- Email: [email protected]
Camptothecin inhibits both the cleavage and religation reactions of eukaryotic DNA topoisomerase I
J. Mol. Biol. (1992) 228, 1025-1030
COMMUNICATIONS
Camptothecin Inhibits Both the Cleavage and Religation Reactions of Eukaryotic DNA Topoisomerase I Eigil Kjeldsen’f, Jesper Q. Svejstrup, Irina I. Gromova Jan Alsner and Ole Westergaardj: University (Received
Department of Molecular Biology of Aarhus, DK-8000 Arhus, C, Denmark 2 June 1992; accepted 18 August
1992)
We investigated
the mode of action of the antitumor drug, camptothecin, by use of a partly double-stranded suicide DNA substrate which enables uncoupling of the cleavage and religation half-reactions of topoisomerase I. The suicide DNA substrate contains a single topoisomerase I site at which SDS cleavage is strongly enhanced by camptothecin on normal double-stranded DNA. The results show that the religation reaction of topoisomerase I per se is strongly inhibited at this site compared to a site that is only marginally affected by camptothecin on double-stranded DNA. This study hereby directly demonstrates that camptothecin-mediated stability of a topoisomerase I-DNA complex is sequence-dependent. The influence of camptothecin on the suicide cleavage reaction of topoisomerase I was also investigated. Surprisingly, the cleavage reaction per se is strongly inhibited by the drug. However, reformation of a cleavable suicide DNA substrate, which is fully double-stranded downstream from the cleavage position except for a nick, completely reverses the inhibitory effect of the drug on the cleavage reaction. The results suggest that the inhibitory effect of camptothecin on cleavage is due to a general decrease in the noncovalent interaction of topoisomerase I with partly double-stranded suicide DNA substrates. Based on the findings, a plausible model for camptothecin action is discussed. Keywords:
camptothecin;
topoisomerase
Camptothecin and several of its more recent derivatives are cytotoxic alkaloids which hold antineoplastic activity due to their specific interaction with eukaryotic DNA topoisomerase I activity (Hsiang et al., 1985; Giovanella et al., 1989). Thus, treatment of cells with camptothecin causes inhibition of DNA and RNA synthesis (Kessel et al., 1972), high frequencies of sister chromatid exchange (Degrassi et al., 1989), and induction of extensive fragmentation of chromosomal DNA (Covey et al., 1989). Topoisomerase I is likely to be the sole cellular target of the drug, as a camptothecin-resistant cell line encodes a drug-resistant topoisomerase I (Andoh et al., 1987), and yeast cells with a disrupted TOP1 gene show none of the physiological effects normally associated with drug treatment (Nitiss & Wang, 1988). On the basis of the in vitro effects of camptothecin 7 Present address: Department of Human Genetics, The Bartholin Building, University of Aarhus, DK-8000 Aarhus, C, Denmark. $ Author to whom all correspondence should be addressed. 0022-2836/92/241025~6
$08.00/O
1025
I; suicide DNA;
cleavage;
religation
on topoisomerase I cleavage of double-stranded DNA fragments, it has been proposed that camptothecin stabilizes the covalent topoisomerase IDNA complex by inhibiting the religation reaction of the enzyme (Hsiang et al., 1985; Kjeldsen et al., 1988a). Recently, we have verified this model by utilizing suicide DNA substrates by which it is possible to investigate the two half-reactions of topoisomerase I separately (Svejstrup et al., 1991). The study was performed with oligonucleotides containing a hexadecameric recognition sequence (site a) which is known to be the preferenti,al site for cleavage (Bonven et al., 1985; Tomsen et aZ., 1987) 1987) and relaxation (Busk et al., by topoisomerase I from various eukaryotes (Christiansen et al., 1987). Topoisomerase I--DNA interaction at site a is only marginally affected by camptothecin (Thomsen et al., 1987; Kjeldsen et al., 1988a), and we have recently shown that the religation reaction, but not the cleavage reaction of topoisomerase I is affected by the drug at this site (Svejstrup et al., 1991). To study further the effects of camptothescin we designed a new suicide substrate based on a typical 0
1992 Academic Press Limited
1026
E. Kjeldsen
- Cleavage - Substrate
B 5’ @j-----
CTTTTTTCATGCACCATTCCTTG Q’-ACGTGGTAAGGAAC
77mer 38mer
‘ii’
t
Figure 1. Topoisomerase I-mediated suicide cleavage of a camptothecin-enhanced site. A, Labeling of the and scissile strand, annealing of oligonucleotides cleavage of the resulting topoisomerase I-mediated suicide DNA substrate was performed as described in Svejstrup et al. (1991). The 3%mer scissile strand had the sequence 5’ GCCTGCAGGTCGACTCTGCCGCCGCAAGGAATGGTGCA 3’, while the 77-mer non-cleaved strand had the sequence 5’ ATTCGAGCTCGGTACCCGGGGATCGATCGTCTTTTTTCATGCACCATTCCTTGCGGCGG CAGAGTCGACCTGCAGGC 3’. Cleavage products were analyzed on a 10% denaturing polyacrylamide gel and visualized by autoradiography as described by Andersen et al. (1989). The cleavage reaction was stopped by addition of SDS to 1 y0 (lane 2) or Nacl to @4 M (lane 3). Lane 1; suicide DNA substrate. The cleavage product migrates slower than the substrate DNA due to covalent attachment of a trypsin-resistant peptide (Svejstrup et al., 1990). B, Schematic illust,ration of the suicide DNA substrate containing a strongly camptothecin-enhanced cleavage site. The arrow denotes the site of cleavage and the asterisk (*) t’he position of the radioactive label. The @ denotes a phosphorylation of the 5’ end of the noncleaved strand made to avoid religation to this end upon enzyme-mediat’ed cleavage.
drug-induced site (site b, depicted in Fig. 1B). In an SDS cleavage assay on double-stranded DNA this site is enhanced approximately 200-fold by camptothecin (Kjeldsen et al., 1988a). In the experiment shown in Figure 1, the suicide substrate was incubated with human DNA topoisomerase I for 30 minutes at 30°C and cleavage stopped by addition of NaCl to 400 mM. Following precipitation and trypsin digestion, the samples were analyzed on a sequencing gel. Topoisomerase I action results in site-specific cleavage at the predicted position (lane 3). Cleavage is suicidal as equal amounts of cleavage are detected when the reaction is stopped by NaCl or SDS (lanes 3 and 2). On normal doublestranded DNA, cleavage is barely detectable at site b in SDS cleavage assays when camptothecin is absent (Kjeldsen et ah, 1988a). The fact that the partly double-stranded suicide substrate is actually
et ai.
