- Email: [email protected]
Cadmium disrupts melanocortin 2 receptor signaling in rainbow trout
Aquatic Toxicology 209 (2019) 26–33
Contents lists available at ScienceDirect
Aquatic Toxicology journal homepage: www.elsevier.com/locate/aqtox
Cadmium disrupts melanocortin 2 receptor signaling in rainbow trout a
b
c
b
Navdeep Sandhu , Liang Liang , James McGeer , Robert M. Dores , Mathilakath M. Vijayan a b c
a,⁎
T
Department of Biology, University of Waterloo, Waterloo, Ontario, N2L 3G1, Canada Department of Biology, University of Denver, Denver, CO, 80208-9010, USA Wilfrid Laurier University, Waterloo, Ontario, N2L 3C5, Canada
A R T I C LE I N FO
A B S T R A C T
Keywords: Oncorhynchus mykiss MRAP1 MRAP2 MC2R Stress response Cortisol HPI axis Endocrine disruption
Cadmium is an endocrine disruptor and inhibits corticosteroid production, but the mechanisms are far from clear. We tested the hypothesis that sublethal exposure to environmentally realistic levels of cadmium impairs cortisol production by disrupting the melanocortin 2 receptor (MC2R) signaling in rainbow trout (Oncorhynchus mykiss). Fish were exposed to sublethal concentrations of cadmium (0.75 or 2.0 μg/L) in a flow-through system for 7 d and subjected to an acute secondary stressor to evoke a cortisol response. Cadmium exposure for 7 d did not affect plasma cortisol concentrations, but head kidney mc2r mRNA levels were higher than in control fish. The cortisol stress performance to a secondary-stressor was attenuated in the cadmium groups, and this corresponded with transient reduction in transcript abundance of mc2r and the gene encoding its accessory protein MRAP1 but not MRAP2 in the head kidney. Furthermore, in vivo cadmium exposure attenuated the adrenocorticotropic hormone (ACTH)-, but not 8-br-cAMP-stimulated cortisol production in head kidney slices ex vivo. This corresponded with reduced transcript abundance of mc2r and mrap1, but not mrap2 in these tissue slices. Also, reporter assays with CHO cells transiently transfected with rainbow trout mc2r and zebrafish mrap1 revealed a dose-independent inhibition in ACTH-stimulated luciferase activity by cadmium. Collectively, waterborne exposure to environmentally realistic concentration of cadmium compromises the stressor-induced cortisol response, and a mode of action involves the disruption of MC2R signaling in rainbow trout.
1. Introduction
adrenal cortex and releases cortisol, the principal glucocorticoid in teleosts, in response to stressor exposure. The stressor-mediated cortisol release is a coordinated response involving the activation of the hypothalamus-pituitary-interrenal (HPI) axis in fish (Wendelaar Bonga, 1997; Mommsen et al., 1999; Faught et al., 2016). Briefly, stressor stimulation of the hypothalamus releases corticotropin-releasing factor (CRF), which in turn stimulates the anterior pituitary to release adrenocorticotropic hormone (ACTH), a peptide derivative of proopiomelanocortin (POMC), the primary cortisol secretagogue in fish (Wendelaar Bonga, 1997; Mommsen et al., 1999). ACTH binds to the melanocortin 2 receptor (MC2R), a G-protein coupled receptor, on the steroidogenic cells of the interrenal tissues and activates the signaling cascade leading to cortisol production (Aluru and Vijayan, 2008). The presence of MC2Rs on the plasma membrane for binding and activation by ACTH has been shown to require the presence of melanocortin receptor accessory proteins (MRAPs) (Hinkle and Sebag, 2009; Agulleiro et al., 2010; Webb and Clark, 2010; Dores and Garcia, 2015). Although trout has two MRAP paralogs, MRAP1 and MRAP2, only MRAP1 is essential for MC2R activation (Liang et al., 2011; Dores et al., 2016), while their transcript abundance in vivo in trout interrenal tissues have
Cadmium (Cd) is a non-essential metal that is present in the aquatic environment due to various anthropogenic activities and natural release processes (McGeer et al., 2011). Current concentrations of Cd in surface water in Canada range from < 0.1 to 122 μg/L (Canadian Environmental Protection Act, 1994; Canadian Council of Ministries of the Environment (CCME, 1999). Accumulation of Cd in aquatic organisms is dependent upon the route of exposure, which is either waterborne or dietary pathways, and uptake occurs primarily through the gut and gills (McGeer et al., 2011). In fish, Cd accumulates predominantly in metabolically active tissues, including gills, liver and kidney (McGeer et al., 2011). Sublethal exposure to this metal has been shown to affect the cortisol stress performance in fishes (Lacroix and Hontela, 2004, 2006; Hontela and Vijayan, 2008; Sandhu and Vijayan, 2011; Sandhu et al., 2014), but the mechanisms are unknown. The cortisol response to stress is a highly conserved adaptive response that is essential for re-establishing homeostasis in vertebrates (Sapolsky et al., 2000). Teleosts lack a discrete adrenal gland and the interrenal tissue located in the head kidney region is analogous to the
⁎
Corresponding author. Present address: Department of Biological Sciences, University of Calgary, 2500 University Drive NW, Calgary, Alberta, T2N 1N4, Canada. E-mail address: [email protected] (M.M. Vijayan).
https://doi.org/10.1016/j.aquatox.2019.01.018 Received 27 September 2018; Received in revised form 19 January 2019; Accepted 22 January 2019 Available online 24 January 2019 0166-445X/ © 2019 Elsevier B.V. All rights reserved.
Aquatic Toxicology 209 (2019) 26–33
N. Sandhu et al.
reach the desired concentration of Cd, the flow rate for 0.75 μg Cd/L was 1290 ml/min and 1210 ml/min for 2.0 μg Cd/L. The flow rate for the control tanks was 1250 ml/min. All water in head tanks and fish tanks were well aerated. Fish were acclimated to their respective tanks for two weeks before Cd exposure and fed at 2% of their body weight daily as a single meal (Bio Oregon Protein Inc., Warrenton, OR, USA).
not so far been reported. Furthermore, very little is known about MRAPs regulation in vivo in response to stressor exposure in animal models. Recent studies demonstrated that Cd inhibits stressor-mediated cortisol production and this involves disruption of corticosteroidogenesis in rainbow trout (Oncorhynchus mykiss; Sandhu and Vijayan, 2011; Sandhu et al., 2014). Specifically, the results suggest that Cd impact on steroidogenesis occurs upstream of cAMP production in rainbow trout interrenal tissue (Sandhu and Vijayan, 2011). However, the mode of action of Cd in impacting corticosteroidogenesis is far from clear. Here we tested the hypothesis that MC2R signaling is a key target for Cdmediated endocrine disruption of the cortisol stress axis. For this, trout were exposed to sublethal dosage of Cd for 7 d and then subjected to a secondary acute stressor to assess the functional integrity of HPI axis activity. Plasma cortisol level was measured as indicator of stress response, while the temporal changes in transcript abundances of mc2r, mrap1 and mrap2 in the head kidney were determined as markers of interrenal responsiveness to ACTH stimulation in vivo. We also tested the transcript abundance of the above molecular markers in response to ACTH stimulation of cortisol production using head kidney tissues pieces ex vivo from Cd-exposed fish. Furthermore, a reporter assay using CHO cells transfected with rainbow trout mc2r and mrap1 was used to test the direct effect of Cd on ACTH-stimulated MC2R signaling.
2.3. Cadmium exposure Two head tanks were used to receive desired concentrations of 0.75 and 2.0 μg Cd/L (as CdCl2, VWR International Mississauga, ON, CAN) and the remaining head tank was used for control (0 μg Cd/L). Dissolved actual Cd concentrations measured in fish tanks were (means ± SEM; n = 7): -0.2 ± 0 0.03 μg Cd/L (control), 0.73 ± 0.12 μg Cd/L, 2.38 ± 0.35 μg Cd/L. All three exposure conditions (control (0), 0.75 and 2.0 μg Cd/L) were carried out in duplicate, therefore n = 24 fish for control, 0.75 and 2.0 μg Cd/L. Initially, head tanks and fish tanks were spiked with appropriate volume from a master stock of 1.0 g/L of Cd to achieve exposure concentrations. Additionally, appropriate volumes from a master stock were added to two 10 L carboys, each delivering Cd solution to the head tanks via pumps (FIM lab pump, Fluid Metering Inc., Oyster Bay NY, USA; 1.2 ml/min) to maintain the desired Cd concentrations in the exposure tanks. Water pH (Mettler Toledo SevenGO™, Fisher Scientific, Fairlawn, NJ, USA) and conductivity and temperature were measured using a conductivity meter (YSI 30, Yellow Springs Instruments, Yellow Springs, Ohio, USA).
2. Materials and methods 2.1. Chemicals Tricaine methanesulfonate (MS222) and sodium bicarbonate were purchased from Syndel Laboratories Ltd., (Vancouver BC, CAN). RNase free water was purchased from Qiagen (Toronto, ON, CAN).). Nitric acid, borosilicate and scintillation tubes, monobasic and dibasic sodium phosphate, potassium bicarbonate, perchloric acid, potassium chloride and sodium bicarbonate were purchased from Fisher Scientific (Fairlawn, NJ, USA). Scintillation cocktail and cortisol antibody were purchased from MP Biomedicals (Solon, OH, USA). [1,2,6,7-3H] cortisol tracer was purchased from GE Healthcare (Upsala, Sweden). Cadmium chloride was purchased from Bioshop (Burlington, ON, CAN). Thimerasol, activated charcoal and dextran (from Leuconostoc mesenteroides) were purchased from Sigma –Aldrich (St. Louis, MO, USA).
2.4. Sampling Rainbow trout were exposed to 0 (control), 0.75 (low dose) or 2.0 (high dose) μg Cd/L for 7 days and plasma and tissue samples were collected (0 h time point). Following the 0 h sampling, the remaining fish were exposed to a secondary stressor consisting of a 5 min handling disturbance as previously described (Aluru and Vijayan, 2008), and the fish allowed to recover. Samples were taken at 1, 4 and 24 h poststressor exposure. Fish were euthanized with an overdose of 0.3 g/L MS-222 buffered with 0.6 g NaHCO3/L. 1 ml of blood was collected from the caudal peduncle in 1.5 ml centrifuge tubes containing 5 mM EDTA as an anticoagulant. Blood samples were immediately centrifuged at 10,000 × g for 2 min. Plasma was separated and stored at −30 °C to measure cortisol levels. Head kidney was stored at −80 °C for measuring Cd concentration and for transcript analysis.
