- Email: [email protected]
Ca2+ and endoplasmic reticulum Ca2+-ATPase regulate the formation of silk fibers with favorable mechanical properties
Journal of Insect Physiology 73 (2015) 53–59
Contents lists available at ScienceDirect
Journal of Insect Physiology journal homepage: www.elsevier.com/locate/jinsphys
Ca2+ and endoplasmic reticulum Ca2+-ATPase regulate the formation of silk fibers with favorable mechanical properties Xin Wang a, Yi Li a, Kang Xie a, Qiying Yi b, Quanmei Chen a, Xiaohuan Wang a, Hong Shen c, Qingyou Xia a, Ping Zhao a,⇑ a b c
State Key Laboratory of Silkworm Genome Biology, Southwest University, Chongqing 400716, China Animal Center, Chongqing Medical University, Chongqing 400016, China College of Resources and Environments, Southwest University, Chongqing 400716, China
a r t i c l e
i n f o
Article history: Received 26 August 2014 Received in revised form 8 January 2015 Accepted 9 January 2015 Available online 17 January 2015 Keywords: Silk fibers Calcium ion Endoplasmic reticulum Ca2+-ATPase Mechanical properties FTIR
a b s t r a c t Calcium ions (Ca2+) are crucial for the conformational transition of silk fibroin in vitro, and silk fibroin conformations correlate with the mechanical properties of silk fibers. To investigate the relationship between Ca2+ and mechanical properties of silk fibers, CaCl2 was injected into silkworms (Bombyx mori). Fourier-transform infrared spectroscopy (FTIR) analysis and mechanical testing revealed that injection of CaCl2 solution (7.5 mg/g body weight) significantly increased the levels of a-helix and random coil structures of silk proteins. In addition, extension of silk fibers increased after CaCl2 injection. In mammals, sarcoplasmic reticulum Ca2+-ATPase in muscle and endoplasmic reticulum Ca2+-ATPase in other tissues (together denoted by SERCA) are responsible for calcium balance. Therefore, we analyzed the expression pattern of silkworm SERCA (BmSERCA) in silk glands and found that BmSERCA was abundant in the anterior silk gland (ASG). After injection of thapsigargin (TG) to block SERCA activity, silkworms showed a silk-spinning deficiency and their cocoons had higher calcium content compared to that of controls. Moreover, FTIR analysis revealed that the levels of a-helix and b-sheet structures increased in silk fibers from TG-injected silkworms compared to controls. The results provide evidence that BmSERCA has a key function in calcium transportation in ASG that is related to maintaining a suitable ionic environment. This ionic environment with a proper Ca2+ concentration is crucial for the formation of silk fibers with favorable mechanical performances. Ó 2015 Elsevier Ltd. All rights reserved.
1. Introduction The silkworm Bombyx mori is economically important and is a model organism of Lepidoptera. In the last larval instar stage, silkworms synthesize large amounts of silk proteins composed of sericin in the middle silk gland (MSG) and fibroin in the posterior silk gland (PSG) (Mondal et al., 2007; Xia et al., 2014). During the last few days of the larval stage, fibroin goes through a conformational transition in the anterior silk gland (ASG) (Xiang, 2005). Calcium ions (Ca2+) are the most versatile intracellular signal for regulating silkworm development, metamorphosis and reproduction (Birkenbeil and Dedos, 2002; Hull et al., 2009; Ohnishi et al., 2011). Recent studies on the roles of metallic ions in fibroin ⇑ Corresponding author. Tel.: +86 23 68250885. E-mail addresses: [email protected] (X. Wang), [email protected] (Y. Li), [email protected] (K. Xie), [email protected] (Q. Yi), [email protected] (Q. Chen), [email protected] (X. Wang), [email protected] (H. Shen), [email protected] (Q. Xia), [email protected] (P. Zhao). http://dx.doi.org/10.1016/j.jinsphys.2015.01.002 0022-1910/Ó 2015 Elsevier Ltd. All rights reserved.
conformation found that Ca2+ is responsible for the conformational transitions in vitro (Ruan et al., 2008; Zhang et al., 2012; Zong et al., 2004). Research on the calcium content of different parts of the silk gland revealed that calcium levels gradually decrease from the PSG to ASG (Ochi et al., 2002; Zhou et al., 2005). Differences in calcium content in the silk gland may contribute to maintaining a proper ionic environment for the production, storage and formation of silk fibers. As described above, Ca2+ regulates the conformational transition of fibroin in vitro. Furthermore, the fibroin conformation plays an important role in the mechanical properties of silk fibers (Keten et al., 2010; Ling et al., 2013). Thus, it is reasonable to think that Ca2+ can regulate the mechanical properties of silk fibers through changing the fibroin conformations. However, the physiological relationship between Ca2+ and the mechanical properties of silk fibers is unclear. We surmise that a calcium balance is required to ensure there is sufficient Ca2+ to regulate the fibroin conformations. In mammals, the mechanisms for maintaining calcium balance have been well studied (Muller et al., 2002; Rizzuto and
54
X. Wang et al. / Journal of Insect Physiology 73 (2015) 53–59
Pozzan, 2006; Zhang et al., 1997). A P-type Ca2+-ATPase (SERCA) in the sarco/endoplasmic reticulum is responsible for maintaining calcium balance by hydrolyzing ATP to exchange protons for two Ca2+ ions (Bublitz et al., 2013; Cahalan et al., 2007; Lukyanenko et al., 2001). In silk glands, many Ca2+-transporting proteins including SERCA have been identified by proteomics (Hou et al., 2007; Yi et al., 2013). We hypothesize that in silk gland SERCA is involved in fibroin conformational transition of fibroin and influence the mechanical properties of silk fibers. In this study, we evaluated the effects of Ca2+ and SERCA on the conformational transition and mechanical properties of silk fibers. The results indicate that Ca2+ influences the conformation of fibroin and the mechanical properties of silk fibers. Furthermore, we found that BmSERCA is a key factor in the regulation of these processes. 2. Materials and methods 2.1. Materials Silkworms were obtained from the State Key Laboratory of Silkworm Genome Biology (Southwest University, China) and were reared on mulberry at 25 °C under standard conditions until wandering, when silkworms prepare for cocoon construction. 2.2. Circular dichroism Cocoons were degummed by boiling them twice in separate aliquots of 0.5% (w/w) NaHCO3 solution for 30 min, and were then dissolved in 9.3 M LiBr. After dialysis against deionized water for 3 days, fibroin solutions were diluted to 0.1 mg/ml at pH 5.2. Fibroin solutions containing different Ca2+ concentrations were prepared by mixing samples with different volumes of 1 M CaCl2. Circular dichroism (CD) was carried out with a MOS-500 instrument (BioLogic, France) equipped with a 0.1 mm sample cell. The scan range was 190–250 nm. The secondary structure of silk fibroin was predicted using DICROPROT with the least-square fit method (Deleage and Geourjon, 1993). 2.3. FTIR microspectroscopy of single silk fibers Degummed silk fibers prepared from cocoons were washed with distilled water and air-dried at room temperature. Experiments were performed on a Nicolet iN10 instrument (Thermo Scientific, USA). FTIR microspectra were collected in the mid-infrared range 800–3800 cm1 at a resolution of 0.25 cm1 with 1024 coadded scans. Spectral data were collected and processed using OMNIC 9 (Thermo Scientific). The background was collected each time before FTIR spectra of single silk fibers were performed. Automatic baseline correction of each FTIR microspectrum and Fourier deconvolution of amide I bands (1600–1700 cm1) used OMNIC 9. Each spectrum represents the mean of separate deconvolutions for at least 15 separate samples.