cleaved at. the right position in the absence of camptothecin suggests that camptothecin does not act to induce cleavage at this site on normal doublestranded DNA, but rather to slow down a normally very rapid religation reaction at the site. The ability, in the absence of camptothecin, to obtain a specific and very efficient cleavage using a suicide substra.te containing site b ma.kes it, possible to investigate directly the effect of the drug on the religation reaction of topoisomerase I at this site. The partly double-stranded suicide DNA substrate was incubated with topoisomerase I in the absence of camptothecin for 30 minutes at 30°C and any further cleavage was inhibited by addition of NaCl to 400 mM. Camptothecin and religation substrate were then added and samples taken after further 1 to 60 minutes of incubation. The samples were precipitated, trypsin-digested and analyzed on a sequencing gel (Fig. 2). The religation reaction of topoisomerase I is inhibited by camptothecin as shown by the stability of the enzyme-DP1’A complex even after 40 to 60 minutes of incubation with religation subst,rate (compare lanes 7 and 8 to lanes 13 and 14). This inhibition is much stronger than that observed at site a where differences in amount of religa.tion product between controls and samples containing camptothecin were only observed through the first minute of reaction (Svejstrup et al., 1991). Comparison of the results of the two experiments thus confirms the interpretation of results obt’ained from studies on double-stranded DNA (Kjeldsen et al., 1988a), the eamptothecin-mediated stability of a topoisomerase I-DEJA complex is sequencedependent. To investigate the effect of camptothecin on the cleavage reaction of topoisomerase I at site b: t,he suicide DNA substrate was incubated with topoisomerase I for 30 minutes at 30°C in the absence or the presence of the drug. Reactions were stopped by the addition of NaCl to 400 rnM, samples were precipitated, trypsin-digested, and analyzed on a sequencing gel (Fig. 3A). Unexpectedly, the suicide cleavage reaction of topoisomerase I is strongly inhibited by camptothecin at site b (compare lanes 2 and 3). This result is highly surprising since it contrasts the generally a,ecepted view of camptothecin as a specific inhibitor of the religation reaction of topoisomerase I. To investigate the mode of inhibition, the effect of eamptothecin on suicide cleavage was investigated with a camptothecin-resistant topoisomerase I (Andoh et al., 1987). On normal double-stranded DNA we have previously shown that SDS cleavage with the mutated enzyme is not affected by addition of camptothecin (Kjeldsen et al., 19886). The suicide substrate, shown schematically in Figure 3C, was incubated with either wild-type (topo I-wt?) or camptothecin-resistant (topo I-K5) topoisomerase I 7 Abbreviations used: topo I-wt, wild-type topoisomerase I; topo I-K5, camptothecin-resistant. topoisomerase I.
1027
Communications
A
B Religation reaction
I III7 M 0 15
-CPT 10204060
+CPT
I s8--
I
1 5 10204060
3’ 5
CTTTTTTCATGCACCATTCCTTG~3’.ACGTGGTMGGMC
T*
t
0
min
_ Reli ation pro8 uct
CLEAVAGE I
II 5’ e
CTTT,-TTCATGCACCAl-TCCTTG TGGTMGGMC
3’
A-
35mer*5
cc++:?’ 0
_ Cleavage product
RELIGATION
- Substrate
I
III s@---1 2 3 4
5 6 7 8
9 10 11 12 13 14
3’ -
CTTTTTTCATGCACCATTCCTTG-GAMMAGTACGTGGTMGGAACStmer+
mner
3’
5’
0 Figure 2. Camptothecin inhibition of religation at site b. A, The suicide DNA substrate was made and reacted with topoisomerase I as described in Fig. 1. Religation was performed by subsequent addition of religation substrate (16.mer oligonucleotide) as described in Svejstrup et al. (1991) in the absence or presence of 30 PM-camptothecin (lanes 3 to 8 and 9 to 14, respectively). The 16-mer religation substrate had the sequence 5’ GCATGAAAAAAGACGA 3’. Samples were withdrawn at different timepoints, reactions stopped by precipitation, and analyzed on a 10% denaturing polyacrylamide gel as described by Andersen et al. (1989). Lane 1, suicide DNA substrate; lane 2; suicide cleavage. B, Schematic illustration of the experimental strategy. I. Topoisomerase I cleavage site. II. Topoisomerase I (filled ellipse) cleavage in absence of camptothecin. Addition of drug and, subsequently, a large surplus of 16.mer religation substrate relative to suicide substrate. III. Topoisomerase I-mediated ligation creates a 51-mer religation product. The asterisk (*) denotes the position of the radioactive label and @ and @ denote a phosphorylated, and a hydroxy 5’-end of the non-cleaved strand and the religation substrate respectively.
for 30 minutes at 30°C in the presence of various amounts of camptothecin. Reactions were stopped by the addition of NaCl to 400 mM. Samples were precipitated, trypsin-digested and analyzed on a sequencing gel (Fig. 3B). Suicide cleavage by topo I-wt is completely inhibited by concentrations of camptothecin higher than 5 PM (lanes 4 to 6) whereas topo I-K5 cleaves the substrate with high efficiency at all camptothecin concentrations tested (lanes 7 to 10). Topo I-K5 is also resistant to camptothecin-mediated inhibition of the religation reaction per se (data not shown). Since topo I-K5 is resistant to the inhibitory effect of camptothecin on not only religation but also suicide cleavage, possibly as a consequence of the improved DNA binding of this enzyme (Kjeldsen et al., 19883), the mode of cleavage inhibition by camptothecin on wild-type topoisomerase I might be related to the ability of the drug to interact with the non-covalent enzyme-DNA complex prior to cleavage. Consistent with this, we have been unable to detect any DNA intercalation of camptothecin at the singlestranded/double-stranded junction by a ligation assay employing the suicide DNA substrate, phosphorylated 13-mer oligonucleotide (see below), and phage T4 ligase (data not shown). Taken together, these results indicate that suicide cleavage inhibi-
tion by camptothecin takes place through interof the drug with the non-covalent action topoisomerase I-DNA complex prior to cleavage, and not because camptothecin interacts with the unusual DNA substrate. The suicide DNA substrate differs from the usual substrates for topoisomerase I-mediated cleavage by being partly single-stranded downstream from the cleavage position. Since it has previously been demonstrated by Krogh et al. (1991) that a decreased stability of the topoisomerase I-DNA complex in this region affects the efficiency of cleavage, the suicide cleavage inhibition by camptothecin might be due to reduced stability of noncovalent binding of topoisomerase I to the suicide DNA substrate. It was therefore determined whether camptothecin inhibition of suicide cleavage could be reversed by reformation of fully dloublestranded DNA downstream from the cleavage position. Topoisomerase I was incubated with a suicide substrate onto which a phosphorylated oligodeoxynucleotide (13.mer) was first hybridized, thereby creating double-stranded DNA except for a nick between the bases + 3 and +4 downstream from the cleavage position (Fig. 4(B)). The doublestranded structure of the substrate was con.firmed by native gel electrophoresis (data not shown). If