2.2. Rainbow trout holding conditions The experimental protocol reported here was approved by the Animal Care Committees at the University of Waterloo and the Wilfrid Laurier University, and followed the guidelines set out by the Canadian Council on Animal Care. Experimental holding conditions for the 7 d in vivo study was similar to that reported recently for cadmium exposure of trout (Sandhu et al., 2014). Briefly, juvenile trout (30.4 ± 1.1 g) were obtained from Rainbow Springs Hatchery (Thamesford, ON, CAN). Fish were initially held in 180 L tanks (2 tanks with 50 fish in each) with water flowing though each tank at 700 ml/min. Water was a 1:1 mixture of well water and soft water produced by reverse osmosis (500 mg/L as CaCO3, 650 μS/cm, pH 7.2, 15 °C). Fish were acclimated to moderately hard water by gradually decreasing the flow of the well water over a two-week period. After the two weeks, fish were randomly distributed among six 200 L polyethylene tanks (16–17 fish in each). 60 L polyethylene mixing head tank received 2.4 L/min of soft water plus 0.6 L/min of well water, for a total of 3 L/min to achieve the chemistry of moderately hard water used for experimental exposures (140 mg/L as CaCO3, 786 ± 25 Ca, 440 ± 18 Mg, 383 ± 32 Na (all in μM ± SD, n = 63), with a conductivity, pH and temperature of 255 μS/cm, pH 7.2, 15 °C respectively as described previously (Sandhu et al., 2014). The mixing head tank delivered water (2 L/min) to three smaller 11.2 L polyethylene head tanks that have equally split outflows of water delivered to the two fish tanks running in duplicate. In order to
2.5. Ex vivo study Juvenile rainbow trout were sampled at 7 d post-Cd exposure exactly as mentioned above. Trout were euthanized with an overdose of MS-222 buffered with sodium bicarbonate and the anterior region of the kidney (containing interrenal tissues) from each fish was finely minced (approximately 1 mm3 pieces) and rinsed with modified Hank’s buffer (NaCl (136.9 mM), KCl (5.4 mM), MgSO4.7H20 (0.8 mM), Na2HPO4.7H2O (0.33 mM), KH2PO4 (0.44 mM), HEPES (5.0 mM), HEPES Na (5.0 mM), 5 mM NaHCO3 and 5 mM glucose pH adjusted to 7.63) to remove blood clots. The resulting mixture was distributed equally (500 μL modified Hank’s buffer with approximately 50 mg of head kidney tissue in each well) into a 24 well tissue culture plate (Sarstedt, Newton, NC, USA). The tissues were maintained for 2 h at 13 °C with gentle shaking. After 2 h, the buffer was replaced and the tissues were incubated for an additional 1 h after which the tissues were replaced with fresh buffer containing no ACTH (control), 0.5 IU/mL ACTH or 5 mM 8-Bromo-cAMP for 4 h. The ACTH and 8-Bromo-cAMP concentrations and the incubation period were chosen based on our previous work (Aluru and Vijayan, 2008; Sandhu and Vijayan, 2011). At the end of the incubation period, samples were collected, quickly centrifuged (13,000 × g for 1 min) and the supernatant and pellet were 27
Aquatic Toxicology 209 (2019) 26–33
N. Sandhu et al.
separated and stored frozen at −30 °C or −80 °C, respectively, for later determination of medium cortisol concentration and tissue transcript abundance. Plasma and media cortisol levels were measured using a radioimmunoassay as described previously (Alsop et al., 2009).
USA) under the following conditions: 2 min at 94 °C followed by 40 cycles of 15 s at 94 °C, 30 s at desired melting temperature (Table 1), and 30 s at 72 °C. PCR products were subjected to melt curve analysis to confirm presence of a single amplicon. Negative controls with no template were carried out for each gene analyzed. Elongation factor 1 alpha (ef1α) was used as the housekeeping gene as no differences were observed between treatments or time-points. The relative quantification of transcript levels was carried out using the standard curves for the genes of interest and housekeeping gene as described previously (Aluru and Vijayan, 2008).
2.6. MC2R/MRAP1 CHO cell functionality during Cd exposure The functional expression of rtMC2R (rainbow trout melanocortin-2 receptor) was performed in Chinese Hamster Ovary (CHO) cells, and the cAMP production measured indirectly by CRE-Luciferase reporter assay as described previously (Dores et al., 2016). Briefly, CHO cells were grown to confluence in a Kaigh’s Modification of Ham’s F12K media and supplemented with 10% fetal bovine serum, 100 units/ml penicillin, 100ug/ml streptomycin, 100ug/ml normocin, and maintained at 37 ᵒC in a CO2 incubator (Liang et al., 2011, 2011). Following trypsin treatment, 3.0 × 106 CHO cells were used for each transfection. For each transfection, rtmc2r (10 nm/rxn) was co-expressed with CRE-Luciferase reporter plasmid (83 nm/rxn; Chepurny and Holz, 2007) and 30 nm/rxn of either rtmrap1 (rainbow trout melanocortin-2 receptor accessory protein 1), rtmrap2 (rainbow trout melanocortin-2 receptor accessory protein 2) or zfmrap1 (zebrafish melanocortin-2 receptor protein 1). The transient transfections were done using a Cell Line Nucleofector Kit (Amaxa Inc., Gaithersburg, MD, USA) with solution T and program U-23. The transfected cells were seeded at a density of 100,000 cells per well in a 96-well plate. Two days after transfection, and after the cells had reach confluency in each well, cells were stimulated with serum-free media only (no hACTH(1–24) or hACTH (1–24) (New England Peptide; Gardiner, MA) in serum-free media (Kaigh’s Modification of Ham’s F12 K media) at concentrations ranging from 10–14 M to 10−6 M (Dores et al., 2016). For the Cd study, CHO cells were treated with 0, 0.1, 10, or 100 nM Cd and stimulated for 4 h at 37 °C in the absence or presence of ACTH (0.1 nM). Note that cells were treated with ACTH and the various concentrations of cadmium for the same amount of time. At the end of the incubation, 100 μl of BrightGlo luciferase assay reagent (Promega, Inc, San Luis Obispo, CA, USA) was applied to each well and incubated for 5 min at room temperature. Luminescence was measured using Bio-Tek Synergy HT plate reader to determine MC2R activity. Luminescence readings were corrected by subtracting the average basal cAMP readings (serum-free media/no ligand) for each transfection dose response curve. All experiments were done in triplicate. The data for each dose response curve were fitted to the Michaelis-Menton equation to obtain EC50 values using Kaleidograph software (www.synergy.com). Data points are expressed as the mean ± SEM (n = 3).
2.9. Statistical analysis All statistical analyses were performed using SigmaPlot 11 software (Systat Software Inc., San Jose, CA, USA) and data are presented as mean ± SEM. Data comparisons for cortisol and transcript levels for in vivo, ex vivo study utilized two-way analysis of variance (ANOVA). Significant differences due to Cd exposure in the CHO cell MC2R/ MRAP1 reporter assay was analyzed using two-way repeated measuresANOVA. Significant differences in head kidney tissue Cd accumulation were assessed using a one-way ANOVA. Significant differences between treatment groups for cortisol and transcripts were compared using Holm-Sidak post hoc test or Student-Newman-Keul’s test for comparison of ranks. The data were transformed wherever necessary to meet the assumption of homogeneity of variance, although non-transformed data are shown in the figures. A probability level of P < 0.05 was considered to be significant. 3. Results 3.1. Cadmium accumulation There was no significant difference in Cd accumulation in the head kidney between the control and 0.75 μg Cd/L treated fish (Fig. 1). There was a significant increase in Cd accumulation in the kidney of fish treated with 2.0 μg Cd/L (0.32 μg/g) compared to the other two groups (Fig. 1). 3.2. In vivo plasma cortisol levels There were no significant differences in plasma cortisol levels between the treatment groups at 7 d post-Cd exposure (0 h). Acute handling disturbance significantly increased plasma cortisol levels at 1 h post-stressor exposure, and the levels were back to pre-stress levels at 4 and 24 h post-stressor exposure in all treatment groups (Fig. 2). In the Cd groups, stressor-induced plasma cortisol elevation at 1 h poststressor exposure was significantly attenuated in a dose-related fashion compared to the controls (˜30% for 0.75 μg/L and ˜64% for 2.0 μg/L Cd; Fig. 2).
2.7. Tissue Cd accumulation Cd concentrations were measured using graphite furnace atomic absorption spectrophotometer (GFAAS; SpectraAA 880 GTA 100 atomizer, Varian, Mississauga, ON, CAN) as previously described (McGeer et al., 2000), and standard curves were validated using certified reference material (TMDA-28.3 and TM 26.3; National Water Research Institute, Burlington, ON, Canada). The concentration of Cd in the head kidney is expressed as μg/g wet weight.
3.3. In vivo head kidney transcript abundance At 7 d exposure (0 h), mc2r mRNA levels were significantly higher by ˜50% and ˜75% in fish exposed to 0.75 μg Cd/L and 2.0 μg Cd/L, respectively, compared to the control fish (Fig. 3A). In response to a secondary stressor, there was a significant time-effect with mc2r transcript levels significantly higher at 1 and 4 h compared to 0 and 24 h post-stressor exposure regardless of treatments (Fig. 3A). However, at 1 h post-stressor exposure, the stressor-induced increase in mc2r transcript abundance seen in the control was completely abolished in both the cadmium groups (Fig. 3A). There was no cadmium effect on mc2r transcript levels at any other time-points post-stressor exposure. At 7 d exposure (0 h), no significant changes were observed in mrap1 mRNA levels in any of the Cd groups with respect to control fish (Fig. 3B). In response to a secondary stressor, there was a time-dependent effect and mrap1 mRNA levels were greater at 1 and 4 h, but
2.8. Gene expression RNA from head kidney was extracted using Ribozol RNA extraction reagent (Amresco, Solon, OH, USA). RNA was DNase treated using manufacturer’s instructions (Fermentas, Pittsburgh, PA, USA). One microgram total RNA was reverse-transcribed with high capacity cDNA reverse transcription kit (Applied Biosystems, Streetsville, ON, CAN). Real-time quantitative PCR (qPCR) was used to measure transcript abundances for mrap1, mrap2 and mc2r in the head kidney. Primer pair sequences, melting temperatures, and amplicon sizes are listed in Table 1. qPCR was performed using iCycler (Bio-Rad, Hercules, CA, 28
Aquatic Toxicology 209 (2019) 26–33
N. Sandhu et al.
Table 1 Primer sequence: Oligonucleotide primers [forward (F) and reverse (R)] for genes encoding melanocortin 2 receptor (mc2r), melanocortin receptor accessory protein (mrap1 and mrap2) and elongation factor 1 alpha (ef1α) used in quantitative real-time PCR along with their melting temperature (Tm; oC) and amplicon size (base pair) and accession number. The gene amplification efficiencies for mc2r, mrap1 and mrap2 were 100%, 125% and 131%, respectively. PRIMER
SEQUENCE
Amplicon Size (bp)
Accession #
Annealing Tm (°C)
mc2r
F: GAGAACCTGTTGGTGGTGGT R: GAGGGAGGAGATGGTGTTGA F: GACGAGCGCAAACTGAAA R: CTGACTGAACGGGACATGAA F: CGGACCCGGACTACAAGTGGA R: GGCCCACCCAGAAGCCTATCA F: CATTGACAAGAGAACCATTGA R: CCTTCAGCTTGTCCAGCAC
105
EU119870
60
116
FR837908
60
111
FR837909
60
95
AF498320
56
mrap1 mrap2 ef1α
respectively, compared to the control group (Fig. 3B). There was no significant effect of Cd exposure or time post-stressor exposure on mrap2 mRNA abundance (Fig. 3C). 3.4. Ex vivo cortisol levels ACTH-stimulated cortisol production was significantly reduced by ˜34% and ˜68% in head kidney slices from fish exposed to 0.75 μg Cd/L and 2.0 μg Cd/L, respectively, compared to control (Fig. 4A). No significant differences in cortisol production were observed between control and Cd-exposed slices stimulated with 8-Bromo-cAMP (Fig. 4A). Head kidney slices stimulated with 8-Bromo-cAMP showed greater cortisol levels than those stimulated with ACTH (Fig. 4A), and the difference in production with 8-Bromo-cAMP was ˜39%, ˜57% and ˜78% greater in the control, 0.75 μg Cd/L and 2.0 μg Cd/L, respectively, compared to each treatment group stimulated with ACTH (Fig. 4A). Fig. 1. Tissue cadmium accumulation: Cd accumulation in head kidney of juvenile rainbow trout exposed to 0, 0.75 or 2.0 μg/L Cd for 7 days. Bars representing mean ± SEM (n = 6). Different letters above bars indicate significant differences between concentrations (P < 0.05; one way ANOVA).
