- Email: [email protected]
Cancer immunotherapeutic effects of novel CpG ODN in murine tumor model
International Immunopharmacology (2008) 8, 1401–1407
w w w. e l s e v i e r. c o m / l o c a t e / i n t i m p
Cancer immunotherapeutic effects of novel CpG ODN in murine tumor model Hyeon Cheol Cho a,1 , Bo Hwan Kim a,1 , Kyunghoon Kim d , Ju Youn Park a , Jae-Ho Chang a , Soo-Ki Kim a,b,c,⁎ a
Department of Microbiology, Wonju College of Medicine, Yonsei University, Wonju 220-701, South Korea Institute of Lifelong Health, Wonju College of Medicine, Yonsei University, Wonju 220-701, South Korea c Institute of Basic Medical Science, Wonju College of Medicine, Yonsei University, Wonju 220-701, South Korea d Divison of Life Sciences, College of Natural Sciences, Kangwon National University, Chunchon, 200-701, South Korea b
Received 15 January 2008; received in revised form 25 April 2008; accepted 20 May 2008 KEYWORDS CpG ODN; Cancer; Immunotherapy; NK cell; Cytokine
Abstract While CpG oligodeoxynucleotides (ODN) are excellent candidates for cancer immunotherapeutics, the numbers of usable CpG ODNs are limited in current clinical settings. To resolve this, we investigated whether novel CpG ODN (KSK-CpG) would be an effective immunotherapeutic in a murine tumor model by affecting in vivo and in vitro parameters, such as survival span, the number of tumor nodules, natural killer (NK) cell and cytotoxic T lymphocyte (CTL) activity and interleukin (IL)-6 or IL-12 cytokine release in splenocytes. We found that KSK-CpG was effective in the murine cancer model by way of prolonging survival span, reducing the number of tumor nodules, augmenting NK cell and CTL cytotoxicity, as well as evoking IL-6 and IL-12 cytokine release in splenocytes. Collectively, these data demonstrate that KSK-CpG is active against the highly malignant B16BL6 and EL4 tumor mouse model via innate immune augmentation. Crown Copyright © 2008 Published by Elsevier B.V. All rights reserved.
1. Introduction Unmethylated CpG oligoneucleotide (ODN) motifs mimicking bacterial DNA are toll-like receptor (TLR) 9 agonists that confer innate immunocytes such as natural killer (NK) cells, monocytes, macrophages and dendritic cells to proliferate,
⁎ Corresponding author. Department of Microbiology, Wonju College of Medicine, Yonsei University, Wonju 220-701, South Korea. Tel.: +82 33 741 0323; fax: +82 33 742 5034. E-mail address: [email protected] (S.-K. Kim). 1 Equally contributed as 1st author.
mature and produce various cytokines and chemokines such as interleukin (IL)-6, IL-12, tumor necrosis factor (TNF) and interferon (IFN)-α/-β in vertebrates [1–8], consequently harnessing these immunocytes against cancer. Currently, the primary focus for the medicinal application of CpG ODNs has been for cancer immunotherapy in preclinical and clinical trials against cancer [9–13]. Although many CpG ODNs have been designed for cancer immunotherapeutics, the numbers of usable CpG ODNs are limited in current clinical settings. To resolve this, we first created novel CpG ODN (KSK-CpG) for human usage, and subsequently demonstrated that in vitro and in vivo treatment of splenocytes with KSK-CpG could potently elicit a Th1 immune response [14], suggesting
1567-5769/$ - see front matter. Crown Copyright © 2008 Published by Elsevier B.V. All rights reserved. doi:10.1016/j.intimp.2008.05.010
1402
H.C. Cho et al.
excellent adjuvanticity equivalent or superior to known human CpG 2006 used in current clinical settings [12]. This CpG ODN has human motif in 5′ upstream sequence and different sequence, activity and mechanism (closer to type C rather than B) when compared to human CpG Gold standard 2006 (type B). Given this finding, we investigated whether KSK-CpG would be an effective immunotherapeutic against a murine tumor model by leveling in vivo and in vitro parameters, including: survival span, the number of tumor nodules, natural killer (NK) cell and cytotoxic T lymphocytes (CTL) activation, and IL-6 or IL-12 cytokine release from splenocytes. Herein, we report that KSK-CpG is active against the highly malignant B16BL6 and EL4 tumor mouse models via innate immune augmentation.
2. Materials and methods 2.1. Mice The animal use and care protocols for these experiments were approved by the Institutional Review Board of the Yonsei Wonju College of Medicine at Wonju. Six-week-old female C57BL/6 and C3H/N mice were maintained in specific pathogen-free conditions and purchased from KOATECH (Pyungteack, Kyungkido). All mice were fed with a commercial diet and provided water ad libitum.
2.2. Cell lines and culture The murine cancer cell lines (YAC-1, B16BL6, and EL4) were obtained from the Korean Cell Line Bank (Seoul, Korea). YAC-1 cell line was used for NK cytotoxicity assay. B16BL6 was used for cytotoxic T lymphocytes assay as well as in vivo lung metastasis assay, and EL4 cell line were used for in vivo survival assay. All test cells were cultured in RPMI1640 medium with 2 mM L-glutamine adjusted to contain 1.5 g/l sodium bicarbonate, 4.5 g/l glucose, 10 mM 4-(2hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), and 1.0 mM sodium pyruvate, or Dulbeco's modified Eagle's medium (DMEM) with 4 mM L-glutamine adjusted to contain 1.5 g/l sodium bicarbonate and 4.5 g/l glucose. All media contained 1% penicillin-streptomycinamphotericin B and 10% fetal bovine serum (FBS).
2.3. CpG oligodeoxynucleotides CpG ODNs were completely phosphorothioate-modified. These were provided by MWG-Biotech AG (Ebersberg, Germany). The sequences used are shown in (Table 1). All CpG ODNs contained b0.1 EU/ml of endotoxin as determined by the Limulus assay (Bio-Whittaker, Walkersville, MD, USA).
2.4. Cytokine release assay The mouse spleen cells were plated onto 24-well dishes (1 × 106 cells per well). Each CpG ODN, dissolved in Tris EDTA (TE) buffer, was
Table 1
Sequence of CpG ODNs
Non-CpG ODN 5′ TCCAGGACTTCTCTCAGGTT 3′ 1826 (mouse motif): 5′ TCCATGACGTTCCTGACGTT 3′ 2006 (human motif) 5′ TCGTCGTTTTGTCGTTTTGTCGTT 3′ KSK-CpG (novel CpG ODN): 5′ TCGTCGTTTTCGTCGTCGTTTT 3′
added to the cultured cells at a final concentration of 0.5, 1, 2, 5, or 10 μg/ml. The cells were cultured at 37 °C in a humidified incubator with 5% CO2 and the culture supernatants were collected after 24 h. The concentrations of murine IL-6 and IL-12 in supernatants were measured by commercially available enzyme-linked immunosorbent assay (ELISA) kits (Komabiotech, Seoul, Korea). Color reaction developed was measured as OD unit at 450 nm on ELISA reader (Molecular Devices Emax, USA). The concentrations of each cytokine in pg/ml by kit's standard curve were plotted. The experiments were performed in triplicate for each concentration of all CpG ODNs.
2.5. Direct cytotoxicity assay of KSK-CpG on B16BL6 melanoma cells Direct cytotoxicity of KSK-CpG on B16BL6 melanoma cells was determined using 3-[4,5Dimethylthiazol-2-yl],5-diphenyltetrazolium bromide or triazolyl blue (MTT) assay [15]. In brief, 1 × 104 cells were grown in a 96 well plate and exposed to KSK-CpG ODN, the other CpG ODNs, cisplantin or control. After incubation for 48 h, the MTT assay was performed. The absorbance at 595 nm was recorded using a FluorS™ Multimager microplate reader (BIO-RAD, USA) and the cell survival was calculated by dividing the mean OD of oligo-containing wells by that of DMSO-control wells.
2.6. NK cytotoxicity assay The splenic NK cell activity was determined by 51Cr-release assays using YAC-1 cells as target. