C9orf72; abnormal RNA expression is the key

Experimental Neurology 262 (2014) 102–110

Contents lists available at ScienceDirect

Experimental Neurology journal homepage: www.elsevier.com/locate/yexnr

Review

C9orf72; abnormal RNA expression is the key Peter Heutink a,b,⁎, Iris E. Jansen b, Emily M. Lynes a a b

Genome Biology of Neurodegenerative Diseases, German Center for Neurodegenerative Diseases (DZNE)-Tübingen, Paul-Ehrlich-Straße 15, 72076 Tübingen, Germany Department of Clinical Genetics, VU University Medical Center, Van der Boechorststraat 7, 1081 BT Amsterdam, The Netherlands

a r t i c l e

i n f o

Article history: Received 10 March 2014 Revised 19 May 2014 Accepted 20 May 2014 Available online 27 May 2014

a b s t r a c t An expanded GGGGCC hexanucleotide repeat in the first intron located between the 1st and 2nd non-coding exons of C9orf72 is the most frequent cause of frontotemporal dementia (FTD) and amyothropic lateral sclerosis (ALS). C9orf72 is a protein with largely unknown function and insight into the disease mechanism caused by the repeat expansion is still in an early stage but increases at an amazing pace. Three main hypotheses are currently being considered to explain the disease process including haploinsuffiency due to the loss of expression from the mutated allele, RNA toxicity caused by accumulation of repeat containing transcripts and toxic protein species generated by the abnormal translation of repeat sequences. We review the current status of genetic, population and functional data and discuss the current insights into the biology of C9orf72 and this repeat expansion disease. © 2014 Elsevier Inc. All rights reserved.

Contents Introduction . . . . . . . . . . . . . . . . . . . . . . . . . The identification of the C9orf72 hexanucleotide repeat expansions Population genetics . . . . . . . . . . . . . . . . . . . . . . C9orf72 is a DENN domain protein . . . . . . . . . . . . . . . The effect of the pathogenic mutation . . . . . . . . . . . . . . What is the evidence for a loss of C9orf72 function? . . . . . . . What is the evidence for a toxic RNA species? . . . . . . . . . . Dipeptide proteins . . . . . . . . . . . . . . . . . . . . . . Concluding remarks . . . . . . . . . . . . . . . . . . . . . . Acknowledgments . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . .

. . . . . . . . . . .

. . . . . . . . . . .

Introduction Fronto temporal dementia (FTD, OMIM #600274) is a progressive form of dementia characterized by behavioural changes (disinhibition, apathy and complex compulsive behaviour), cognitive impairment (language impairment and executive dysfunctions) and the deterioration of the frontal and or temporal lobes (Seelaar et al., 2011). In 75–80% of cases, the disease starts before the age of 65 years and it is the second most common pre-senile dementia after Alzheimer's disease (AD) accounting for approximately 15–20% of cases. FTD can manifest as two main clinically recognized subtypes based on the presenting ⁎ Corresponding author at: Genome Biology of Neurodegenerative Diseases, German Center for Neurodegenerative Diseases (DZNE)-Tübingen, Paul-Ehrlich-Straße 15, 72076 Tübingen, Germany. E-mail address: [email protected] (P. Heutink).

http://dx.doi.org/10.1016/j.expneurol.2014.05.020 0014-4886/© 2014 Elsevier Inc. All rights reserved.

. . . . . . . . . . .

. . . . . . . . . . .

. . . . . . . . . . .

. . . . . . . . . . .

. . . . . . . . . . .

. . . . . . . . . . .

. . . . . . . . . . .

. . . . . . . . . . .

. . . . . . . . . . .

. . . . . . . . . . .

. . . . . . . . . . .

. . . . . . . . . . .

. . . . . . . . . . .

. . . . . . . . . . .

. . . . . . . . . . .

. . . . . . . . . . .

. . . . . . . . . . .

. . . . . . . . . . .

. . . . . . . . . . .

. . . . . . . . . . .

. . . . . . . . . . .

. . . . . . . . . . .

. . . . . . . . . . .

. . . . . . . . . . .

. . . . . . . . . . .

. . . . . . . . . . .

. . . . . . . . . . .

. . . . . . . . . . .

. . . . . . . . . . .

. . . . . . . . . . .

. . . . . . . . . . .

. . . . . . . . . . .

. . . . . . . . . . .

. . . . . . . . . . .

. . . . . . . . . . .

. . . . . . . . . . .

102 103 103 104 105 105 107 107 108 108 108

and predominant features of either behavioural and personality changes, or language disturbances. In up to 40% of patients' motor neuron dysfunction has been observed and 15% of cases fulfil the criteria for the diagnosis of amyothropic lateral sclerosis (ALS, OMIM #105400) the most common type of motor neuron disease (MND) (Van Langenhove et al., 2012). ALS is a fatal neurodegenerative disease, with insidious onset around the age of 65 years. The disease is characterized by rapid degeneration of upper and lower motor neurons resulting in progressive paralysis and death from respiratory failure, typically within two to five years of symptom onset (Sabatelli et al., 2013). The cardinal feature is progressive muscle weakness; however, cognitive impairment and behavioural changes, similar to those seen in FTD, are increasingly recognized symptoms (Sabatelli et al., 2013; Sieben et al., 2012). Post mortem brain examinations show abnormal intracellular accumulations of TAR DNA-binding protein (TDP-43) in a large proportion of

P. Heutink et al. / Experimental Neurology 262 (2014) 102–110

FTD and ALS cases (Neumann et al., 2006). Because of this clear overlap in clinical and neuropathological findings there is a growing consensus that FTD and ALS form part of a continuum of neurological diseases (Dion et al., 2009). Research into the pathogenesis of FTD has made astonishing advances over the past 15 years, arguably because FTD is a highly heritable disorder. Up to 40% of cases have a positive family history and in 10–23 %, the disease segregates in the family with an autosomal dominant inheritance pattern (Sieben et al., 2012). Until now, seven genes have been identified of which the microtubule associated protein tau (MAPT) (Hutton et al., 1998; Poorkaj et al., 1998; Spillantini et al., 1998), Granulin (GRN) (Baker et al., 2006; Cruts et al., 2006) and Chromosome 9 open reading frame 72 (C9orf72) (DeJesus-Hernandez et al., 2011; Renton et al., 2011) explain N 50% of familial cases. While charged multivesicular body protein 2b (CHMB2B), valosin-containing protein (VCP), fused in sarcoma (FUS) and TAR DNA-binding protein 43 (TDP-43) are more rare causes of familial FTD accounting for less than 1% of disease (Sieben et al., 2012). In contrast to FTD, ALS is a largely sporadic disease with around 5 to 10% of patients having a positive family history of disease. Mutations in super oxid dismutase 1 (SOD1) (12–23% of familial cases), and C9orf72 (up to 72% of families) (DeJesus-Hernandez et al., 2011; Renton et al., 2011) are the most common mutations in familial ALS. Mutations in, TDP-43, FUS, VCP, optineurin (OPTN), CHMP2B, FIG4, vesicle-associated membrane protein-associated protein B/C (VAMP), D-amino-acid oxidase (DAO), ubiquilin 2 (UBQLN2) and sequesterome 1 (SQSTM1) are rare causes of ALS (Sabatelli et al., 2013). In contrast to the familial forms of FTD and ALS, our knowledge of the genetic underpinnings of sporadic forms of these diseases is far less advanced. To date only a single Genome Wide Association Study (GWAS) has been published for FTD in which an association for a subset of pathologically confirmed cases with TDP-43 positive pathology was identified with the trans membrane protein 106 (TMEM106) (Van Deerlin et al., 2010). For ALS several risk loci have been identified by GWAS studies but not all have been consistently replicated (Laaksovirta et al., 2010; Rollinson et al., 2011; Shatunov et al., 2010; van Es et al., 2009). The identification of the C9orf72 hexanucleotide repeat expansions After the discovery of mutations in the MAPT and GRN genes, explaining up to 25% of familial cases for FTD, a number of unresolved families remained and renewed efforts were launched to identify additional risk factors for FTD. In 2006, genetic linkage was reported at chromosome 9p21.3–9p21.1 in families with a mixed phenotype of FTD and MND (Momeni et al., 2006; Morita et al., 2006; Vance et al., 2006). Since then, a series of published and unpublished studies confirmed the importance of this locus (Boxer et al., 2011; Luty et al., 2008; Pearson et al., 2011). Even though each separate study showed a large critical region, mostly due to the limited size of the families used, combining the data of all families suggested a critical region of ~3.6 Mb shared by all conclusively linked families. A number of laboratories then embarked on extensive candidate gene sequencing, however initially without success. Help came from a GWAS study in a cohort of ALS cases from Finland in which a risk haplotype was identified on chromosome 9p spanning a region of 232 kb that was located within the shared critical region identified in the FTD/MND linkage studies, suggesting that the linkage and association signals are related to a single locus (Laaksovirta et al., 2010). The evidence for this hypothesis was strengthened by a study of Mok et al. (2012), which investigated the risk haplotype in more detail across populations, and identified a single risk haplotype spanning 20 single nucleotide polymorphisms (SNPs) in a 140 kb region containing three protein coding genes; MOB kinase activator 3B (MOBK3B), chromosome 9 open reading frame 72 (C9orf72) and interferon, kappa (IFNK) and the long non coding RNA GC09P027531. Subsequent