3.5. Ex vivo head kidney transcript abundance The transcript abundance of mc2r in head kidney slices from trout was significantly higher in response to ACTH-stimulation in vitro compared to the sham group (Fig. 4B). This ACTH-stimulated increase in mc2r transcript abundance was completely absent in head kidney slices from both the Cd-treated fish groups (Fig. 4B). The mrap1 transcript abundance also showed a profile similar to that seen with mc2r (Fig. 4C). ACTH-treatment in vitro significantly increased mrap1 mRNA abundance compared to the sham group (Fig. 4C). However, this ACTH-stimulated mrap1 mRNA transcript abundance was completely absent in the head kidney slices from both the Cd-treated groups (Fig. 4C). ACTH-stimulation in vitro did not significantly affect mrap2 mRNA abundance compared to the sham group in head kidney slices from either the control or Cd-treated groups (Fig. 4D). 3.6. Functional activation of MC2R/MRAP1 Rainbow trout MC2R activation of cAMP in CHO cells by ACTH is dependent on MRAP1, but not MRAP2 (Fig. 5A and B). The rainbow trout MC2R activation by ACTH in CHO cells was significantly greater (P = 0.03) when co-transfected with zfmrap1 compared to rtmrap1 (Fig. 5B). For the Cd exposure experiments, we elected to use zfmrap1 instead of rtmrap1 to maximize the activation of rtmc2r. MC2R/MRAP1 expression in CHO cells did not affect the basal activation of cAMP in unstimulated control cells (background levels) exposed to 0, 0.1, 10 or 100 nM Cd (Fig. 5C). The ACTH-stimulated cAMP production was significantly higher with the MC2R/MRAP1 expression in the control CHO cells exposed to 0 nM Cd relative to CHO cells in the absence of ACTH (Fig. 5). Cd exposure significantly inhibited the ACTH-induced cAMP production by ˜42% (0.1 nM), ˜41% (10 nM) and ˜49% (100 nM) compared to control CHO cells (0 nM Cd) stimulated with ACTH (Fig. 5C).
Fig. 2. Cortisol response in vivo: Plasma cortisol from juvenile rainbow trout exposed to 0, 0.75 or 2.0 μg/L Cd after 7 d exposure (0 h) and after 1,4 and 24 h after exposure to a secondary stressor on day 7. Bars represent mean ± SEM (n = 6). Different letters above lines indicate significant differences between time-points (P < 0.05; two-way ANOVA). Different lower case letters indicate significant treatment differences within the time-point (P < 0.05; one-way ANOVA).
not at 24 h after exposure to secondary stressor compared to 0 h samples (Fig. 3B). The stressor-induced significant changes observed in mrap1 mRNA levels at 1 h post-stressor exposure was significantly lower by ˜63% and ˜91% in fish exposed to 0.75 μg Cd/L and 2.0 μg Cd/L, 29
Aquatic Toxicology 209 (2019) 26–33
N. Sandhu et al.
Fig. 3. Transcript abundance in vivo: MC2R (A), MRAP1 (B) and MRAP2 (C) mRNA levels from juvenile rainbow trout exposed to 0, 0.75 or 2.0 μg/L Cd after 7 d exposure (0 h) and after 1,4 and 24 h after exposure to a secondary stressor on day 7. Bars represent mean ± SEM (n = 6). Different letters above lines indicate significant differences between time-points (P < 0.05; two-way ANOVA). Different lower case letters indicate significant treatment differences within the time-point (P < 0.05; one-way ANOVA).
4. Discussion
Fig. 4. Cortisol and transcript response ex vivo: Magnitude of change of cortisol levels (A) and MC2R (B), MRAP1 (C) and MRAP 2 (D) mRNA levels in juvenile rainbow trout head kidney slices exposed to 0, 0.75 or 2.0 μg/L Cd for 7 days in vivo and stimulated with ACTH or 8-Bromo-cAMP in vitro. Cortisol values show changes with respect to ACTH and 8-Bromo-cAMP stimulation, and the values shown are magnitude of change (%) relative to the control (unstimulated head kidney slices). Values represent mean ± SEM (n = 8). Bars or lines with different letters are significant different. Asterisks represent significantly different from the ACTH treatment (P < 0.05; t-test).
This study demonstrates that environmentally realistic levels of Cd impairs the cortisol stress response, and the mode of action involves the disruption of MC2R signaling in rainbow trout. Cortisol, the primary glucocorticoid in teleosts, is produced in response to stressor activation of the HPI axis, and this highly conserved response is important for the metabolic adaptation to stress (Mommsen et al., 1999; Faught et al., 30
Aquatic Toxicology 209 (2019) 26–33
N. Sandhu et al.
Fig. 5. Activation of rtMC2R following co-expression with MRAPs: A) rtmc2r cDNA was either expressed alone in CHO cells or co-expressed with rtmrap1 cDNA. The transfected cells were stimulated with hACTH(1–24) at concentrations ranging from 10−6 to 10-12M. The EC50 value for rtMC2R/rtMRAP1 transfected CHO cells was 1.2 × 10-10M +/- 4.6 × 10-11). B) rtmc2r cDNA was co-expressed in CHO cells with either zfmrap1, rtmrap1 or rtmrap2 cDNA. The transfected cells were stimulated with hACTH(1–24) at concentrations ranging from 10-7 to 10-14M. The EC50 value for rtMC2R/zfMRAP1 transfected CHO cells was 1.3 × 10-11M +/3.3 × 10-12 and for rtMC2R/rtMRAP1 transfected CHO cells was 1.1 × 10-10M +/- 3.6 × 10-11. C) Maximal responses of rtMC2/zfMRAP1 receptor complex expressed in CHO cells exposed to 0, 0.1, 10 or 100 nM of Cd for 4 h in the presence or absence of ACTH (0.1 nM). Values represent mean ± SEM (n = 3). Inset indicates overall stimulant effect between control and ACTH (P < 0.05, two-way repeated measures ANOVA). Lines with different letters above it represent significant differences in ACTH groups between control and Cd treatments (P < 0.05; one-way ANOVA). Asterisks above bar represent significant differences in cell expression with ACTH compared to the control group (P < 0.05; t-test).
31
Aquatic Toxicology 209 (2019) 26–33
N. Sandhu et al.
ACTH signaling, we treated CHO cells transfected with rtmc2r and zfmrap1 with Cd for 4 h either with or without ACTH stimulation in vitro. Although ACTH was able to stimulate cAMP production in the Cdtreated cells, the magnitude of production was reduced by ˜40% in all treatment groups (Fig. 5C). This dose-independent reduction in cAMP production with Cd suggests that the impact of this metal may be at the level of disruption in either ACTH binding to the MC2R and/or trafficking the receptor to the plasma membrane. We propose that Cd may be affecting the translocation of MC2R and this may involve interaction with MRAP1, but further studies are warranted to confirm if this is the mechanism of action in disrupting ACTH signaling. Exposure to environmentally realistic Cd concentrations led to significant accumulation of the metal in the head kidney, which is in agreement with previously reported studies in fish (McGeer et al., 2000; Kwong et al., 2011; McGeer et al., 2011). Interestingly, although the accumulation was evident only at the highest concentration, the toxic effects of this metal were evident even with the lower concentration of waterborne Cd, which showed tissue burden similar to that of the background detected in the control fish kidney (McGeer et al., 2000). While the background levels may be due to feed contamination (McGeer et al., 2000), it has been shown that depending on the tissue accumulation, Cd is partitioned into subcellular compartments, which may modify its toxic effect (Kamunde, 1999). One possible explanation is that perhaps the low level Cd exposure induced changes in the subcellular distribution of Cd within the head kidney without changing overall tissue burden. It is also possible that other physiological impacts of Cd exposure may have induced secondary responses related to corticosteroidogenesis. For example it is well known that disruption in the internal ionic balance of Ca2+ and Na+ occurs as a result of sublethal waterborne Cd exposure (McGeer et al., 2011). While these ideas remains to be studied, the toxic effect on MC2R signaling and cortisol production was clear and head kidney Cd accumulation is not a reliable predictor of its effects on interrenal corticosteroidogenesis. In conclusion, waterborne exposure to very low and environmentally-realistic levels of Cd impairs the highly conserved stress axis function in rainbow trout. Specifically, Cd disrupts the acute stressor-mediated corticosteroid production in vivo, as well as in head kidney slices ex vivo stimulated with ACTH, but not 8-br-cAMP. Our results reveal for the first time that Cd exposure affects mc2r and mrap1 transcript abundance in trout head kidney tissues in vivo. Furthermore, CRE-luciferase reporter assay using rainbow trout MC2R/MRAP in CHO cells showed that Cd dose-independently suppresses the ACTH-induced cAMP production. Taken together, Cd is an adrenotoxicant, inhibiting the stressor-induced cortisol production, and the mode of action involves disruption of MC2R signaling in rainbow trout.