E. K.jeldsen et ai.
1028
Cleavage
B
Top0I-wt ' 0
Topo I-K5
1 2 51080'0
2108O'ti
Substrate CPT 7
Cleavage Substrate
nmei
53 3’d
c 5’@ 3’
t
77mer 3’ 38mer * 5’
Figure 3. Camptothecin inhibits suicide cleavage at site b by wild-type, but not by camptothecin-resistant topoisomerase I. A; Topoisomerase I-mediated cleavage of the suicide DNA substrate was performed as described under Fig. 1 in the absence (lane 3) or presence (lane 2) of 30 pi?-camptothecin. The reaction was stopped by addition of NaCl to 0.4 n1. Cleavage products were analyzed on a 10% denaturing polyacrylamide gel and visualized by autoradiography as described by Andersen et al. (1989). Lane 1, suicide cleavage substrate. B, Topoisomerase Imediat,ed cleavage of the suicide DNA substrate was performed as described in Fig. 1 legend in the presence of differing amount,s of camptothecin with either wild-type (lanes 1 to 6) or camptothecin-resistant (lanes 7 to 10) topoisomerase I. The reaction was stopped by addition of NaCl to 04 M. Cleavage products were analyzed on a 10% denaturing polyacrylamide gel and visualized by autoradiography as described by Andersen et al. (1989). C, Schematic presentation of the suicide DTU’A substrate. The arrow (t) denotes the site of cleavage and the asterisk (*) the position of the radioactive label. The @ denotes a phosphorylation of the 5’.end of the non-cleaved strand.
topoisomerase I is able to cleave the substrate in the presence of camptothecin, the cleavage will not be religated due to the 5’.end phosphorylation of the added 13.mer oligonucleotide. After 30 minutes of incubation, the reaction was stopped with NaCl, precipitated and trypsin-digested and finally analyzed on a sequencing gel (Fig. 4A). Topoisomerase I is able to cleave this substrate in the presence of all tested concentrations of camp-
,
3mer
2
Figure 4. Reversion of camptothecin inhibition of suicide cleavage by reformation of a double-stranded DKA structure downstream from the cleavage position. A, Topoisomerase I-mediated cleavage of the suicide DNA substra,te, onto which a phosphorylated 13.mer oligonucleotide was hybridized, was performed as described in Fig. 1 in the presence of differing amounts of camptothecin (Lanes 2 to 8). The 13-mer oligonucleotide had the sequence 5’ TGAAAAAAGACGA 3’. The reaction was stopped by addition of KaCl to O-4 M. Cleavage products were analyzed on a, 10% denaturing polyacrylamide gel and visualized by autoradiography as described by Andersen et al. (1989). Lane 1, suicide cleavage substrate. B, Schematic presentation of the suicide DNA substrate. A phosphorylated 13-mer oligonucleotide added to t’he suicide DNA substrate prior to incubation with topoisomerase I creates a double-stranded DiVVA structure except for a nick. The asterisk (*) denotes the site of the radioactive label and @ denotes a $-end phosphorylation.
totheein (lanes 3 to 8). The same concentrations of camptothecin were previously shown to be completely inhibitory to the suicide cleavage reaction in absence of the 13-mer oligonucleotide. Most likely, the formation of fully double-stranded DNA on the downstream side of the cleavage position makes topoisomerase I-DNA binding more stable and thus, completely reverses the inhibitory effect of camptothecin on the suicide cleavage reaction. This result, in addition of the result shown in Figure 3, therefore indicates that reduced stability of noncovalent DP\‘A binding is the cause of camptothecin inhibition of topoisomerase I-mediated cleavage. Earlier studies have shown that campt,othecin binds to topoisomerase I in the presence of DNA, but not to topoisomerase I or DXA alone (Hertzberg et al., 1989; 1990). These studies together with several others have led to a model where the drug is thought, to act as an inhibitor of the religa-
Communications tion reaction of topoisomerase I. Thus, camptothecin has been proposed to form a ternary complex with enzyme and DNA by binding reversibly at the DNA cleavage site after establishment of the covaet lent topoisomerase I-DNA complex (Hertzberg al., 1990; Jaxel et al., 1991). Further, it has recently been found that the dinucleotides 5’-T^ G/not-T-3’ are overrepresented at the strongly camptothecinenhanced cleavage sites, suggesting that the drug interacts directly with the + 1 base, thereby inhibiting the religation reaction of the enzyme (Jaxel et al., 1991). We find that not only the religation reaction, but also the cleavage reaction of topoisomerase I is inhibited by camptothecin, when the enzyme interacts with a suicide DNA substrate. Thus, our results demonstrate that camptothecin must also be able to interact with the non-covalent topoisomerase I-DNA complex. Consistent with this conclusion, topoisomerase I sites on duplex DNA have actually also been identified where cleavage disappears in the presence of camptothecin (Kjeldsen et al., 1988; Gromova et al., 1990; Shen & 1990). Sequence analysis of a few of these sites revealed a preference for either T^T or G G dinucleotides at the position of cleavage (Kjeldsen et al., 1988a). The sites have never been subject to further analysis, though, partly because inhibition was only observed at weaker cleavage sites. The downstream region of the topoisomerase I binding sequence that is single-stranded in suicide DNA substrates has previously been shown to play a role in the binding of topoisomerase I to doublestranded DNA (Krogh et al., 1991). Furthermore, a high frequency of specific nucleotides has been found in this region at positions + I, + 10 and. + 11 relative to the cleavage position in sites strongly affected by camptothecin (Kjeldsen et al., 1988a; Champoux & Arnoff, 1989; Jaxel et al., 1991). The camptothecin inhibition of suicide observed cleavage at site b is thus most likely due to the single-stranded DNA structure in this region of the suicide substrate. We have previously reported that suicide cleavage at site a is not effected by camptothecin. However, the suicide substrate containing site a has a single-stranded, palindromic tract of nucleotides downstream from the cleavage site (Svejstrup et al., 1991) and might by itself create stable double-stranded DNA in this region. Thus, a non-covalent topoisomerase I-DNA binding could be a general primary determinant for the degree of camptothecin inhibition, the stability of binding to sequences downstream from the cleavage position might be of importance for the accessibility of a topoisomerase I complex to camptothecin. Based on the above comparison of our present results and the earlier models (Hertzberg et al., 1990; Jaxel et al., 1991), we propose the following modified model for camptothecin inhibition of topoisomerase I action: initial non-covalent binding of topoisomerase I to most of its DNA targets in double-stranded DNA sites is stable, preventing from entering the enzyme-DNA camptothecin complex and thereby from interfering with the
1029
cleavage reaction of the enzyme. Upon topoisomerase I-mediated cleavage, however, the structure of the DNA (now nicked) and thereby of the enzyme-DNA complex is altered, and the stability of some of the non-covalent DNA interactions therefore reduced. A generally reduced stability of non-covalent binding has no effect on religation in the absence of the drug, since it has previously been shown that religation is not affected by concentrations of salt which completely disrupt non-covalent enzyme-DNA binding (Svejstrup et al., 1991). In the presence of the drug, however, the above mentioned reduction of some non-covalent interactions makes it possible for camptothecin to enter the topoisomerase I-DNA complex., and thereby to inhibit the religation reaction of the enzyme. In contrast, the non-covalent binding of topoisomerase I to suicide DNA substrate may be expected to be unstable in some regions already before the cleavage event, due to the partly doublestranded structure of the substrate, enabling camptothecin to interact with topoisomerase I already at this stage and hence to inhibit the cleavage reaction of the enzyme. Thus, in addition to the models proposed by Hertzberg et al. (1990) and Jaxel et al. (1991), where camptothecin is suggested to inhibit the religation step only, we have shown that camptothecin is capable of inhibiting both the cleavage and religation steps of topoisomerase I in a manner which is likely to depend on the stability of the noncovalent enzyme-DNA complex. Therefore, camptothecin should not be viewed solely as an inhibitor of the religation reaction of topoisomerase I, but rather as a general inhibitor of the errzyme’s cleavage and religation reactions. We wish to thank
Drs Kent
Andersen for helpful B. Dal1 for
skilful
Christiansen
and Anni
H.