103

mutation detection for the coding regions of the three protein coding genes within this region in families with FTD/MND however, did not reveal any obvious pathogenic mutations and it became clear that there was a need to search for mutations in non coding sequences of the critical region including structural variants such as deletions or inversions. Two consortia simultaneously published their findings using different strategies. Renton et al. (2011) used a combination of two massive parallel sequencing (MPS) approaches to identify the causative mutation. From cell lines of a single affected individual of a family from Finland, chromosome 9 was flow sorted and fully sequenced. In addition, a Dutch family was used for MPS sequencing of a library that captured predicted functional sequences within the larger critical region defined by the linkage results on two affected and one unaffected individual. DeJesus-Hernandez et al. (2011) used classical Sanger sequencing of selected non-coding regions of the critical region. All three approaches resulted in the identification of a pathological expansion of a noncoding GGGGCC hexanucleotide repeat of up to 10–12 kb in the proximal regulatory region of C9orf72, which explained both the linkage and association signals (DeJesus-Hernandez et al., 2011; Englund et al., 2012; Gijselinck et al., 2012; Renton et al., 2011). These initial publications were quickly followed by a large series of other studies all identifying a similar hexanucleotide repeat expansion in a wide series of populations (excellently reviewed by Cruts et al. (2013)). Repeat expansions for C9orf72 have also been confirmed in cases of Alzheimer's disease, corticobasal and ataxic syndromes (Lindquist et al., 2013; Majounie et al., 2012a; Snowden et al., 2012). Population genetics A large number of studies have now reported the frequencies of C9orf72 repeat expansions in different populations and several studies have combined these data (Cruts et al., 2013; Majounie et al., 2012b; van der Zee et al., 2013) demonstrating that C9orf72 repeat expansions account for about 12–25% of familial and 6–7% of sporadic FTD patients and for 10–50% of familial and 5–7% of sporadic ALS cases making them the most common cause of the FTD/ALS complex of diseases. As is often the case for genetic studies, these studies are strongly biased towards patient cohorts derived from populations of European descent. Studies on cohorts of non-European descent are limited to a small number of Asian populations from the Middle and Far East and a cohort from the island of Guam. These studies found a lower frequency of mutations than the average found in European cohorts (Ishiura et al., 2012; Jang et al., 2013; Jiao et al., 2014; Konno et al., 2013; Majounie et al., 2012b; Ogaki et al., 2012; Tsai et al., 2012; Zou et al., 2013). Interestingly the mutations in the Asian cohorts are present on the same risk haplotype as described for cases of European descent. This risk haplotype, initially described by Mok et al. (2012), is shared in patients across populations of European descent suggesting a founder effect for the pathogenic mutation. After the identification of the C9orf72 hexanucleotide repeat expansions, Majounie et al. (2012b) expanded this study by looking at 4448 patients with ALS and 1425 patients with FTD from 17 regions worldwide where they correlated the repeat expansion and C9orf72 haplotypes and confirmed that all cases across populations with a repeat expansion carried the same risk haplotype. This intriguing observation has led to the hypothesis that a single mutational event took place in Finland, which then subsequently spread through other populations by for example the Vikings (Pliner et al., 2014; Renton et al., 2011). Given the now available data this scenario is very unlikely for several reasons. The Viking expansion took place in the 9th and 10th century, not more than 1200 years ago, and the vast majority of them were of Southern Norwegian, Swedish and Danish origin. The Viking expansion included coastal areas in Europe including Finland and there is good evidence for Viking settlements in Finland, but there is no evidence for substantial emigration to other parts of Europe for descendants of these Finish settlements. In agreement with

104

P. Heutink et al. / Experimental Neurology 262 (2014) 102–110

this, the currently available mutation frequencies for C9orf72 repeat expansions in European populations show very little correlation with areas of Viking expansion. Further, there is no strong historical or genetic evidence, using for example Y chromosome haplotyping, for strong population admixture by a Scandinavian gene pool in most of Europe, except for the British Isles, Iceland, Russia, Northern France, Sicily and Southern Italy. For example, Haplogroup I1 (Y-DNA) is the original paternal lineage of Nordic Europe and is very rare in Southern Europe and, as we have shown previously, entirely absent in Sardinia (Pardo et al., 2012), thus for example the relatively high frequency of C9Orf72 mutations in Sardinia can certainly not be explained by raiding Vikings. An alternative, and in our opinion much more likely, explanation could be that the relatively high frequencies in the Finnish and Sardinian populations are explained by the history of these populations. Both are well-documented founder populations that have remained relatively isolated and where genetic drift has had a large influence on allele frequencies, which could therefore explain the high occurrence of the mutation in these populations (Heutink and Oostra, 2002; Service et al., 2006). If this alternative scenario is true the mutation should be substantially older than the Viking age. Several studies have used SNP haplotype data of the risk allele in patients to calculate an estimated time that the founder mutation occurred arguing that the mutation arose between 1500 (Majounie et al., 2012b) and 6300 (Smith et al., 2013) years ago. Estimates of the age of founder events depend primarily on the growth rate of the populations, the decay of linkage disequilibrium (LD) by recombination and new mutations and the generational interval. Although a range of different parameters and methods can be used for such calculations (Bergman et al., 2001; Risch et al., 1995) most researchers use realistic population growth estimates between 2.5 and 8.5% and intergenerational intervals, supported by historical evidence, between 20 and 30 years. Following these parameters the founder event is likely to be thousands of years old and this is supported by a study Beck et al. (2013) who did not only look at SNP data that because of their mutational stability are best suited for studies on very ancient mutational events but also included short tandem repeat (STR) data that are more suited to determine the age of more recent events. They tested ten STRs spanning a region of 13.1 Mb around the hexanucleotide repeat, including two markers within 300 kb of the repeat that each has an estimated recombination frequency of b1:100 generations. In fact the authors calculate mutation frequencies of the two markers closest to the repeat; D9S263 and D9S169 as b1 in 500 and b 1 in 150 meiosis, respectively. The haplotype diversity on the risk haplotype was not significantly different from that of the non-risk haplotype in the UK population, suggesting that the risk haplotype is not a recent event but at least several thousands of years older than the aforementioned 1500 years and this is in agreement with the estimates of Smith et al. (2013) using SNP data. Given the uncertainty of the actual time and location of occurrence of the proposed founder mutation and the very scarce data from populations of non-European descent it is not really possible to determine if there has been a single founder mutation or, alternatively, that multiple independent repeat expansions on a specific relatively unstable background have occurred. However, several observations make the latter explanation a possibility that should not be ignored. The C9orf72 repeat expansions occurred on a risk haplotype of at least 140 kb spanning 20 SNPs described by Mok et al. (2012) and is not just present in patients but also in the healthy population. The haplotype is present in all populations used for the Phase 1 of the 1000 Genomes project (Europe, Africa, Asia and the America's) (Fig. 1a) and similarly in most European, African and Asian populations collected for the Human Genome Diversity Panel (Fig. 1b). The full 20 SNP risk haplotype is absent in populations from Oceania, native American populations and many (non coastal) East Asian populations although part of the risk haplotype (7 SNPs) spanning the entire C9orf72 genomic locus is present in most of these populations as well (Fig. 1b). Its presence in