2016). Consequently, disruption of the cortisol stress axis by environmental contaminants, including Cd, may compromise stress coping and predator-avoidance, leading to reduced fitness and survival (Scott et al., 2003; Hontela and Vijayan, 2008; Thomas et al., 2018). Cadmium is an endocrine disruptor (Lizardo-Daudt et al., 2007, 2008; Sandhu and Vijayan, 2011; Sandhu et al., 2014), and several studies have shown disruption of the HPI axis functioning in fishes from metal-contaminated waters (Brodeur et al., 1997; Hontela, 1998; Norris et al., 1999; Laflamme et al., 2000; Gravel et al., 2005). Majority of these studies have focused on the Cd impact on interrenal corticosteroid biosynthetic capacity. Indeed, head kidney tissue pieces or dispersed interrenal cells from either Cd contaminated fish or tissues treated in vitro with the metal showed a reduced capacity for cortisol production in response to ACTH or cAMP analog stimulation (Leblond and Hontela, 1999; Lizardo-Daut et al., 2007; Hontela and Vijayan, 2008; Sandhu and Vijayan, 2011). This was further evident from the present study showing that environmentally realistic levels of Cd disrupt the stimulated cortisol production (Fig. 4A). As seen before in trout, the inhibition of cortisol production by Cd in head kidney slices in vitro was evident only with ACTH, but not dbcAMP stimulation, supporting the proposal that Cd toxicity manifests upstream of cAMP production (Sandhu and Vijayan, 2011). MC2R, a G-protein coupled receptor, is a key target for stressormediated HPI axis regulation, because ACTH binds to this receptor to activate the adenylyl cyclase, leading to cAMP production, which initiates the downstream cascades culminating in cortisol biosynthesis (Aluru and Vijayan, 2008; Dores and Garcia, 2015). It is well documented that MC2R activation requires MRAP, which plays a role in the trafficking of the receptor to the plasma membrane for ACTH activation (Hinkle and Sebag, 2009; Agulleiro et al., 2010; Webb and Clark, 2010; Dores and Garcia, 2015). Indeed, in vitro reporter assays utilizing CHO cells transfected with rainbow trout mc2r reveals that rtMRAP1 is necessary for ACTH stimulation of cAMP production, whereas rtMRAP2 has no effect on this receptor activation (Fig. 5A and B). This is in agreement with previous studies showing that heterologous MRAP1 is required for ACTH-mediated MC2R signaling (Liang et al., 2011; Dores et al., 2016). So, we hypothesized that MRAP dysregulation by Cd may be a mechanism leading to the lack of ACTH sensing in response to secondary stressors in fish. Our results reveal that acute stress transiently upregulates mrap1, but not mrap2 transcript abundance in trout head kidney, and this expression is disrupted by environmental levels of Cd. While acute stress upregulate mc2r transcript abundance in trout (Aluru and Vijayan, 2008), this is the first study to show that mrap1 expression follows the mc2r expression pattern post-stressor expression in vivo, suggesting the tight regulation of these two proteins as essential for acute stressormediated corticosteroidogenesis. Indeed, mutation in MRAP that precludes MC2R functioning leads to glucocorticoid deficiency in humans (Cooray et al., 2008), but this has not been tested in fish. However, Cd exposure for 7 days reduced both mc2r and mrap1, but not mrap2 transcript abundance, and this coincided with an attenuated cortisol performance to stress in trout. This suggests that a mechanism of action of cadmium involves decreasing the sensitivity of the interrenal cells to ACTH stimulation, and this may include either reducing MC2R abundance and/or impacting the intracellular trafficking of the receptor to the plasma membrane mediated by MRAP1. Interestingly, the reduced mc2r and mrap1 transcript abundances in the Cd group with stress evident in vivo was also observed ex vivo in response to ACTH stimulation lending support to the proposal that Cd disrupts ACTH sensing in the interrenal cells of trout. Also, this suggests that ACTH may be playing a direct role in regulating the MC2R and MRAP1 levels during stress in fish. Consequently, in addition to disrupting MC2R signaling, Cd may also be reducing circulating levels of ACTH (Norris et al., 1999), suggesting multiple modes of action of this metal in impairing HPI axis regulation. To further elucidate the mechanisms involved in Cd impact on
Acknowledgements This work was funded by the Natural Sciences and Engineering Research Council of Canada Discovery Grant to MMV (217481-2013RGPIN). We thank Jesse Cunningham for helping with this project and for measuring water and tissue cadmium concentrations. References Agulleiro, M.J., Roy, S., Sanchez, E., Puchol, P., Gallo-Payet, N., Cerda-Reverter, J.M., 2010. Role of melanocortin receptor accessory proteins in the function of zebrafish melanocortin receptor type 2. Mol. Cell. Endocrinol. 320, 145–152. Alsop, D., Ings, J.S., Vijayan, M.M., 2009. Adrenocorticotropic hormone suppresses gonadotropin-stimulated estradiol release from zebrafish ovarian follicles. PLoS One 4 (7), e6463. Aluru, N., Vijayan, M.M., 2008. Molecular characterization, tissue-specific expression and regulation of melanocortin 2 receptor in rainbow trout. Endocrinology 149 (9), 4577–4588. Brodeur, J.C., Sherwood, G., Rasmussen, J.B., Hontela, A., 1997. Impaired cortisol secretion in yellow perch (Perca flavescens) from lakes contaminated by heavy metals: in vivo and in vitro assessment. Can. J. Fish. Aquat. Sci. 54, 2752–2758. Canadian Council of Ministries of the Environment (CCME), 1999. Canadian water quality guidelines for the protection of aquatic life: cadmium. Canadian
32
Aquatic Toxicology 209 (2019) 26–33
N. Sandhu et al.
Leblond, V.S., Hontela, A., 1999. Effects of in vitro exposures to cadmium, mercury, zinc, and 1-(2-chlorophenyl)-1-(4-chlorophenyl)-2,2-dichloroethane on steroidogensis by dispersed interrenal cells of rainbow trout (Oncorhynchus mykiss). Toxicol. Appl. Pharmacol. 157, 16–22. Liang, L., Sebag, J.A., Eagelston, L., Serasinghe, M.N., Veo, K., Reinick, C., Angleson, J., Hinkle, P.M., Dores, R.M., 2011. Functional expression of frog and rainbow trout melanocortin 2 receptors using heterologous MRAP1s. Gen. Comp. Endocrinol. 174, 5–14. Lizardo-Daudt, H.M., Bains, O.S., Singh, C.R., Kennedy, C.J., 2007. Biosynthetic capacity of rainbow trout (Oncorhynchus mykiss) interrenal tissue after cadmium exposure. Arch. Environ. Contam. Toxicol. 52, 90–96. Lizardo-Daudt, H.M., Bains, O.S., Singh, C.R., Kennedy, C.J., 2008. Cadmium chlorideinduced disruption of testicular steroidogenesis in rainbow trout, Oncorhynchus mykiss. Arch. Environ. Contam. Toxicol. 55, 103–110. McGeer, J.C., Szebedinszky, C., McDonald, G.D., Wood, C.M., 2000. Effects of chronic sublethal exposure to waterborne Cu, Cd or Zn in rainbow trout 2: tissue specific metal accumulation. Aquat. Toxicol. 50 (3), 245–256. McGeer, J.C., Niyogi, S., Smith, D.S., 2011. Cadmium. In: Wood, C.M., Farrell, A.P., Brauner, C.J. (Eds.), Homeostasis and Toxicology of Non-Essential Metals, Fish Physiology Vol. 31, Part B. Elsevier, New York, pp. 125–184. Mommsen, T., Vijayan, M.M., Moon, T., 1999. Cortisol in teleosts: dynamics, mechanisms of action, and metabolic regulation. Rev. Fish Biol. Fish. 9, 211–268. Norris, D.O., Donahue, S., Dores, R.M., Lee, J.K., Maldonado, T.A., Ruth, T., Woodling, J.D., 1999. Impaired adrenocortical response to stress by brown trout, Salmo trutta, living in metal-contaminated waters of the Eagle River, Colarado. Gen. Comp. Endocrinol. 113, 1–8. Sandhu, N., Vijayan, M.M., 2011. Cadmium-mediated disruption of cortisol biosynthesis involves suppression of corticosteroidogenic genes in rainbow trout. Aquat. Toxicol. 103 (92), 100. Sandhu, N., McGeer, J.C., Vijayan, M.M., 2014. Exposure to environmental levels of waterborne cadmium impacts corticosteroidogenic and metabolic capacities, and compromises secondary stressor performances in rainbow trout. Aquat. Toxicol. 146, 20–27. Sapolsky, R.M., Romero, L.M., Munck, A.U., 2000. How do glucocorticoids influence stress responses? Integrating permissive, suppressive, stimulatory, and preparative actions. Endocr. Rev. 21, 55–89. Scott, G.R., Sloman, K.A., Rouleau, C., Wood, C.M., 2003. Cadmium disrupts behavioural and physiological responses to alarm substance in juvenile rainbow trout (Oncorhynchus mykiss). J. Exp. Biol. 206, 1779–1790. Thomas, J.K., Birceanu, O., Sadoul, B., Vijayan, M.M., 2018. Bisphenol A in eggs impairs the long-term stress performance of rainbow trout in two generations. Environ. Sci. Technol. 52, 7951–7961. Webb, T.R., Clark, A.J., 2010. Minireview: the melanocortin 2 receptor accessory proteins. Mol. Endocrinol. 24, 475–484. Wendelaar Bonga, S., 1997. The stress response in fish. Physiol. Rev. 77, 591–626.
Environmental Quality Guidelines. Winnipeg, Manitoba. Canadian Environmental Protection Act, 1994. Cadmium and Its Compounds. Environment Canada Health Canada Priority Substances List Assessment Report. Canadian Environmental Protection Act. Chepurny, O.G., Holz, G.G., 2007. A novel cyclic adenosine monophosphate responsive luciferase reporter incorporating a nonpalindromic cyclic adenosine monophosphate response element provides optimal performance for use in G protein coupled receptor drug discovery efforts. J. Biomol. Screen. 12, 740–746. Cooray, S.N., Chan, L., Metherell, L., Storr, H., Calrk, A.J., 2008. Adrenocorticotropin resistance syndromes. Endocr. Dev. 13, 99–116. Dores, R.M., Garcia, Y., 2015. Views on the co-evolution of the melanocortin-2 receptor, MRAPs, and the hypothalamus/pituitary/adrenal-interrenal axis. Mol. Cell. Endocrinol. 408, 12–22. Dores, R.M., Liang, L., Hollmann, R.E., Sandhu, N., Vijayan, M.M., 2016. Identifying the activation motif in the N-terminal of rainbow trout and zebrafish melanocortin-2 receptor accessory protein 1 (MRAP1) orthologs. Gen. Comp. Endocrinol. 234, 117–122. Faught, E., Aluru, N., Vijayan, M.M., 2016. The molecular stress response. In: In: Schreck, C.B., Tort, L., Farrell, A., Brauner, C. (Eds.), Biology of Stress in Fish: Fish Physiology, vol. 35. Elsevier Academic Press, pp. 114–149. Gravel, A., Campbell, G.C., Hontela, A., 2005. Disruption of the hypothalamo-pituitaryinterrenal axis in 1+ yellow perch (Perca flavescens) chronically exposed to metals in the environment. Can. J. Fish. Aquat. Sci. 62, 982–990. Hinkle, P.M., Sebag, J.A., 2009. Structure and function of the melanocortin 2 receptor accessory protein. Mol. Cell. Endocrinol. 300, 25–31. Hontela, A., 1998. Interrenal dysfunction in fish from contaminated sites: in vivo and in vitro assessment. Environ. Toxicol. Chem. 17, 44–48. Hontela, A., Vijayan, M.M., 2008. Adrenocortical toxicology in fishes. In: Harvey, P.W., Everett, D., Springall, C. (Eds.), Adrenal Toxicology. Taylor and Francis, Boca Ration, Fl, pp. 233–256. Kamunde, C., 1999. Early subcellular partitioning of cadmium in gill and liver of rainbow trout (Oncorhynchus mykiss) following low-to-near-lethal waterborne Cd exposure. Aquat. Toxicol. 91 (4), 291–301. Kwong, R.W.M., Andres, J.A., Niyogi, S., 2011. Effects of dietary cadmium exposure on tissue-specific cadmium accumulation, iron status and expression of iron-handling and stress-inducible genes in rainbow trout – influence of elevated dietary iron. Aquat. Toxicol. 102 (1-2), 1–9. Lacroix, A., Hontela, A., 2004. A comparative assessment of the adrenotoxic effects of cadmium in two teleost species, rainbow trout, Oncorhynchus mykiss, and yellow perch, Perca flavescens. Aquat. Toxicol. 67 (1), 13–21. Lacroix, A., Hontela, A., 2006. Role of calcium channels in cadmium-induced disruption of cortisol synthesis in rainbow trout (Oncorhynchus mykiss). Comp. Biochem. Physiol. C Toxicol. Pharmacol. 144 (2), 141–147. Laflamme, J.-S., Couillard, Y., Campbell, P.G.C., Hontela, A., 2000. Interrenal metallothionein and cortisol secretion in relation to Cd, Cu, and Zn exposure in yellow perch, Perca flavescens, from Abitibi lakes. Can. J. Fish. Aquat. Sci. 57, 1692–1700.
33
Contents lists available at ScienceDirect
Aquatic Toxicology journal homepage: www.elsevier.com/locate/aqtox
Cadmium disrupts melanocortin 2 receptor signaling in rainbow trout a
b
c
b
Navdeep Sandhu , Liang Liang , James McGeer , Robert M. Dores , Mathilakath M. Vijayan a b c
a,⁎
T
Department of Biology, University of Waterloo, Waterloo, Ontario, N2L 3G1, Canada Department of Biology, University of Denver, Denver, CO, 80208-9010, USA Wilfrid Laurier University, Waterloo, Ontario, N2L 3C5, Canada
A R T I C LE I N FO
A B S T R A C T
Keywords: Oncorhynchus mykiss MRAP1 MRAP2 MC2R Stress response Cortisol HPI axis Endocrine disruption
Cadmium is an endocrine disruptor and inhibits corticosteroid production, but the mechanisms are far from clear. We tested the hypothesis that sublethal exposure to environmentally realistic levels of cadmium impairs cortisol production by disrupting the melanocortin 2 receptor (MC2R) signaling in rainbow trout (Oncorhynchus mykiss). Fish were exposed to sublethal concentrations of cadmium (0.75 or 2.0 μg/L) in a flow-through system for 7 d and subjected to an acute secondary stressor to evoke a cortisol response. Cadmium exposure for 7 d did not affect plasma cortisol concentrations, but head kidney mc2r mRNA levels were higher than in control fish. The cortisol stress performance to a secondary-stressor was attenuated in the cadmium groups, and this corresponded with transient reduction in transcript abundance of mc2r and the gene encoding its accessory protein MRAP1 but not MRAP2 in the head kidney. Furthermore, in vivo cadmium exposure attenuated the adrenocorticotropic hormone (ACTH)-, but not 8-br-cAMP-stimulated cortisol production in head kidney slices ex vivo. This corresponded with reduced transcript abundance of mc2r and mrap1, but not mrap2 in these tissue slices. Also, reporter assays with CHO cells transiently transfected with rainbow trout mc2r and zebrafish mrap1 revealed a dose-independent inhibition in ACTH-stimulated luciferase activity by cadmium. Collectively, waterborne exposure to environmentally realistic concentration of cadmium compromises the stressor-induced cortisol response, and a mode of action involves the disruption of MC2R signaling in rainbow trout.
1. Introduction
adrenal cortex and releases cortisol, the principal glucocorticoid in teleosts, in response to stressor exposure. The stressor-mediated cortisol release is a coordinated response involving the activation of the hypothalamus-pituitary-interrenal (HPI) axis in fish (Wendelaar Bonga, 1997; Mommsen et al., 1999; Faught et al., 2016). Briefly, stressor stimulation of the hypothalamus releases corticotropin-releasing factor (CRF), which in turn stimulates the anterior pituitary to release adrenocorticotropic hormone (ACTH), a peptide derivative of proopiomelanocortin (POMC), the primary cortisol secretagogue in fish (Wendelaar Bonga, 1997; Mommsen et al., 1999). ACTH binds to the melanocortin 2 receptor (MC2R), a G-protein coupled receptor, on the steroidogenic cells of the interrenal tissues and activates the signaling cascade leading to cortisol production (Aluru and Vijayan, 2008). The presence of MC2Rs on the plasma membrane for binding and activation by ACTH has been shown to require the presence of melanocortin receptor accessory proteins (MRAPs) (Hinkle and Sebag, 2009; Agulleiro et al., 2010; Webb and Clark, 2010; Dores and Garcia, 2015). Although trout has two MRAP paralogs, MRAP1 and MRAP2, only MRAP1 is essential for MC2R activation (Liang et al., 2011; Dores et al., 2016), while their transcript abundance in vivo in trout interrenal tissues have
Cadmium (Cd) is a non-essential metal that is present in the aquatic environment due to various anthropogenic activities and natural release processes (McGeer et al., 2011). Current concentrations of Cd in surface water in Canada range from < 0.1 to 122 μg/L (Canadian Environmental Protection Act, 1994; Canadian Council of Ministries of the Environment (CCME, 1999). Accumulation of Cd in aquatic organisms is dependent upon the route of exposure, which is either waterborne or dietary pathways, and uptake occurs primarily through the gut and gills (McGeer et al., 2011). In fish, Cd accumulates predominantly in metabolically active tissues, including gills, liver and kidney (McGeer et al., 2011). Sublethal exposure to this metal has been shown to affect the cortisol stress performance in fishes (Lacroix and Hontela, 2004, 2006; Hontela and Vijayan, 2008; Sandhu and Vijayan, 2011; Sandhu et al., 2014), but the mechanisms are unknown. The cortisol response to stress is a highly conserved adaptive response that is essential for re-establishing homeostasis in vertebrates (Sapolsky et al., 2000). Teleosts lack a discrete adrenal gland and the interrenal tissue located in the head kidney region is analogous to the
⁎
Corresponding author. Present address: Department of Biological Sciences, University of Calgary, 2500 University Drive NW, Calgary, Alberta, T2N 1N4, Canada. E-mail address: [email protected] (M.M. Vijayan).
https://doi.org/10.1016/j.aquatox.2019.01.018 Received 27 September 2018; Received in revised form 19 January 2019; Accepted 22 January 2019 Available online 24 January 2019 0166-445X/ © 2019 Elsevier B.V. All rights reserved.
Aquatic Toxicology 209 (2019) 26–33
N. Sandhu et al.
reach the desired concentration of Cd, the flow rate for 0.75 μg Cd/L was 1290 ml/min and 1210 ml/min for 2.0 μg Cd/L. The flow rate for the control tanks was 1250 ml/min. All water in head tanks and fish tanks were well aerated. Fish were acclimated to their respective tanks for two weeks before Cd exposure and fed at 2% of their body weight daily as a single meal (Bio Oregon Protein Inc., Warrenton, OR, USA).
not so far been reported. Furthermore, very little is known about MRAPs regulation in vivo in response to stressor exposure in animal models. Recent studies demonstrated that Cd inhibits stressor-mediated cortisol production and this involves disruption of corticosteroidogenesis in rainbow trout (Oncorhynchus mykiss; Sandhu and Vijayan, 2011; Sandhu et al., 2014). Specifically, the results suggest that Cd impact on steroidogenesis occurs upstream of cAMP production in rainbow trout interrenal tissue (Sandhu and Vijayan, 2011). However, the mode of action of Cd in impacting corticosteroidogenesis is far from clear. Here we tested the hypothesis that MC2R signaling is a key target for Cdmediated endocrine disruption of the cortisol stress axis. For this, trout were exposed to sublethal dosage of Cd for 7 d and then subjected to a secondary acute stressor to assess the functional integrity of HPI axis activity. Plasma cortisol level was measured as indicator of stress response, while the temporal changes in transcript abundances of mc2r, mrap1 and mrap2 in the head kidney were determined as markers of interrenal responsiveness to ACTH stimulation in vivo. We also tested the transcript abundance of the above molecular markers in response to ACTH stimulation of cortisol production using head kidney tissues pieces ex vivo from Cd-exposed fish. Furthermore, a reporter assay using CHO cells transfected with rainbow trout mc2r and mrap1 was used to test the direct effect of Cd on ACTH-stimulated MC2R signaling.
2.3. Cadmium exposure Two head tanks were used to receive desired concentrations of 0.75 and 2.0 μg Cd/L (as CdCl2, VWR International Mississauga, ON, CAN) and the remaining head tank was used for control (0 μg Cd/L). Dissolved actual Cd concentrations measured in fish tanks were (means ± SEM; n = 7): -0.2 ± 0 0.03 μg Cd/L (control), 0.73 ± 0.12 μg Cd/L, 2.38 ± 0.35 μg Cd/L. All three exposure conditions (control (0), 0.75 and 2.0 μg Cd/L) were carried out in duplicate, therefore n = 24 fish for control, 0.75 and 2.0 μg Cd/L. Initially, head tanks and fish tanks were spiked with appropriate volume from a master stock of 1.0 g/L of Cd to achieve exposure concentrations. Additionally, appropriate volumes from a master stock were added to two 10 L carboys, each delivering Cd solution to the head tanks via pumps (FIM lab pump, Fluid Metering Inc., Oyster Bay NY, USA; 1.2 ml/min) to maintain the desired Cd concentrations in the exposure tanks. Water pH (Mettler Toledo SevenGO™, Fisher Scientific, Fairlawn, NJ, USA) and conductivity and temperature were measured using a conductivity meter (YSI 30, Yellow Springs Instruments, Yellow Springs, Ohio, USA).
2. Materials and methods 2.1. Chemicals Tricaine methanesulfonate (MS222) and sodium bicarbonate were purchased from Syndel Laboratories Ltd., (Vancouver BC, CAN). RNase free water was purchased from Qiagen (Toronto, ON, CAN).). Nitric acid, borosilicate and scintillation tubes, monobasic and dibasic sodium phosphate, potassium bicarbonate, perchloric acid, potassium chloride and sodium bicarbonate were purchased from Fisher Scientific (Fairlawn, NJ, USA). Scintillation cocktail and cortisol antibody were purchased from MP Biomedicals (Solon, OH, USA). [1,2,6,7-3H] cortisol tracer was purchased from GE Healthcare (Upsala, Sweden). Cadmium chloride was purchased from Bioshop (Burlington, ON, CAN). Thimerasol, activated charcoal and dextran (from Leuconostoc mesenteroides) were purchased from Sigma –Aldrich (St. Louis, MO, USA).
2.4. Sampling Rainbow trout were exposed to 0 (control), 0.75 (low dose) or 2.0 (high dose) μg Cd/L for 7 days and plasma and tissue samples were collected (0 h time point). Following the 0 h sampling, the remaining fish were exposed to a secondary stressor consisting of a 5 min handling disturbance as previously described (Aluru and Vijayan, 2008), and the fish allowed to recover. Samples were taken at 1, 4 and 24 h poststressor exposure. Fish were euthanized with an overdose of 0.3 g/L MS-222 buffered with 0.6 g NaHCO3/L. 1 ml of blood was collected from the caudal peduncle in 1.5 ml centrifuge tubes containing 5 mM EDTA as an anticoagulant. Blood samples were immediately centrifuged at 10,000 × g for 2 min. Plasma was separated and stored at −30 °C to measure cortisol levels. Head kidney was stored at −80 °C for measuring Cd concentration and for transcript analysis.