discussions and K. Andersen and
technical
assistance. This work was Society (grant 90.020), the Danish Center for Human Genome Research, the Danish Research Council, the Carlsberg Foundation, the Danish National Agency of Technology (1987-1331444~870714), and NATO grant (5-%05/RG 0157188) for international collaboration in research.
supported by Danish Cancer
References Andersen,
A. H.,
Jensen,
Christiansen,
P. S., Osheroff,
K.,
N.
Zechiedrich,
E. L.,
& Westergaard,
0.
(1989). Strand specificity of the topoisomerase II mediated double-stranded DNA cleavage reaction. Biochemistry, 28, 6237-6244. Andoh, T., Ishii, K., Suzuki, Y ., Ikegami, Y., Kusunoki, Takemoto, Y. & Okada, K. (1987). Y., Characterization of a mammalian mutant with a camptothecin-resistant DNA topoisomerase I. Proc. Nat. Acad. Sci., U.S.A. 84, 5565-5669. Bonven, B. J., Gocke, E. & Westergaard, 0. (1985). A high affinity topoisomerase I binding sequence is clustered at DNAase I hypersensitive sites in tetrahymena r-chromatin. Cell, 41, 541-551. Busk, H., Thomsen, B., Bonven, B. J., Kjeldsen, E., Nielsin, 0. F. & Westergaard, 0. (1987). Preferential
1030 relaxation decameric
E. Kjeldsen of supercoiled DNA recognition sequence
Nature (London),
containing a hexafor topoisomerase I.
327, 638-640.
Champoux, J. J. & Aronoff, R. (1989). The effects of camptothecin on the reaction and the specificity of the wheat germ type I topoisomerase. J. Biol. Chem. 264, 1010-1015. Christiansen, K., Bonven, B. J. & Westergaard, 0. (1987). Mapping of sequence-specific chromatin proteins by a novel method: topoisomerase I on tetrahymena riboJ. Mol. Biol. 193, 517-525. somal chromatin. Covey, J. M., Jaxel, C., Kohn, K. W. 8i Pommier, Y. (1989). Protein-linked DNA strand breaks induced in mammalian cells by camptothecin, an inhibitor of topoisomerase I. Cancer Res. 49, 5016-5022. Degrassi, F., De-Salvia, R.; Tanzarella, C. $ Palitti. F. (1989). Induction of chromosomal aberrations and SCE by camptothecin, an inhibitor of mammalian topoisomerase I. Mutat. Res. 211, 125-130. Giovanella, B. C.; Stehlin, J. S., Wall, M. E., Wani, M. C.; Nicholas, A. W., Liu, L. F., Silber, R. & Potmesil, M. (1989). DNA topoisomerase I-targeted chemotherapy of human colon cancer in xenografts. Xcience, 46, 104661048. Gromova, I. I., Buchman, V. L.; Abagyan, R. A.; Ulyanov, A. V. & Bronstein, I. B. (1990). Sequence dependent modulating effect of camptothecin on the DNA-cleaving activity of calf thymus t’ype I topoisomerase. Nucl. Acids Res. 18, 637-645. Hertzberg, R. P., Caranfa, M. J. & He&t, S. M. (1989). On the mechanism of topoisomerase I inhibition by camptothecin: evidence for binding to an enzymeDNA complex. Biochemistry, 28, 4629-4638. Hertzberg. R. P., Busby, R. W., Caranfa, M. J., Holden; K. J., Johnson, R. K., Hecht, S. M. 8: Kingsbury, W. D. (1990). Irreversible t,rapping of the DNA-topoisomerase I covalent complex. J. Biol. Chem. 265, 19287719295. Hsiang, Y.-H., Hertzberg; R. P., Hecht, S. & Liu, L. F. (1985). Camptothecin induces protein-linked DNA breaks via mammalian DNA topoisomerase I. J. Biol. Chem. 260, 14873-14878.
Edited
et ai. Jaxel,
C., Capranisco, G.; Kerrigan, D., Kohn, K. W. & Pommier, Y. (1991). Effect of local DN-4 sequence on topoisomerase I cleavage in the presence or absence of camptothecin. J. Biol. Chem. 266; 20418-20423. Kessel, D., Bosmann, H. B. & Lohr, K. (1972). Camptothecin effects on DNA synthesis in murine leukemia cells. Biochim. Bioph,ys. Acta, 269: 210-216. Kjeldsen, E., Mollerup, S., Thomsen, B., Bonven, B. J., Bolund, L. & Westergaard, 0. (198Sa). Sequencedependent effect of camptothecin on human topoisomerase I DNA cleavage. J. MOE. Biol. 202. 333-342. Kjeldsen, E., Bonven, B. J., dndoh. T., Ishii, K.; Okada, K., Bolund, L. & West,ergaard. 0. (198%). Characterization of a camptothecin-resistant human DNA topoisomerase I. J. Biol. Chem. 263, 39123916. Krogh, S.. Mortensen, U. H., Westergaard, 0. & Bonvm, B. J. (1991). Eukaryotic topoisomerase T-DNA interaction is stabilized by helix curvature. ,Irucl. Acids Res. 19, 12351241. Nit&s, J. & Wang, J. C. (1988). DN$ topoisomerasetargeting antitumor drugs can be studied in yeast.
Proc. Nat. Aead. Sci., U.S.A. 85, 7501-7505. Shen, C. C. & Shen, C.-K. J. (1990). Specificity and flexibility of the recognition of DNA helical structure by eukaryotic topoisomerase I. J. Mol. Riol. 212,
67-78. Svejstrup, J. Q., Christiansen, K., Andersen, A. H., Lund, K. & Westergaard, 0. (1990). Minimal DNA duplex requirements for topoisomerase I-mediated cleavage in vitro. J. Biol. Chem. 265, 12529-12535. Svejstrup, J. Q., Christiansen, K., Gromova. I. I., Andersen, A. H. & Westergaard, 0. (1991). New technique for uncoupling the cleavage and religation reactions of eukaryotie topoisomerase I. The mode of action of camptothecin at a specific recognition site.