Japan). Single-fiber testing was performed under ambient conditions (25 ± 1 °C and 60 ± 5% humidity) using an AG-X plus instrument (Shimadzu, Japan) equipped with a standard 1000-N cell at a strain rate of 2 mm/min until the fiber broke. Stress–strain curves and mean curves were calculated and drawn using OriginPro 9.0 (OriginLab Corporation, USA). Experiment was repeated 3 times. 2.5. Cloning of BmSERCA Total RNA was extracted from the heads of the third-day, fifth instar larvae (EZNA Total RNA Kit; Omega Bio-Tek, USA) and 5 lg RNA was reverse transcribed using oligo-dT primers (Table 1). Bmserca-specific primers (Table 1) were used to PCR amplification. PCR amplification was performed using 0.1 lg of cDNA, 0.2 lm primers, 0.2 mM each dNTP, and 2.5 U of high-fidelity TransTaq DNA polymerase (Transgen, China) in 1 PCR buffer II containing 2 mM Mg2+, for 94 °C for 4 min, then 25 cycles of 94 °C for 40 s, 60 °C for 40 s, 72 °C for 3 min, and 72 °C for 10 min. 2.6. Expression and purification of recombinant protein A fragment encoding an intracellular part of BmSERCA (1009– 2202 bp) was used to design primers. The forward primer contains an NdeI restriction site and the reverse primer has a NotI restriction site downstream of the stop codon (Table 1). The PCR amplification conditions were as for cloning of BmSERCA. The fragment was inserted into a p28 vector (with a 6 His-tag N-terminus) using T4 DNA ligase (New England Biolabs, UK). After sequencing confirmation, the BmSERCA-p28 vector was transformed into Escherichia coli BL21 (DE3). Single colonies were used to inoculate LB media containing 30 lg/ml kanamycin and expression was induced using 24 lg/ml isopropyl b-D-1-thiogalactopyranoside at 37 °C for 4 h when cells had reached OD600 0.6–0.8. Induced cells were centrifuged at 6000g and the pellet was resuspended in binding buffer (20 mM Tris, 100 mM NaCl, pH 8.0). Cells were lysed ultrasonically (Sonics Vibracell, 1-s pulses, 4 min, 0 °C) and clarified by centrifugation at 12,000g for 15 min. The pellet was dissolved overnight in urea buffer (8 M urea, 20 mM Tris and 100 mM NaCl, pH 8.0). Samples were purified by Ni-NTA affinity chromatography (Qiagen, USA) and then dialyzed against Tris–glycine–SDS buffer (125 mM Tris, 1.25 M glycine and 0.5% w/v SDS) at 4 °C. Purified sample was used to immunize rabbits to generate polyclonal antibodies that were subsequently purified using an antigenic affinity method. 2.7. Immunofluorescence Silk glands were dissected from wandering larvae. Silk glands were divided into three parts and fixed in 4% paraformaldehyde (PFA) for 1 h at room temperature. After freezing in Tissue-Tek (Sakura, Japan) at 80 °C, sections of 7 lm in thickness were cut from the silk glands using freezing microtome (Leica, Germany). Sections were soaked in phosphate-buffered saline (PBS) containing
2.4. Mechanical testing of silk fibers Wandering larvae were divided into weight-matched groups. A 20-ll aliquot of CaCl2 solution (7.5 mg/g body weight) or sterilized deionized water (ddH2O) was injected into the hemolymph of each larva through the pore. Injected silkworms were allowed to cocoon naturally in a box at 25 °C and 65 ± 5% humidity. Silk fibers were then reeled from the cocoons in water at 80–90 °C and air-dried at room temperature. The first 50 m of silk was collected for mechanical testing. Silk fibers were cut with initial lengths of 16 mm. The average cross-sectional diameter was measured across two brains under a scanning electron microscopy (SEM; Jeol,
Table 1 Primers used in this research. Purpose
Description
Sequence (50 –30 )
Cloning
Oligo-dT BmSERCA Fwd BmSERCA Rev
TTTTTTTTTTTTTTTTTTTT ATGGAGGACGCTCACACGA TTATAGTGGTCCGTAGATGATGATG
Expression
NdeI-BmSERCA Fwd
GGAATTCCATATGCCGTCAGTCGA AACCCTTGGCT ATAAGAATGCGGCCGCTTACACCAT CTCGGCGGCGGA
NotI-BmSERCA Rev
X. Wang et al. / Journal of Insect Physiology 73 (2015) 53–59
0.3% Triton X-100 and fixed in PBS containing 10% (v/v) goat serum and 1% (w/v) bovine serum albumin (BSA). Primary and secondary antibodies labeled with Cy3 were diluted to 1:1000 in antibody dilution buffer (PBS with 1% w/v BSA). Nuclei were stained with 40 ,6-Diamidino-2-phenylindole dihydrochloride (Beyotime, China) for 3 min. Sections were examined and photographed using a fluorescence microscope (Nikon, Japan). 2.8. Injection of thapsigargin Silkworm larvae at wandering stage were divided into weightmatched groups and each larva was injected with 10 ll of solution containing 2 nmol of thapsigargin (TG), 1 nmol of TG, or dimethyl sulfoxide (DMSO; control) through the pore into the hemolymph. At 30 min after injection, five larvae were chosen randomly and silk glands were dissected to examine TG-mediated loss of SERCA activity. Other larvae were allowed to cocoon naturally at 25 °C and the cocoon shell ratio was calculated as [cocoon shell weight/(cocoon shell weight + pupa weight) 100%]. The calcium content of cocoons was determined by inductively coupled plasma atomic adsorption spectroscopy using a modification of the method of Zhou et al. (2005). This experiment was repeated 3 times. 2.9. Ca2+-ATPase activity assays Ca2+-ATPase activity assays were performed according to Saborido et al. (1999) and the rate of ATP hydrolysis was calculated from spectrophotometric data for NADH oxidation at 340 nm. The quantities of silk gland homogenate used for Ca2+-ATPase activity assays were normalized by western blotting using BmSERCAspecific antibody. 3. Results and discussion
55
regenerated silk fibroin. In silks spun underwater by caddisfly larval, Ca2+ and the phosphate side chains form crossbridges in b-sheet structure (Addison et al., 2013; Stewart and Wang, 2010). Silkworm Fib-H has several serine phosphorylation sites (Chen et al., 2010), but the effect of phosphorylation on silk fibroin conformation appears to be different from that for caddisfly silk. Winkler et al. (2000) reported that phosphorylation of spider silk inhibits b-sheet assembly. Considering the high similarities between spider silk and silkworm silk, we propose that the combination of excess Ca2+ and phosphate side chains may inhibit b-sheet formation in B. mori silk. Fig. 1 confirms that the b-sheet content decreased when a higher level of Ca2+ was added to regenerated silk fibroin. To determine the physiological relationship between Ca2+ and the mechanical properties of silk fibers, we injected CaCl2 into silkworm larvae. Previous studies indicate that the calcium content of silkworm silk gland is high, at approximately 2.5 mg/g (Zhou et al., 2005). Thus, we used several doses for injections: 0.25, 1.25, 2.5, 7.5, 10, 15 and 50 mg/g (data not shown). At CaCl2 concentrations of <15 mg/g, injected silkworms had a normal phenotype; they spun cocoons naturally and metamorphosed into pupae and moths as normal. However, silkworms injected with 15 and 50 mg/g CaCl2 showed abnormal phenotypes; many silkworms could not spin silk fibers and died. The Ca2+ tolerance of B. mori seems to be higher in the wandering stage, probably because larvae have a higher metabolic rate in this stage. Besides, silkworm larvae in the wandering stage can excrete large amounts of urine. In this process, a considerable proportion of the CaCl2 we injected into hemolymph might have been excreted. To ensure that silkworms remained alive and that there was sufficient Ca2+ transport into the silk gland lumen, we chose a CaCl2 dose of 7.5 mg/g for experiments. After injection, we harvested cocoons to obtain single silk fiber. SEM observations revealed that the diameter of silk fiber increased after CaCl2 injection (Fig. 2A). FTIR microspectroscopy, which provides both qualitative and quantitative information about protein conformation (Ahmed
3.1. Ca2+ affects the conformation and mechanical properties of silk fibers CD spectroscopy revealed that the Ca2+ concentration has a profound effect on the secondary structures of fibroin in solution (Fig. 1). At a Ca2+ concentration of 10 mg/g, the b-sheet content reached a maximum of approximately 36%. A further increase in Ca2+ concentrations led to a decrease in b-sheet content. One possible mechanism whereby Ca2+ concentrations affect conformational transition in silk proteins has been proposed by Zhou et al. that low Ca2+ concentrations promote structural transitions by disrupting the hydrogen bonds in silk fibroin chains, allowing freer chain movement that facilitates chain refolding (Zhou et al., 2004). Another possibility is that the phosphoserine within fibroin heavy chain (Fib-H), together with Ca2+, affects the conformation of
Fig. 1. Circular dichroism (CD) spectroscopy analysis of regenerate silk fibroin. CD spectroscopy revealed that Ca2+ has an effect on fibroin secondary structure in vitro.
Fig. 2. Ca2+ regulates the fibroin conformations of silk fibers in vivo. (A) The diameters of the silk fibers. (B) FTIR spectrograms of silk fibers. ⁄⁄p < 0.01 (Student’s t-test).
56
X. Wang et al. / Journal of Insect Physiology 73 (2015) 53–59
et al., 1995; Jackson and Mantsch, 1995; Kong and Yu, 2007), was used to investigate the conformation of degummed silk fibers. The spectra showed good resolution in the amide I region (1600– 1700 cm1) and were suitable for analysis (Fig. 2B). The broad peak centered around 1660 cm1 can be assigned to random coil (1640– 1650 cm1) and/or a-helix (1650–1670 cm1) elements. The peaks at 1620–1630 cm1 and 1690–1700 cm1 are assigned to b-sheets and b-turn, respectively (Lenormant, 1956; Ling et al., 2011; Min et al., 2004). What is more, the area of characteristic absorption bands for proteins corresponds to secondary structure content (Ahmed et al., 1995; Ling et al., 2013, 2011). By calculating the area of the characteristic absorption band, the secondary structure content can be easily quantitatively determined. Our FTIR result shows that peaks at 1640–1650 cm1 and 1650–1670 cm1 were of higher intensity for the CaCl2-injected group (Fig. 2B), which suggests that the levels of random coil and a-helix structure increase after CaCl2 injection. Furthermore, the mechanical properties of silk fibers were tested to confirm the relationship between the protein secondary structure and textile properties. The stress–strain curves in Fig. 3A show that the breaking strain was dramatically higher for the CaCl2-injected group compared to that of ddH2O-injected group (Fig. 3B). However, no significant changes in tenacity and Young’s modulus were observed (Fig. 3C and D). We have found that after injecting with CaCl2, excess Ca2+ in silk fibroin induced the formation of more random coil and a-helix structure in silk fibers (Fig. 2B), and previous studies have indicated that random coil and a-helix elements contribute to the toughness of silk fibers (Ling et al., 2013). Thus, we hypothesize that the increasing in toughness is partly due to the direct effect of Ca2+ on the conformations of fibroin. In addition, Muscle contraction in spinneret can provide shearing and extensional stress for the conformational transition of fibroin from a-helix to b-sheets during spinning (Asakura et al., 2007; Gong et al., 2009; Wu, 1980; Xiang, 2005). After CaCl2 injection, excess Ca2+ can negatively affect muscle contraction. As a result, there is no enough shearing and extensional stress for the conformational transition from a-helix to b-sheets. Therefore, we propose that the indirect effect of Ca2+ on the spinneret muscle also makes silk fibers tougher. Our results suggest
Fig. 4. Expression and purification of BmSERCA fragment. (A) Recombinant BmSERCA was expressed in inclusion bodies in E. coli and purified using Ni-NTA affinity chromatography and a stepwise imidazole gradient in urea buffer. Line 1: molecular weight markers, Line 2: precipitate of recombinant E. coli after ultrasonic treatment, Lines 3–10: elution fractions of a stepwise imidazole gradient for purifying recombinant BmSERCA. (B) Recombinant BmSERCA was obtained from combined eluted fractions. Line 1: molecular weight markers, Line 2: recombinant BmSERCA. Gel conditions: 12% SDS–PAGE, visualized by Coomassie brilliant blue R250 staining.
that Ca2+ affects the conformation and mechanical properties of silk fibers in vivo. 3.2. Cloning and prokaryotic expression of BmSERCA In mammals, SERCA is crucial for maintenance of Ca2+ balance (Bublitz et al., 2013). To determine the effect of BmSERCA on regulating the calcium transport in silk glands, we cloned the full length cDNA of Bmserca and selected an intracellular BmSERCA fragment for prokaryotic expression. Recombinant protein was expressed in inclusion bodies and was purified using Ni–NTA affinity chromatography with a stepwise imidazole gradient in urea buffer (Fig. 4). Purified recombinant protein was identified as BmSERCA by MALDI-TOF/TOF tandem mass spectrometry, and was used to immunize rabbits to generate a polyclonal anti-BmSERCA antibody. Antibody specificity was verified by Western blotting against recombinant BmSERCA protein and total protein extracted from silkworm tissues (data not shown).
Fig. 3. Mechanical performances of silk fibers. (A) Stress–strain curves of silk fibers after injection. Red curve represents the average curve of each group. (B) When 7.5 mg/g CaCl2 was injected into silkworm, the breaking strain increased. (C and D) No significant changes were observed in tenacity (C) and Young’ modulus (D) of the silk fibers. ⁄ p < 0.05 (Student’s t-test). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
X. Wang et al. / Journal of Insect Physiology 73 (2015) 53–59
Fig. 5. Expression patterns of BmSERCA in different parts of silk glands at wandering stage. (a–d) In ASG represent fibroin, sericin, cuticular layer and ASG cells, respectively. Nuclei are labeled blue with DAPI. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
3.3. Distribution of BmSERCA in silk glands Previous studies found that calcium levels in silk gland decrease from the PSG to the ASG (Ochi et al., 2002). The variations in Ca2+ levels in different sections of silk gland are probably involved in silk protein storage and fiber formation. Zhou et al. (2005) hypothesized that high Ca2+ concentrations permit the formation of b-sheets for easy storage in the PSG and MSG, while low Ca2+ concentrations in the ASG promote the formation of insoluble threads. To investigate the possible correlation between BmSERCA and Ca2+ variations in different parts of the silk gland, we used immunofluorescent microscopy to detect BmSERCA in silk glands at the wandering stage. The ASG is the smallest part of the silk gland and has a cuticular layer in its lumen (Fig. 5). It is believed that this layer comprises chitin and cuticle proteins that provide shearing and extensional stress and protect ASG cells during silk fiber formation (Dong et al., 2013; Wu, 1980). Immunofluorescence suggested that BmSERCA was highly expressed in ASG (Fig. 5); an intense signal for BmSERCA was detected only in the cellular layer, particularly in the cytoplasm adjacent to the cuticular layer of the ASG. We also examined the mRNA expression pattern of other Ca2+-transporting proteins such as BmOrai1, BmSTIM1 and BmCRAC, all of which were highly expressed in the ASG (data not shown). These molecules are involved in the calcium signal and forming a Ca2+-transporting pathway (Barr et al., 2008; Cahalan, 2009; Luik et al., 2006; Manjarres et al., 2010). The high expressions of Ca2+-transporting proteins in the ASG suggest that this part of the silk gland is likely to have active calcium transport. The Ca2+-transporting proteins in the gland cells of ASG may interact with each other to form the Ca2+-transporting pathway for Ca2+ delivery from silk proteins to gland cells.
57
at the wandering larva stage. After injection of 2 nmol of TG, 30% of silkworms could not spin normally (Fig. 6A) and another 25% constructed abnormal cocoons. By contrast, almost all silkworms treated with 1 nmol TG or DMSO constructed normal cocoons (Fig. 6A). The cocoon shell ratio was remarkably lower for silkworms treated with 2 nmol of TG compared to the DMSO treated group (Fig. 6B). Moreover, SEM observations show that the cocoons of TG-injected silkworms were more compact than those of DMSOtreated controls (Fig. 6C). Ca2+ activity assays were used to determine BmSERCA enzyme activity. As shown in Fig. 7A, the SERCA activity in silk glands was remarkably lower for larvae injected with 2 nmol of TG than for the control group. Calcium content in cocoon was slightly higher for TG-injected silkworms than for DMSO controls (P = 0.06, Student’s t-test; Fig. 7B), which suggests that the Ca2+ transport in silk gland is abnormal after blocking BmSERCA activity. Loss of BmSERCA activity led to the production of silk fibers with higher calcium levels, indicating that BmSERCA is a key molecule in regulating calcium balance between silk glands and silk proteins. We used FTIR microspectroscopy to detect the conformational changes in silk fibers after TG treatment. We observed spectral differences for fibers from the treatment and control groups. First, the peak at 1620–1630 cm1 was higher for the 2 nmol TG-injected group than for the other two groups (Fig. 7C). This result indicates that the b-sheet content in silk is highest for the 2 nmol TG group. We propose that this increase in b-sheets content is the result of a higher level of Ca2+ in silk fibers after blocking BmSERCA activity. Second, a stronger and broader peak at 1660 cm1 was observed for silk from TG-injected insects, which suggests that the a-helix content strongly increases. In addition to b-sheets, a-helix and random coil elements, silk proteins contain other structural configurations such as b-turn and intermediate structure (Zhou et al., 2004). Characteristic absorption bands are at 1685 cm1 for intermediate structures and 1695 cm1 for b-turns (Zhou et al., 2004). In our study, the broad peak at 1680–1900 cm1 decreased
3.4. BmSERCA controls calcium transport to regulate silk fibroin conformations To study the function of BmSERCA in the synthesis and conformational transitions of silk fibroin, we injected TG, a SERCA-specific inhibitor (Mintz and Guillain, 1997), into B. mori
Fig. 6. Silkworms formed abnormal cocoons after SERCA activity was inhibited by thapsigargin (TG). (A) After injection, about 30% of 2 nmol TG treated silkworms could not spin. (B) The cocoon shell ratios of 2 nmol TG treated silkworms decreased significantly. (C) SEM pictures of both cross sections of cocoons revealed that the cocoons from TG-injected silkworms were more compact than control.
58
X. Wang et al. / Journal of Insect Physiology 73 (2015) 53–59
Conflict of interest The authors report no conflict of interest. Acknowledgement We thank Prof. F. Wang in our lab and Emma Jia in Institute of Biochemistry and Cell Biology (CAS) for helping us in editing the manuscript. This work was supported by Grants from the National Hi-Tech Research and Development Program of China (Grant No. 2011AA100306), the National Natural Science Foundation (Grant No. 31472154), the China Postdoctoral Science Foundation (2014T70843) and the PhD Start-up Foundation of Southwest University (Grant No. swu113113). References
Fig. 7. Calcium levels and conformations of treated silk fibers. (A) SERCA activity was partly reduced by TG injection, and the quantities of silk gland homogenates used for Ca2+-ATPase activity assays were normalized by western blotting with BmSERCA-specific antibodies. (B) Calcium levels of silk fibers were elevated after inhibition of BmSERCA activity. (C) Deconvoluted FTIR spectrograms of the silk fibers revealed that the conformations of silk proteins altered after TG injection. All results are mean and s.d. of more than 3 independent experimental observations. ⁄ p < 0.05 (Student’s t-test).
when silkworms were injected with TG. This result suggests that the levels of intermediate and b-turn decrease (Fig. 7C). SERCA regulates muscle excitation in Drosophila (Abraham and Wolf, 2013). Therefore, the muscles controlling spinning might also exhibit disorder after inhibition of SERCA activity in silkworms. As described above, Ca2+ and muscle contraction disorder may induce reassembly of the fibroin molecular chain. After TG injection, the excess Ca2+ in silks and the muscle contraction disorder acted together on the silk fibroin and finally made the level of secondary structure altered. Besides, we observed that the extent of the conformational transitions in silk was consistent with the TG dose used for injection. Thus, we surmise that SERCA plays a key role in the conformational transitions of silk proteins. As mentioned above, silk protein conformations are related with the rigidity (tenacity) and toughness (breaking strain) of silk fibers. Therefore, we hypothesize that the mechanical properties may differ between silk fibers from TG-injected silkworms and controls. However, determination of whether rigidity or toughness is elevated requires further investigation. Our results indicate that BmSERCA is involved in Ca2+ transport between silk glands and silk proteins and plays a key role in creating a proper ionic environment for silk fiber formation. 4. Conclusion This study adds to our understanding of the relationships between silk fibers and Ca2+. We found that Ca2+ has fundamental effects on the conformational transitions and mechanical properties of silk fibers. Moreover, the Ca2+-transporting protein BmSERCA that is highly expressed in ASG plays an active role in calcium transport. According to our results, BmSERCA is important in Ca2+ transportation in silk glands for creating a suitable environment for silk fiber formation. Thus, BmSERCA can be a potential target for modification of the mechanical properties of silk fibers.
Abraham, D.M., Wolf, M.J., 2013. Disruption of sarcoendoplasmic reticulum calcium ATPase function in Drosophila leads to cardiac dysfunction. PLoS ONE 8, e77785. Addison, J.B., Ashton, N.N., Weber, W.S., Stewart, R.J., Holland, G.P., Yarger, J.L., 2013. Beta-sheet nanocrystalline domains formed from phosphorylated serine-rich motifs in caddisfly larval silk: a solid state NMR and XRD study. Biomacromolecules 14, 1140–1148. Ahmed, A., Tajmir-Riahi, H.A., Carpentier, R., 1995. A quantitative secondary structure analysis of the 33 kDa extrinsic polypeptide of photosystem II by FTIR spectroscopy. FEBS Lett. 363, 65–68. Asakura, T., Umemura, K., Nakazawa, Y., Hirose, H., Higham, J., Knight, D., 2007. Some observations on the structure and function of the spinning apparatus in the silkworm Bombyx mori. Biomacromolecules 8, 175–181. Barr, V.A., Bernot, K.M., Srikanth, S., Gwack, Y., Balagopalan, L., Regan, C.K., Helman, D.J., Sommers, C.L., Oh-Hora, M., Rao, A., Samelson, L.E., 2008. Dynamic movement of the calcium sensor STIM1 and the calcium channel Orai1 in activated T-cells: puncta and distal caps. Mol. Biol. Cell 19, 2802–2817. Birkenbeil, H., Dedos, S.G., 2002. Ca2+ as second messenger in PTTH-stimulated prothoracic glands of the silkworm, Bombyx mori. Insect Biochem. Mol. 32, 1625–1634. Bublitz, M., Musgaard, M., Poulsen, H., Thogersen, L., Olesen, C., Schiott, B., Morth, J.P., Moller, J.V., Nissen, P., 2013. Ion pathways in the sarcoplasmic reticulum Ca2+-ATPase. J. Biol. Chem. 288, 10759–10765. Cahalan, M.D., 2009. STIMulating store-operated Ca(2+) entry. Nat. Cell Biol. 11, 669–677. Cahalan, M.D., Zhang, S.L., Yeromin, A.V., Ohlsen, K., Roos, J., Stauderman, K.A., 2007. Molecular basis of the CRAC channel. Cell Calcium 42, 133–144. Chen, W.Q., Priewalder, H., John, J.P.P., Lubec, G., 2010. Silk cocoon of Bombyx mori: proteins and posttranslational modifications – heavy phosphorylation and evidence for lysine-mediated cross links. Proteomics 10, 369–379. Deleage, G., Geourjon, C., 1993. An interactive graphic program for calculating the secondary structure content of proteins from circular dichroism spectrum. Comput. Appl. Biosci. 9, 197–199. Dong, Z., Zhao, P., Wang, C., Zhang, Y., Chen, J., Wang, X., Lin, Y., Xia, Q., 2013. Comparative proteomics reveal diverse functions and dynamic changes of Bombyx mori silk proteins spun from different development stages. J. Proteome Res. 12, 5213–5222. Gong, Z., Huang, L., Yang, Y., Chen, X., Shao, Z., 2009. Two distinct beta-sheet fibrils from silk protein. Chem. Commun., 7506–7508 Hou, Y., Xia, Q., Zhao, P., Zou, Y., Liu, H., Guan, J., Gong, J., Xiang, Z., 2007. Studies on middle and posterior silk glands of silkworm (Bombyx mori) using twodimensional electrophoresis and mass spectrometry. Insect Biochem. Mol. 37, 486–496. Hull, J.J., Lee, J.M., Kajigaya, R., Matsumoto, S., 2009. Bombyx mori homologs of STIM1 and Orai1 are essential components of the signal transduction cascade that regulates sex pheromone production. J. Biol. Chem. 284, 31200–31213. Jackson, M., Mantsch, H.H., 1995. The use and misuse of FTIR spectroscopy in the determination of protein-structure. Crit. Rev. Biochem. Mol. 30, 95–120. Keten, S., Xu, Z., Ihle, B., Buehler, M.J., 2010. Nanoconfinement controls stiffness, strength and mechanical toughness of beta-sheet crystals in silk. Nat. Mater. 9, 359–367. Kong, J., Yu, S., 2007. Fourier transform infrared spectroscopic analysis of protein secondary structures. Acta Biochim. Biophys. Sin. 39, 549–559. Lenormant, H., 1956. Infra-red spectra and structure of the proteins of the silk glands. Trans. Faraday Soc. 52, 549–553. Ling, S., Qi, Z., Knight, D.P., Shao, Z., Chen, X., 2011. Synchrotron FTIR microspectroscopy of single natural silk fibers. Biomacromolecules 12, 3344– 3349. Ling, S., Qi, Z., Knight, D.P., Huang, Y., Huang, L., Zhou, H., Shao, Z., Chen, X., 2013. Insight into the structure of single Antheraea pernyi silkworm fibers using synchrotron FTIR microspectroscopy. Biomacromolecules 14, 1885–1892. Luik, R.M., Wu, M.M., Buchanan, J., Lewis, R.S., 2006. The elementary unit of storeoperated Ca2+ entry: local activation of CRAC channels by STIM1 at ER-plasma membrane junctions. J. Cell Biol. 174, 815–825.
X. Wang et al. / Journal of Insect Physiology 73 (2015) 53–59 Lukyanenko, V., Gyorke, I., Wiesner, T.F., Gyorke, S., 2001. Potentiation of Ca(2+) release by cADP-ribose in the heart is mediated by enhanced SR Ca(2+) uptake into the sarcoplasmic reticulum. Circ. Res. 89, 614–622. Manjarres, I.M., Rodriguez-Garcia, A., Alonso, M.T., Garcia-Sancho, J., 2010. The sarco/endoplasmic reticulum Ca2+ ATPase (SERCA) is the third element in capacitative calcium entry. Cell Calcium 47, 412–418. Min, B.M., Jeong, L., Nam, Y.S., Kim, J.M., Kim, J.Y., Park, W.H., 2004. Formation of silk fibroin matrices with different texture and its cellular response to normal human keratinocytes. Int. J. Biol. Macromol. 34, 281–288. Mintz, E., Guillain, F., 1997. Ca2+ transport by the sarcoplasmic reticulum ATPase. Biochim. Biophys. Acta 1318, 52–70. Mondal, M., Trivedy, K., Kumar, S.N., 2007. The silk proteins, sericin and fibroin in silkworm, Bombyx mori Linn., – a review Caspian. J. Environ. Sci. 5, 63–76. Muller, F.U., Kirchhefer, U., Begrow, F., Reinke, U., Neumann, J., Schmitz, W., 2002. Junctional sarcoplasmic reticulum transmembrane proteins in the heart. Basic Res. Cardiol. 97 (Suppl. 1), I52–I55. Ochi, A., Hossain, K.S., Magoshi, J., Nemoto, N., 2002. Rheology and dynamic light scattering of silk fibroin solution extracted from the middle division of Bombyx mori silkworm. Biomacromolecules 3, 1187–1196. Ohnishi, A., Hull, J.J., Kaji, M., Hashimoto, K., Lee, J.M., Tsuneizumi, K., Suzuki, T., Dohmae, N., Matsumoto, S., 2011. Hormone signaling linked to silkmoth sex pheromone biosynthesis involves Ca2+/calmodulin-dependent protein kinase IImediated phosphorylation of the insect PAT family protein Bombyx mori lipid storage droplet protein-1 (BmLsd1). J. Biol. Chem. 286, 24101–24112. Rizzuto, R., Pozzan, T., 2006. Microdomains of intracellular Ca2+: molecular determinants and functional consequences. Physiol. Rev. 86, 369–408. Ruan, Q.X., Zhou, P., Hu, B.W., Ji, D., 2008. An investigation into the effect of potassium ions on the folding of silk fibroin studied by generalized twodimensional NMR-NMR correlation and Raman spectroscopy. FEBS J. 275, 219– 232. Saborido, A., Delgado, J., Megias, A., 1999. Measurement of sarcoplasmic reticulum Ca2+-ATPase activity and E-type Mg2+-ATPase activity in rat heart homogenates. Anal. Biochem. 268, 79–88.
59
Stewart, R.J., Wang, C.S., 2010. Adaptation of caddisfly larval silks to aquatic habitats by phosphorylation of h-fibroin serines. Biomacromolecules 11, 969–974. Winkler, S., Wilson, D., Kaplan, D.L., 2000. Controlling beta-sheet assembly in genetically engineered silk by enzymatic phosphorylation/dephosphorylation. Biochemistry 39, 12739–12746. Wu, Z.D., 1980. The Silkworm Anatomy and Physiology. Zhejiang Agricultural University Publishing House, Hangzhou. Xia, Q., Li, S., Feng, Q., 2014. Advances in silkworm studies accelerated by the genome sequencing of Bombyx mori. Annu. Rev. Entomol. 59, 513–536. Xiang, Z.H., 2005. Biology of Sericulture. China Forestry Publishing House, Beijing. Yi, Q., Zhao, P., Wang, X., Zou, Y., Zhong, X., Wang, C., Xiang, Z., Xia, Q.Y., 2013. Shotgun proteomic analysis of the Bombyx mori anterior silk gland: an insight into the biosynthetic fiber spinning process. Proteomics 13, 2657–2663. Zhang, L., Kelley, J., Schmeisser, G., Kobayashi, Y.M., Jones, L.R., 1997. Complex formation between junctin, triadin, calsequestrin, and the ryanodine receptor: proteins of the cardiac junctional sarcoplasmic reticulum membrane. J. Biol. Chem. 272, 23389–23397. Zhang, Y.H., Jiang, T., Zheng, Y.W., Zhou, P., 2012. Interference of EGCG on the Zn(II)induced conformational transition of silk fibroin as a model protein related to neurodegenerative diseases. Soft Matter 8, 5543–5549. Zhou, P., Xie, X., Knight, D.P., Zong, X.H., Deng, F., Yao, W.H., 2004. Effects of pH and calcium ions on the conformational transitions in silk fibroin using 2D Raman correlation spectroscopy and 13C solid-state NMR. Biochemistry 43, 11302– 11311. Zhou, L., Chen, X., Shao, Z., Huang, Y., Knight, D.P., 2005. Effect of metallic ions on silk formation in the Mulberry silkworm, Bombyx mori. J. Phys. Chem. B 109, 16937–16945. Zong, X.H., Zhou, P., Shao, Z.Z., Chen, S.M., Chen, X., Hu, B.W., Deng, F., Yao, W.H., 2004. Effect of pH and copper(II) on the conformation transitions of silk fibroin based on EPR, NMR, and Raman spectroscopy. Biochemistry 43, 11932–11941.