2.2. Rainbow trout holding conditions The experimental protocol reported here was approved by the Animal Care Committees at the University of Waterloo and the Wilfrid Laurier University, and followed the guidelines set out by the Canadian Council on Animal Care. Experimental holding conditions for the 7 d in vivo study was similar to that reported recently for cadmium exposure of trout (Sandhu et al., 2014). Briefly, juvenile trout (30.4 ± 1.1 g) were obtained from Rainbow Springs Hatchery (Thamesford, ON, CAN). Fish were initially held in 180 L tanks (2 tanks with 50 fish in each) with water flowing though each tank at 700 ml/min. Water was a 1:1 mixture of well water and soft water produced by reverse osmosis (500 mg/L as CaCO3, 650 μS/cm, pH 7.2, 15 °C). Fish were acclimated to moderately hard water by gradually decreasing the flow of the well water over a two-week period. After the two weeks, fish were randomly distributed among six 200 L polyethylene tanks (16–17 fish in each). 60 L polyethylene mixing head tank received 2.4 L/min of soft water plus 0.6 L/min of well water, for a total of 3 L/min to achieve the chemistry of moderately hard water used for experimental exposures (140 mg/L as CaCO3, 786 ± 25 Ca, 440 ± 18 Mg, 383 ± 32 Na (all in μM ± SD, n = 63), with a conductivity, pH and temperature of 255 μS/cm, pH 7.2, 15 °C respectively as described previously (Sandhu et al., 2014). The mixing head tank delivered water (2 L/min) to three smaller 11.2 L polyethylene head tanks that have equally split outflows of water delivered to the two fish tanks running in duplicate. In order to
2.5. Ex vivo study Juvenile rainbow trout were sampled at 7 d post-Cd exposure exactly as mentioned above. Trout were euthanized with an overdose of MS-222 buffered with sodium bicarbonate and the anterior region of the kidney (containing interrenal tissues) from each fish was finely minced (approximately 1 mm3 pieces) and rinsed with modified Hank’s buffer (NaCl (136.9 mM), KCl (5.4 mM), MgSO4.7H20 (0.8 mM), Na2HPO4.7H2O (0.33 mM), KH2PO4 (0.44 mM), HEPES (5.0 mM), HEPES Na (5.0 mM), 5 mM NaHCO3 and 5 mM glucose pH adjusted to 7.63) to remove blood clots. The resulting mixture was distributed equally (500 μL modified Hank’s buffer with approximately 50 mg of head kidney tissue in each well) into a 24 well tissue culture plate (Sarstedt, Newton, NC, USA). The tissues were maintained for 2 h at 13 °C with gentle shaking. After 2 h, the buffer was replaced and the tissues were incubated for an additional 1 h after which the tissues were replaced with fresh buffer containing no ACTH (control), 0.5 IU/mL ACTH or 5 mM 8-Bromo-cAMP for 4 h. The ACTH and 8-Bromo-cAMP concentrations and the incubation period were chosen based on our previous work (Aluru and Vijayan, 2008; Sandhu and Vijayan, 2011). At the end of the incubation period, samples were collected, quickly centrifuged (13,000 × g for 1 min) and the supernatant and pellet were 27
Aquatic Toxicology 209 (2019) 26–33
N. Sandhu et al.
separated and stored frozen at −30 °C or −80 °C, respectively, for later determination of medium cortisol concentration and tissue transcript abundance. Plasma and media cortisol levels were measured using a radioimmunoassay as described previously (Alsop et al., 2009).
USA) under the following conditions: 2 min at 94 °C followed by 40 cycles of 15 s at 94 °C, 30 s at desired melting temperature (Table 1), and 30 s at 72 °C. PCR products were subjected to melt curve analysis to confirm presence of a single amplicon. Negative controls with no template were carried out for each gene analyzed. Elongation factor 1 alpha (ef1α) was used as the housekeeping gene as no differences were observed between treatments or time-points. The relative quantification of transcript levels was carried out using the standard curves for the genes of interest and housekeeping gene as described previously (Aluru and Vijayan, 2008).
2.6. MC2R/MRAP1 CHO cell functionality during Cd exposure The functional expression of rtMC2R (rainbow trout melanocortin-2 receptor) was performed in Chinese Hamster Ovary (CHO) cells, and the cAMP production measured indirectly by CRE-Luciferase reporter assay as described previously (Dores et al., 2016). Briefly, CHO cells were grown to confluence in a Kaigh’s Modification of Ham’s F12K media and supplemented with 10% fetal bovine serum, 100 units/ml penicillin, 100ug/ml streptomycin, 100ug/ml normocin, and maintained at 37 ᵒC in a CO2 incubator (Liang et al., 2011, 2011). Following trypsin treatment, 3.0 × 106 CHO cells were used for each transfection. For each transfection, rtmc2r (10 nm/rxn) was co-expressed with CRE-Luciferase reporter plasmid (83 nm/rxn; Chepurny and Holz, 2007) and 30 nm/rxn of either rtmrap1 (rainbow trout melanocortin-2 receptor accessory protein 1), rtmrap2 (rainbow trout melanocortin-2 receptor accessory protein 2) or zfmrap1 (zebrafish melanocortin-2 receptor protein 1). The transient transfections were done using a Cell Line Nucleofector Kit (Amaxa Inc., Gaithersburg, MD, USA) with solution T and program U-23. The transfected cells were seeded at a density of 100,000 cells per well in a 96-well plate. Two days after transfection, and after the cells had reach confluency in each well, cells were stimulated with serum-free media only (no hACTH(1–24) or hACTH (1–24) (New England Peptide; Gardiner, MA) in serum-free media (Kaigh’s Modification of Ham’s F12 K media) at concentrations ranging from 10–14 M to 10−6 M (Dores et al., 2016). For the Cd study, CHO cells were treated with 0, 0.1, 10, or 100 nM Cd and stimulated for 4 h at 37 °C in the absence or presence of ACTH (0.1 nM). Note that cells were treated with ACTH and the various concentrations of cadmium for the same amount of time. At the end of the incubation, 100 μl of BrightGlo luciferase assay reagent (Promega, Inc, San Luis Obispo, CA, USA) was applied to each well and incubated for 5 min at room temperature. Luminescence was measured using Bio-Tek Synergy HT plate reader to determine MC2R activity. Luminescence readings were corrected by subtracting the average basal cAMP readings (serum-free media/no ligand) for each transfection dose response curve. All experiments were done in triplicate. The data for each dose response curve were fitted to the Michaelis-Menton equation to obtain EC50 values using Kaleidograph software (www.synergy.com). Data points are expressed as the mean ± SEM (n = 3).
2.9. Statistical analysis All statistical analyses were performed using SigmaPlot 11 software (Systat Software Inc., San Jose, CA, USA) and data are presented as mean ± SEM. Data comparisons for cortisol and transcript levels for in vivo, ex vivo study utilized two-way analysis of variance (ANOVA). Significant differences due to Cd exposure in the CHO cell MC2R/ MRAP1 reporter assay was analyzed using two-way repeated measuresANOVA. Significant differences in head kidney tissue Cd accumulation were assessed using a one-way ANOVA. Significant differences between treatment groups for cortisol and transcripts were compared using Holm-Sidak post hoc test or Student-Newman-Keul’s test for comparison of ranks. The data were transformed wherever necessary to meet the assumption of homogeneity of variance, although non-transformed data are shown in the figures. A probability level of P < 0.05 was considered to be significant. 3. Results 3.1. Cadmium accumulation There was no significant difference in Cd accumulation in the head kidney between the control and 0.75 μg Cd/L treated fish (Fig. 1). There was a significant increase in Cd accumulation in the kidney of fish treated with 2.0 μg Cd/L (0.32 μg/g) compared to the other two groups (Fig. 1). 3.2. In vivo plasma cortisol levels There were no significant differences in plasma cortisol levels between the treatment groups at 7 d post-Cd exposure (0 h). Acute handling disturbance significantly increased plasma cortisol levels at 1 h post-stressor exposure, and the levels were back to pre-stress levels at 4 and 24 h post-stressor exposure in all treatment groups (Fig. 2). In the Cd groups, stressor-induced plasma cortisol elevation at 1 h poststressor exposure was significantly attenuated in a dose-related fashion compared to the controls (˜30% for 0.75 μg/L and ˜64% for 2.0 μg/L Cd; Fig. 2).
2.7. Tissue Cd accumulation Cd concentrations were measured using graphite furnace atomic absorption spectrophotometer (GFAAS; SpectraAA 880 GTA 100 atomizer, Varian, Mississauga, ON, CAN) as previously described (McGeer et al., 2000), and standard curves were validated using certified reference material (TMDA-28.3 and TM 26.3; National Water Research Institute, Burlington, ON, Canada). The concentration of Cd in the head kidney is expressed as μg/g wet weight.
3.3. In vivo head kidney transcript abundance At 7 d exposure (0 h), mc2r mRNA levels were significantly higher by ˜50% and ˜75% in fish exposed to 0.75 μg Cd/L and 2.0 μg Cd/L, respectively, compared to the control fish (Fig. 3A). In response to a secondary stressor, there was a significant time-effect with mc2r transcript levels significantly higher at 1 and 4 h compared to 0 and 24 h post-stressor exposure regardless of treatments (Fig. 3A). However, at 1 h post-stressor exposure, the stressor-induced increase in mc2r transcript abundance seen in the control was completely abolished in both the cadmium groups (Fig. 3A). There was no cadmium effect on mc2r transcript levels at any other time-points post-stressor exposure. At 7 d exposure (0 h), no significant changes were observed in mrap1 mRNA levels in any of the Cd groups with respect to control fish (Fig. 3B). In response to a secondary stressor, there was a time-dependent effect and mrap1 mRNA levels were greater at 1 and 4 h, but
2.8. Gene expression RNA from head kidney was extracted using Ribozol RNA extraction reagent (Amresco, Solon, OH, USA). RNA was DNase treated using manufacturer’s instructions (Fermentas, Pittsburgh, PA, USA). One microgram total RNA was reverse-transcribed with high capacity cDNA reverse transcription kit (Applied Biosystems, Streetsville, ON, CAN). Real-time quantitative PCR (qPCR) was used to measure transcript abundances for mrap1, mrap2 and mc2r in the head kidney. Primer pair sequences, melting temperatures, and amplicon sizes are listed in Table 1. qPCR was performed using iCycler (Bio-Rad, Hercules, CA, 28
Aquatic Toxicology 209 (2019) 26–33
N. Sandhu et al.
Table 1 Primer sequence: Oligonucleotide primers [forward (F) and reverse (R)] for genes encoding melanocortin 2 receptor (mc2r), melanocortin receptor accessory protein (mrap1 and mrap2) and elongation factor 1 alpha (ef1α) used in quantitative real-time PCR along with their melting temperature (Tm; oC) and amplicon size (base pair) and accession number. The gene amplification efficiencies for mc2r, mrap1 and mrap2 were 100%, 125% and 131%, respectively. PRIMER
SEQUENCE
Amplicon Size (bp)
Accession #
Annealing Tm (°C)
mc2r
F: GAGAACCTGTTGGTGGTGGT R: GAGGGAGGAGATGGTGTTGA F: GACGAGCGCAAACTGAAA R: CTGACTGAACGGGACATGAA F: CGGACCCGGACTACAAGTGGA R: GGCCCACCCAGAAGCCTATCA F: CATTGACAAGAGAACCATTGA R: CCTTCAGCTTGTCCAGCAC
105
EU119870
60
116
FR837908
60
111
FR837909
60
95
AF498320
56
mrap1 mrap2 ef1α
respectively, compared to the control group (Fig. 3B). There was no significant effect of Cd exposure or time post-stressor exposure on mrap2 mRNA abundance (Fig. 3C). 3.4. Ex vivo cortisol levels ACTH-stimulated cortisol production was significantly reduced by ˜34% and ˜68% in head kidney slices from fish exposed to 0.75 μg Cd/L and 2.0 μg Cd/L, respectively, compared to control (Fig. 4A). No significant differences in cortisol production were observed between control and Cd-exposed slices stimulated with 8-Bromo-cAMP (Fig. 4A). Head kidney slices stimulated with 8-Bromo-cAMP showed greater cortisol levels than those stimulated with ACTH (Fig. 4A), and the difference in production with 8-Bromo-cAMP was ˜39%, ˜57% and ˜78% greater in the control, 0.75 μg Cd/L and 2.0 μg Cd/L, respectively, compared to each treatment group stimulated with ACTH (Fig. 4A). Fig. 1. Tissue cadmium accumulation: Cd accumulation in head kidney of juvenile rainbow trout exposed to 0, 0.75 or 2.0 μg/L Cd for 7 days. Bars representing mean ± SEM (n = 6). Different letters above bars indicate significant differences between concentrations (P < 0.05; one way ANOVA).