J. Mol. BioE. 222, 669-678. Thomsen, B., Mollerup, S., Bonven, B. J., Frank; R., Blocker, H., Nielsen, 0. F. & Westergaard. 0. (1987). Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin. EMBO J. 6: 1817-1823.
by J. Karn
COMMUNICATIONS
Camptothecin Inhibits Both the Cleavage and Religation Reactions of Eukaryotic DNA Topoisomerase I Eigil Kjeldsen’f, Jesper Q. Svejstrup, Irina I. Gromova Jan Alsner and Ole Westergaardj: University (Received
Department of Molecular Biology of Aarhus, DK-8000 Arhus, C, Denmark 2 June 1992; accepted 18 August
1992)
We investigated
the mode of action of the antitumor drug, camptothecin, by use of a partly double-stranded suicide DNA substrate which enables uncoupling of the cleavage and religation half-reactions of topoisomerase I. The suicide DNA substrate contains a single topoisomerase I site at which SDS cleavage is strongly enhanced by camptothecin on normal double-stranded DNA. The results show that the religation reaction of topoisomerase I per se is strongly inhibited at this site compared to a site that is only marginally affected by camptothecin on double-stranded DNA. This study hereby directly demonstrates that camptothecin-mediated stability of a topoisomerase I-DNA complex is sequence-dependent. The influence of camptothecin on the suicide cleavage reaction of topoisomerase I was also investigated. Surprisingly, the cleavage reaction per se is strongly inhibited by the drug. However, reformation of a cleavable suicide DNA substrate, which is fully double-stranded downstream from the cleavage position except for a nick, completely reverses the inhibitory effect of the drug on the cleavage reaction. The results suggest that the inhibitory effect of camptothecin on cleavage is due to a general decrease in the noncovalent interaction of topoisomerase I with partly double-stranded suicide DNA substrates. Based on the findings, a plausible model for camptothecin action is discussed. Keywords:
camptothecin;
topoisomerase
Camptothecin and several of its more recent derivatives are cytotoxic alkaloids which hold antineoplastic activity due to their specific interaction with eukaryotic DNA topoisomerase I activity (Hsiang et al., 1985; Giovanella et al., 1989). Thus, treatment of cells with camptothecin causes inhibition of DNA and RNA synthesis (Kessel et al., 1972), high frequencies of sister chromatid exchange (Degrassi et al., 1989), and induction of extensive fragmentation of chromosomal DNA (Covey et al., 1989). Topoisomerase I is likely to be the sole cellular target of the drug, as a camptothecin-resistant cell line encodes a drug-resistant topoisomerase I (Andoh et al., 1987), and yeast cells with a disrupted TOP1 gene show none of the physiological effects normally associated with drug treatment (Nitiss & Wang, 1988). On the basis of the in vitro effects of camptothecin 7 Present address: Department of Human Genetics, The Bartholin Building, University of Aarhus, DK-8000 Aarhus, C, Denmark. $ Author to whom all correspondence should be addressed. 0022-2836/92/241025~6
$08.00/O
1025
I; suicide DNA;
cleavage;
religation
on topoisomerase I cleavage of double-stranded DNA fragments, it has been proposed that camptothecin stabilizes the covalent topoisomerase IDNA complex by inhibiting the religation reaction of the enzyme (Hsiang et al., 1985; Kjeldsen et al., 1988a). Recently, we have verified this model by utilizing suicide DNA substrates by which it is possible to investigate the two half-reactions of topoisomerase I separately (Svejstrup et al., 1991). The study was performed with oligonucleotides containing a hexadecameric recognition sequence (site a) which is known to be the preferenti,al site for cleavage (Bonven et al., 1985; Tomsen et aZ., 1987) 1987) and relaxation (Busk et al., by topoisomerase I from various eukaryotes (Christiansen et al., 1987). Topoisomerase I--DNA interaction at site a is only marginally affected by camptothecin (Thomsen et al., 1987; Kjeldsen et al., 1988a), and we have recently shown that the religation reaction, but not the cleavage reaction of topoisomerase I is affected by the drug at this site (Svejstrup et al., 1991). To study further the effects of camptothescin we designed a new suicide substrate based on a typical 0
1992 Academic Press Limited
1026
E. Kjeldsen
- Cleavage - Substrate
B 5’ @j-----
CTTTTTTCATGCACCATTCCTTG Q’-ACGTGGTAAGGAAC
77mer 38mer
‘ii’
t
Figure 1. Topoisomerase I-mediated suicide cleavage of a camptothecin-enhanced site. A, Labeling of the and scissile strand, annealing of oligonucleotides cleavage of the resulting topoisomerase I-mediated suicide DNA substrate was performed as described in Svejstrup et al. (1991). The 3%mer scissile strand had the sequence 5’ GCCTGCAGGTCGACTCTGCCGCCGCAAGGAATGGTGCA 3’, while the 77-mer non-cleaved strand had the sequence 5’ ATTCGAGCTCGGTACCCGGGGATCGATCGTCTTTTTTCATGCACCATTCCTTGCGGCGG CAGAGTCGACCTGCAGGC 3’. Cleavage products were analyzed on a 10% denaturing polyacrylamide gel and visualized by autoradiography as described by Andersen et al. (1989). The cleavage reaction was stopped by addition of SDS to 1 y0 (lane 2) or Nacl to @4 M (lane 3). Lane 1; suicide DNA substrate. The cleavage product migrates slower than the substrate DNA due to covalent attachment of a trypsin-resistant peptide (Svejstrup et al., 1990). B, Schematic illust,ration of the suicide DNA substrate containing a strongly camptothecin-enhanced cleavage site. The arrow denotes the site of cleavage and the asterisk (*) t’he position of the radioactive label. The @ denotes a phosphorylation of the 5’ end of the noncleaved strand made to avoid religation to this end upon enzyme-mediat’ed cleavage.
drug-induced site (site b, depicted in Fig. 1B). In an SDS cleavage assay on double-stranded DNA this site is enhanced approximately 200-fold by camptothecin (Kjeldsen et al., 1988a). In the experiment shown in Figure 1, the suicide substrate was incubated with human DNA topoisomerase I for 30 minutes at 30°C and cleavage stopped by addition of NaCl to 400 mM. Following precipitation and trypsin digestion, the samples were analyzed on a sequencing gel. Topoisomerase I action results in site-specific cleavage at the predicted position (lane 3). Cleavage is suicidal as equal amounts of cleavage are detected when the reaction is stopped by NaCl or SDS (lanes 3 and 2). On normal doublestranded DNA, cleavage is barely detectable at site b in SDS cleavage assays when camptothecin is absent (Kjeldsen et ah, 1988a). The fact that the partly double-stranded suicide substrate is actually
et ai.
