Calcium-induced apoptosis of developing cerebellar granule neurons depends causally on NGFI-B

Int. J. Devl Neuroscience 55 (2016) 82–90

Contents lists available at ScienceDirect

International Journal of Developmental Neuroscience journal homepage: www.elsevier.com/locate/ijdevneu

Calcium-induced apoptosis of developing cerebellar granule neurons depends causally on NGFI-B Lars Peter Engeset Austdal a , Gro H. Mathisen a , Else Marit Løberg b , Ragnhild E. Paulsen a,∗ a b

Department of Pharmaceutical Biosciences, School of Pharmacy, University of Oslo, Norway Department of Pathology, Oslo University Hospital, Ullevål, Norway

a r t i c l e

i n f o

Article history: Received 28 July 2016 Received in revised form 14 October 2016 Accepted 15 October 2016 Available online 18 October 2016 Keywords: Apoptosis Calcium Cerebellar granule neurons Development NGFI-B Translocation

a b s t r a c t Immediate early gene nerve growth factor-induced clone B (NGFI-B), a nuclear receptor important for differentiation and apoptosis, is expressed in mice and rat cerebellum from an early stage of postnatal development. Following apoptotic stimuli NGFI-B translocates to mitochondria to initiate cell death processes. Controlled cell death is critical for correct cerebellar development. Immunohistochemical analysis of NGFI-B in sections of mice cerebella showed NGFI-B to be expressed in granule neurons in vivo at a time (P8-11) when apoptosis is known to occur. The importance of NGFI-B for apoptosis of cultured rat cerebellar granule neurons was investigated by inducing apoptosis with calcium ionophore A23187 (CaI, 0.1 ␮M). Imaging studies of gfp-tagged NGFI-B confirmed that mitochondrial translocation of NGFIB occurred following treatment with CaI and was reduced by addition of 9-cis-retinoic acid (1 ␮M), a retinoid X receptor (RXR) agonist that prevents dimerization of RXR and NGFI-B that is known to occur before translocation. Consequently, 9-cis-retinoic acid partly reduced cell death. To address the causality of NGFI-B in apoptosis further, knock-down by siRNA was performed and it removed 85% of the NGFI-B protein. This resulted in a complete inhibition of apoptosis after CaI exposure. Together these findings suggest that NGFI-B plays a role in controlling correct cerebellar development. © 2016 ISDN. Published by Elsevier Ltd. All rights reserved.

1. Introduction NGFI-B (nerve growth factor induced clone B) was first identified in rat PC12 cells (Milbrandt, 1988). NGFI-B is also known as NR4A1 in rats, Nur77 in mice and TR3 in human (Maruyama et al., 1998). It is classified as an orphan nuclear receptor as it has no known ligand (Wang et al., 2003). NGFI-B is an immediate early gene induced by several stimuli (Hazel et al., 1988) and acts as a transcription factor (Wilson et al., 1991; Paulsen et al., 1992, 1995). NGFI-B is important for cellular differentiation and critical for neurite outgrowth in PC12 cells (Zhang et al., 2015), and is expressed throughout the brain during development (Bandoh et al., 1997; Watson and Milbrandt, 1990).

Abbreviations: 9cRA, 9-cis-retinoic acid; CaI, calcium ionophore A23187; DIV, day in vitro; gfp, green fluorescent protein; NGFI-B, nerve growth factor-induced clone B; P, postnatal day; RXR, retinoid X receptor; siRNA, short interfering RNA. ∗ Corresponding author at: Department of Pharmaceutical Biosciences, School of Pharmacy, University of Oslo, P.O. Box 1068, Blindern, N-0316 Oslo, Norway. E-mail address: [email protected] (R.E. Paulsen). http://dx.doi.org/10.1016/j.ijdevneu.2016.10.003 0736-5748/© 2016 ISDN. Published by Elsevier Ltd. All rights reserved.

Regulation of cell death is an important mechanism for correct development in vertebrates (Glucksmann, 1951). Neuronal populations often are overproduced and neurons must be removed to allow right synaptic connections (Williams and Herrup, 1988). This is critical for brain structure and function (Kuida et al., 1996), including the developing cerebellum. The cerebellar cortex has a stringent architecture comprised of the external granule layer (EGL), the molecular layer (ML), Purkinje cells, and the internal granule layer (IGL). Granule neurons originate from precursors in the EGL before they migrate to the IGL and finish maturation (Marzban et al., 2014). The formation of granule neurons peaks between postnatal day (P) 8 and 15 in rats (Altman, 1972). NGFI-B is expressed in rat (Bandoh et al., 1997) and mice cerebellum during this period of postnatal development (Watson and Milbrandt, 1990). Cerebellar granule neurons in vitro is an established model to study cell death processes as apoptosis and necrosis (Contestabile, 2002). During necrosis there is swelling of the organelles, acute mitochondrial dysfunction and cellular lysis, and this is an acute and uncontrolled type of cell death (Galluzzi et al., 2012). Apoptosis describes a form of regulated cell death that was first introduced