Contents lists available at ScienceDirect
Journal of Insect Physiology journal homepage: www.elsevier.com/locate/jinsphys
Ca2+ and endoplasmic reticulum Ca2+-ATPase regulate the formation of silk fibers with favorable mechanical properties Xin Wang a, Yi Li a, Kang Xie a, Qiying Yi b, Quanmei Chen a, Xiaohuan Wang a, Hong Shen c, Qingyou Xia a, Ping Zhao a,⇑ a b c
State Key Laboratory of Silkworm Genome Biology, Southwest University, Chongqing 400716, China Animal Center, Chongqing Medical University, Chongqing 400016, China College of Resources and Environments, Southwest University, Chongqing 400716, China
a r t i c l e
i n f o
Article history: Received 26 August 2014 Received in revised form 8 January 2015 Accepted 9 January 2015 Available online 17 January 2015 Keywords: Silk fibers Calcium ion Endoplasmic reticulum Ca2+-ATPase Mechanical properties FTIR
a b s t r a c t Calcium ions (Ca2+) are crucial for the conformational transition of silk fibroin in vitro, and silk fibroin conformations correlate with the mechanical properties of silk fibers. To investigate the relationship between Ca2+ and mechanical properties of silk fibers, CaCl2 was injected into silkworms (Bombyx mori). Fourier-transform infrared spectroscopy (FTIR) analysis and mechanical testing revealed that injection of CaCl2 solution (7.5 mg/g body weight) significantly increased the levels of a-helix and random coil structures of silk proteins. In addition, extension of silk fibers increased after CaCl2 injection. In mammals, sarcoplasmic reticulum Ca2+-ATPase in muscle and endoplasmic reticulum Ca2+-ATPase in other tissues (together denoted by SERCA) are responsible for calcium balance. Therefore, we analyzed the expression pattern of silkworm SERCA (BmSERCA) in silk glands and found that BmSERCA was abundant in the anterior silk gland (ASG). After injection of thapsigargin (TG) to block SERCA activity, silkworms showed a silk-spinning deficiency and their cocoons had higher calcium content compared to that of controls. Moreover, FTIR analysis revealed that the levels of a-helix and b-sheet structures increased in silk fibers from TG-injected silkworms compared to controls. The results provide evidence that BmSERCA has a key function in calcium transportation in ASG that is related to maintaining a suitable ionic environment. This ionic environment with a proper Ca2+ concentration is crucial for the formation of silk fibers with favorable mechanical performances. Ó 2015 Elsevier Ltd. All rights reserved.
1. Introduction The silkworm Bombyx mori is economically important and is a model organism of Lepidoptera. In the last larval instar stage, silkworms synthesize large amounts of silk proteins composed of sericin in the middle silk gland (MSG) and fibroin in the posterior silk gland (PSG) (Mondal et al., 2007; Xia et al., 2014). During the last few days of the larval stage, fibroin goes through a conformational transition in the anterior silk gland (ASG) (Xiang, 2005). Calcium ions (Ca2+) are the most versatile intracellular signal for regulating silkworm development, metamorphosis and reproduction (Birkenbeil and Dedos, 2002; Hull et al., 2009; Ohnishi et al., 2011). Recent studies on the roles of metallic ions in fibroin ⇑ Corresponding author. Tel.: +86 23 68250885. E-mail addresses: [email protected] (X. Wang), [email protected] (Y. Li), [email protected] (K. Xie), [email protected] (Q. Yi), [email protected] (Q. Chen), [email protected] (X. Wang), [email protected] (H. Shen), [email protected] (Q. Xia), [email protected] (P. Zhao). http://dx.doi.org/10.1016/j.jinsphys.2015.01.002 0022-1910/Ó 2015 Elsevier Ltd. All rights reserved.
conformation found that Ca2+ is responsible for the conformational transitions in vitro (Ruan et al., 2008; Zhang et al., 2012; Zong et al., 2004). Research on the calcium content of different parts of the silk gland revealed that calcium levels gradually decrease from the PSG to ASG (Ochi et al., 2002; Zhou et al., 2005). Differences in calcium content in the silk gland may contribute to maintaining a proper ionic environment for the production, storage and formation of silk fibers. As described above, Ca2+ regulates the conformational transition of fibroin in vitro. Furthermore, the fibroin conformation plays an important role in the mechanical properties of silk fibers (Keten et al., 2010; Ling et al., 2013). Thus, it is reasonable to think that Ca2+ can regulate the mechanical properties of silk fibers through changing the fibroin conformations. However, the physiological relationship between Ca2+ and the mechanical properties of silk fibers is unclear. We surmise that a calcium balance is required to ensure there is sufficient Ca2+ to regulate the fibroin conformations. In mammals, the mechanisms for maintaining calcium balance have been well studied (Muller et al., 2002; Rizzuto and
54
X. Wang et al. / Journal of Insect Physiology 73 (2015) 53–59
Pozzan, 2006; Zhang et al., 1997). A P-type Ca2+-ATPase (SERCA) in the sarco/endoplasmic reticulum is responsible for maintaining calcium balance by hydrolyzing ATP to exchange protons for two Ca2+ ions (Bublitz et al., 2013; Cahalan et al., 2007; Lukyanenko et al., 2001). In silk glands, many Ca2+-transporting proteins including SERCA have been identified by proteomics (Hou et al., 2007; Yi et al., 2013). We hypothesize that in silk gland SERCA is involved in fibroin conformational transition of fibroin and influence the mechanical properties of silk fibers. In this study, we evaluated the effects of Ca2+ and SERCA on the conformational transition and mechanical properties of silk fibers. The results indicate that Ca2+ influences the conformation of fibroin and the mechanical properties of silk fibers. Furthermore, we found that BmSERCA is a key factor in the regulation of these processes. 2. Materials and methods 2.1. Materials Silkworms were obtained from the State Key Laboratory of Silkworm Genome Biology (Southwest University, China) and were reared on mulberry at 25 °C under standard conditions until wandering, when silkworms prepare for cocoon construction. 2.2. Circular dichroism Cocoons were degummed by boiling them twice in separate aliquots of 0.5% (w/w) NaHCO3 solution for 30 min, and were then dissolved in 9.3 M LiBr. After dialysis against deionized water for 3 days, fibroin solutions were diluted to 0.1 mg/ml at pH 5.2. Fibroin solutions containing different Ca2+ concentrations were prepared by mixing samples with different volumes of 1 M CaCl2. Circular dichroism (CD) was carried out with a MOS-500 instrument (BioLogic, France) equipped with a 0.1 mm sample cell. The scan range was 190–250 nm. The secondary structure of silk fibroin was predicted using DICROPROT with the least-square fit method (Deleage and Geourjon, 1993). 2.3. FTIR microspectroscopy of single silk fibers Degummed silk fibers prepared from cocoons were washed with distilled water and air-dried at room temperature. Experiments were performed on a Nicolet iN10 instrument (Thermo Scientific, USA). FTIR microspectra were collected in the mid-infrared range 800–3800 cm1 at a resolution of 0.25 cm1 with 1024 coadded scans. Spectral data were collected and processed using OMNIC 9 (Thermo Scientific). The background was collected each time before FTIR spectra of single silk fibers were performed. Automatic baseline correction of each FTIR microspectrum and Fourier deconvolution of amide I bands (1600–1700 cm1) used OMNIC 9. Each spectrum represents the mean of separate deconvolutions for at least 15 separate samples.