cleaved at. the right position in the absence of camptothecin suggests that camptothecin does not act to induce cleavage at this site on normal doublestranded DNA, but rather to slow down a normally very rapid religation reaction at the site. The ability, in the absence of camptothecin, to obtain a specific and very efficient cleavage using a suicide substra.te containing site b ma.kes it, possible to investigate directly the effect of the drug on the religation reaction of topoisomerase I at this site. The partly double-stranded suicide DNA substrate was incubated with topoisomerase I in the absence of camptothecin for 30 minutes at 30°C and any further cleavage was inhibited by addition of NaCl to 400 mM. Camptothecin and religation substrate were then added and samples taken after further 1 to 60 minutes of incubation. The samples were precipitated, trypsin-digested and analyzed on a sequencing gel (Fig. 2). The religation reaction of topoisomerase I is inhibited by camptothecin as shown by the stability of the enzyme-DP1’A complex even after 40 to 60 minutes of incubation with religation subst,rate (compare lanes 7 and 8 to lanes 13 and 14). This inhibition is much stronger than that observed at site a where differences in amount of religa.tion product between controls and samples containing camptothecin were only observed through the first minute of reaction (Svejstrup et al., 1991). Comparison of the results of the two experiments thus confirms the interpretation of results obt’ained from studies on double-stranded DNA (Kjeldsen et al., 1988a), the eamptothecin-mediated stability of a topoisomerase I-DEJA complex is sequencedependent. To investigate the effect of camptothecin on the cleavage reaction of topoisomerase I at site b: t,he suicide DNA substrate was incubated with topoisomerase I for 30 minutes at 30°C in the absence or the presence of the drug. Reactions were stopped by the addition of NaCl to 400 rnM, samples were precipitated, trypsin-digested, and analyzed on a sequencing gel (Fig. 3A). Unexpectedly, the suicide cleavage reaction of topoisomerase I is strongly inhibited by camptothecin at site b (compare lanes 2 and 3). This result is highly surprising since it contrasts the generally a,ecepted view of camptothecin as a specific inhibitor of the religation reaction of topoisomerase I. To investigate the mode of inhibition, the effect of eamptothecin on suicide cleavage was investigated with a camptothecin-resistant topoisomerase I (Andoh et al., 1987). On normal double-stranded DNA we have previously shown that SDS cleavage with the mutated enzyme is not affected by addition of camptothecin (Kjeldsen et al., 19886). The suicide substrate, shown schematically in Figure 3C, was incubated with either wild-type (topo I-wt?) or camptothecin-resistant (topo I-K5) topoisomerase I 7 Abbreviations used: topo I-wt, wild-type topoisomerase I; topo I-K5, camptothecin-resistant. topoisomerase I.
1027
Communications
A
B Religation reaction
I III7 M 0 15
-CPT 10204060
+CPT
I s8--
I
1 5 10204060
3’ 5
CTTTTTTCATGCACCATTCCTTG~3’.ACGTGGTMGGMC
T*
t
0
min
_ Reli ation pro8 uct
CLEAVAGE I
II 5’ e
CTTT,-TTCATGCACCAl-TCCTTG TGGTMGGMC
3’
A-
35mer*5
cc++:?’ 0
_ Cleavage product
RELIGATION
- Substrate
I
III s@---1 2 3 4
5 6 7 8
9 10 11 12 13 14
3’ -
CTTTTTTCATGCACCATTCCTTG-GAMMAGTACGTGGTMGGAACStmer+
mner
3’
5’
0 Figure 2. Camptothecin inhibition of religation at site b. A, The suicide DNA substrate was made and reacted with topoisomerase I as described in Fig. 1. Religation was performed by subsequent addition of religation substrate (16.mer oligonucleotide) as described in Svejstrup et al. (1991) in the absence or presence of 30 PM-camptothecin (lanes 3 to 8 and 9 to 14, respectively). The 16-mer religation substrate had the sequence 5’ GCATGAAAAAAGACGA 3’. Samples were withdrawn at different timepoints, reactions stopped by precipitation, and analyzed on a 10% denaturing polyacrylamide gel as described by Andersen et al. (1989). Lane 1, suicide DNA substrate; lane 2; suicide cleavage. B, Schematic illustration of the experimental strategy. I. Topoisomerase I cleavage site. II. Topoisomerase I (filled ellipse) cleavage in absence of camptothecin. Addition of drug and, subsequently, a large surplus of 16.mer religation substrate relative to suicide substrate. III. Topoisomerase I-mediated ligation creates a 51-mer religation product. The asterisk (*) denotes the position of the radioactive label and @ and @ denote a phosphorylated, and a hydroxy 5’-end of the non-cleaved strand and the religation substrate respectively.
for 30 minutes at 30°C in the presence of various amounts of camptothecin. Reactions were stopped by the addition of NaCl to 400 mM. Samples were precipitated, trypsin-digested and analyzed on a sequencing gel (Fig. 3B). Suicide cleavage by topo I-wt is completely inhibited by concentrations of camptothecin higher than 5 PM (lanes 4 to 6) whereas topo I-K5 cleaves the substrate with high efficiency at all camptothecin concentrations tested (lanes 7 to 10). Topo I-K5 is also resistant to camptothecin-mediated inhibition of the religation reaction per se (data not shown). Since topo I-K5 is resistant to the inhibitory effect of camptothecin on not only religation but also suicide cleavage, possibly as a consequence of the improved DNA binding of this enzyme (Kjeldsen et al., 19883), the mode of cleavage inhibition by camptothecin on wild-type topoisomerase I might be related to the ability of the drug to interact with the non-covalent enzyme-DNA complex prior to cleavage. Consistent with this, we have been unable to detect any DNA intercalation of camptothecin at the singlestranded/double-stranded junction by a ligation assay employing the suicide DNA substrate, phosphorylated 13-mer oligonucleotide (see below), and phage T4 ligase (data not shown). Taken together, these results indicate that suicide cleavage inhibi-
tion by camptothecin takes place through interof the drug with the non-covalent action topoisomerase I-DNA complex prior to cleavage, and not because camptothecin interacts with the unusual DNA substrate. The suicide DNA substrate differs from the usual substrates for topoisomerase I-mediated cleavage by being partly single-stranded downstream from the cleavage position. Since it has previously been demonstrated by Krogh et al. (1991) that a decreased stability of the topoisomerase I-DNA complex in this region affects the efficiency of cleavage, the suicide cleavage inhibition by camptothecin might be due to reduced stability of noncovalent binding of topoisomerase I to the suicide DNA substrate. It was therefore determined whether camptothecin inhibition of suicide cleavage could be reversed by reformation of fully dloublestranded DNA downstream from the cleavage position. Topoisomerase I was incubated with a suicide substrate onto which a phosphorylated oligodeoxynucleotide (13.mer) was first hybridized, thereby creating double-stranded DNA except for a nick between the bases + 3 and +4 downstream from the cleavage position (Fig. 4(B)). The doublestranded structure of the substrate was con.firmed by native gel electrophoresis (data not shown). If