3.5. Ex vivo head kidney transcript abundance The transcript abundance of mc2r in head kidney slices from trout was significantly higher in response to ACTH-stimulation in vitro compared to the sham group (Fig. 4B). This ACTH-stimulated increase in mc2r transcript abundance was completely absent in head kidney slices from both the Cd-treated fish groups (Fig. 4B). The mrap1 transcript abundance also showed a profile similar to that seen with mc2r (Fig. 4C). ACTH-treatment in vitro significantly increased mrap1 mRNA abundance compared to the sham group (Fig. 4C). However, this ACTH-stimulated mrap1 mRNA transcript abundance was completely absent in the head kidney slices from both the Cd-treated groups (Fig. 4C). ACTH-stimulation in vitro did not significantly affect mrap2 mRNA abundance compared to the sham group in head kidney slices from either the control or Cd-treated groups (Fig. 4D). 3.6. Functional activation of MC2R/MRAP1 Rainbow trout MC2R activation of cAMP in CHO cells by ACTH is dependent on MRAP1, but not MRAP2 (Fig. 5A and B). The rainbow trout MC2R activation by ACTH in CHO cells was significantly greater (P = 0.03) when co-transfected with zfmrap1 compared to rtmrap1 (Fig. 5B). For the Cd exposure experiments, we elected to use zfmrap1 instead of rtmrap1 to maximize the activation of rtmc2r. MC2R/MRAP1 expression in CHO cells did not affect the basal activation of cAMP in unstimulated control cells (background levels) exposed to 0, 0.1, 10 or 100 nM Cd (Fig. 5C). The ACTH-stimulated cAMP production was significantly higher with the MC2R/MRAP1 expression in the control CHO cells exposed to 0 nM Cd relative to CHO cells in the absence of ACTH (Fig. 5). Cd exposure significantly inhibited the ACTH-induced cAMP production by ˜42% (0.1 nM), ˜41% (10 nM) and ˜49% (100 nM) compared to control CHO cells (0 nM Cd) stimulated with ACTH (Fig. 5C).
Fig. 2. Cortisol response in vivo: Plasma cortisol from juvenile rainbow trout exposed to 0, 0.75 or 2.0 μg/L Cd after 7 d exposure (0 h) and after 1,4 and 24 h after exposure to a secondary stressor on day 7. Bars represent mean ± SEM (n = 6). Different letters above lines indicate significant differences between time-points (P < 0.05; two-way ANOVA). Different lower case letters indicate significant treatment differences within the time-point (P < 0.05; one-way ANOVA).
not at 24 h after exposure to secondary stressor compared to 0 h samples (Fig. 3B). The stressor-induced significant changes observed in mrap1 mRNA levels at 1 h post-stressor exposure was significantly lower by ˜63% and ˜91% in fish exposed to 0.75 μg Cd/L and 2.0 μg Cd/L, 29
Aquatic Toxicology 209 (2019) 26–33
N. Sandhu et al.
Fig. 3. Transcript abundance in vivo: MC2R (A), MRAP1 (B) and MRAP2 (C) mRNA levels from juvenile rainbow trout exposed to 0, 0.75 or 2.0 μg/L Cd after 7 d exposure (0 h) and after 1,4 and 24 h after exposure to a secondary stressor on day 7. Bars represent mean ± SEM (n = 6). Different letters above lines indicate significant differences between time-points (P < 0.05; two-way ANOVA). Different lower case letters indicate significant treatment differences within the time-point (P < 0.05; one-way ANOVA).
4. Discussion
Fig. 4. Cortisol and transcript response ex vivo: Magnitude of change of cortisol levels (A) and MC2R (B), MRAP1 (C) and MRAP 2 (D) mRNA levels in juvenile rainbow trout head kidney slices exposed to 0, 0.75 or 2.0 μg/L Cd for 7 days in vivo and stimulated with ACTH or 8-Bromo-cAMP in vitro. Cortisol values show changes with respect to ACTH and 8-Bromo-cAMP stimulation, and the values shown are magnitude of change (%) relative to the control (unstimulated head kidney slices). Values represent mean ± SEM (n = 8). Bars or lines with different letters are significant different. Asterisks represent significantly different from the ACTH treatment (P < 0.05; t-test).
This study demonstrates that environmentally realistic levels of Cd impairs the cortisol stress response, and the mode of action involves the disruption of MC2R signaling in rainbow trout. Cortisol, the primary glucocorticoid in teleosts, is produced in response to stressor activation of the HPI axis, and this highly conserved response is important for the metabolic adaptation to stress (Mommsen et al., 1999; Faught et al., 30
Aquatic Toxicology 209 (2019) 26–33
N. Sandhu et al.
Fig. 5. Activation of rtMC2R following co-expression with MRAPs: A) rtmc2r cDNA was either expressed alone in CHO cells or co-expressed with rtmrap1 cDNA. The transfected cells were stimulated with hACTH(1–24) at concentrations ranging from 10−6 to 10-12M. The EC50 value for rtMC2R/rtMRAP1 transfected CHO cells was 1.2 × 10-10M +/- 4.6 × 10-11). B) rtmc2r cDNA was co-expressed in CHO cells with either zfmrap1, rtmrap1 or rtmrap2 cDNA. The transfected cells were stimulated with hACTH(1–24) at concentrations ranging from 10-7 to 10-14M. The EC50 value for rtMC2R/zfMRAP1 transfected CHO cells was 1.3 × 10-11M +/3.3 × 10-12 and for rtMC2R/rtMRAP1 transfected CHO cells was 1.1 × 10-10M +/- 3.6 × 10-11. C) Maximal responses of rtMC2/zfMRAP1 receptor complex expressed in CHO cells exposed to 0, 0.1, 10 or 100 nM of Cd for 4 h in the presence or absence of ACTH (0.1 nM). Values represent mean ± SEM (n = 3). Inset indicates overall stimulant effect between control and ACTH (P < 0.05, two-way repeated measures ANOVA). Lines with different letters above it represent significant differences in ACTH groups between control and Cd treatments (P < 0.05; one-way ANOVA). Asterisks above bar represent significant differences in cell expression with ACTH compared to the control group (P < 0.05; t-test).
31
Aquatic Toxicology 209 (2019) 26–33
N. Sandhu et al.
ACTH signaling, we treated CHO cells transfected with rtmc2r and zfmrap1 with Cd for 4 h either with or without ACTH stimulation in vitro. Although ACTH was able to stimulate cAMP production in the Cdtreated cells, the magnitude of production was reduced by ˜40% in all treatment groups (Fig. 5C). This dose-independent reduction in cAMP production with Cd suggests that the impact of this metal may be at the level of disruption in either ACTH binding to the MC2R and/or trafficking the receptor to the plasma membrane. We propose that Cd may be affecting the translocation of MC2R and this may involve interaction with MRAP1, but further studies are warranted to confirm if this is the mechanism of action in disrupting ACTH signaling. Exposure to environmentally realistic Cd concentrations led to significant accumulation of the metal in the head kidney, which is in agreement with previously reported studies in fish (McGeer et al., 2000; Kwong et al., 2011; McGeer et al., 2011). Interestingly, although the accumulation was evident only at the highest concentration, the toxic effects of this metal were evident even with the lower concentration of waterborne Cd, which showed tissue burden similar to that of the background detected in the control fish kidney (McGeer et al., 2000). While the background levels may be due to feed contamination (McGeer et al., 2000), it has been shown that depending on the tissue accumulation, Cd is partitioned into subcellular compartments, which may modify its toxic effect (Kamunde, 1999). One possible explanation is that perhaps the low level Cd exposure induced changes in the subcellular distribution of Cd within the head kidney without changing overall tissue burden. It is also possible that other physiological impacts of Cd exposure may have induced secondary responses related to corticosteroidogenesis. For example it is well known that disruption in the internal ionic balance of Ca2+ and Na+ occurs as a result of sublethal waterborne Cd exposure (McGeer et al., 2011). While these ideas remains to be studied, the toxic effect on MC2R signaling and cortisol production was clear and head kidney Cd accumulation is not a reliable predictor of its effects on interrenal corticosteroidogenesis. In conclusion, waterborne exposure to very low and environmentally-realistic levels of Cd impairs the highly conserved stress axis function in rainbow trout. Specifically, Cd disrupts the acute stressor-mediated corticosteroid production in vivo, as well as in head kidney slices ex vivo stimulated with ACTH, but not 8-br-cAMP. Our results reveal for the first time that Cd exposure affects mc2r and mrap1 transcript abundance in trout head kidney tissues in vivo. Furthermore, CRE-luciferase reporter assay using rainbow trout MC2R/MRAP in CHO cells showed that Cd dose-independently suppresses the ACTH-induced cAMP production. Taken together, Cd is an adrenotoxicant, inhibiting the stressor-induced cortisol production, and the mode of action involves disruption of MC2R signaling in rainbow trout.
