y. Yamada, H. Wada, K. Saito, Y. Iwakura, M. Asano, H. Moriwaki, M. Seishima, Lack of Interleukin-1b decreases the severity of atherosclerosis in ApoE-deficient mice, Arterioscler. Thromb. Vasc. Biol. 23 (2003) 656e660. [24] A.F. Saad, G. Virella, C. Chassereau, R.J. Boackle, M.F. Lopes-Virella, OxLDL immune complexes activate complement and induce cytokine production by MonoMac 6 cells and human macrophages, J. Lipid Res. 47 (2006) 1975e1983. [25] M. Furuhashi, G. Tuncman, C.Z. Gorgun, L. Makowski, G. Atsumi, E. Vaillancourt, K. Kono, V.R. Babaev, S. Fazio, M.F. Linton, R. Sulsky, J.A. Robl, R.A. Parker, G.S. Hotamisligil, Treatment of diabetes and atherosclerosis by inhibiting fatty-acid-binding protein aP2, Nature 447 (2007) 959e965.
45
[26] X.Q. Wang, P. Nigro, C. World, K. Fujiwara, C. Yan, B.C. Berk, Thioredoxin interacting protein promotes endothelial cell inflammation in response to disturbed flow by increasing leukocyte adhesion and repressing kruppel-like factor 2, Circ. Res. 110 (2012) 560e568. [27] M. Iwaki, M. Matsuda, N. Maeda, T. Funahashi, Y. Matsuzawa, M. Makishima, I. Shimomura, Induction of adiponectin, a fat-derived antidiabetic and antiatherogenic factor, by nuclear receptors, Diabetes 52 (2003) 1655e1663. [28] L. Shapiro, P.E. Scherer, The crystal structure of a complement-1q family protein suggests an evolutionary link to tumor necrosis factor, Curr. Biol. CB 8 (1998) 335e338. [29] G.W. Wong, S.A. Krawczyk, C. Kitidis-Mitrokostas, G. Ge, E. Spooner, C. Hug, R. Gimeno, H.F. Lodish, Identification and characterization of CTRP9, a novel secreted glycoprotein, from adipose tissue that reduces serum glucose in mice and forms heterotrimers with adiponectin, FASEB J. 23 (2009) 241e258. [30] H. Li, X. Gao, Y. Zhou, N. Li, C. Ge, X. Hui, Y. Wang, A. Xu, S. Jin, D. Wu, High level expression, purification and characterization of active fusion human C1q and tumor necrosis factor related protein 2 (hCTRP2) in Escherichia coli, Protein Expr. Purif. 79 (2011) 1e6. [31] J.M. Peterson, Z. Wei, G.W. Wong, C1q/TNF-related protein-3 (CTRP3), a novel adipokine that regulates hepatic glucose output, J. Biol. Chem. 285 (2010) 39691e39701. [32] S.Y. Park, J.H. Choi, H.S. Ryu, Y.K. Pak, K.S. Park, H.K. Lee, W. Lee, C1q tumor necrosis factor alpha-related protein isoform 5 is increased in mitochondrial DNA-depleted myocytes and activates AMP-activated protein kinase, J. Biol. Chem. 284 (2009) 27780e27789. [33] Z. Wei, J.M. Peterson, G.W. Wong, Metabolic regulation by C1q/TNF-related protein-13 (CTRP13): activation OF AMP-activated protein kinase and suppression of fatty acid-induced JNK signaling, J. Biol. Chem. 286 (2011) 15652e15665. [34] L. Lu, R.Y. Zhang, X.Q. Wang, Z.H. Liu, Y. Shen, F.H. Ding, H. Meng, L.J. Wang, X.X. Yan, K. Yang, H.B. Wang, L.J. Pu, Q. Zhang, Q.J. Chen, R. De Caterina, W.F. Shen, C1q/TNF-related protein-1: an adipokinemarking and promoting atherosclerosis, Eur. Heart J (2015), http://dx.doi.org/10.1093/eurheartj/ ehv649. Epub Dec. 24. [35] D. Yuasa, K. Ohashi, R. Shibata, N. Mizutani, Y. Kataoka, T. Kambara, Y. Uemura, K. Matsuo, N. Kanemura, S. Hayakawa, M. Hiramatsu-Ito, M. Ito, H. Ogawa, T. Murate, T. Murohara, N. Ouchi, C1q/TNF-related protein-1 functions to protect against acute ischemic injury in the heart, FASEB J. 30 (2016) 1065e1075. [36] A. Schaffler, J. Weigert, M. Neumeier, J. Scholmerich, C. Buechler, Regulation and function of collagenous repeat containing sequence of 26-kDa protein gene product “cartonectin”, Obesity 15 (2007) 303e313. [37] Y. Arita, S. Kihara, N. Ouchi, M. Takahashi, K. Maeda, J. Miyagawa, K. Hotta, I. Shimomura, T. Nakamura, K. Miyaoka, H. Kuriyama, M. Nishida, S. Yamashita, K. Okubo, K. Matsubara, M. Muraguchi, Y. Ohmoto, T. Funahashi, Y. Matsuzawa, Paradoxical decrease of an adipose-specific protein, adiponectin, in obesity, Biochem. Biophys. Res. Commun. 257 (1999) 79e83. €ki, T. Ro €nnemaa, R. Huupponen, T. Lehtim€ [38] R. Lautama aki, P. Iozzo, K.E.J. Airaksinen, J. Knuuti, P. Nuutila, Low serum adiponectin is associated with high circulating oxidized low-density lipoprotein in patients with type 2 diabetes mellitus and coronary artery disease, Metabolism 56 (2007) 881e886.