E. K.jeldsen et ai.
1028
Cleavage
B
Top0I-wt ' 0
Topo I-K5
1 2 51080'0
2108O'ti
Substrate CPT 7
Cleavage Substrate
nmei
53 3’d
c 5’@ 3’
t
77mer 3’ 38mer * 5’
Figure 3. Camptothecin inhibits suicide cleavage at site b by wild-type, but not by camptothecin-resistant topoisomerase I. A; Topoisomerase I-mediated cleavage of the suicide DNA substrate was performed as described under Fig. 1 in the absence (lane 3) or presence (lane 2) of 30 pi?-camptothecin. The reaction was stopped by addition of NaCl to 0.4 n1. Cleavage products were analyzed on a 10% denaturing polyacrylamide gel and visualized by autoradiography as described by Andersen et al. (1989). Lane 1, suicide cleavage substrate. B, Topoisomerase Imediat,ed cleavage of the suicide DNA substrate was performed as described in Fig. 1 legend in the presence of differing amount,s of camptothecin with either wild-type (lanes 1 to 6) or camptothecin-resistant (lanes 7 to 10) topoisomerase I. The reaction was stopped by addition of NaCl to 04 M. Cleavage products were analyzed on a 10% denaturing polyacrylamide gel and visualized by autoradiography as described by Andersen et al. (1989). C, Schematic presentation of the suicide DTU’A substrate. The arrow (t) denotes the site of cleavage and the asterisk (*) the position of the radioactive label. The @ denotes a phosphorylation of the 5’.end of the non-cleaved strand.
topoisomerase I is able to cleave the substrate in the presence of camptothecin, the cleavage will not be religated due to the 5’.end phosphorylation of the added 13.mer oligonucleotide. After 30 minutes of incubation, the reaction was stopped with NaCl, precipitated and trypsin-digested and finally analyzed on a sequencing gel (Fig. 4A). Topoisomerase I is able to cleave this substrate in the presence of all tested concentrations of camp-
,
3mer
2
Figure 4. Reversion of camptothecin inhibition of suicide cleavage by reformation of a double-stranded DKA structure downstream from the cleavage position. A, Topoisomerase I-mediated cleavage of the suicide DNA substra,te, onto which a phosphorylated 13.mer oligonucleotide was hybridized, was performed as described in Fig. 1 in the presence of differing amounts of camptothecin (Lanes 2 to 8). The 13-mer oligonucleotide had the sequence 5’ TGAAAAAAGACGA 3’. The reaction was stopped by addition of KaCl to O-4 M. Cleavage products were analyzed on a, 10% denaturing polyacrylamide gel and visualized by autoradiography as described by Andersen et al. (1989). Lane 1, suicide cleavage substrate. B, Schematic presentation of the suicide DNA substrate. A phosphorylated 13-mer oligonucleotide added to t’he suicide DNA substrate prior to incubation with topoisomerase I creates a double-stranded DiVVA structure except for a nick. The asterisk (*) denotes the site of the radioactive label and @ denotes a $-end phosphorylation.
totheein (lanes 3 to 8). The same concentrations of camptothecin were previously shown to be completely inhibitory to the suicide cleavage reaction in absence of the 13-mer oligonucleotide. Most likely, the formation of fully double-stranded DNA on the downstream side of the cleavage position makes topoisomerase I-DNA binding more stable and thus, completely reverses the inhibitory effect of camptothecin on the suicide cleavage reaction. This result, in addition of the result shown in Figure 3, therefore indicates that reduced stability of noncovalent DP\‘A binding is the cause of camptothecin inhibition of topoisomerase I-mediated cleavage. Earlier studies have shown that campt,othecin binds to topoisomerase I in the presence of DNA, but not to topoisomerase I or DXA alone (Hertzberg et al., 1989; 1990). These studies together with several others have led to a model where the drug is thought, to act as an inhibitor of the religa-
Communications tion reaction of topoisomerase I. Thus, camptothecin has been proposed to form a ternary complex with enzyme and DNA by binding reversibly at the DNA cleavage site after establishment of the covaet lent topoisomerase I-DNA complex (Hertzberg al., 1990; Jaxel et al., 1991). Further, it has recently been found that the dinucleotides 5’-T^ G/not-T-3’ are overrepresented at the strongly camptothecinenhanced cleavage sites, suggesting that the drug interacts directly with the + 1 base, thereby inhibiting the religation reaction of the enzyme (Jaxel et al., 1991). We find that not only the religation reaction, but also the cleavage reaction of topoisomerase I is inhibited by camptothecin, when the enzyme interacts with a suicide DNA substrate. Thus, our results demonstrate that camptothecin must also be able to interact with the non-covalent topoisomerase I-DNA complex. Consistent with this conclusion, topoisomerase I sites on duplex DNA have actually also been identified where cleavage disappears in the presence of camptothecin (Kjeldsen et al., 1988; Gromova et al., 1990; Shen & 1990). Sequence analysis of a few of these sites revealed a preference for either T^T or G G dinucleotides at the position of cleavage (Kjeldsen et al., 1988a). The sites have never been subject to further analysis, though, partly because inhibition was only observed at weaker cleavage sites. The downstream region of the topoisomerase I binding sequence that is single-stranded in suicide DNA substrates has previously been shown to play a role in the binding of topoisomerase I to doublestranded DNA (Krogh et al., 1991). Furthermore, a high frequency of specific nucleotides has been found in this region at positions + I, + 10 and. + 11 relative to the cleavage position in sites strongly affected by camptothecin (Kjeldsen et al., 1988a; Champoux & Arnoff, 1989; Jaxel et al., 1991). The camptothecin inhibition of suicide observed cleavage at site b is thus most likely due to the single-stranded DNA structure in this region of the suicide substrate. We have previously reported that suicide cleavage at site a is not effected by camptothecin. However, the suicide substrate containing site a has a single-stranded, palindromic tract of nucleotides downstream from the cleavage site (Svejstrup et al., 1991) and might by itself create stable double-stranded DNA in this region. Thus, a non-covalent topoisomerase I-DNA binding could be a general primary determinant for the degree of camptothecin inhibition, the stability of binding to sequences downstream from the cleavage position might be of importance for the accessibility of a topoisomerase I complex to camptothecin. Based on the above comparison of our present results and the earlier models (Hertzberg et al., 1990; Jaxel et al., 1991), we propose the following modified model for camptothecin inhibition of topoisomerase I action: initial non-covalent binding of topoisomerase I to most of its DNA targets in double-stranded DNA sites is stable, preventing from entering the enzyme-DNA camptothecin complex and thereby from interfering with the
1029
cleavage reaction of the enzyme. Upon topoisomerase I-mediated cleavage, however, the structure of the DNA (now nicked) and thereby of the enzyme-DNA complex is altered, and the stability of some of the non-covalent DNA interactions therefore reduced. A generally reduced stability of non-covalent binding has no effect on religation in the absence of the drug, since it has previously been shown that religation is not affected by concentrations of salt which completely disrupt non-covalent enzyme-DNA binding (Svejstrup et al., 1991). In the presence of the drug, however, the above mentioned reduction of some non-covalent interactions makes it possible for camptothecin to enter the topoisomerase I-DNA complex., and thereby to inhibit the religation reaction of the enzyme. In contrast, the non-covalent binding of topoisomerase I to suicide DNA substrate may be expected to be unstable in some regions already before the cleavage event, due to the partly doublestranded structure of the substrate, enabling camptothecin to interact with topoisomerase I already at this stage and hence to inhibit the cleavage reaction of the enzyme. Thus, in addition to the models proposed by Hertzberg et al. (1990) and Jaxel et al. (1991), where camptothecin is suggested to inhibit the religation step only, we have shown that camptothecin is capable of inhibiting both the cleavage and religation steps of topoisomerase I in a manner which is likely to depend on the stability of the noncovalent enzyme-DNA complex. Therefore, camptothecin should not be viewed solely as an inhibitor of the religation reaction of topoisomerase I, but rather as a general inhibitor of the errzyme’s cleavage and religation reactions. We wish to thank
Drs Kent
Andersen for helpful B. Dal1 for
skilful
Christiansen
and Anni
H.