African, European and Asian populations suggests that the 20 SNP risk haplotype itself, on which the repeat expansions occurred, was already in existence at the time the human population migrated towards Europe and Asia (N 50,000 years ago) but that it did not reach Oceania and the America's during prehistoric migrations. The hexanucleotide repeat has also been observed in the chimpanzee and gorilla reference genomes and is polymorphic in chimpanzee (Smith et al., 2013). In human populations, a number of studies have reported that the repeat is polymorphic in the general population on the background of the risk haplotype (Beck et al., 2013; Renton et al., 2011; Simon-Sanchez et al., 2012; Smith et al., 2013; van der Zee et al., 2013). This observed repeat instability was also investigated in the CEPH family set and an intergenerational repeat length change of 0.29% was calculated with all the events occurring in repeat lengths N10 (Beck et al., 2013). These data are consistent with the possibility that the pathogenic repeat expansions identified in diverse populations could be the result of multiple mutation events. The molecular reasons for the instability of the hexanucleotide repeat on the backround of the risk haplotype are unknown but one study has looked at sequence characteristics in the genomic region in the vicinity of the repeat by sequencing the region 5′ of the repeat which is a GC-rich Low Complexity Sequence (LCS) (van der Zee et al., 2013). They identified a 10 bp deletion (delGTGGTCGGGG) in patients which is almost contiguous with the hexanucleotide repeat on the risk haplotype and the deletion joins the repeat with another 100% GC sequence which might favor the formation of hairpin secondary loop structures that disrupt normal DNA replication (Fig. 2). C9orf72 is a DENN domain protein C9orf72 is a gene with a largely unknown function located on the short arm of chromosome 9 (cytogenetic position 9p21.2 and genomic location; chromosome 9:27,546,542 to 27,573,863). The gene is transcribed as three major messenger RNAs (transcript 1 to 3) encoding for two protein isoforms of 222 and 481 amino acids (C9ORF72a and b) (Fig. 2). The two protein isoforms share the first 221 N-terminal amino acids but differ in their C-terminal. In the general population the gene contains a stretch of hexanucleotide (GGGGCC) sequences with a median length of two repeats (range 0 to ± 20) within the first intron following noncoding exon 1 of transcript variants 1 and 3, and in the upstream regulatory region of transcript variant 2 (Fig. 2). It is likely that the repeat is associated with multiple components of the RNA polymerase II complex (Gijselinck et al., 2012) and the location of promoter-specific histone marks, transcription factor binding sites and DNAse I hypersensitivity sites (Fig. 2), suggesting that the region contains regulatory sequence elements. C9orf72 is relatively low expressed throughout the CNS as demonstrated by quantitative PCR analyses (DeJesus-Hernandez et al., 2011; Gijselinck et al., 2012; Renton et al., 2011) but significantly higher expression is observed in cerebellum (Belzil et al., 2013; Renton et al., 2011). Protein expression data are still scarce but are so far consistent with this pattern (Waite et al., 2014). Due to the lack of specific antibodies its exact subcellular localization is not very well determined; however, in transient transfection studies of neuroblastoma cells, C9orf72 is seen both in the nucleus and cytoplasm and secreted in the medium (Farg et al., 2014). Other studies have suggested that it is also present in the membrane fraction of cells after subcellular fractionation experiments (Donnelly et al., 2013; Sareen et al., 2013). C9orf72 is highly conserved in evolution throughout its length, suggesting that it acts as one functional unit and was present in the last common eukaryotic ancestor. Insects, plants and fungi have no C9orf72 (Levine et al., 2013). Bioinformatic analysis of the C9orf72 coding sequence has found high homology of a region near the N-terminus (amino acids 108–229), shared by both protein isoforms, except for the last eight amino acids which are absent in the short isoform, with the differentially expressed in normal and neoplastic cells (DENN) domain,

P. Heutink et al. / Experimental Neurology 262 (2014) 102–110

A

Scale; chr 9

105

10 kb

| 27, 546, 542 bp

27,573,863bp | Transcript 2 Transcript 3 Transcript 1

B

Transcript 2 Transcript 3 Transcript 1

C AS

TSS 3 TSS 1

TPM

TSS 2

D CCGCCTCCTCACTCACCCACTCGCCACCGCCTGCGCCTCCGCCGCCGCGGGCGCAGGCACCGC AACCGCAGCCCCGCCCCGGGCCCGCCCCCGGGCCCGCCCCGACCACGCCCCGGCCCCGGCCCC(GGC CCC)n Fig. 1. Genomic organization of C9orf72 and the (GGGGCC)n hexanucleotide repeat at chromosome 9p21. A. The major transcripts of the C9Orf72 gene with variants numbered according to the NCBI RefSeq transcript collection (http://www.ncbi.nlm.nih.gov/refseq/). B. Screenshot of the 5′ region of C9orf72 with data for epigenetic marks such as H3K27Ac, DNAse 1 hypersensitivity sites and transcription factor Chip-seq data taken from the UCSC genome browser (http://genome-euro.ucsc.edu/index.html). Location of the (GGGGCC)n hexanucleotide repeat is indicated by the red arrow. C. Screenshot of the 5′ region of C9orf72 with data for transcription start sites (TSS) (purple) as determined by CAGEseq on human post mortem brain tissues (Forrest et al. in press). TSS for transcripts 1–3 are indicated, with transcript 2 having the most abundant expression levels. Antisense transcription is indicated in green. D. Genomic sequence 3′ of the hexanucleotide repeat (red) with the 10 bp deletion (blue) reported by van der Zee et al. (2013). Sequences in capital letters are derived from exon 1 of transcript 2.

also found in guanine exchange factors (GEFs) that activate RAB GTPases (Levine et al., 2013; Zhang et al., 2012) suggesting a role for C9orf72 protein in Rab GTPase-dependent membrane trafficking. Functional data confirming that C9orf72 is a Rab-GEF are still scarce but Farg et al. (2014) identified several Rab proteins (Rabs 1, 5, 7 and 11) involved in endocytosis and autophagy that either co-localized or coimmunoprecipitated with C9ORF72. Knockdown of C9orf72 in neuronal cell lines led to defects in autophagic processing as well as endocytosis, despite the fact that C9orf72 did not appear to localize to the plasma membrane in this study. In agreement with this finding, Almeida et al. (2013) observed that human differentiated iPS neurons harboring the C9orf72 repeat expansion were more sensitive to autophagy inhibiting drugs (Almeida et al., 2013). Further experiments are needed to conclusively determine where the protein is localized and functional studies including a biochemical GEF activity assay with a more complete panel of Rab proteins, are required in order to conclusively demonstrate that C9orf72 encodes a GEF and with which Rab proteins it interacts.

The effect of the pathogenic mutation Partly due to the nature and location of the expanded repeat, the causal effect of the mutation has not yet been firmly established and three main hypotheses are currently being considered; Firstly, there is good evidence that the expanded repeat is associated with reduced expression of C9orf72 transcripts, in human post mortem brain tissue, patient derived iPS lines and lymphoblasts suggesting that a loss of function might be relevant for the disease pathogenesis (Almeida et al., 2013; Belzil et al., 2013; Ciura et al., 2013; DeJesus-Hernandez et al., 2011; Donnelly et al., 2013; Gijselinck et al., 2012; Mori et al., 2013a; Waite et al., 2014).

Secondly, it has been suggested that the repeat sequences can be transcribed and included in the pre-mRNA of transcripts 1 and 3 and that their presence then prevents the normal splicing towards a mature mRNA. The resulting repeat-containing RNA species then could have a toxic effect and could aggregate. Indeed repeat-containing RNA aggregates have been reported in brains of patients and in patient derived iPS lines (DeJesus-Hernandez et al., 2011; Donnelly et al., 2013; Lagier-Tourenne et al., 2013; Mizielinska et al., 2013; Sareen et al., 2013). Thirdly, an interesting observation was made suggesting that Repeat Associated Non-ATG initiated translation (RAN-translation) takes place within the expanded repeat sequence resulting in production and aggregation of dipeptide repeat proteins. Indeed aggregates positive for staining with antibodies raised against dipeptide proteins have been detected in human post-mortem brain and cultured patient derived iPS cells (Ash et al., 2013; Donnelly et al., 2013; Mori et al., 2013a). While all three hypotheses are very intriguing, the biological significance for the disease pathogenesis of neither of them has yet been conclusively established and it might also be that a combination of these three mechanisms, or a currently unknown mechanism, causes the disease. What is the evidence for a loss of C9orf72 function? The location of the hexanucleotide repeat in the 5′ regulatory region upstream of the transcription start site for transcript 2 and the location within intron 1 of the other two transcripts (Fig. 2) suggested that the mutation could influence the transcription of C9orf72 or the processing of its precursor mRNAs. There is now convincing evidence that the repeat expansion is indeed associated with reduced expression level of all C9orf72 transcripts (Almeida et al., 2013; Belzil et al., 2013; Ciura et al., 2013; DeJesus-Hernandez et al., 2011; Donnelly et al., 2013;

106

P. Heutink et al. / Experimental Neurology 262 (2014) 102–110

A

35

% 20 SNP haplotype 30 % 7 SNP haplotype

Frequency

25

20

15

10

5

0 CEU

GBR

TSI

FIN

IBS

Europe

B

YRI

LWK

ASW

Africa

PUR

MXL

CLM

America’s

CHB

CHS

JPT

East Asia

50 45

% 20-snp haplotype % 7-snp haplotype

40

Frequency

35 30 25 20 15 10 5

Europe

Africa

Middle East Central Asia

East Asia

Maya Pima Colombians Karitiana Surui

NAN_Melanesian Papuan

Mongola Tu Oroqen Daur Naxi Dai Hezhen Tujia Miaozu Yizu Lahu Xibo Han She Cambodians Japanese

Yakut Balochi Brahui Burusho Hazara Kalash Makrani Pathan Sindhi Uygur

Bedouin Druze Palestinian

Mozabite Mandenka Yoruba Biaka_Pygmies Mbuti_Pygmies Bantu San

Sardinian

French_Basque Russian Adygei

Orcadian French North_Italian Tuscan

0

Oceania America’s

Fig. 2. Bar charts showing how the frequency of the disease risk haplotype varies across continents and populations. Blue bars represent the frequency of the 20SNP haplotype reported by Mok et al. (2012). Red bars represent a 7 SNP core haplotype encopasing the complete C9orf72 locus. a. Data from the 1000 genomes project (http://www.1000genomes.org). CEU: Utah residents (CEPH) with Northern and Western European Ancestry. GBR: British from England and Scotland. TSI: Italian from Tuscany. FIN: Finnish. IBS: Spanish (Iberian). YRI: Nigerian (Yoruba). LWK: Kenyan (Webuye). ASW: African-American (Southwest US). PUR: Puerto Rican. MXL: Mexican–American (Los Angeles). CLM: Colombian (Medelin). CHB: Han Chinese (Beijing). CHS: Southern Han Chinese. JPT: Japanese (Tokyo) and b. Data from the Human Genome Diversity project (http://www.hagsc.org/hgdp/).

Gijselinck et al., 2012; Mori et al., 2013a; Waite et al., 2014). A possible mechanism for this reduced expression of all transcripts and not just those containing the repeat sequence could be that the repeat expansion induces epigenetic changes as has been described previously for Friedreich's ataxia and FragileX syndrome (Greene et al., 2007;

Sutcliffe et al., 1992). There are now two studies that indeed describe such changes associated with the repeat expansion. Xi et al. (2013) studied two predicted CpG islands immediately flanking the hexanucleotide repeat. The more 5′ CpG showed hypermethylation associated with an expanded hexanucleotide repeat in a cohort of 37 ALS repeat expansion

P. Heutink et al. / Experimental Neurology 262 (2014) 102–110

carriers, 64 ALS non carriers and 76 controls. In non-carriers this CpG island was unmethylated in 97% of cases while in carriers it was methylated in 73%. No methylation was observed in carriers of intermediate size alleles up to 43 repeats. Notably, an individual with 43 repeats had a C9Orf72 expression level similar to non-carriers. The highest level of methylation was seen in brain tissue and correlated with overall C9orf72 expression. A second study performed chromatin immunoprecipitation (ChIP) on post mortem brain tissue and reported that reduced transcription of C9orf72 is triggered by epigenetic changes including abnormal binding of trimethylated histones (H3K9me3, H3K27me3, H3K79me3, total histone H3 as well as H4K20me3 and total histone H4) to the expanded hexanucleotide repeats (Belzil et al., 2013). In patient fibroblasts, the reduction in expression could be rescued by 5-AZA demethylation treatment indicating that repression of the C9orf72 gene, in pathogenic hexanucleotide repeat carriers, is caused by the binding of mutant C9orf72 to trimethylated lysine residues within histones H3 and H4, a mechanism similar to what has been described for Friedreichs ataxia and myotonic dystrophy where it was suggested the repeat could act as barrier inhibiting spread of methylation downstream. Whether the hexanucleotide repeat itself is methylated is unknown as this is difficult to access with available methods. Evidence that this reduction in C9orf72 expression level could indeed be important for the disease process comes from one of the first animal models for C9orf72. Ciura et al. (2013) created a zebrafish model in which the knocked down zC9orf72 expression using antisense morpholino oligonucleotides (AMOs). This resulted in disrupted branching and shortening of the motor neuron axons when compared to non injected or mismatch AMO injected fish that could be rescued by injecting mRNA for the longest transcript of C9orf72. In addition knockdown of zC9orf72 resulted in motor deficits such as touch evoked escape response (TEER), reduced mobility and axonopathy. However, the clinical and pathological findings in two patients with expansions on both alleles are within the range of those found in heterozygous cases and in one study C9Orf72 transcripts were detected in a case with one large expansion and a smaller expansion of ± 45 repeats. These findings do not support a complete loss of function (Cooper-Knock et al., 2013; Fratta et al., 2013) although they do not exclude that reduced expression of C9Orf72 could have important biological consequences in the disease process. Cellular and other animal models have also not confirmed the finding that a loss of function is the main mechanisms of the mutation although only experiments using anti sense oligonucleotides (ASO) and siRNA probes have been reported an so far no full knockout models have been studied (Lagier-Tourenne et al., 2013; Sareen et al., 2013). In a mouse model with a partial knockdown of C9Orf72 to 60–70% of endogenous levels, the reduction was well tolerated in mouse for 18 weeks (Lagier-Tourenne et al., 2013) but it is difficult to extrapolate these results to a full knockout situation for the whole lifespan of an animal.

What is the evidence for a toxic RNA species? Intracellular accumulation of expanded nucleotide repeats as RNA foci in the nucleus or cytoplasm has emerged as an important disease mechanism in for example myotonic dystrophy and some spinocerebellar ataxias (Wojciechowska and Krzyzosiak, 2011). In post mortem brain material of patients with the C9orf72 repeat expansion RNA foci have been observed in a subset of nuclei suggesting that similar mechanisms could play a role in C9orf72 related FTD/ALS (DeJesus-Hernandez et al., 2011; Lagier-Tourenne et al., 2013; Mizielinska et al., 2013). RNA foci are present in cortical, hippocampal, cerebellar and spinal motor neurons and in astrocytes and microglia but in these last two cell types they appear rare (Mizielinska et al., 2013). Additional work has now also confirmed the presence of RNA foci in cultured patient derived induced pluripotent

107

stem cell (iPSC) neurons (Donnelly et al., 2013; Lagier-Tourenne et al., 2013; Sareen et al., 2013). Pre-mRNA transcripts including the expanded repeat (transcripts 1 and 3) consist of only a small proportion of the total amount of C9orf72 pre-mRNA as transcript 2 is much more abundant. In addition only a single copy of the gene contains the expanded repeat and thus the large majority of transcripts produced in patients are normal (Lagier-Tourenne et al., 2013). In vitro experiments using GGGGCrepeat RNA oligonucleotides have shown that they fold into stable RNA G-Quadruplex structures (Fratta et al., 2012; Zamiri et al., 2014) and this suggests that the inclusion of the expanded repeat into the C9orf72 transcripts in vivo could interfere with the normal processing of the pre-mRNA for transcripts 1 and 3. The exact sequence of these expanded repeat containing RNAs has not been determined but there are two possibilities; either the whole repeat sequence is included in transcripts 1 and 3 and the transcription continues with the other exons in a normal fashion, or the expected strong secondary structures could lead to prematurely terminated RNA molecules that for unknown reasons are not completely degraded. Indeed by using in vitro transcription assays Haeusler et al. (2014) could confirm the presence of abortive transcripts. These findings were confirmed in patient derived Blymphocytes. Interestingly they observed that these transcripts can form hybrid molecules with the DNA template of the repeat sequence which might have consequences for the transcription process. Evidence that that the RNA foci or the aberrantly processed premRNAs are toxic, similar to what has been described in other diseases, is currently still limited. In a Drosophila melanogaster model overexpressing an imperfect expanded repeat (GGGGCC)15CTCGAG(GGGG CC)15 in developing neuronal tissue, lethality in early development was observed suggesting that the overexpressed expanded repeat sequence was indeed toxic. Expression specifically in motor neurons resulted in a reduction in locomotor activity and overexpression in mammalian Neuro-2a cells reduced cell viability (Xu et al., 2013). A second study used heterogeneous neuron populations from patient derived iPSC and showed increased glutamate excitotoxicity in cells with the expanded repeat (Donnelly et al., 2013). This is a relevant biological phenotype as it has previously been shown that ALS patients have a reduction in the levels of Astroglial glutamate transporter 1 (GLT-1) (Lin et al., 1998; Rothstein et al., 1995). Treatment with ASOs specifically targeting the repeat sequence at the RNA level rescued this phenotype (Donnelly et al., 2013). One possible mechanism for RNA-mediated toxicity is through sequestration of normal RNA-binding proteins (RBPs) by transcribed expanded repeats, causing a depletion of RBPs available for normal RNA metabolism. The effects of depletion of these RBPs could include the loss of specific transcripts and abnormalities in normal splicing patterns. RNA binding assays, using r(GGGGCC)10 repeat sequences, identified Pur α as a repeat binding protein. Loss of Pur α reduced cell viability of Neuro-2a cells and overexpression of Pur α in Drosophila and Neuro-2a cells mitigated the repeat mediated neurotoxicity (Xu et al., 2013). The interaction of Pur α is supported by the reported co-localization of RNA foci with Pur α and hnRNP A1 (Sareen et al., 2013). Other studies have reported binding of other members of the hnRNP family to GGGGCC repeats. For example Mori et al. (2013b) used proteome arrays to look for GGGGCC interactors and identified 19 possible binding partners. They followed up on a single candidate; the RNA-editing deaminase-2 or ADARB2, which is a known RBP. Knockdown of ADARB2 in patient derived iPSC-neurons reduced RNA foci in vivo. Interestingly immuno-histochemical staining could not confirm the presence of any other RBP in the foci including hnRNPA1B2 and Pur α that were reported by the studies mentioned above. Dipeptide proteins The presence of stable RNA G-Quadruplex structures can induce repeat associated non-ATG translation (RAN translation) similar to what