L.P.E. Austdal et al. / Int. J. Devl Neuroscience 55 (2016) 82–90

by Kerr and is characterized by cellular shrinkage, chromatin condensation, DNA fragmentation and membrane blebbing (Kerr et al., 1972). Generally, apoptosis is dependent on caspase 3 activation. However, a caspase independent version has also been defined (Galluzzi et al., 2012). Apoptosis in the EGL reaches a maximum early in the postnatal mice cerebellum (around P8-9) whereas at later stages (from P11-15) apoptotic cells are only found in the IGL (Wood et al., 1993; Cheng et al., 2011). Results from the human cerebellum suggest similar developmental regulation of apoptosis of cells in the IGL that is associated with differentiation and formation of synaptic connections (Nat et al., 2001). Correct calcium signaling is important for development, migration, and maturation of cerebellar granule neurons (Nakanishi and Okazawa, 2006; Yacubova and Komuro, 2003; Komuro and Kumada, 2005). During development, patterns of spontaneous calcium waves have been recorded in granule neurons in vitro (Apuschkin et al., 2013) and similar oscillations have been discovered in the neocortex (Garaschuk et al., 2000). Such patterns of spontaneous activity may be important for axon guidance (Hanson and Landmesser, 2004). Different routes of calcium influx have been described to fulfil these roles, including NMDA receptors (Lawrie et al., 1993) and 5-HT3 receptors (Ladewig et al., 2004). Calcium influx is also an important initiator of cell death processes as for example seen after NMDA receptor over-activation (Choi, 1985). Calcium ionophore A23187 causes calcium influx and is an established inducer of cell death (Petersen et al., 2000). Calcium is the major regulator of NGFI-B (Woronicz et al., 1995), and transcription has been shown to increase in NMDA-stimulated neurons following raised intracellular calcium (Bading et al., 1995; Mathisen et al., 2011). NGFI-B exerts a crucial role in apoptosis that is independent of gene regulation (Liu et al., 1994). During apoptosis NGFI-B translocates from the nucleus to mitochondria (Li et al., 2000) as a heterodimer with RXR (Cao et al., 2004) where it converts Bcl-2 into an apoptosis inducer that triggers cytochrome c release (Lin et al., 2004) and caspase 3-activation (Li et al., 2000). Overexpression of NGFI-B is associated with increased apoptosis in cancer cells (Chang et al., 2011; Xu et al., 2006). Blocking of RXR to prevent dimerization inhibits mitochondrial translocation of NGFI-B in human prostate cancer cells (Cao et al., 2004). The role of NGFI-B in neuronal apoptosis is less characterized. However, it is established that NGFI-B is expressed in cultured cerebellar granule neurons and translocates to the mitochondria following apoptotic stimuli (Mathisen et al., 2011; Boldingh Debernard et al., 2012). It has also been shown that this translocation can be inhibited by blocking the NGFI-B/RXR heterodimerization with high-affinity RXR-ligand 9-cis-retinoic acid (9cRA), and that this reduces glutamate excitotoxicity (Mathisen et al., 2011). These studies suggest an extensive role of NGFI-B in neuronal apoptosis. The hypothesis of the present study was that NGFI-B is allimportant for executing calcium-induced apoptosis in developing cerebellar granule neurons. To confirm causality siRNA knockdown was performed to reduce cellular NGFI-B level and 9cRA used to block heterodimerization with RXR before calcium ionophore A23187 (0.1 ␮M) was applied to induce apoptosis.

2. Materials and methods 2.1. Reagents Basal Eagle’s medium (BME), fetal bovine serum (FBS), penicillin-streptomycin (PenStrep), Lipofectamine® 2000, Lipofectamine® RNAiMAX, SYBR® Green, High-capacity RNAto-cDNATM , Hoechst 33342, and Pierce® BCA protein assay were acquired from Gibco, Invitrogen, Applied Biosystems and Thermo

83

that now have merged into ThermoFisher (Waltham, US). Goat anti-mouse IgG-HRP, polyacrylamide gels, and nitrocellulose membrane were purchased from Bio-Rad (Hercules, US). Caspase 3 inhibitor z-DEVD-cmk was obtained from Bachem AG (Bubendor, Switzerland). Antibodies targeting NGFI-B were: anti-Nur77 (p15) used for western blots, cat # 3559S from Cell Signaling (Danvers, US) and anti-Nur77 (M210) used for immunohistochemistry, cat # SC5569 from Santa Cruz Biotechnology (Santa Cruz, US). Antibody against ␣-tubulin and secondary antibody donkey-anti-rabbit IgG-HRP were also from Santa Cruz Biotechnology. Luminata Forte and Classico were from Merck Millipore (a part of Merck, Darmstadt, Germany). Calcium ionophore A23187 (cat # C7522, elsewhere in the manuscript abbreviated calcium ionophore or CaI), anti-␤-actin (cat # A5316), and all other reagents were from Sigma-Aldrich (now a part of Merck, Darmstadt, Germany). 2.2. Animals Male wistar albino rats (Rattus norvegicus) were obtained from Charles River (bred in Sulzfeld, Germany) or from Envigo (formerly Harlan, bred in Horst, The Netherlands) and used for preparation of cultured granule neurons. To reduce the number of animals sacrificed for experiments in accordance with the 3R-principle we utilized cerebellar slices from BALB/c mice (from Envigo, bred in Horst, The Netherlands) originating from other studies (Bodin et al., 2013; Mathisen et al., 2013) for histological analysis. The animals were housed at the laboratory animal facility of the Norwegian Institute of Public health until they were decapitated. All experiments were conducted in accordance with the Norwegian Animal Welfare Act and the EU directive 2010/63/EU. 2.3. Histology Cerebella from mice prepared for histology were isolated on P8 or 11 and fixed for at least 24 h in 10% buffered formalin (ChemiTeknik AS, Oslo, Norway) before they were processed for paraffin embedding in a vacuum infiltration tissue processor (Sakura-Tissue Tek VIP). Sections of 3 ␮m were cut from the paraffin-embedded tissue blocks, mounted on SuperFrost® Plus slides, incubated dry for 30–40 min at 56 ◦ C and stored at 4 ◦ C. The sections were then deparaffinised, rehydrated and demasked in a microwave oven for 24 min in TRS (Target Retrieval Solution, pH 6.00–6.20). Anti-Nur77 (1:100) was used as primary antibody and DAKO EnVision HRPsystem (Dako, Glostrup, Denmark) was utilized for visualization using 3,3 -diaminobenzidin as the chromogen. The sections were counterstained with haematoxylin. A Leica DM3000 microscope with a 40× objective was used for the recordings of immunohistochemical findings. 2.4. Cerebellar granule neurons and treatments Cultures of granule neurons were made from rat cerebella isolated on P7 or 8. Preparation of cerebellar granule neurons has been described previously (Gallo et al., 1987; Ciani et al., 1996; Jacobs et al., 2006a). Culture conditions have been optimized in our lab for rat neurons and found to give a higher yield than cultures originating from mice cerebella. Neurons were cultured in BME supplemented with 10% FBS, 2 mM l-glutamine, 25 mM KCl, and PenStrep (100 U/mL–100 ␮g/mL). Cells were seeded at a density of 1.2 × 106 cells/mL onto NuncTM (ThermoFisher, Waltham, US) or MatTek (Ashland, US) dishes that had been pre-coated with poly-l-lysine. After 24 h of incubation (37 ◦ C, 5% CO2 ), cytosine arabinoside (ARA-C, 10 ␮M) was added to cultures to prevent growth of non-neuronal cells. Cultures were treated with calcium ionophore 0.1 ␮M or DMSO (1:100,000). Co-exposure with caspase 3 inhibitor (1 ␮M) was performed 15 min prior to exposure to cal-