Japan). Single-fiber testing was performed under ambient conditions (25 ± 1 °C and 60 ± 5% humidity) using an AG-X plus instrument (Shimadzu, Japan) equipped with a standard 1000-N cell at a strain rate of 2 mm/min until the fiber broke. Stress–strain curves and mean curves were calculated and drawn using OriginPro 9.0 (OriginLab Corporation, USA). Experiment was repeated 3 times. 2.5. Cloning of BmSERCA Total RNA was extracted from the heads of the third-day, fifth instar larvae (EZNA Total RNA Kit; Omega Bio-Tek, USA) and 5 lg RNA was reverse transcribed using oligo-dT primers (Table 1). Bmserca-specific primers (Table 1) were used to PCR amplification. PCR amplification was performed using 0.1 lg of cDNA, 0.2 lm primers, 0.2 mM each dNTP, and 2.5 U of high-fidelity TransTaq DNA polymerase (Transgen, China) in 1 PCR buffer II containing 2 mM Mg2+, for 94 °C for 4 min, then 25 cycles of 94 °C for 40 s, 60 °C for 40 s, 72 °C for 3 min, and 72 °C for 10 min. 2.6. Expression and purification of recombinant protein A fragment encoding an intracellular part of BmSERCA (1009– 2202 bp) was used to design primers. The forward primer contains an NdeI restriction site and the reverse primer has a NotI restriction site downstream of the stop codon (Table 1). The PCR amplification conditions were as for cloning of BmSERCA. The fragment was inserted into a p28 vector (with a 6 His-tag N-terminus) using T4 DNA ligase (New England Biolabs, UK). After sequencing confirmation, the BmSERCA-p28 vector was transformed into Escherichia coli BL21 (DE3). Single colonies were used to inoculate LB media containing 30 lg/ml kanamycin and expression was induced using 24 lg/ml isopropyl b-D-1-thiogalactopyranoside at 37 °C for 4 h when cells had reached OD600 0.6–0.8. Induced cells were centrifuged at 6000g and the pellet was resuspended in binding buffer (20 mM Tris, 100 mM NaCl, pH 8.0). Cells were lysed ultrasonically (Sonics Vibracell, 1-s pulses, 4 min, 0 °C) and clarified by centrifugation at 12,000g for 15 min. The pellet was dissolved overnight in urea buffer (8 M urea, 20 mM Tris and 100 mM NaCl, pH 8.0). Samples were purified by Ni-NTA affinity chromatography (Qiagen, USA) and then dialyzed against Tris–glycine–SDS buffer (125 mM Tris, 1.25 M glycine and 0.5% w/v SDS) at 4 °C. Purified sample was used to immunize rabbits to generate polyclonal antibodies that were subsequently purified using an antigenic affinity method. 2.7. Immunofluorescence Silk glands were dissected from wandering larvae. Silk glands were divided into three parts and fixed in 4% paraformaldehyde (PFA) for 1 h at room temperature. After freezing in Tissue-Tek (Sakura, Japan) at 80 °C, sections of 7 lm in thickness were cut from the silk glands using freezing microtome (Leica, Germany). Sections were soaked in phosphate-buffered saline (PBS) containing
2.4. Mechanical testing of silk fibers Wandering larvae were divided into weight-matched groups. A 20-ll aliquot of CaCl2 solution (7.5 mg/g body weight) or sterilized deionized water (ddH2O) was injected into the hemolymph of each larva through the pore. Injected silkworms were allowed to cocoon naturally in a box at 25 °C and 65 ± 5% humidity. Silk fibers were then reeled from the cocoons in water at 80–90 °C and air-dried at room temperature. The first 50 m of silk was collected for mechanical testing. Silk fibers were cut with initial lengths of 16 mm. The average cross-sectional diameter was measured across two brains under a scanning electron microscopy (SEM; Jeol,
Table 1 Primers used in this research. Purpose
Description
Sequence (50 –30 )
Cloning
Oligo-dT BmSERCA Fwd BmSERCA Rev
TTTTTTTTTTTTTTTTTTTT ATGGAGGACGCTCACACGA TTATAGTGGTCCGTAGATGATGATG
Expression
NdeI-BmSERCA Fwd
GGAATTCCATATGCCGTCAGTCGA AACCCTTGGCT ATAAGAATGCGGCCGCTTACACCAT CTCGGCGGCGGA
NotI-BmSERCA Rev
X. Wang et al. / Journal of Insect Physiology 73 (2015) 53–59
0.3% Triton X-100 and fixed in PBS containing 10% (v/v) goat serum and 1% (w/v) bovine serum albumin (BSA). Primary and secondary antibodies labeled with Cy3 were diluted to 1:1000 in antibody dilution buffer (PBS with 1% w/v BSA). Nuclei were stained with 40 ,6-Diamidino-2-phenylindole dihydrochloride (Beyotime, China) for 3 min. Sections were examined and photographed using a fluorescence microscope (Nikon, Japan). 2.8. Injection of thapsigargin Silkworm larvae at wandering stage were divided into weightmatched groups and each larva was injected with 10 ll of solution containing 2 nmol of thapsigargin (TG), 1 nmol of TG, or dimethyl sulfoxide (DMSO; control) through the pore into the hemolymph. At 30 min after injection, five larvae were chosen randomly and silk glands were dissected to examine TG-mediated loss of SERCA activity. Other larvae were allowed to cocoon naturally at 25 °C and the cocoon shell ratio was calculated as [cocoon shell weight/(cocoon shell weight + pupa weight) 100%]. The calcium content of cocoons was determined by inductively coupled plasma atomic adsorption spectroscopy using a modification of the method of Zhou et al. (2005). This experiment was repeated 3 times. 2.9. Ca2+-ATPase activity assays Ca2+-ATPase activity assays were performed according to Saborido et al. (1999) and the rate of ATP hydrolysis was calculated from spectrophotometric data for NADH oxidation at 340 nm. The quantities of silk gland homogenate used for Ca2+-ATPase activity assays were normalized by western blotting using BmSERCAspecific antibody. 3. Results and discussion
55
regenerated silk fibroin. In silks spun underwater by caddisfly larval, Ca2+ and the phosphate side chains form crossbridges in b-sheet structure (Addison et al., 2013; Stewart and Wang, 2010). Silkworm Fib-H has several serine phosphorylation sites (Chen et al., 2010), but the effect of phosphorylation on silk fibroin conformation appears to be different from that for caddisfly silk. Winkler et al. (2000) reported that phosphorylation of spider silk inhibits b-sheet assembly. Considering the high similarities between spider silk and silkworm silk, we propose that the combination of excess Ca2+ and phosphate side chains may inhibit b-sheet formation in B. mori silk. Fig. 1 confirms that the b-sheet content decreased when a higher level of Ca2+ was added to regenerated silk fibroin. To determine the physiological relationship between Ca2+ and the mechanical properties of silk fibers, we injected CaCl2 into silkworm larvae. Previous studies indicate that the calcium content of silkworm silk gland is high, at approximately 2.5 mg/g (Zhou et al., 2005). Thus, we used several doses for injections: 0.25, 1.25, 2.5, 7.5, 10, 15 and 50 mg/g (data not shown). At CaCl2 concentrations of <15 mg/g, injected silkworms had a normal phenotype; they spun cocoons naturally and metamorphosed into pupae and moths as normal. However, silkworms injected with 15 and 50 mg/g CaCl2 showed abnormal phenotypes; many silkworms could not spin silk fibers and died. The Ca2+ tolerance of B. mori seems to be higher in the wandering stage, probably because larvae have a higher metabolic rate in this stage. Besides, silkworm larvae in the wandering stage can excrete large amounts of urine. In this process, a considerable proportion of the CaCl2 we injected into hemolymph might have been excreted. To ensure that silkworms remained alive and that there was sufficient Ca2+ transport into the silk gland lumen, we chose a CaCl2 dose of 7.5 mg/g for experiments. After injection, we harvested cocoons to obtain single silk fiber. SEM observations revealed that the diameter of silk fiber increased after CaCl2 injection (Fig. 2A). FTIR microspectroscopy, which provides both qualitative and quantitative information about protein conformation (Ahmed
3.1. Ca2+ affects the conformation and mechanical properties of silk fibers CD spectroscopy revealed that the Ca2+ concentration has a profound effect on the secondary structures of fibroin in solution (Fig. 1). At a Ca2+ concentration of 10 mg/g, the b-sheet content reached a maximum of approximately 36%. A further increase in Ca2+ concentrations led to a decrease in b-sheet content. One possible mechanism whereby Ca2+ concentrations affect conformational transition in silk proteins has been proposed by Zhou et al. that low Ca2+ concentrations promote structural transitions by disrupting the hydrogen bonds in silk fibroin chains, allowing freer chain movement that facilitates chain refolding (Zhou et al., 2004). Another possibility is that the phosphoserine within fibroin heavy chain (Fib-H), together with Ca2+, affects the conformation of
Fig. 1. Circular dichroism (CD) spectroscopy analysis of regenerate silk fibroin. CD spectroscopy revealed that Ca2+ has an effect on fibroin secondary structure in vitro.
Fig. 2. Ca2+ regulates the fibroin conformations of silk fibers in vivo. (A) The diameters of the silk fibers. (B) FTIR spectrograms of silk fibers. ⁄⁄p < 0.01 (Student’s t-test).
56
X. Wang et al. / Journal of Insect Physiology 73 (2015) 53–59
et al., 1995; Jackson and Mantsch, 1995; Kong and Yu, 2007), was used to investigate the conformation of degummed silk fibers. The spectra showed good resolution in the amide I region (1600– 1700 cm1) and were suitable for analysis (Fig. 2B). The broad peak centered around 1660 cm1 can be assigned to random coil (1640– 1650 cm1) and/or a-helix (1650–1670 cm1) elements. The peaks at 1620–1630 cm1 and 1690–1700 cm1 are assigned to b-sheets and b-turn, respectively (Lenormant, 1956; Ling et al., 2011; Min et al., 2004). What is more, the area of characteristic absorption bands for proteins corresponds to secondary structure content (Ahmed et al., 1995; Ling et al., 2013, 2011). By calculating the area of the characteristic absorption band, the secondary structure content can be easily quantitatively determined. Our FTIR result shows that peaks at 1640–1650 cm1 and 1650–1670 cm1 were of higher intensity for the CaCl2-injected group (Fig. 2B), which suggests that the levels of random coil and a-helix structure increase after CaCl2 injection. Furthermore, the mechanical properties of silk fibers were tested to confirm the relationship between the protein secondary structure and textile properties. The stress–strain curves in Fig. 3A show that the breaking strain was dramatically higher for the CaCl2-injected group compared to that of ddH2O-injected group (Fig. 3B). However, no significant changes in tenacity and Young’s modulus were observed (Fig. 3C and D). We have found that after injecting with CaCl2, excess Ca2+ in silk fibroin induced the formation of more random coil and a-helix structure in silk fibers (Fig. 2B), and previous studies have indicated that random coil and a-helix elements contribute to the toughness of silk fibers (Ling et al., 2013). Thus, we hypothesize that the increasing in toughness is partly due to the direct effect of Ca2+ on the conformations of fibroin. In addition, Muscle contraction in spinneret can provide shearing and extensional stress for the conformational transition of fibroin from a-helix to b-sheets during spinning (Asakura et al., 2007; Gong et al., 2009; Wu, 1980; Xiang, 2005). After CaCl2 injection, excess Ca2+ can negatively affect muscle contraction. As a result, there is no enough shearing and extensional stress for the conformational transition from a-helix to b-sheets. Therefore, we propose that the indirect effect of Ca2+ on the spinneret muscle also makes silk fibers tougher. Our results suggest
Fig. 4. Expression and purification of BmSERCA fragment. (A) Recombinant BmSERCA was expressed in inclusion bodies in E. coli and purified using Ni-NTA affinity chromatography and a stepwise imidazole gradient in urea buffer. Line 1: molecular weight markers, Line 2: precipitate of recombinant E. coli after ultrasonic treatment, Lines 3–10: elution fractions of a stepwise imidazole gradient for purifying recombinant BmSERCA. (B) Recombinant BmSERCA was obtained from combined eluted fractions. Line 1: molecular weight markers, Line 2: recombinant BmSERCA. Gel conditions: 12% SDS–PAGE, visualized by Coomassie brilliant blue R250 staining.
that Ca2+ affects the conformation and mechanical properties of silk fibers in vivo. 3.2. Cloning and prokaryotic expression of BmSERCA In mammals, SERCA is crucial for maintenance of Ca2+ balance (Bublitz et al., 2013). To determine the effect of BmSERCA on regulating the calcium transport in silk glands, we cloned the full length cDNA of Bmserca and selected an intracellular BmSERCA fragment for prokaryotic expression. Recombinant protein was expressed in inclusion bodies and was purified using Ni–NTA affinity chromatography with a stepwise imidazole gradient in urea buffer (Fig. 4). Purified recombinant protein was identified as BmSERCA by MALDI-TOF/TOF tandem mass spectrometry, and was used to immunize rabbits to generate a polyclonal anti-BmSERCA antibody. Antibody specificity was verified by Western blotting against recombinant BmSERCA protein and total protein extracted from silkworm tissues (data not shown).