2016). Consequently, disruption of the cortisol stress axis by environmental contaminants, including Cd, may compromise stress coping and predator-avoidance, leading to reduced fitness and survival (Scott et al., 2003; Hontela and Vijayan, 2008; Thomas et al., 2018). Cadmium is an endocrine disruptor (Lizardo-Daudt et al., 2007, 2008; Sandhu and Vijayan, 2011; Sandhu et al., 2014), and several studies have shown disruption of the HPI axis functioning in fishes from metal-contaminated waters (Brodeur et al., 1997; Hontela, 1998; Norris et al., 1999; Laflamme et al., 2000; Gravel et al., 2005). Majority of these studies have focused on the Cd impact on interrenal corticosteroid biosynthetic capacity. Indeed, head kidney tissue pieces or dispersed interrenal cells from either Cd contaminated fish or tissues treated in vitro with the metal showed a reduced capacity for cortisol production in response to ACTH or cAMP analog stimulation (Leblond and Hontela, 1999; Lizardo-Daut et al., 2007; Hontela and Vijayan, 2008; Sandhu and Vijayan, 2011). This was further evident from the present study showing that environmentally realistic levels of Cd disrupt the stimulated cortisol production (Fig. 4A). As seen before in trout, the inhibition of cortisol production by Cd in head kidney slices in vitro was evident only with ACTH, but not dbcAMP stimulation, supporting the proposal that Cd toxicity manifests upstream of cAMP production (Sandhu and Vijayan, 2011). MC2R, a G-protein coupled receptor, is a key target for stressormediated HPI axis regulation, because ACTH binds to this receptor to activate the adenylyl cyclase, leading to cAMP production, which initiates the downstream cascades culminating in cortisol biosynthesis (Aluru and Vijayan, 2008; Dores and Garcia, 2015). It is well documented that MC2R activation requires MRAP, which plays a role in the trafficking of the receptor to the plasma membrane for ACTH activation (Hinkle and Sebag, 2009; Agulleiro et al., 2010; Webb and Clark, 2010; Dores and Garcia, 2015). Indeed, in vitro reporter assays utilizing CHO cells transfected with rainbow trout mc2r reveals that rtMRAP1 is necessary for ACTH stimulation of cAMP production, whereas rtMRAP2 has no effect on this receptor activation (Fig. 5A and B). This is in agreement with previous studies showing that heterologous MRAP1 is required for ACTH-mediated MC2R signaling (Liang et al., 2011; Dores et al., 2016). So, we hypothesized that MRAP dysregulation by Cd may be a mechanism leading to the lack of ACTH sensing in response to secondary stressors in fish. Our results reveal that acute stress transiently upregulates mrap1, but not mrap2 transcript abundance in trout head kidney, and this expression is disrupted by environmental levels of Cd. While acute stress upregulate mc2r transcript abundance in trout (Aluru and Vijayan, 2008), this is the first study to show that mrap1 expression follows the mc2r expression pattern post-stressor expression in vivo, suggesting the tight regulation of these two proteins as essential for acute stressormediated corticosteroidogenesis. Indeed, mutation in MRAP that precludes MC2R functioning leads to glucocorticoid deficiency in humans (Cooray et al., 2008), but this has not been tested in fish. However, Cd exposure for 7 days reduced both mc2r and mrap1, but not mrap2 transcript abundance, and this coincided with an attenuated cortisol performance to stress in trout. This suggests that a mechanism of action of cadmium involves decreasing the sensitivity of the interrenal cells to ACTH stimulation, and this may include either reducing MC2R abundance and/or impacting the intracellular trafficking of the receptor to the plasma membrane mediated by MRAP1. Interestingly, the reduced mc2r and mrap1 transcript abundances in the Cd group with stress evident in vivo was also observed ex vivo in response to ACTH stimulation lending support to the proposal that Cd disrupts ACTH sensing in the interrenal cells of trout. Also, this suggests that ACTH may be playing a direct role in regulating the MC2R and MRAP1 levels during stress in fish. Consequently, in addition to disrupting MC2R signaling, Cd may also be reducing circulating levels of ACTH (Norris et al., 1999), suggesting multiple modes of action of this metal in impairing HPI axis regulation. To further elucidate the mechanisms involved in Cd impact on
Acknowledgements This work was funded by the Natural Sciences and Engineering Research Council of Canada Discovery Grant to MMV (217481-2013RGPIN). We thank Jesse Cunningham for helping with this project and for measuring water and tissue cadmium concentrations. References Agulleiro, M.J., Roy, S., Sanchez, E., Puchol, P., Gallo-Payet, N., Cerda-Reverter, J.M., 2010. Role of melanocortin receptor accessory proteins in the function of zebrafish melanocortin receptor type 2. Mol. Cell. Endocrinol. 320, 145–152. Alsop, D., Ings, J.S., Vijayan, M.M., 2009. Adrenocorticotropic hormone suppresses gonadotropin-stimulated estradiol release from zebrafish ovarian follicles. PLoS One 4 (7), e6463. Aluru, N., Vijayan, M.M., 2008. Molecular characterization, tissue-specific expression and regulation of melanocortin 2 receptor in rainbow trout. Endocrinology 149 (9), 4577–4588. Brodeur, J.C., Sherwood, G., Rasmussen, J.B., Hontela, A., 1997. Impaired cortisol secretion in yellow perch (Perca flavescens) from lakes contaminated by heavy metals: in vivo and in vitro assessment. Can. J. Fish. Aquat. Sci. 54, 2752–2758. Canadian Council of Ministries of the Environment (CCME), 1999. Canadian water quality guidelines for the protection of aquatic life: cadmium. Canadian
32
Aquatic Toxicology 209 (2019) 26–33
N. Sandhu et al.
Leblond, V.S., Hontela, A., 1999. Effects of in vitro exposures to cadmium, mercury, zinc, and 1-(2-chlorophenyl)-1-(4-chlorophenyl)-2,2-dichloroethane on steroidogensis by dispersed interrenal cells of rainbow trout (Oncorhynchus mykiss). Toxicol. Appl. Pharmacol. 157, 16–22. Liang, L., Sebag, J.A., Eagelston, L., Serasinghe, M.N., Veo, K., Reinick, C., Angleson, J., Hinkle, P.M., Dores, R.M., 2011. Functional expression of frog and rainbow trout melanocortin 2 receptors using heterologous MRAP1s. Gen. Comp. Endocrinol. 174, 5–14. Lizardo-Daudt, H.M., Bains, O.S., Singh, C.R., Kennedy, C.J., 2007. Biosynthetic capacity of rainbow trout (Oncorhynchus mykiss) interrenal tissue after cadmium exposure. Arch. Environ. Contam. Toxicol. 52, 90–96. Lizardo-Daudt, H.M., Bains, O.S., Singh, C.R., Kennedy, C.J., 2008. Cadmium chlorideinduced disruption of testicular steroidogenesis in rainbow trout, Oncorhynchus mykiss. Arch. Environ. Contam. Toxicol. 55, 103–110. McGeer, J.C., Szebedinszky, C., McDonald, G.D., Wood, C.M., 2000. Effects of chronic sublethal exposure to waterborne Cu, Cd or Zn in rainbow trout 2: tissue specific metal accumulation. Aquat. Toxicol. 50 (3), 245–256. McGeer, J.C., Niyogi, S., Smith, D.S., 2011. Cadmium. In: Wood, C.M., Farrell, A.P., Brauner, C.J. (Eds.), Homeostasis and Toxicology of Non-Essential Metals, Fish Physiology Vol. 31, Part B. Elsevier, New York, pp. 125–184. Mommsen, T., Vijayan, M.M., Moon, T., 1999. Cortisol in teleosts: dynamics, mechanisms of action, and metabolic regulation. Rev. Fish Biol. Fish. 9, 211–268. Norris, D.O., Donahue, S., Dores, R.M., Lee, J.K., Maldonado, T.A., Ruth, T., Woodling, J.D., 1999. Impaired adrenocortical response to stress by brown trout, Salmo trutta, living in metal-contaminated waters of the Eagle River, Colarado. Gen. Comp. Endocrinol. 113, 1–8. Sandhu, N., Vijayan, M.M., 2011. Cadmium-mediated disruption of cortisol biosynthesis involves suppression of corticosteroidogenic genes in rainbow trout. Aquat. Toxicol. 103 (92), 100. Sandhu, N., McGeer, J.C., Vijayan, M.M., 2014. Exposure to environmental levels of waterborne cadmium impacts corticosteroidogenic and metabolic capacities, and compromises secondary stressor performances in rainbow trout. Aquat. Toxicol. 146, 20–27. Sapolsky, R.M., Romero, L.M., Munck, A.U., 2000. How do glucocorticoids influence stress responses? Integrating permissive, suppressive, stimulatory, and preparative actions. Endocr. Rev. 21, 55–89. Scott, G.R., Sloman, K.A., Rouleau, C., Wood, C.M., 2003. Cadmium disrupts behavioural and physiological responses to alarm substance in juvenile rainbow trout (Oncorhynchus mykiss). J. Exp. Biol. 206, 1779–1790. Thomas, J.K., Birceanu, O., Sadoul, B., Vijayan, M.M., 2018. Bisphenol A in eggs impairs the long-term stress performance of rainbow trout in two generations. Environ. Sci. Technol. 52, 7951–7961. Webb, T.R., Clark, A.J., 2010. Minireview: the melanocortin 2 receptor accessory proteins. Mol. Endocrinol. 24, 475–484. Wendelaar Bonga, S., 1997. The stress response in fish. Physiol. Rev. 77, 591–626.
Environmental Quality Guidelines. Winnipeg, Manitoba. Canadian Environmental Protection Act, 1994. Cadmium and Its Compounds. Environment Canada Health Canada Priority Substances List Assessment Report. Canadian Environmental Protection Act. Chepurny, O.G., Holz, G.G., 2007. A novel cyclic adenosine monophosphate responsive luciferase reporter incorporating a nonpalindromic cyclic adenosine monophosphate response element provides optimal performance for use in G protein coupled receptor drug discovery efforts. J. Biomol. Screen. 12, 740–746. Cooray, S.N., Chan, L., Metherell, L., Storr, H., Calrk, A.J., 2008. Adrenocorticotropin resistance syndromes. Endocr. Dev. 13, 99–116. Dores, R.M., Garcia, Y., 2015. Views on the co-evolution of the melanocortin-2 receptor, MRAPs, and the hypothalamus/pituitary/adrenal-interrenal axis. Mol. Cell. Endocrinol. 408, 12–22. Dores, R.M., Liang, L., Hollmann, R.E., Sandhu, N., Vijayan, M.M., 2016. Identifying the activation motif in the N-terminal of rainbow trout and zebrafish melanocortin-2 receptor accessory protein 1 (MRAP1) orthologs. Gen. Comp. Endocrinol. 234, 117–122. Faught, E., Aluru, N., Vijayan, M.M., 2016. The molecular stress response. In: In: Schreck, C.B., Tort, L., Farrell, A., Brauner, C. (Eds.), Biology of Stress in Fish: Fish Physiology, vol. 35. Elsevier Academic Press, pp. 114–149. Gravel, A., Campbell, G.C., Hontela, A., 2005. Disruption of the hypothalamo-pituitaryinterrenal axis in 1+ yellow perch (Perca flavescens) chronically exposed to metals in the environment. Can. J. Fish. Aquat. Sci. 62, 982–990. Hinkle, P.M., Sebag, J.A., 2009. Structure and function of the melanocortin 2 receptor accessory protein. Mol. Cell. Endocrinol. 300, 25–31. Hontela, A., 1998. Interrenal dysfunction in fish from contaminated sites: in vivo and in vitro assessment. Environ. Toxicol. Chem. 17, 44–48. Hontela, A., Vijayan, M.M., 2008. Adrenocortical toxicology in fishes. In: Harvey, P.W., Everett, D., Springall, C. (Eds.), Adrenal Toxicology. Taylor and Francis, Boca Ration, Fl, pp. 233–256. Kamunde, C., 1999. Early subcellular partitioning of cadmium in gill and liver of rainbow trout (Oncorhynchus mykiss) following low-to-near-lethal waterborne Cd exposure. Aquat. Toxicol. 91 (4), 291–301. Kwong, R.W.M., Andres, J.A., Niyogi, S., 2011. Effects of dietary cadmium exposure on tissue-specific cadmium accumulation, iron status and expression of iron-handling and stress-inducible genes in rainbow trout – influence of elevated dietary iron. Aquat. Toxicol. 102 (1-2), 1–9. Lacroix, A., Hontela, A., 2004. A comparative assessment of the adrenotoxic effects of cadmium in two teleost species, rainbow trout, Oncorhynchus mykiss, and yellow perch, Perca flavescens. Aquat. Toxicol. 67 (1), 13–21. Lacroix, A., Hontela, A., 2006. Role of calcium channels in cadmium-induced disruption of cortisol synthesis in rainbow trout (Oncorhynchus mykiss). Comp. Biochem. Physiol. C Toxicol. Pharmacol. 144 (2), 141–147. Laflamme, J.-S., Couillard, Y., Campbell, P.G.C., Hontela, A., 2000. Interrenal metallothionein and cortisol secretion in relation to Cd, Cu, and Zn exposure in yellow perch, Perca flavescens, from Abitibi lakes. Can. J. Fish. Aquat. Sci. 57, 1692–1700.
33