84

L.P.E. Austdal et al. / Int. J. Devl Neuroscience 55 (2016) 82–90

Fig. 1. NGFI-B is expressed in granule neurons in the postnatal developing cerebellum. Sections of mice cerebella were made on postnatal day (P) 8 (Fig. 1A) and 11 (Fig. 1B). Tissue sections were stained with anti-NGFI-B (appear brown) and counterstained with haematoxylin (blue) to visualize nuclei. Representative images are shown (obj. ×40). The external granule layer (EGL), the molecular layer (ML), Purkinje cells, and the internal granule layer (IGL) can be identified. Neurons positive for NGFI-B are localized in the EGL, the ML, and the IGL (highlighted with arrows) on both P8 and P11, a critical period for neuronal migration and apoptosis. For further details, please see Section 2. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

cium ionophore. For neurons co-exposed with 9cRA (1 ␮M) this was added 24 h prior or 1–3 h after treatment with calcium ionophore. 2.5. Plasmid transfection Experiments were performed using rat cerebellar granule neurons as sequences for rat protein were available. Neurons were transfected on DIV4 or 5 with plasmids (1 ␮g DNA per mL culture medium) expressing gfp-tagged NGFI-B (NGFI-B-gfp (Jacobs and Paulsen, 2005)) or RXR (RXR-gfp, gift from Dr. Noa Noy, Case Western Reserve University, Ohio) using LipofectamineTM 2000 (6 ␮L per mL culture medium). Plasmids were prepared with Qiagen Plasmid Maxi Kit (Qiagen, Venlo, The Netherlands). Liposome-DNAcomplexes were prepared in BME without serum and incubated at RT for 20 min before dropwise application to cell cultures. After incubation for 5 h (37 ◦ C, 5% CO2 ), medium containing transfection reagent was removed and replaced by preconditioned culture medium. Cell cultures were treated with calcium ionophore or DMSO two days after transfection. 2.6. siRNA transfection Neurons were transfected on DIV2 or 3 with siRNA targeting NGFI-B or with a negative control (scrambled). The Stealth RNAiTM siRNA acquired from Invitrogen (now ThermoFisher) was a set of three duplexes (RSS330510, RSS330511, RSS330512). Initial experiments (not shown) found RSS330511 (Duplex containing sequences GAGACAACGCUUCGUGCCAGCAUUA, UAAUGCUGGCACGAAGCGUUGUCUC) to be most effective and was thus chosen for further studies. Stealth RNAiTM siRNA Negative Control, Medium GC Duplex (cat # 12935300) was chosen as scrambled negative

control. Liposome-siRNA-complexes were prepared by incubating siRNA or negative control (final concentration 120 pmol per mL culture medium) at room temperature for 20 min together with LipofectamineTM RNAiMAX (2 ␮L per mL medium) in BME supplemented only with l-glutamine (2 mM) and KCl (25 mM). The complexes were added dropwise to cell cultures that were incubated for a further 4–6 h (37 ◦ C, 5% CO2 ) before medium was removed and replaced by preconditioned culture medium. 48 h after transfection cells were harvested for western analysis or treated with calcium ionophore or DMSO. 2.7. Western blot analysis Cultures of cerebellar granule neurons were washed twice with ice-cold PBS and harvested in 2% SDS in PBS. To enrich samples with cytosolic proteins and remove nuclear proteins, cells were harvested in 0.25 M sucrose with 100 mM Hepes pH 7.4, centrifuged (3500 rpm, 4 ◦ C, 15 min) before SDS was added to a concentration of 2%. The efficiency of this protocol has been assessed previously (Mathisen et al., 2011). The following protease inhibitors were used: leupeptin (5 ␮g/␮L), pepstatin A (1 ␮g/␮L), PMSF (300 ␮M), and phosphatase inhibitor Na3 VO4 (100 ␮M) as NGFI-B is a phosphoprotein. Homogenization was done with a syringe with a 22G needle and proteases were inactivated by boiling for 5 min. Protein concentration was determined with the Pierce® BCA Protein Assay Kit to ensure equal amount of protein in all samples (50 ␮g/well) before addition of Laemmli buffer and 2-mercaptoethanol (5%). After separation with SDS-PAGE proteins were transferred to a nitrocellulose membrane and unbound sites were blocked with 5% dry skimmed milk in TBS-T (Tris buffered saline with 0.1% Tween20) for a minimum of 1 h. The blots were incubated at 4–8 ◦ C with

L.P.E. Austdal et al. / Int. J. Devl Neuroscience 55 (2016) 82–90

85

Fig. 2. Calcium ionophore induces expression of NGFI-B and translocation of NGFI-B and RXR in cerebellar granule neurons. Cultured granule neurons isolated from rat cerebella at P7 or 8 were treated with calcium ionophore (CaI, 0.1 ␮M) on DIV6-7 and mRNA expression of NGFI-B was measured 30 m, 1 h, 2 h and 3 h after exposure (Fig. 2A). The level of NGFI-B protein in cytosolic enriched fractions from whole cell lysate 2 h after treatment with CaI was determined by Western analysis. Relative protein level adjusted to internal standard (␣-tubulin) was calculated (normalized to untreated) and is presented together with one representative blot (Fig. 2B). Neurons were transfected with plasmids expressing gfp-tagged NGFI-B (NGFI-Bgfp) or RXR (RXRgfp) 48 h prior to treatment with CaI (0.1 ␮M) and co-stained with Hoechst 33342 (0.1 ␮g/mL, 30 min). Localization of gfp-tagged NGFI-B and RXR was tracked by confocal