discussions and K. Andersen and
technical
assistance. This work was Society (grant 90.020), the Danish Center for Human Genome Research, the Danish Research Council, the Carlsberg Foundation, the Danish National Agency of Technology (1987-1331444~870714), and NATO grant (5-%05/RG 0157188) for international collaboration in research.
supported by Danish Cancer
References Andersen,
A. H.,
Jensen,
Christiansen,
P. S., Osheroff,
K.,
N.
Zechiedrich,
E. L.,
& Westergaard,
0.
(1989). Strand specificity of the topoisomerase II mediated double-stranded DNA cleavage reaction. Biochemistry, 28, 6237-6244. Andoh, T., Ishii, K., Suzuki, Y ., Ikegami, Y., Kusunoki, Takemoto, Y. & Okada, K. (1987). Y., Characterization of a mammalian mutant with a camptothecin-resistant DNA topoisomerase I. Proc. Nat. Acad. Sci., U.S.A. 84, 5565-5669. Bonven, B. J., Gocke, E. & Westergaard, 0. (1985). A high affinity topoisomerase I binding sequence is clustered at DNAase I hypersensitive sites in tetrahymena r-chromatin. Cell, 41, 541-551. Busk, H., Thomsen, B., Bonven, B. J., Kjeldsen, E., Nielsin, 0. F. & Westergaard, 0. (1987). Preferential
1030 relaxation decameric
E. Kjeldsen of supercoiled DNA recognition sequence
Nature (London),
containing a hexafor topoisomerase I.
327, 638-640.
Champoux, J. J. & Aronoff, R. (1989). The effects of camptothecin on the reaction and the specificity of the wheat germ type I topoisomerase. J. Biol. Chem. 264, 1010-1015. Christiansen, K., Bonven, B. J. & Westergaard, 0. (1987). Mapping of sequence-specific chromatin proteins by a novel method: topoisomerase I on tetrahymena riboJ. Mol. Biol. 193, 517-525. somal chromatin. Covey, J. M., Jaxel, C., Kohn, K. W. 8i Pommier, Y. (1989). Protein-linked DNA strand breaks induced in mammalian cells by camptothecin, an inhibitor of topoisomerase I. Cancer Res. 49, 5016-5022. Degrassi, F., De-Salvia, R.; Tanzarella, C. $ Palitti. F. (1989). Induction of chromosomal aberrations and SCE by camptothecin, an inhibitor of mammalian topoisomerase I. Mutat. Res. 211, 125-130. Giovanella, B. C.; Stehlin, J. S., Wall, M. E., Wani, M. C.; Nicholas, A. W., Liu, L. F., Silber, R. & Potmesil, M. (1989). DNA topoisomerase I-targeted chemotherapy of human colon cancer in xenografts. Xcience, 46, 104661048. Gromova, I. I., Buchman, V. L.; Abagyan, R. A.; Ulyanov, A. V. & Bronstein, I. B. (1990). Sequence dependent modulating effect of camptothecin on the DNA-cleaving activity of calf thymus t’ype I topoisomerase. Nucl. Acids Res. 18, 637-645. Hertzberg, R. P., Caranfa, M. J. & He&t, S. M. (1989). On the mechanism of topoisomerase I inhibition by camptothecin: evidence for binding to an enzymeDNA complex. Biochemistry, 28, 4629-4638. Hertzberg. R. P., Busby, R. W., Caranfa, M. J., Holden; K. J., Johnson, R. K., Hecht, S. M. 8: Kingsbury, W. D. (1990). Irreversible t,rapping of the DNA-topoisomerase I covalent complex. J. Biol. Chem. 265, 19287719295. Hsiang, Y.-H., Hertzberg; R. P., Hecht, S. & Liu, L. F. (1985). Camptothecin induces protein-linked DNA breaks via mammalian DNA topoisomerase I. J. Biol. Chem. 260, 14873-14878.
Edited
et ai. Jaxel,
C., Capranisco, G.; Kerrigan, D., Kohn, K. W. & Pommier, Y. (1991). Effect of local DN-4 sequence on topoisomerase I cleavage in the presence or absence of camptothecin. J. Biol. Chem. 266; 20418-20423. Kessel, D., Bosmann, H. B. & Lohr, K. (1972). Camptothecin effects on DNA synthesis in murine leukemia cells. Biochim. Bioph,ys. Acta, 269: 210-216. Kjeldsen, E., Mollerup, S., Thomsen, B., Bonven, B. J., Bolund, L. & Westergaard, 0. (198Sa). Sequencedependent effect of camptothecin on human topoisomerase I DNA cleavage. J. MOE. Biol. 202. 333-342. Kjeldsen, E., Bonven, B. J., dndoh. T., Ishii, K.; Okada, K., Bolund, L. & West,ergaard. 0. (198%). Characterization of a camptothecin-resistant human DNA topoisomerase I. J. Biol. Chem. 263, 39123916. Krogh, S.. Mortensen, U. H., Westergaard, 0. & Bonvm, B. J. (1991). Eukaryotic topoisomerase T-DNA interaction is stabilized by helix curvature. ,Irucl. Acids Res. 19, 12351241. Nit&s, J. & Wang, J. C. (1988). DN$ topoisomerasetargeting antitumor drugs can be studied in yeast.
Proc. Nat. Aead. Sci., U.S.A. 85, 7501-7505. Shen, C. C. & Shen, C.-K. J. (1990). Specificity and flexibility of the recognition of DNA helical structure by eukaryotic topoisomerase I. J. Mol. Riol. 212,
67-78. Svejstrup, J. Q., Christiansen, K., Andersen, A. H., Lund, K. & Westergaard, 0. (1990). Minimal DNA duplex requirements for topoisomerase I-mediated cleavage in vitro. J. Biol. Chem. 265, 12529-12535. Svejstrup, J. Q., Christiansen, K., Gromova. I. I., Andersen, A. H. & Westergaard, 0. (1991). New technique for uncoupling the cleavage and religation reactions of eukaryotie topoisomerase I. The mode of action of camptothecin at a specific recognition site.
J. Mol. BioE. 222, 669-678. Thomsen, B., Mollerup, S., Bonven, B. J., Frank; R., Blocker, H., Nielsen, 0. F. & Westergaard. 0. (1987). Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin. EMBO J. 6: 1817-1823.
by J. Karn