Fig. 3. Mechanical performances of silk fibers. (A) Stress–strain curves of silk fibers after injection. Red curve represents the average curve of each group. (B) When 7.5 mg/g CaCl2 was injected into silkworm, the breaking strain increased. (C and D) No significant changes were observed in tenacity (C) and Young’ modulus (D) of the silk fibers. ⁄ p < 0.05 (Student’s t-test). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
X. Wang et al. / Journal of Insect Physiology 73 (2015) 53–59
Fig. 5. Expression patterns of BmSERCA in different parts of silk glands at wandering stage. (a–d) In ASG represent fibroin, sericin, cuticular layer and ASG cells, respectively. Nuclei are labeled blue with DAPI. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
3.3. Distribution of BmSERCA in silk glands Previous studies found that calcium levels in silk gland decrease from the PSG to the ASG (Ochi et al., 2002). The variations in Ca2+ levels in different sections of silk gland are probably involved in silk protein storage and fiber formation. Zhou et al. (2005) hypothesized that high Ca2+ concentrations permit the formation of b-sheets for easy storage in the PSG and MSG, while low Ca2+ concentrations in the ASG promote the formation of insoluble threads. To investigate the possible correlation between BmSERCA and Ca2+ variations in different parts of the silk gland, we used immunofluorescent microscopy to detect BmSERCA in silk glands at the wandering stage. The ASG is the smallest part of the silk gland and has a cuticular layer in its lumen (Fig. 5). It is believed that this layer comprises chitin and cuticle proteins that provide shearing and extensional stress and protect ASG cells during silk fiber formation (Dong et al., 2013; Wu, 1980). Immunofluorescence suggested that BmSERCA was highly expressed in ASG (Fig. 5); an intense signal for BmSERCA was detected only in the cellular layer, particularly in the cytoplasm adjacent to the cuticular layer of the ASG. We also examined the mRNA expression pattern of other Ca2+-transporting proteins such as BmOrai1, BmSTIM1 and BmCRAC, all of which were highly expressed in the ASG (data not shown). These molecules are involved in the calcium signal and forming a Ca2+-transporting pathway (Barr et al., 2008; Cahalan, 2009; Luik et al., 2006; Manjarres et al., 2010). The high expressions of Ca2+-transporting proteins in the ASG suggest that this part of the silk gland is likely to have active calcium transport. The Ca2+-transporting proteins in the gland cells of ASG may interact with each other to form the Ca2+-transporting pathway for Ca2+ delivery from silk proteins to gland cells.
57
at the wandering larva stage. After injection of 2 nmol of TG, 30% of silkworms could not spin normally (Fig. 6A) and another 25% constructed abnormal cocoons. By contrast, almost all silkworms treated with 1 nmol TG or DMSO constructed normal cocoons (Fig. 6A). The cocoon shell ratio was remarkably lower for silkworms treated with 2 nmol of TG compared to the DMSO treated group (Fig. 6B). Moreover, SEM observations show that the cocoons of TG-injected silkworms were more compact than those of DMSOtreated controls (Fig. 6C). Ca2+ activity assays were used to determine BmSERCA enzyme activity. As shown in Fig. 7A, the SERCA activity in silk glands was remarkably lower for larvae injected with 2 nmol of TG than for the control group. Calcium content in cocoon was slightly higher for TG-injected silkworms than for DMSO controls (P = 0.06, Student’s t-test; Fig. 7B), which suggests that the Ca2+ transport in silk gland is abnormal after blocking BmSERCA activity. Loss of BmSERCA activity led to the production of silk fibers with higher calcium levels, indicating that BmSERCA is a key molecule in regulating calcium balance between silk glands and silk proteins. We used FTIR microspectroscopy to detect the conformational changes in silk fibers after TG treatment. We observed spectral differences for fibers from the treatment and control groups. First, the peak at 1620–1630 cm1 was higher for the 2 nmol TG-injected group than for the other two groups (Fig. 7C). This result indicates that the b-sheet content in silk is highest for the 2 nmol TG group. We propose that this increase in b-sheets content is the result of a higher level of Ca2+ in silk fibers after blocking BmSERCA activity. Second, a stronger and broader peak at 1660 cm1 was observed for silk from TG-injected insects, which suggests that the a-helix content strongly increases. In addition to b-sheets, a-helix and random coil elements, silk proteins contain other structural configurations such as b-turn and intermediate structure (Zhou et al., 2004). Characteristic absorption bands are at 1685 cm1 for intermediate structures and 1695 cm1 for b-turns (Zhou et al., 2004). In our study, the broad peak at 1680–1900 cm1 decreased
3.4. BmSERCA controls calcium transport to regulate silk fibroin conformations To study the function of BmSERCA in the synthesis and conformational transitions of silk fibroin, we injected TG, a SERCA-specific inhibitor (Mintz and Guillain, 1997), into B. mori
Fig. 6. Silkworms formed abnormal cocoons after SERCA activity was inhibited by thapsigargin (TG). (A) After injection, about 30% of 2 nmol TG treated silkworms could not spin. (B) The cocoon shell ratios of 2 nmol TG treated silkworms decreased significantly. (C) SEM pictures of both cross sections of cocoons revealed that the cocoons from TG-injected silkworms were more compact than control.
58
X. Wang et al. / Journal of Insect Physiology 73 (2015) 53–59
Conflict of interest The authors report no conflict of interest. Acknowledgement We thank Prof. F. Wang in our lab and Emma Jia in Institute of Biochemistry and Cell Biology (CAS) for helping us in editing the manuscript. This work was supported by Grants from the National Hi-Tech Research and Development Program of China (Grant No. 2011AA100306), the National Natural Science Foundation (Grant No. 31472154), the China Postdoctoral Science Foundation (2014T70843) and the PhD Start-up Foundation of Southwest University (Grant No. swu113113). References
Fig. 7. Calcium levels and conformations of treated silk fibers. (A) SERCA activity was partly reduced by TG injection, and the quantities of silk gland homogenates used for Ca2+-ATPase activity assays were normalized by western blotting with BmSERCA-specific antibodies. (B) Calcium levels of silk fibers were elevated after inhibition of BmSERCA activity. (C) Deconvoluted FTIR spectrograms of the silk fibers revealed that the conformations of silk proteins altered after TG injection. All results are mean and s.d. of more than 3 independent experimental observations. ⁄ p < 0.05 (Student’s t-test).
when silkworms were injected with TG. This result suggests that the levels of intermediate and b-turn decrease (Fig. 7C). SERCA regulates muscle excitation in Drosophila (Abraham and Wolf, 2013). Therefore, the muscles controlling spinning might also exhibit disorder after inhibition of SERCA activity in silkworms. As described above, Ca2+ and muscle contraction disorder may induce reassembly of the fibroin molecular chain. After TG injection, the excess Ca2+ in silks and the muscle contraction disorder acted together on the silk fibroin and finally made the level of secondary structure altered. Besides, we observed that the extent of the conformational transitions in silk was consistent with the TG dose used for injection. Thus, we surmise that SERCA plays a key role in the conformational transitions of silk proteins. As mentioned above, silk protein conformations are related with the rigidity (tenacity) and toughness (breaking strain) of silk fibers. Therefore, we hypothesize that the mechanical properties may differ between silk fibers from TG-injected silkworms and controls. However, determination of whether rigidity or toughness is elevated requires further investigation. Our results indicate that BmSERCA is involved in Ca2+ transport between silk glands and silk proteins and plays a key role in creating a proper ionic environment for silk fiber formation. 4. Conclusion This study adds to our understanding of the relationships between silk fibers and Ca2+. We found that Ca2+ has fundamental effects on the conformational transitions and mechanical properties of silk fibers. Moreover, the Ca2+-transporting protein BmSERCA that is highly expressed in ASG plays an active role in calcium transport. According to our results, BmSERCA is important in Ca2+ transportation in silk glands for creating a suitable environment for silk fiber formation. Thus, BmSERCA can be a potential target for modification of the mechanical properties of silk fibers.