86

L.P.E. Austdal et al. / Int. J. Devl Neuroscience 55 (2016) 82–90

antibodies against Nur77 (1:100) for 24 h before three wash cycles with TBS-T, incubation at room temperature with a secondary antibody conjugated with HRP (1:10,000), and a further three wash cycles with TBS-T. Similarly, blots were probed with antibodies against internal standard. Anti-␤-actin (1:5000) was used for whole cell lysates. For samples enriched with cytosolic proteins anti-␣tubulin (1:1000) was chosen as we have used this antibody when validating the efficiency of protein enrichment in such samples previously (Mathisen et al., 2011). Immunoreactive proteins were visualized with a HRP substrate through the use of a gel doc system (Syngene, Cambridge, UK). Quantification was performed in ImageJ. 2.8. RT-qPCR RNA was isolated from cerebellar granule neurons on DIV67 after treatment with calcium ionophore. According to the manufacturers” protocols, RNA was isolated with the RNeasy kit (Qiagen, Venlo, The Netherlands) and cDNA was prepared by reverse transcription with the High-capacity RNA-to-cDNATM kit (Applied Biosystems, now ThermoFisher). Primers for NGFIB were designed using Primer Express (Applied Biosystems): F: CATCTTCTTCCTCGTCCTCG; R: AACTGCTCAGTCCATACCCG. ␤-actin was chosen as house-keeping control (F: GATGACGATATCGCTGCGCTC; R: GTCAGGATGCCT). DNA expression was measured with SYBR® Green (Applied Biosystems) using an ABI PRISM 7000 Detection System (Applied Biosystems). 2.9. Microscopy and measurement of cell death Cells were imaged using a Nikon TE2000-E microscope with a C1 Nikon confocal unit, lasers (408 nm, 488 nm and 543 nm) and detectors (450–535 nm, 515–530 nm and 605–675 nm) and EZ-C1 software. The objective was an oil immersion 40× plan fluor (NA 1.3). Scanning was performed at the horizontal level of the cells where the average diameter of nuclei was at its highest. Images were captured below saturation level and illumination was kept at a minimum to avoid bleaching. For every replicate 4–5 randomly chosen areas containing transfected cells were studied. As cerebellar granule neurons are hard to transfect the average number of cells studied per dish was 25. Images were captured with different channels to detect green (NGFI-Bgfp) and blue fluorescent light (Hoechst). Differential interference contrast (DIC) was utilized to visualize outline of the neurons. Captured images were later analyzed with the EZ-C1 software and overlay images generated. These were then carefully analyzed. Neurons that showed green staining outside of the blue stained nucleus were considered to have cytosolic NGFI-Bgfp. The average of three technical replicates (sister dishes) was regarded as one independent value. Cell death was assessed 24 h after treatment with calcium ionophore or DMSO by the trypan blue exclusion method (0.2% trypan blue, 30 min incubation). Cells were counted in 4 randomly chosen areas per culture dish with an approximate number of 100 neurons per area. This method is considered the gold standard for cell death measurement in neuronal cultures as morphology (as apoptotic cells) and cell type can be visually inspected to ascertain that only granule neurons are counted. The reliability of this method in cerebellar granule neurons has been validated by our lab previously (Aden et al., 2008).

2.10. Statistical analysis SigmaPlot software from Systat Software Inc. was used for statistical analysis. Means are given with standard error and a value of p < 0.05 was considered significant. When normalization was performed values were calculated as ratios relative to the control for each experiment, either to a single value for experiments paired with one control (Fig. 2B and G) or to the average of control samples for experiments that included several controls to get an estimate of variation within the control group. Differences between two groups were tested with Student’s t-test for data that passed the normality test or with Mann-Whitney Rank sum test for data that did not follow Gaussian distribution. Differences between several groups were tested with one-way ANOVA (analysis of variance) followed by Dunn’s or Tukey’s post hoc tests. 3. Results 3.1. Granule neurons in the developing cerebellum express NGFI-B during migration Immunohistochemistry was applied to evaluate if NGFI-B was expressed in cerebellar granule neurons during development. Staining of sections from mice isolated on postnatal day (P) 8 (Fig. 1A) and P11 (Fig. 1B) showed that NGFI-B was present in many, but not all neurons both in the external granule layer (EGL) and the internal granule layer (IGL) in the period when migration and apoptosis are known to peak. As apoptotic cells are cleared immediately they are difficult to study in isolated whole tissue sections. Previous studies have shown that the number of caspase 3 positive granule neurons in the IGL at a given time is as low as 0.2% (Aden et al., 2008). To further address the mechanisms behind apoptosis, the remaining experiments were thus performed in cultured granule neurons. 3.2. Calcium ionophore increases NGFI-B expression and induces translocation of NGFI-B from the nucleus in cerebellar granule neurons NGFI-B has a short half-life of 30 min and it has previously been shown in PC12 cells that it can be induced by calcium ionophore (Fahrner et al., 1990). In cerebellar granule neurons expression of NGFI-B mRNA increased within 1 h after exposure to calcium ionophore and continued to increase until 2 h after exposure (Fig. 2A). As NGFI-B translocates from the nucleus following apoptotic stimuli, the level of NGFI-B in samples enriched in cytosolic proteins after exposure was examined to investigate if a similar translocation took place in the present study. Calcium ionophore 0.1 ␮M caused a significant increase in this level after 2 h (Fig. 2B). Cerebellar granule neurons were transfected to overexpress gfp-tagged NGFI-B, and fluorescence confocal microscopy of this protein was applied to further assess translocation following exposure to calcium ionophore. Live imaging 1–9 h after treatment revealed NGFI-B-gfp to be constricted to the nucleus in non-treated cells but could be detected in the cytosol and neurites in a part of the CaI treated cells (Fig. 2C). Translocated NGFI-B remained cytosolic and the percentage of cells where translocation had occurred was calculated. The number of cells with

microscopy imaging 1–9 h after initiation of treatment. Differential interference contrast (DIC) was utilized to visualize outline of the neurons. Nuclear localization was characterized by complete overlay of Hoechst and gfp. Neurons with cytosolic protein were identified by a rim encircling the Hoechst-stained nucleus. This is highlighted with an arrow. The percentage of neurons with cytosolic protein in untreated and CaI-exposed neurons was calculated. Representative images together with calculated values are given for NGFI-Bgfp (Fig. 2C and D) and RXRgfp (Fig. 2E and F). 9-cis-retinoid-acid (9cRA, 1 ␮M) was added 24 h before or 1–2 h after exposure to CaI and the relative number of neurons with cytosolic NGFI-Bgfp was determined (normalized to CaI-treated) (Fig. 2G). Data are given as means with SEM (A: n = 3, B: n = 4, D: n = 4–6, F: n = 8–9, G: n = 3–5). Data are compared pairwise with Mann-Whitney Rank Sum Test (B) or t-test (D and F). Multiple groups were analyzed using One Way ANOVA on Ranks followed by Dunn’s post hoc test (G). *p < 0.05.

L.P.E. Austdal et al. / Int. J. Devl Neuroscience 55 (2016) 82–90

Fig. 3. NGFI-B in cultured cerebellar granule neurons can efficiently be knocked down by siRNA. Cultures of granule neurons were made from rat cerebella isolated on postnatal day 7 or 8. On DIV2 or 3 neurons were transfected with siRNA targeting NGFI-B or with negative control, or left untreated. Cells were harvested 48 h after transfection and the level of NGFI-B protein in the neuronal cultures was assessed with Western analysis. For further details, please see Section 2. A representative blot is shown (Fig. 3A). Bands were quantified, protein level was adjusted to internal standard, and relative values (to non-transfected neurons) were calculated (Fig. 3B). Means are given with SEM (n = 4–5), data are compared pairwise with Mann-Whitney Rank Sum Test, and *p < 0.05.

cytosolic NGFI-Bgfp increased significantly after exposure to CaI (Fig. 2D). Similar results were obtained with RXR-gfp, which also translocated in ionophore-treated neurons (Fig. 2E and F). It has previously been shown that solvent DMSO exerts no such effects on translocation (Boldingh Debernard et al., 2012). A comparison using a gfp-plasmid showed that gfp did not translocate (data not included). As NGFI-B forms a dimer with RXR it was tested if RXR ligand 9-cis-retinoic acid (9cRA) 1 ␮M could inhibit translocation after treatment with calcium ionophore. We have previously reported that this was possible after exposure to glutamate (Mathisen et al., 2011). Preconditioning with 9cRA for 24 h or addition within 1 h after initiation of treatment with calcium ionophore reduced the number of neurons with cytosolic NGFI-B-gfp significantly. 9cRA had no effect if added 3 h after exposure to CaI (Fig. 2G). 3.3. siRNA efficiently knocks down NGFI-B in cerebellar granule neurons Western analysis showed that NGFI-B protein was present in cultures of rat cerebellar granule neurons at DIV 4/5 in concordance with former studies (Mathisen et al., 2011). The applied antibody targeting NGFI-B had previously been validated (Mathisen et al., 2011; Strom and Paulsen, 2012) and a positive control was included to identify correct band size (results not included). Three siRNA sequences were tested, and the sequence specified in Section 2 was found to be effective. The level of NGFI-B protein was reduced by 85% compared to negative scrambled control (Fig. 3). 3.4. Calcium ionophore-induced cell death can be inhibited by knock-down of NGFI-B in cerebellar granule neurons Calcium influx has an important role during cerebellar development and is a known trigger of apoptosis. Experiments confirmed

87

that calcium ionophore 0.1 ␮M induced cell death in cultures of cerebellar granule neurons (Fig. 4A). DMSO did not increase cell death in any experiment where it was included. This complies with former studies (Slagsvold et al., 2003) and thus DMSO was not included in every experiment. The extent of cell death varied in primary neurons from different batches and to compare results relative cell death was calculated. To investigate the nature of cell death induced by calcium ionophore in this low concentration, the morphology of trypan blue stained cells was studied and found to be consistent with apoptotic cells (results not shown). Additionally, a caspase 3 inhibitor could partly block the increase in cell death caused by calcium ionophore (Fig. 4B). 9cRA decreased translocation of NGFI-B after exposure to calcium ionophore and has previously been utilized to reduce apoptotic cell death after glutamate exposure in cerebellar granule neurons (Mathisen et al., 2011). It was thus applied as a pharmacological tool to explore if NGFI-B is important in cell death processes initiated by calcium ionophore. Pretreatment with 9cRA for 24 h or addition one or two hours after exposure to calcium ionophore reduced cell death significantly, but not completely (Fig. 4C). These results suggested an important role of NGFI-B. As knock-down by siRNA was confirmed by western analysis to be effective, this method was employed to more firmly establish a causal link between NGFI-B and calcium induced cell death. Transfection was performed 48 h before exposure of cell cultures for 24 h. A criterion for including experiments for data analysis was that calcium ionophore 0.1 ␮M induced death in cultures transfected with negative control plasmid. Knock-down of NGFI-B abolished the induction of cell death normally seen after exposure to calcium ionophore (Fig. 4D). This confirmed NGFI-B’s crucial role in executing cell death processes in cerebellar granule neurons.

4. Discussion Previous studies have underlined a role of NGFI-B during apoptosis of cerebellar granule neurons (Mathisen et al., 2011; Jacobs et al., 2004). It has been established that NGFI-B translocates to the mitochondria as a heterodimer with RXR in these neurons following apoptotic triggers and that targeting this translocation by blocking RXR with 9cRA can reduce cell death following exposure to glutamate, a well-known inducer of cell death through calcium influx of the NMDA receptor (Mathisen et al., 2011; Jacobs et al., 2004). However, the present study is the first to investigate if apoptosis is firmly dependent on recruitment of NGFI-B using siRNA knock-down to provide a causal link. The nature of cell death caused by calcium ionophore A23187 has been a subject of discussion as pointed out by Petersen et al. (2000). They detected massive cell death in cultured striatal neurons exposed to 0.5–4 ␮M calcium ionophore, but even after a lower dose of 0.1 ␮M a combination of apoptosis and necrosis occurred. In PC12-cells (Takadera and Ohyashiki, 1997) and cortical neurons (Gwag et al., 1999) 0.1 ␮M of calcium ionophore induced apoptosis whereas necrosis dominated at higher concentrations (>1 ␮M). We have previously applied 1 ␮M CaI to induce necrosis in cerebellar granule neurons (Slagsvold et al., 2003). As necrosis does not depend on translocation of NGFI-B, we chose 0.1 ␮M as the appropriate dose in the present study. According to our experience 0.1 ␮M calcium ionophore is not a strong inducer and in some experiments failed to initiate cell death. These experiments were then excluded. We have previously confirmed that other apoptotic stimuli to cerebellar granule neurons cause translocation of NGFIB by using both immunostaining techniques (Jacobs et al., 2006b) and live cell imaging with gfp-tagged proteins as was chosen in the present study (Mathisen et al., 2011). In these neuronal cultures 1 ␮M calcium ionophore increases expression and induces translo-

88

L.P.E. Austdal et al. / Int. J. Devl Neuroscience 55 (2016) 82–90

Fig. 4. Inhibiting NGFI-B prevents calcium-induced cell death in cerebellar granule neurons. Granule neurons were isolated from rat cerebella at P7 or 8 and cultured in vitro. At DIV4-6 neurons were exposed to calcium ionophore (CaI, 0.1 ␮M) or DMSO (1:100,000) for 24 h before cell death was assessed by trypan blue exclusion. CaI increased cell death significantly, but DMSO had no effect on cell death (Fig. 4A). Relative cell death was calculated. Co-exposure with the caspase 3 inhibitor z-DEVD-cmk (1 ␮M) 15 min prior to exposure to CaI caused a significantly reduced cell death (Fig. 4B), indicating that these processes are apoptotic in nature. Concomitant exposure to RXR ligand 9-cis-retinoic-acid (9cRA) significantly reduced cell death if given 24 h prior or up to 2 h after initiation of treatment with calcium ionophore (Fig. 4C). Transfection with siRNA against NGFI-B or with negative scrambled control was performed 48 h before treatment with CaI or DMSO. For further details, please see Section 2. Knock-down of NGFI-B abolished the CaI-induced increase in cell death (Fig. 4D). Please note the differences in scale of the vertical axis. Means are given with SEM (A: n = 3–11, B: n = 6–8, C: n = 4–7, D: n = 9–12). Data are compared with One Way Anova followed by pairwise comparisons using Tukey’s post hoc test and p < 0.05 is denoted with *.

cation of NGFI-B (Boldingh Debernard et al., 2012). However, as this dose was not suited for the present study, it was necessary to confirm that 0.1 ␮M calcium ionophore could recruit NGFI-B similarly as seen after exposure to validated apoptotic stimuli, such as glutamate (Mathisen et al., 2011). Expression of NGFI-B mRNA and cytosolic protein increased within 2 h after exposure to 0.1 ␮M calcium ionophore. This exposure led to translocation of RXR and NGFI-B from the nucleus and could be arrested by RXR-ligand 9cRA within 1 h after initiation of treatment. As translocation of NGFI-B is followed by conversion of Bcl-2 and cytochrome c release (Lin et al., 2004), it was expected that exposure to CaI 0.1 ␮M would lead to caspase 3 activation, and the observed cell death could be inhibited with a caspase 3 inhibitor. Thus, the preceding molecular mechanisms before cell death are consistent with previous findings and calcium ionophore could be used as an apoptosis inducer to further study the role of NGFI-B. NGFI-B is rapidly induced after stimuli (Watson and Milbrandt, 1989) and has a short half-life (Strom and Paulsen, 2012) which makes it a suitable candidate to target with siRNA. To provide

reliable results this depends on high transfection efficiency. Experiments in human embryonic stem cells indicate that Lipofectamine RNAiMAX provides excellent efficiency with knock-down of 90% (Zhao et al., 2008). Primary neurons are hard to transfect, but we detected a reduction in NGFI-B protein in the same range. When knock-down is not total there is a possibility that remaining protein can exert NGFI-Bs functions. However, results from primary Schwann cells and PC12-cells treated with siRNA showed that reduction of a similar magnitude (>50%) was able to block differentiation and neurite outgrowth (Zhang et al., 2015). siRNA may cause toxicity to cells, especially through immune responses (Yang et al., 2014; Robbins et al., 2009). Comparison was thus made with cells transfected with a negative control but the siRNA transfection caused no toxicity. Pharmacological interference of NGFI-B translocation with 9cRA translated to a significantly reduced cell death after exposure to calcium ionophore. Exposure > 2 h after calcium ionophore was unable to prevent translocation and, consequently, had no impact on cell death. On the other hand, knock-down of NGFI-B with siRNA was able to inhibit calcium ionophore induced

L.P.E. Austdal et al. / Int. J. Devl Neuroscience 55 (2016) 82–90

cell death completely. The causality of NGFI-B in apoptosis has been demonstrated using siRNA in a human lung cancer cell line (Li et al., 1998). However, this is the first time this has been performed in cerebellar neurons. Expression studies have established that NGFI-B is present in the rat and mouse whole cerebellum (Watson and Milbrandt, 1990; Saucedo-Cardenas and Conneely, 1996). We had sections of mice cerebellum whereas rat cerebellar granule neurons were deemed optimal for in vitro studies due to higher yield of cultured neurons and plasmid availability. However, cerebellar development in mice closely resembles that in rats with the formation of granule neurons peaking in the same postnatal period (Altman, 1972; Fujita et al., 1966). The level of NGFI-B increases over time and is higher in the adult cerebellum. Significant levels are not seen before P7 in rats (Watson and Milbrandt, 1990) and in adult rats NGFI-B is only found in the Purkinje cell layer and deeper cerebellar nuclei (Xiao et al., 1996). Apoptosis associated with DNA fragmentation is seen in mice cerebellum from P5 (Wood et al., 1993) before NGFIB is significantly expressed. Apoptosis was early believed to occur predominantly in precursors in the EGL (Tanaka and Marunouchi, 1998), but is important in the IGL and peaks at P9 in mice cerebellum (Cheng et al., 2011). Cerebellar granule neurons in vitro have sufficiently high NGFI-B for it to take part in execution of apoptosis (Jacobs et al., 2004). Additionally, cell death mechanisms in cultured rat and mouse neurons show the same characteristics (results not shown). However, an in vitro artefact is that cerebellar granule neurons acquire IGL-like properties in culture (Manzini et al., 2006). As the studies of NGFI-B during early cerebellar development have not determined cell-type specific expression it was important to assess that NGFI-B was present in granule neurons from P8-11, a period where apoptosis in the IGL is especially significant. It has been suggested that several different apoptotic pathways are activated at different stages in granule neurons. A FAS receptor has been identified (Nat et al., 2001), and a study showed that apoptosis of precursors and pre-migratory cells occurs in the absence of caspase 3 cleavage whereas death of post-migratory neurons is linked to caspase 3 activation (Lossi et al., 2004). A hypothesis can then be stated that NGFI-B is more involved in apoptosis in the IGL than in the EGL. The overlap between NGFI-B expression and occurrence of IGL apoptosis, the established role of NGFI-B in in vitro neurons that resemble IGL-like cells and a link to caspase 3 activation support this theory. Further, in the cerebellum of 3 months old mice NGFI-B is not expressed in granule neurons (Xiao et al., 1996) and apoptosis has ceased (Altman, 1972). As NGFI-B is critical for apoptosis after calcium influx and expressed in granule neurons at a time when apoptosis is important and transient calcium waves are known to occur, we postulate a function of NGFI-B in cerebellar development. That NGFI-B remains highly expressed in other parts of the cerebellum towards adulthood indicates that transcriptional effects of NGFI-B are important in the mature brain as well as during development. However, this continued presence of NGFI-B can contribute to a pathologically increased apoptosis in conditions with an altered calcium level, such as neuroinflammation (Fairless et al., 2014), e.g. during meningitis, or after excess NMDA or 5-HT3 activation, both in the developing and adult brain. In conclusion, the present work has demonstrated that NGFI-B is causally involved in apoptosis induced by calcium influx in IGL-like granule neurons, and that further work is warranted to understand its role during physiological and pathological apoptosis.

Conflicts of interest The authors of the manuscript have no conflicts of interest to declare.

89

Acknowledgments The authors want to thank Mona Gaarder and Ingeborg Goverud for expert technical assistance and Dr. Vivi Ann Flørenes, Oslo University Hospital, for scientific advice. Financial support from the Norwegian Research Council (Grant 195484 to R.E.P. and G.H.M.) and The Anders Jahre Foundation is gratefully acknowledged.