108

P. Heutink et al. / Experimental Neurology 262 (2014) 102–110

has been reported for expanded CAG repeats in spinocerebellar ataxia 8 and myotonic dystrophy type 1 (Zu et al., 2011). Two studies, that appeared almost simultaneously, generated antibodies against the predicted di-peptide repeat proteins and demonstrated that RAN translation occurred from the expanded hexanucleotide repeat (Ash et al., 2013; Mori et al., 2013c). Strong signals for poly-GA proteins were obtained in post mortem brain tissue although also poly-GP and poly-GR proteins were detected. Sequencing of DNAse 1 treated pre-mRNA from post mortem tissue revealed matching genomic sequence of the C9orf72 locus supporting the hypothesis of translation of the di-peptide proteins from the C9orf72 locus (Ash et al., 2013). The finding of RNA foci and aggregates of repeat dinucleotide protein aggregates in brains of C9orf72 patients has added another layer of complexity to the neuropathology of FTD and ALS. The neuropathology of C9orf72 FTD/ALS has been reviewed by Mackenzie et al. (2014) and is characterized by nuclear TDP-43 inclusion body formation in a wide range of brain regions, the presence of p62 positive NCI that are negative for TDP-43 but positive for dipeptide repeat proteins. Interestingly a C9orf72 antisense transcript containing intron 1 sequences including repeat sequences was detected raising the possibility that the di-peptide repeat proteins might be (also) translated from this transcript (Mori et al., 2013c). Foci containing this antisense RNA transcript are observed in the same brain regions as the sense foci described above. They seem to be present in fewer cells than sense foci but the average number of foci per cell appears much higher (Mizielinska et al., 2013). A recent study suggested that there is no direct correlation to the amount of aggregated dinucleotide peptide and neurodegeneration (Mackenzie et al., 2013). In addition it also has been reported that the sense RNA foci burden correlates inversely with age at onset and that for antisense foci a similar trend was observed (Mizielinska et al., 2013) in a relatively small study. There is however a strong correlation between TDP-43 inclusions and neurodegeneration suggesting that the dipeptide inclusions are not the toxic species and in fact might be protective. However, this still leaves open the possibility that nonaggregated dinucleotide peptides and/or the RNA foci could be toxic similar to the situation in other neurodegenerative diseases. Concluding remarks The identification of a hexanucleotide expansion in the 5′ regulatory region of C9orf72 has been a major step in elucidating the genetic underpinnings of FTD and ALS. A series of studies have now demonstrated that it is the most common cause of familial forms of these diseases and it is found in non-familial cases. While C9orf72 has been at the center stage since the discovery of the pathogenic mutation, our understanding of the mechanisms by which the mutations lead to the disease is still very limited. Only recently the first indications of its normal biological function as a DENN domain Rab-Guanine Exchange Factor have been published and need to be confirmed. There is also not yet conclusive evidence on how the repeat expansions lead to disease. There is however, solid evidence that the expansion leads to reduced expression of C9orf72 transcripts, that repeat sequences are included in C9orf72 transcripts and form nuclear RNA foci, that RAN translation into repeat di-peptide proteins takes place from these transcripts and that these proteins are found in aggregates identified in neurons. However, which of these observations or which combination of observations is most relevant for the disease pathogenesis is still unclear. This uncertainty makes it difficult to offer genetic testing in combination with genetic counseling. In addition there is still a lack of conclusive data for the pathogenic threshold of repeat expansions; the inherent instability of the repeat also makes it highly variable between tissues further complicating molecular testing (Beck et al., 2013; Harms et al., 2013). On the phenotypic level there are also many uncertainties as the penetrance of the mutation is unknown and there is currently no

systematic genotype–phenotype data that would provide counselors with data to explain patients what to expect; for example, will the disease present as a predominantly FTD or ALS phenotype? To make this situation even more complex, several studies described TMEM106B as a genetic modifier for the risk of developing disease (Gallagher et al., 2014; van Blitterswijk et al., 2014) and patients with mutations in C9orf72 in combination with mutations in other genes involved in FTD/ALS have been reported (Lashley et al., 2013; van Blitterswijk et al., 2013). Thus genetic testing and counseling will leave the patient and their families with many uncertainties and would require extensive follow-up and support. Understanding the full biology of C9orf72 mutations is thus not only important for developing therapeutic approaches but there is also an urgent need to resolve these genetic questions on the short term in order to offer reliable genetic advice to patients and their families.

Acknowledgments This work was supported in part by the Hersenstichting Nederland (Hersenstichting Fellowship project B08.03); I.E.J. is currently supported by the Prinses Beatrix Spierfonds (W.OP09-02). Disclosure statement Peter Heutink is a co-applicant on a patent application related to C9orf72-method on clinical testing and therapeutic intervention for the hexanucleotide repeat expansion of C9orf72 (PCT/GB2012/ 052140) and co-owner of Synaptologics BV.

References Almeida, S., Gascon, E., Tran, H., Chou, H.J., Gendron, T.F., Degroot, S., Tapper, A.R., Sellier, C., Charlet-Berguerand, N., Karydas, A., et al., 2013. Modeling key pathological features of frontotemporal dementia with C9ORF72 repeat expansion in iPSC-derived human neurons. Acta Neuropathol. 126, 385–399. Ash, P.E., Bieniek, K.F., Gendron, T.F., Caulfield, T., Lin, W.L., Dejesus-Hernandez, M., van Blitterswijk, M.M., Jansen-West, K., Paul III, J.W., Rademakers, R., et al., 2013. Unconventional translation of C9ORF72 GGGGCC expansion generates insoluble polypeptides specific to c9FTD/ALS. Neuron 77, 639–646. Baker, M., Mackenzie, I.R., Pickering-Brown, S.M., Gass, J., Rademakers, R., Lindholm, C., Snowden, J., Adamson, J., Sadovnick, A.D., Rollinson, S., et al., 2006. Mutations in progranulin cause tau-negative frontotemporal dementia linked to chromosome 17. Nature 442, 916–919. Beck, J., Poulter, M., Hensman, D., Rohrer, J.D., Mahoney, C.J., Adamson, G., Campbell, T., Uphill, J., Borg, A., Fratta, P., et al., 2013. Large C9orf72 hexanucleotide repeat expansions are seen in multiple neurodegenerative syndromes and are more frequent than expected in the UK population. Am. J. Hum. Genet. 92, 345–353. Belzil, V.V., Bauer, P.O., Prudencio, M., Gendron, T.F., Stetler, C.T., Yan, I.K., Pregent, L., Daughrity, L., Baker, M.C., Rademakers, R., et al., 2013. Reduced C9orf72 gene expression in c9FTD/ALS is caused by histone trimethylation, an epigenetic event detectable in blood. Acta Neuropathol. 126, 895–905. Bergman, A., Einbeigi, Z., Olofsson, U., Taib, Z., Wallgren, A., Karlsson, P., Wahlstrom, J., Martinsson, T., Nordling, M., 2001. The western Swedish BRCA1 founder mutation 3171ins5; a 3.7 cM conserved haplotype of today is a reminiscence of a 1500-yearold mutation. Eur. J. Hum. Genet. 9, 787–793. Boxer, A.L., Mackenzie, I.R., Boeve, B.F., Baker, M., Seeley, W.W., Crook, R., Feldman, H., Hsiung, G.Y., Rutherford, N., Laluz, V., et al., 2011. Clinical, neuroimaging and neuropathological features of a new chromosome 9p-linked FTD-ALS family. J. Neurol. Neurosurg. Psychiatry 82, 196–203. Ciura, S., Lattante, S., Le Ber, I., Latouche, M., Tostivint, H., Brice, A., Kabashi, E., 2013. Loss of function of C9orf72 causes motor deficits in a zebrafish model of Amyotrophic Lateral Sclerosis. Ann. Neurol. 72, 180–187. Cooper-Knock, J., Higginbottom, A., Connor-Robson, N., Bayatti, N., Bury, J.J., Kirby, J., Ninkina, N., Buchman, V.L., Shaw, P.J., 2013. C9ORF72 transcription in a frontotemporal dementia case with two expanded alleles. Neurology 81, 1719–1721. Cruts, M., Gijselinck, I., van der Zee, J., Engelborghs, S., Wils, H., Pirici, D., Rademakers, R., Vandenberghe, R., Dermaut, B., Martin, J.J., et al., 2006. Null mutations in progranulin cause ubiquitin-positive frontotemporal dementia linked to chromosome 17q21. Nature 442, 920–924. Cruts, M., Gijselinck, I., Van Langenhove, T., van der Zee, J., Van Broeckhoven, C., 2013. Current insights into the C9orf72 repeat expansion diseases of the FTLD/ALS spectrum. Trends Neurosci. 36, 450–459. DeJesus-Hernandez, M., Mackenzie, I.R., Boeve, B.F., Boxer, A.L., Baker, M., Rutherford, N.J., Nicholson, A.M., Finch, N.A., Flynn, H., Adamson, J., et al., 2011. Expanded GGGGCC hexanucleotide repeat in noncoding region of C9ORF72 causes chromosome 9p-linked FTD and ALS. Neuron 72, 245–256. Dion, P.A., Daoud, H., Rouleau, G.A., 2009. Genetics of motor neuron disorders: new insights into pathogenic mechanisms. Nat. Rev. Genet. 10, 769–782.