Abraham, D.M., Wolf, M.J., 2013. Disruption of sarcoendoplasmic reticulum calcium ATPase function in Drosophila leads to cardiac dysfunction. PLoS ONE 8, e77785. Addison, J.B., Ashton, N.N., Weber, W.S., Stewart, R.J., Holland, G.P., Yarger, J.L., 2013. Beta-sheet nanocrystalline domains formed from phosphorylated serine-rich motifs in caddisfly larval silk: a solid state NMR and XRD study. Biomacromolecules 14, 1140–1148. Ahmed, A., Tajmir-Riahi, H.A., Carpentier, R., 1995. A quantitative secondary structure analysis of the 33 kDa extrinsic polypeptide of photosystem II by FTIR spectroscopy. FEBS Lett. 363, 65–68. Asakura, T., Umemura, K., Nakazawa, Y., Hirose, H., Higham, J., Knight, D., 2007. Some observations on the structure and function of the spinning apparatus in the silkworm Bombyx mori. Biomacromolecules 8, 175–181. Barr, V.A., Bernot, K.M., Srikanth, S., Gwack, Y., Balagopalan, L., Regan, C.K., Helman, D.J., Sommers, C.L., Oh-Hora, M., Rao, A., Samelson, L.E., 2008. Dynamic movement of the calcium sensor STIM1 and the calcium channel Orai1 in activated T-cells: puncta and distal caps. Mol. Biol. Cell 19, 2802–2817. Birkenbeil, H., Dedos, S.G., 2002. Ca2+ as second messenger in PTTH-stimulated prothoracic glands of the silkworm, Bombyx mori. Insect Biochem. Mol. 32, 1625–1634. Bublitz, M., Musgaard, M., Poulsen, H., Thogersen, L., Olesen, C., Schiott, B., Morth, J.P., Moller, J.V., Nissen, P., 2013. Ion pathways in the sarcoplasmic reticulum Ca2+-ATPase. J. Biol. Chem. 288, 10759–10765. Cahalan, M.D., 2009. STIMulating store-operated Ca(2+) entry. Nat. Cell Biol. 11, 669–677. Cahalan, M.D., Zhang, S.L., Yeromin, A.V., Ohlsen, K., Roos, J., Stauderman, K.A., 2007. Molecular basis of the CRAC channel. Cell Calcium 42, 133–144. Chen, W.Q., Priewalder, H., John, J.P.P., Lubec, G., 2010. Silk cocoon of Bombyx mori: proteins and posttranslational modifications – heavy phosphorylation and evidence for lysine-mediated cross links. Proteomics 10, 369–379. Deleage, G., Geourjon, C., 1993. An interactive graphic program for calculating the secondary structure content of proteins from circular dichroism spectrum. Comput. Appl. Biosci. 9, 197–199. Dong, Z., Zhao, P., Wang, C., Zhang, Y., Chen, J., Wang, X., Lin, Y., Xia, Q., 2013. Comparative proteomics reveal diverse functions and dynamic changes of Bombyx mori silk proteins spun from different development stages. J. Proteome Res. 12, 5213–5222. Gong, Z., Huang, L., Yang, Y., Chen, X., Shao, Z., 2009. Two distinct beta-sheet fibrils from silk protein. Chem. Commun., 7506–7508 Hou, Y., Xia, Q., Zhao, P., Zou, Y., Liu, H., Guan, J., Gong, J., Xiang, Z., 2007. Studies on middle and posterior silk glands of silkworm (Bombyx mori) using twodimensional electrophoresis and mass spectrometry. Insect Biochem. Mol. 37, 486–496. Hull, J.J., Lee, J.M., Kajigaya, R., Matsumoto, S., 2009. Bombyx mori homologs of STIM1 and Orai1 are essential components of the signal transduction cascade that regulates sex pheromone production. J. Biol. Chem. 284, 31200–31213. Jackson, M., Mantsch, H.H., 1995. The use and misuse of FTIR spectroscopy in the determination of protein-structure. Crit. Rev. Biochem. Mol. 30, 95–120. Keten, S., Xu, Z., Ihle, B., Buehler, M.J., 2010. Nanoconfinement controls stiffness, strength and mechanical toughness of beta-sheet crystals in silk. Nat. Mater. 9, 359–367. Kong, J., Yu, S., 2007. Fourier transform infrared spectroscopic analysis of protein secondary structures. Acta Biochim. Biophys. Sin. 39, 549–559. Lenormant, H., 1956. Infra-red spectra and structure of the proteins of the silk glands. Trans. Faraday Soc. 52, 549–553. Ling, S., Qi, Z., Knight, D.P., Shao, Z., Chen, X., 2011. Synchrotron FTIR microspectroscopy of single natural silk fibers. Biomacromolecules 12, 3344– 3349. Ling, S., Qi, Z., Knight, D.P., Huang, Y., Huang, L., Zhou, H., Shao, Z., Chen, X., 2013. Insight into the structure of single Antheraea pernyi silkworm fibers using synchrotron FTIR microspectroscopy. Biomacromolecules 14, 1885–1892. Luik, R.M., Wu, M.M., Buchanan, J., Lewis, R.S., 2006. The elementary unit of storeoperated Ca2+ entry: local activation of CRAC channels by STIM1 at ER-plasma membrane junctions. J. Cell Biol. 174, 815–825.
X. Wang et al. / Journal of Insect Physiology 73 (2015) 53–59 Lukyanenko, V., Gyorke, I., Wiesner, T.F., Gyorke, S., 2001. Potentiation of Ca(2+) release by cADP-ribose in the heart is mediated by enhanced SR Ca(2+) uptake into the sarcoplasmic reticulum. Circ. Res. 89, 614–622. Manjarres, I.M., Rodriguez-Garcia, A., Alonso, M.T., Garcia-Sancho, J., 2010. The sarco/endoplasmic reticulum Ca2+ ATPase (SERCA) is the third element in capacitative calcium entry. Cell Calcium 47, 412–418. Min, B.M., Jeong, L., Nam, Y.S., Kim, J.M., Kim, J.Y., Park, W.H., 2004. Formation of silk fibroin matrices with different texture and its cellular response to normal human keratinocytes. Int. J. Biol. Macromol. 34, 281–288. Mintz, E., Guillain, F., 1997. Ca2+ transport by the sarcoplasmic reticulum ATPase. Biochim. Biophys. Acta 1318, 52–70. Mondal, M., Trivedy, K., Kumar, S.N., 2007. The silk proteins, sericin and fibroin in silkworm, Bombyx mori Linn., – a review Caspian. J. Environ. Sci. 5, 63–76. Muller, F.U., Kirchhefer, U., Begrow, F., Reinke, U., Neumann, J., Schmitz, W., 2002. Junctional sarcoplasmic reticulum transmembrane proteins in the heart. Basic Res. Cardiol. 97 (Suppl. 1), I52–I55. Ochi, A., Hossain, K.S., Magoshi, J., Nemoto, N., 2002. Rheology and dynamic light scattering of silk fibroin solution extracted from the middle division of Bombyx mori silkworm. Biomacromolecules 3, 1187–1196. Ohnishi, A., Hull, J.J., Kaji, M., Hashimoto, K., Lee, J.M., Tsuneizumi, K., Suzuki, T., Dohmae, N., Matsumoto, S., 2011. Hormone signaling linked to silkmoth sex pheromone biosynthesis involves Ca2+/calmodulin-dependent protein kinase IImediated phosphorylation of the insect PAT family protein Bombyx mori lipid storage droplet protein-1 (BmLsd1). J. Biol. Chem. 286, 24101–24112. Rizzuto, R., Pozzan, T., 2006. Microdomains of intracellular Ca2+: molecular determinants and functional consequences. Physiol. Rev. 86, 369–408. Ruan, Q.X., Zhou, P., Hu, B.W., Ji, D., 2008. An investigation into the effect of potassium ions on the folding of silk fibroin studied by generalized twodimensional NMR-NMR correlation and Raman spectroscopy. FEBS J. 275, 219– 232. Saborido, A., Delgado, J., Megias, A., 1999. Measurement of sarcoplasmic reticulum Ca2+-ATPase activity and E-type Mg2+-ATPase activity in rat heart homogenates. Anal. Biochem. 268, 79–88.
59
Stewart, R.J., Wang, C.S., 2010. Adaptation of caddisfly larval silks to aquatic habitats by phosphorylation of h-fibroin serines. Biomacromolecules 11, 969–974. Winkler, S., Wilson, D., Kaplan, D.L., 2000. Controlling beta-sheet assembly in genetically engineered silk by enzymatic phosphorylation/dephosphorylation. Biochemistry 39, 12739–12746. Wu, Z.D., 1980. The Silkworm Anatomy and Physiology. Zhejiang Agricultural University Publishing House, Hangzhou. Xia, Q., Li, S., Feng, Q., 2014. Advances in silkworm studies accelerated by the genome sequencing of Bombyx mori. Annu. Rev. Entomol. 59, 513–536. Xiang, Z.H., 2005. Biology of Sericulture. China Forestry Publishing House, Beijing. Yi, Q., Zhao, P., Wang, X., Zou, Y., Zhong, X., Wang, C., Xiang, Z., Xia, Q.Y., 2013. Shotgun proteomic analysis of the Bombyx mori anterior silk gland: an insight into the biosynthetic fiber spinning process. Proteomics 13, 2657–2663. Zhang, L., Kelley, J., Schmeisser, G., Kobayashi, Y.M., Jones, L.R., 1997. Complex formation between junctin, triadin, calsequestrin, and the ryanodine receptor: proteins of the cardiac junctional sarcoplasmic reticulum membrane. J. Biol. Chem. 272, 23389–23397. Zhang, Y.H., Jiang, T., Zheng, Y.W., Zhou, P., 2012. Interference of EGCG on the Zn(II)induced conformational transition of silk fibroin as a model protein related to neurodegenerative diseases. Soft Matter 8, 5543–5549. Zhou, P., Xie, X., Knight, D.P., Zong, X.H., Deng, F., Yao, W.H., 2004. Effects of pH and calcium ions on the conformational transitions in silk fibroin using 2D Raman correlation spectroscopy and 13C solid-state NMR. Biochemistry 43, 11302– 11311. Zhou, L., Chen, X., Shao, Z., Huang, Y., Knight, D.P., 2005. Effect of metallic ions on silk formation in the Mulberry silkworm, Bombyx mori. J. Phys. Chem. B 109, 16937–16945. Zong, X.H., Zhou, P., Shao, Z.Z., Chen, S.M., Chen, X., Hu, B.W., Deng, F., Yao, W.H., 2004. Effect of pH and copper(II) on the conformation transitions of silk fibroin based on EPR, NMR, and Raman spectroscopy. Biochemistry 43, 11932–11941.