References Aden, P., et al., 2008. Low-potency glucocorticoid hydrocortisone has similar neurotoxic effects as high-potency glucocorticoid dexamethasone on neurons in the immature chicken cerebellum. Brain Res. 1236, 39–48. Altman, J., 1972. Postnatal development of the cerebellar cortex in the rat. 3. Maturation of the components of the granular layer. J. Comp. Neurol. 145 (4), 465–513. Apuschkin, M., Ougaard, M., Rekling, J.C., 2013. Spontaneous calcium waves in granule cells in cerebellar slice cultures. Neurosci. Lett. 553, 78–83. Bading, H., et al., 1995. N-Methyl-D-aspartate receptors are critical for mediating the effects of glutamate on intracellular calcium concentration and immediate early gene expression in cultured hippocampal neurons. Neuroscience 64 (3), 653–664. Bandoh, S., et al., 1997. Differential expression of NGFI-B and RNR-1 genes in various tissues and developing brain of the rat: comparative study by quantitative reverse transcription-polymerase chain reaction. J. Neuroendocrinol. 9 (1), 3–8. Bodin, J., et al., 2013. Long-term bisphenol A exposure accelerates insulitis development in diabetes-prone NOD mice. Immunopharmacol. Immunotoxicol. 35 (3), 349–358. Boldingh Debernard, K.A., Mathisen, G.H., Paulsen, R.E., 2012. Differences in NGFI-B, Nurr1, and NOR-1 expression and nucleocytoplasmic translocation in glutamate-treated neurons. Neurochem. Int. 61 (1), 79–88. Cao, X., et al., 2004. Retinoid X receptor regulates Nur77/TR3-dependent apoptosis [corrected] by modulating its nuclear export and mitochondrial targeting. Mol. Cell. Biol. 24 (22), 9705–9725. Chang, L.F., et al., 2011. Overexpression of the orphan receptor Nur77 and its translocation induced by PCH4 may inhibit malignant glioma cell growth and induce cell apoptosis. J. Surg. Oncol. 103 (5), 442–450. Cheng, X.S., et al., 2011. Neuronal apoptosis in the developing cerebellum. Anat. Histol. Embryol. 40 (1), 21–27. Choi, D.W., 1985. Glutamate neurotoxicity in cortical cell culture is calcium dependent. Neurosci. Lett. 58 (3), 293–297. Ciani, E., et al., 1996. Inhibition of free radical production or free radical scavenging protects from the excitotoxic cell death mediated by glutamate in cultures of cerebellar granule neurons. Brain Res. 728 (1), 1–6. Contestabile, A., 2002. Cerebellar granule cells as a model to study mechanisms of neuronal apoptosis or survival in vivo and in vitro. Cerebellum 1 (1), 41–55. Fahrner, T.J., Carroll, S.L., Milbrandt, J., 1990. The NGFI-B protein, an inducible member of the thyroid/steroid receptor family, is rapidly modified posttranslationally. Mol. Cell. Biol. 10 (12), 6454–6459. Fairless, R., Williams, S.K., Diem, R., 2014. Dysfunction of neuronal calcium signalling in neuroinflammation and neurodegeneration. Cell Tissue Res. 357 (2), 455–462. Fujita, S., Shimada, M., Nakamura, T., 1966. H3-thymidine autoradiographic studies on the cell proliferation and differentiation in the external and the internal granular layers of the mouse cerebellum. J. Comp. Neurol. 128 (2), 191–208. Gallo, V., et al., 1987. The role of depolarization in the survival and differentiation of cerebellar granule cells in culture. J. Neurosci. 7 (7), 2203–2213. Galluzzi, L., et al., 2012. Molecular definitions of cell death subroutines: recommendations of the Nomenclature Committee on Cell Death 2012. Cell Death Differ. 19 (1), 107–120. Garaschuk, O., et al., 2000. Large-scale oscillatory calcium waves in the immature cortex. Nat. Neurosci. 3 (5), 452–459. Glucksmann, A., 1951. Cell deaths in normal vertebrate ontogeny. Biol. Rev. Camb. Philos. Soc. 26 (1), 59–86. Gwag, B.J., et al., 1999. Calcium ionophores can induce either apoptosis or necrosis in cultured cortical neurons. Neuroscience 90 (4), 1339–1348. Hanson, M.G., Landmesser, L.T., 2004. Normal patterns of spontaneous activity are required for correct motor axon guidance and the expression of specific guidance molecules. Neuron 43 (5), 687–701. Hazel, T.G., Nathans, D., Lau, L.F., 1988. A gene inducible by serum growth factors encodes a member of the steroid and thyroid hormone receptor superfamily. Proc. Natl. Acad. Sci. U. S. A. 85 (22), 8444–8448. Jacobs, C.M., Paulsen, R.E., 2005. Crosstalk between ERK2 and RXR regulates nuclear import of transcription factor NGFI-B. Biochem. Biophys. Res. Commun. 336 (2), 646–652. Jacobs, C.M., et al., 2004. ERK2 prohibits apoptosis-induced subcellular translocation of orphan nuclear receptor NGFI-B/TR3. J. Biol. Chem. 279 (48), 50097–50101. Jacobs, C.M., et al., 2006a. Chicken cerebellar granule neurons rapidly develop excitotoxicity in culture. J. Neurosci. Methods 156 (1–2), 129–135.