P. Heutink et al. / Experimental Neurology 262 (2014) 102–110 Donnelly, C.J., Zhang, P.W., Pham, J.T., Heusler, A.R., Mistry, N.A., Vidensky, S., Daley, E.L., Poth, E.M., Hoover, B., Fines, D.M., et al., 2013. RNA toxicity from the ALS/FTD C9ORF72 expansion is mitigated by antisense intervention. Neuron 80, 415–428. Englund, E., Gustafson, L., Passant, U., Majounie, E., Renton, A.E., Traynor, B.J., Rohrer, J.D., Mok, K., Hardy, J., 2012. Familial Lund frontotemporal dementia caused by C9ORF72 hexanucleotide expansion. Neurobiol. Aging 33 (1850), e1813–e1856. Farg, M.A., Sundaramoorthy, V., Sultana, J.M., Yang, S., Atkinson, R.A., Levina, V., Halloran, M.A., Gleeson, P., Blair, I.P., Soo, K.Y., et al., 2014. C9ORF72, implicated in amytrophic lateral sclerosis and frontotemporal dementia, regulates endosomal trafficking. Hum. Mol. Genet. http://dx.doi.org/10.1093/hmg/ddu068 (Epub ahead of print). Fratta, P., Mizielinska, S., Nicoll, A.J., Zloh, M., Fisher, E.M., Parkinson, G., Isaacs, A.M., 2012. C9orf72 hexanucleotide repeat associated with amyotrophic lateral sclerosis and frontotemporal dementia forms RNA G-quadruplexes. Sci. Rep. 2, 1016. Fratta, P., Poulter, M., Lashley, T., Rohrer, J.D., Polke, J.M., Beck, J., Ryan, N., Hensman, D., Mizielinska, S., Waite, A.J., et al., 2013. Homozygosity for the C9orf72 GGGGCC repeat expansion in frontotemporal dementia. Acta Neuropathol. 126, 401–409. Gallagher, M.D., Suh, E., Grossman, M., Elman, L., McCluskey, L., Van Swieten, J.C., Al-Sarraj, S., Neumann, M., Gelpi, E., Ghetti, B., et al., 2014. TMEM106B is a genetic modifier of frontotemporal lobar degeneration with C9orf72 hexanucleotide repeat expansions. Acta Neuropathol. 127, 407–418. Gijselinck, I., Van Langenhove, T., van der Zee, J., Sleegers, K., Philtjens, S., Kleinberger, G., Janssens, J., Bettens, K., Van Cauwenberghe, C., Pereson, S., et al., 2012. A C9orf72 promoter repeat expansion in a Flanders-Belgian cohort with disorders of the frontotemporal lobar degeneration-amyotrophic lateral sclerosis spectrum: a gene identification study. Lancet Neurol. 11, 54–65. Greene, E., Mahishi, L., Entezam, A., Kumari, D., Usdin, K., 2007. Repeat-induced epigenetic changes in intron 1 of the frataxin gene and its consequences in Friedreich ataxia. Nucleic Acids Res. 35, 3383–3390. Haeusler, A.R., Donnelly, C.J., Periz, G., Simko, E.A., Shaw, P.G., Kim, M.S., Maragakis, N.J., Troncoso, J.C., Pandey, A., Sattler, R., et al., 2014. C9orf72 nucleotide repeat structures initiate molecular cascades of disease. Nature 507, 195–200. Harms, M.B., Cady, J., Zaidman, C., Cooper, P., Bali, T., Allred, P., Cruchaga, C., Baughn, M., Libby, R.T., Pestronk, A., et al., 2013. Lack of C9ORF72 coding mutations supports a gain of function for repeat expansions in amyotrophic lateral sclerosis. Neurobiol. Aging 34 (2234), e2213–e2239. Heutink, P., Oostra, B.A., 2002. Gene finding in genetically isolated populations. Hum. Mol. Genet. 11, 2507–2515. Hutton, M., Lendon, C.L., Rizzu, P., Baker, M., Froelich, S., Houlden, H., Pickering-Brown, S., Chakraverty, S., Isaacs, A., Grover, A., et al., 1998. Association of missense and 5′-splice-site mutations in tau with the inherited dementia FTDP-17. Nature 393, 702–705. Ishiura, H., Takahashi, Y., Mitsui, J., Yoshida, S., Kihira, T., Kokubo, Y., Kuzuhara, S., Ranum, L.P., Tamaoki, T., Ichikawa, Y., et al., 2012. C9ORF72 repeat expansion in amyotrophic lateral sclerosis in the Kii peninsula of Japan. Arch. Neurol. 69, 1154–1158. Jang, J.H., Kwon, M.J., Choi, W.J., Oh, K.W., Koh, S.H., Ki, C.S., Kim, S.H., 2013. Analysis of the C9orf72 hexanucleotide repeat expansion in Korean patients with familial and sporadic amyotrophic lateral sclerosis. Neurobiol. Aging 34 (1311), e1317–e1319. Jiao, B., Tang, B., Liu, X., Yan, X., Zhou, L., Yang, Y., Wang, J., Xia, K., Shen, L., 2014. Identification of C9orf72 repeat expansions in patients with amyotrophic lateral sclerosis and frontotemporal dementia in mainland China. Neurobiol. Aging 35 (936), e919–e922. Konno, T., Shiga, A., Tsujino, A., Sugai, A., Kato, T., Kanai, K., Yokoseki, A., Eguchi, H., Kuwabara, S., Nishizawa, M., et al., 2013. Japanese amyotrophic lateral sclerosis patients with GGGGCC hexanucleotide repeat expansion in C9ORF72. J. Neurol. Neurosurg. Psychiatry 84, 398–401. Laaksovirta, H., Peuralinna, T., Schymick, J.C., Scholz, S.W., Lai, S.L., Myllykangas, L., Sulkava, R., Jansson, L., Hernandez, D.G., Gibbs, J.R., et al., 2010. Chromosome 9p21 in amyotrophic lateral sclerosis in Finland: a genome-wide association study. Lancet Neurol. 9, 978–985. Lagier-Tourenne, C., Baughn, M., Rigo, F., Sun, S., Liu, P., Li, H.R., Jiang, J., Watt, A.T., Chun, S., Katz, M., et al., 2013. Targeted degradation of sense and antisense C9orf72 RNA foci as therapy for ALS and frontotemporal degeneration. Proc. Natl. Acad. Sci. U. S. A. 110, E4530–E4539. Lashley, T., Rohrer, J.D., Mahoney, C., Gordon, E., Beck, J., Mead, S., Warren, J., Rossor, M., Revesz, T., 2013. A pathogenic progranulin mutation and C9orf72 repeat expansion in a family with frontotemporal dementia. Neuropathol. Appl. Neurobiol. 40, 502–513. Levine, T.P., Daniels, R.D., Gatta, A.T., Wong, L.H., Hayes, M.J., 2013. The product of C9orf72, a gene strongly implicated in neurodegeneration, is structurally related to DENN Rab-GEFs. Bioinformatics 29, 499–503. Lin, C.L., Bristol, L.A., Jin, L., Dykes-Hoberg, M., Crawford, T., Clawson, L., Rothstein, J.D., 1998. Aberrant RNA processing in a neurodegenerative disease: the cause for absent EAAT2, a glutamate transporter, in amyotrophic lateral sclerosis. Neuron 20, 589–602. Lindquist, S.G., Duno, M., Batbayli, M., Puschmann, A., Braendgaard, H., Mardosiene, S., Svenstrup, K., Pinborg, L.H., Vestergaard, K., Hjermind, L.E., et al., 2013. Corticobasal and ataxia syndromes widen the spectrum of C9ORF72 hexanucleotide expansion disease. Clin. Genet. 83, 279–283. Luty, A.A., Kwok, J.B., Thompson, E.M., Blumbergs, P., Brooks, W.S., Loy, C.T., Dobson-Stone, C., Panegyres, P.K., Hecker, J., Nicholson, G.A., et al., 2008. Pedigree with frontotemporal lobar degeneration–motor neuron disease and Tar DNA binding protein-43 positive neuropathology: genetic linkage to chromosome 9. BMC Neurol. 8, 32. Mackenzie, I.R., Arzberger, T., Kremmer, E., Troost, D., Lorenzl, S., Mori, K., Weng, S.M., Haass, C., Kretzschmar, H.A., Edbauer, D., et al., 2013. Dipeptide repeat protein pathology in C9ORF72 mutation cases: clinico-pathological correlations. Acta Neuropathol. 126, 859–879. Mackenzie, I.R., Frick, P., Neumann, M., 2014. The neuropathology associated with repeat expansions in the C9ORF72 gene. Acta Neuropathol. 127, 347–357.

109

Majounie, E., Abramzon, Y., Renton, A.E., Perry, R., Bassett, S.S., Pletnikova, O., Troncoso, J.C., Hardy, J., Singleton, A.B., Traynor, B.J., 2012a. Repeat expansion in C9ORF72 in Alzheimer's disease. N. Engl. J. Med. 366, 283–284. Majounie, E., Renton, A.E., Mok, K., Dopper, E.G., Waite, A., Rollinson, S., Chio, A., Restagno, G., Nicolaou, N., Simon-Sanchez, J., et al., 2012b. Frequency of the C9orf72 hexanucleotide repeat expansion in patients with amyotrophic lateral sclerosis and frontotemporal dementia: a cross-sectional study. Lancet Neurol. 11, 323–330. Mizielinska, S., Lashley, T., Norona, F.E., Clayton, E.L., Ridler, C.E., Fratta, P., Isaacs, A.M., 2013. C9orf72 frontotemporal lobar degeneration is characterised by frequent neuronal sense and antisense RNA foci. Acta Neuropathol. 126, 845–857. Mok, K., Traynor, B.J., Schymick, J., Tienari, P.J., Laaksovirta, H., Peuralinna, T., Myllykangas, L., Chio, A., Shatunov, A., Boeve, B.F., et al., 2012. Chromosome 9 ALS and FTD locus is probably derived from a single founder. Neurobiol. Aging 33 (209), e203–e208. Momeni, P., Schymick, J., Jain, S., Cookson, M.R., Cairns, N.J., Greggio, E., Greenway, M.J., Berger, S., Pickering-Brown, S., Chio, A., et al., 2006. Analysis of IFT74 as a candidate gene for chromosome 9p-linked ALS-FTD. BMC Neurol. 6, 44. Mori, K., Weng, S.M., Arzberger, T., May, S., Rentzsch, K., Kremmer, E., Schmid, B., Kretzschmar, H.A., Cruts, M., Van Broeckhoven, C., et al., 2013a. The C9orf72 GGGG CC repeat is translated into aggregating dipeptide-repeat proteins in FTLD/ALS. Science 339, 1335–1338. Mori, K., Lammich, S., Mackenzie, I.R., Forne, I., Zilow, S., Kretzschmar, H., Edbauer, D., Janssens, J., Kleinberger, G., Cruts, M., et al., 2013b. hnRNP A3 binds to GGGGCC repeats and is a constituent of p62-positive/TDP43-negative inclusions in the hippocampus of patients with C9orf72 mutations. Acta Neuropathol. 125, 413–423. Mori, K., Arzberger, T., Grasser, F.A., Gijselinck, I., May, S., Rentzsch, K., Weng, S.M., Schludi, M.H., van der Zee, J., Cruts, M., et al., 2013c. Bidirectional transcripts of the expanded C9orf72 hexanucleotide repeat are translated into aggregating dipeptide repeat proteins. Acta Neuropathol. 126, 881–893. Morita, M., Al-Chalabi, A., Andersen, P.M., Hosler, B., Sapp, P., Englund, E., Mitchell, J.E., Habgood, J.J., de Belleroche, J., Xi, J., et al., 2006. A locus on chromosome 9p confers susceptibility to ALS and frontotemporal dementia. Neurology 66, 839–844. Neumann, M., Sampathu, D.M., Kwong, L.K., Truax, A.C., Micsenyi, M.C., Chou, T.T., Bruce, J., Schuck, T., Grossman, M., Clark, C.M., et al., 2006. Ubiquitinated TDP-43 in frontotemporal lobar degeneration and amyotrophic lateral sclerosis. Science 314, 130–133. Ogaki, K., Li, Y., Atsuta, N., Tomiyama, H., Funayama, M., Watanabe, H., Nakamura, R., Yoshino, H., Yato, S., Tamura, A., et al., 2012. Analysis of C9orf72 repeat expansion in 563 Japanese patients with amyotrophic lateral sclerosis. Neurobiol. Aging 33 (2527), e2511–e2526. Pardo, L.M., Piras, G., Asproni, R., van der Gaag, K.J., Gabbas, A., Ruiz-Linares, A., de Knijff, P., Monne, M., Rizzu, P., Heutink, P., 2012. Dissecting the genetic make-up of North-East Sardinia using a large set of haploid and autosomal markers. Eur. J. Hum. Genet. 20, 956–964. Pearson, J.P., Williams, N.M., Majounie, E., Waite, A., Stott, J., Newsway, V., Murray, A., Hernandez, D., Guerreiro, R., Singleton, A.B., et al., 2011. Familial frontotemporal dementia with amyotrophic lateral sclerosis and a shared haplotype on chromosome 9p. J. Neurol. 258, 647–655. Pliner, H.A., Mann, D.M., Traynor, B.J., 2014. Searching for Grendel: origin and global spread of the C9ORF72 repeat expansion. Acta Neuropathol. 127, 391–396. Poorkaj, P., Bird, T.D., Wijsman, E., Nemens, E., Garruto, R.M., Anderson, L., Andreadis, A., Wiederholt, W.C., Raskind, M., Schellenberg, G.D., 1998. Tau is a candidate gene for chromosome 17 frontotemporal dementia. Ann. Neurol. 43, 815–825. Renton, A.E., Majounie, E., Waite, A., Simon-Sanchez, J., Rollinson, S., Gibbs, J.R., Schymick, J.C., Laaksovirta, H., van Swieten, J.C., Myllykangas, L., et al., 2011. A hexanucleotide repeat expansion in C9ORF72 is the cause of chromosome 9p21-linked ALS-FTD. Neuron 72, 257–268. Risch, N., de Leon, D., Ozelius, L., Kramer, P., Almasy, L., Singer, B., Fahn, S., Breakefield, X., Bressman, S., 1995. Genetic analysis of idiopathic torsion dystonia in Ashkenazi Jews and their recent descent from a small founder population. Nat. Genet. 9, 152–159. Rollinson, S., Mead, S., Snowden, J., Richardson, A., Rohrer, J., Halliwell, N., Usher, S., Neary, D., Mann, D., Hardy, J., et al., 2011. Frontotemporal lobar degeneration genome wide association study replication confirms a risk locus shared with amyotrophic lateral sclerosis. Neurobiol. Aging 32 (758), e751–e757. Rothstein, J.D., Van Kammen, M., Levey, A.I., Martin, L.J., Kuncl, R.W., 1995. Selective loss of glial glutamate transporter GLT-1 in amyotrophic lateral sclerosis. Ann. Neurol. 38, 73–84. Sabatelli, M., Conte, A., Zollino, M., 2013. Clinical and genetic heterogeneity of amyotrophic lateral sclerosis. Clin. Genet. 83, 408–416. Sareen, D., O'Rourke, J.G., Meera, P., Muhammad, A.K., Grant, S., Simpkinson, M., Bell, S., Carmona, S., Ornelas, L., Sahabian, A., et al., 2013. Targeting RNA foci in iPSCderived motor neurons from ALS patients with a C9ORF72 repeat expansion. Sci. Transl. Med. 5 (208ra149). Seelaar, H., Rohrer, J.D., Pijnenburg, Y.A., Fox, N.C., van Swieten, J.C., 2011. Clinical, genetic and pathological heterogeneity of frontotemporal dementia: a review. J. Neurol. Neurosurg. Psychiatry 82, 476–486. Service, S., DeYoung, J., Karayiorgou, M., Roos, J.L., Pretorious, H., Bedoya, G., Ospina, J., Ruiz-Linares, A., Macedo, A., Palha, J.A., et al., 2006. Magnitude and distribution of linkage disequilibrium in population isolates and implications for genome-wide association studies. Nat. Genet. 38, 556–560. Shatunov, A., Mok, K., Newhouse, S., Weale, M.E., Smith, B., Vance, C., Johnson, L., Veldink, J.H., van Es, M.A., van den Berg, L.H., et al., 2010. Chromosome 9p21 in sporadic amyotrophic lateral sclerosis in the UK and seven other countries: a genome-wide association study. Lancet Neurol. 9, 986–994. Sieben, A., Van Langenhove, T., Engelborghs, S., Martin, J.J., Boon, P., Cras, P., De Deyn, P.P., Santens, P., Van Broeckhoven, C., Cruts, M., 2012. The genetics and neuropathology of frontotemporal lobar degeneration. Acta Neuropathol. 124, 353–372.

110

P. Heutink et al. / Experimental Neurology 262 (2014) 102–110

Simon-Sanchez, J., Dopper, E.G., Cohn-Hokke, P.E., Hukema, R.K., Nicolaou, N., Seelaar, H., de Graaf, J.R., de Koning, I., van Schoor, N.M., Deeg, D.J., et al., 2012. The clinical and pathological phenotype of C9ORF72 hexanucleotide repeat expansions. Brain 135, 723–735. Smith, B.N., Newhouse, S., Shatunov, A., Vance, C., Topp, S., Johnson, L., Miller, J., Lee, Y., Troakes, C., Scott, K.M., et al., 2013. The C9ORF72 expansion mutation is a common cause of ALS+/−FTD in Europe and has a single founder. Eur. J. Hum. Genet. 21, 102–108. Snowden, J.S., Rollinson, S., Thompson, J.C., Harris, J.M., Stopford, C.L., Richardson, A.M., Jones, M., Gerhard, A., Davidson, Y.S., Robinson, A., et al., 2012. Distinct clinical and pathological characteristics of frontotemporal dementia associated with C9ORF72 mutations. Brain 135, 693–708. Spillantini, M.G., Murrell, J.R., Goedert, M., Farlow, M.R., Klug, A., Ghetti, B., 1998. Mutation in the tau gene in familial multiple system tauopathy with presenile dementia. Proc. Natl. Acad. Sci. U. S. A. 95, 7737–7741. Sutcliffe, J.S., Nelson, D.L., Zhang, F., Pieretti, M., Caskey, C.T., Saxe, D., Warren, S.T., 1992. DNA methylation represses FMR-1 transcription in fragile X syndrome. Hum. Mol. Genet. 1, 397–400. Tsai, C.P., Soong, B.W., Tu, P.H., Lin, K.P., Fuh, J.L., Tsai, P.C., Lu, Y.C., Lee, I.H., Lee, Y.C., 2012. A hexanucleotide repeat expansion in C9ORF72 causes familial and sporadic ALS in Taiwan. Neurobiol. Aging 33 (2232 e2211-2232 e2218). van Blitterswijk, M., Baker, M.C., DeJesus-Hernandez, M., Ghidoni, R., Benussi, L., Finger, E., Hsiung, G.Y., Kelley, B.J., Murray, M.E., Rutherford, N.J., et al., 2013. C9ORF72 repeat expansions in cases with previously identified pathogenic mutations. Neurology 81, 1332–1341. van Blitterswijk, M., Mullen, B., Nicholson, A.M., Bieniek, K.F., Heckman, M.G., Baker, M.C., Dejesus-Hernandez, M., Finch, N.A., Brown, P.H., Murray, M.E., et al., 2014. TMEM106B protects C9ORF72 expansion carriers against frontotemporal dementia. Acta Neuropathol. 127, 397–406. Van Deerlin, V.M., Sleiman, P.M., Martinez-Lage, M., Chen-Plotkin, A., Wang, L.S., Graff-Radford, N.R., Dickson, D.W., Rademakers, R., Boeve, B.F., Grossman, M., et al., 2010. Common variants at 7p21 are associated with frontotemporal lobar degeneration with TDP-43 inclusions. Nat. Genet. 42, 234–239. van der Zee, J., Gijselinck, I., Dillen, L., Van Langenhove, T., Theuns, J., Engelborghs, S., Philtjens, S., Vandenbulcke, M., Sleegers, K., Sieben, A., et al., 2013. A pan-European study of the C9orf72 repeat associated with FTLD: geographic prevalence, genomic instability, and intermediate repeats. Hum. Mutat. 34, 363–373.

van Es, M.A., Veldink, J.H., Saris, C.G., Blauw, H.M., van Vught, P.W., Birve, A., Lemmens, R., Schelhaas, H.J., Groen, E.J., Huisman, M.H., et al., 2009. Genome-wide association study identifies 19p13.3 (UNC13A) and 9p21.2 as susceptibility loci for sporadic amyotrophic lateral sclerosis. Nat. Genet. 41, 1083–1087. Van Langenhove, T., van der Zee, J., Van Broeckhoven, C., 2012. The molecular basis of the frontotemporal lobar degeneration-amyotrophic lateral sclerosis spectrum. Ann. Med. 44, 817–828. Vance, C., Al-Chalabi, A., Ruddy, D., Smith, B.N., Hu, X., Sreedharan, J., Siddique, T., Schelhaas, H.J., Kusters, B., Troost, D., et al., 2006. Familial amyotrophic lateral sclerosis with frontotemporal dementia is linked to a locus on chromosome 9p13.2-21.3. Brain 129, 868–876. Waite, A.J., Baumer, D., East, S., Neal, J., Morris, H.R., Ansorge, O., Blake, D.J., 2014. Reduced C9orf72 protein levels in frontal cortex of amyotrophic lateral sclerosis and frontotemporal degeneration brain with the C9ORF72 hexanucleotide repeat expansion. Neurobiol. Aging 35, 1779.e5–1779.e13. Wojciechowska, M., Krzyzosiak, W.J., 2011. Cellular toxicity of expanded RNA repeats: focus on RNA foci. Hum. Mol. Genet. 20, 3811–3821. Xi, Z., Zinman, L., Moreno, D., Schymick, J., Liang, Y., Sato, C., Zheng, Y., Ghani, M., Dib, S., Keith, J., et al., 2013. Hypermethylation of the CpG island near the GC repeat in ALS with a C9orf72 expansion. Am. J. Hum. Genet. 92, 981–989. Xu, Z., Poidevin, M., Li, X., Li, Y., Shu, L., Nelson, D.L., Li, H., Hales, C.M., Gearing, M., Wingo, T.S., et al., 2013. Expanded GGGGCC repeat RNA associated with amyotrophic lateral sclerosis and frontotemporal dementia causes neurodegeneration. Proc. Natl. Acad. Sci. U. S. A. 110, 7778–7783. Zamiri, B., Reddy, K., Macgregor Jr., R.B., Pearson, C.E., 2014. TMPyP4 porphyrin distorts RNA G-quadruplex structures of the disease-associated r(GGGGCC)n repeat of the C9orf72 gene and blocks interaction of RNA-binding proteins. J. Biol. Chem. 289, 4653–4659. Zhang, D., Iyer, L.M., He, F., Aravind, L., 2012. Discovery of novel DENN proteins: implications for the evolution of eukaryotic intracellular membrane structures and human disease. Front. Genet. 3, 283. Zou, Z.Y., Li, X.G., Liu, M.S., Cui, L.Y., 2013. Screening for C9orf72 repeat expansions in Chinese amyotrophic lateral sclerosis patients. Neurobiol. Aging 34 (1710), e1715–e1716. Zu, T., Gibbens, B., Doty, N.S., Gomes-Pereira, M., Huguet, A., Stone, M.D., Margolis, J., Peterson, M., Markowski, T.W., Ingram, M.A., et al., 2011. Non-ATG-initiated translation directed by microsatellite expansions. Proc. Natl. Acad. Sci. U. S. A. 108, 260–265.