90

L.P.E. Austdal et al. / Int. J. Devl Neuroscience 55 (2016) 82–90

Jacobs, C.M., et al., 2006b. Dexamethasone induces cell death which may be blocked by NMDA receptor antagonists but is insensitive to Mg2+ in cerebellar granule neurons. Brain Res. 1070 (1), 116–123. Kerr, J.F., Wyllie, A.H., Currie, A.R., 1972. Apoptosis: a basic biological phenomenon with wide-ranging implications in tissue kinetics. Br. J. Cancer 26 (4), 239–257. Komuro, H., Kumada, T., 2005. Ca2+ transients control CNS neuronal migration. Cell Calcium 37 (5), 387–393. Kuida, K., et al., 1996. Decreased apoptosis in the brain and premature lethality in CPP32-deficient mice. Nature 384 (6607), 368–372. Ladewig, T., Lalley, P.M., Keller, B.U., 2004. Serotonergic modulation of intracellular calcium dynamics in neonatal hypoglossal motoneurons from mouse. Brain Res. 1001 (1–2), 1–12. Lawrie, A.M., et al., 1993. Synchronous calcium oscillations in cerebellar granule cells in culture mediated by NMDA receptors. Neuroreport 4 (5), 539–542. Li, Y., et al., 1998. Molecular determinants of AHPN (CD437)-induced growth arrest and apoptosis in human lung cancer cell lines. Mol. Cell. Biol. 18 (8), 4719–4731. Li, H., et al., 2000. Cytochrome c release and apoptosis induced by mitochondrial targeting of nuclear orphan receptor TR3. Science 289 (5482), 1159–1164. Lin, B., et al., 2004. Conversion of Bcl-2 from protector to killer by interaction with nuclear orphan receptor Nur77/TR3. Cell 116 (4), 527–540. Liu, Z.G., et al., 1994. Apoptotic signals delivered through the T-cell receptor of a T-cell hybrid require the immediate-early gene nur77. Nature 367 (6460), 281–284. Lossi, L., Tamagno, I., Merighi, A., 2004. Molecular morphology of neuronal apoptosis: analysis of caspase 3 activation during postnatal development of mouse cerebellar cortex. J. Mol. Histol. 35 (6), 621–629. Manzini, M.C., et al., 2006. The stop signal revised: immature cerebellar granule neurons in the external germinal layer arrest pontine mossy fiber growth. J. Neurosci. 26 (22), 6040–6051. Maruyama, K., et al., 1998. The NGFI-B subfamily of the nuclear receptor superfamily (review). Int. J. Oncol. 12 (6), 1237–1243. Marzban, H., et al., 2014. Cellular commitment in the developing cerebellum. Front. Cell. Neurosci. 8, 450. Mathisen, G.H., et al., 2011. Delayed translocation of NGFI-B/RXR in glutamate stimulated neurons allows late protection by 9-cis retinoic acid. Biochem. Biophys. Res. Commun. 414 (1), 90–95. Mathisen, G.H., et al., 2013. Prenatal exposure to bisphenol A interferes with the development of cerebellar granule neurons in mice and chicken. Int. J. Dev. Neurosci. 31 (8), 762–769. Milbrandt, J., 1988. Nerve growth factor induces a gene homologous to the glucocorticoid receptor gene. Neuron 1 (3), 183–188. Nakanishi, S., Okazawa, M., 2006. Membrane potential-regulated Ca2+ signalling in development and maturation of mammalian cerebellar granule cells. J. Physiol. 575 (Pt. 2), 389–395. Nat, R., et al., 2001. Apoptosis in human embryo development: 2. Cerebellum. J. Cell. Mol. Med. 5 (2), 179–187. Paulsen, R.E., et al., 1992. Domains regulating transcriptional activity of the inducible orphan receptor NGFI-B. J. Biol. Chem. 267 (23), 16491–16496. Paulsen, R.F., et al., 1995. Three related brain nuclear receptors, NGFI-B, Nurr1, and NOR-1, as transcriptional activators. J. Mol. Neurosci. 6 (4), 249–255. Petersen, A., et al., 2000. Oxidative stress, mitochondrial permeability transition and activation of caspases in calcium ionophore A23187-induced death of cultured striatal neurons. Brain Res. 857 (1–2), 20–29.

Robbins, M., Judge, A., MacLachlan, I., 2009. siRNA and innate immunity. Oligonucleotides 19 (2), 89–102. Saucedo-Cardenas, O., Conneely, O.M., 1996. Comparative distribution of NURR1 and NUR77 nuclear receptors in the mouse central nervous system. J. Mol. Neurosci. 7 (1), 51–63. Slagsvold, H.H., et al., 2003. High molecular weight DNA fragments are processed by caspase sensitive or caspase independent pathways in cultures of cerebellar granule neurons. Brain Res. 984 (1–2), 111–121. Strom, B.O., Paulsen, R.E., 2012. Apoptosis inducer NGFI-B is degraded by the proteasome and stabilized by treatment with EGF. Biochem. Biophys. Res. Commun. 417 (4), 1292–1297. Takadera, T., Ohyashiki, T., 1997. Apoptotic cell death and caspase 3 (CPP32) activation induced by calcium ionophore at low concentrations and their prevention by nerve growth factor in PC12 cells. Eur. J. Biochem. 249 (1), 8–12. Tanaka, M., Marunouchi, T., 1998. Immunohistochemical analysis of developmental stage of external granular layer neurons which undergo apoptosis in postnatal rat cerebellum. Neurosci. Lett. 242 (2), 85–88. Wang, Z., et al., 2003. Structure and function of Nurr1 identifies a class of ligand-independent nuclear receptors. Nature 423 (6939), 555–560. Watson, M.A., Milbrandt, J., 1989. The NGFI-B gene, a transcriptionally inducible member of the steroid receptor gene superfamily: genomic structure and expression in rat brain after seizure induction. Mol. Cell. Biol. 9 (10), 4213–4219. Watson, M.A., Milbrandt, J., 1990. Expression of the nerve growth factor-regulated NGFI-A and NGFI-B genes in the developing rat. Development 110 (1), 173–183. Williams, R.W., Herrup, K., 1988. The control of neuron number. Annu. Rev. Neurosci. 11, 423–453. Wilson, T.E., et al., 1991. Identification of the DNA binding site for NGFI-B by genetic selection in yeast. Science 252 (5010), 1296–1300. Wood, K.A., Dipasquale, B., Youle, R.J., 1993. In situ labeling of granule cells for apoptosis-associated DNA fragmentation reveals different mechanisms of cell loss in developing cerebellum. Neuron 11 (4), 621–632. Woronicz, J.D., et al., 1995. Regulation of the Nur77 orphan steroid receptor in activation-induced apoptosis. Mol. Cell. Biol. 15 (11), 6364–6376. Xiao, Q., Castillo, S.O., Nikodem, V.M., 1996. Distribution of messenger RNAs for the orphan nuclear receptors Nurr1 and Nur77 (NGFI-B) in adult rat brain using in situ hybridization. Neuroscience 75 (1), 221–230. Xu, J.H., et al., 2006. Gene expression profile and overexpression of apoptosis-related genes (NGFI-B and Gadd 45 gamma) in early phase of Thy-1 nephritis model. Cell Tissue Res. 326 (1), 159–168. Yacubova, E., Komuro, H., 2003. Cellular and molecular mechanisms of cerebellar granule cell migration. Cell Biochem. Biophys. 37 (3), 213–234. Yang, H.Y., et al., 2014. Cell type and transfection reagent-dependent effects on viability, cell content, cell cycle and inflammation of RNAi in human primary mesenchymal cells. Eur. J. Pharm. Sci. 53, 35–44. Zhang, W., et al., 2015. Nur77 was essential for neurite outgrowth and involved in schwann cell differentiation after sciatic nerve injury. J. Mol. Neurosci. 57 (1), 38–47. Zhao, M., et al., 2008. Lipofectamine RNAiMAX: an efficient siRNA transfection reagent in human embryonic stem cells. Mol. Biotechnol. 40 (1), 19–26.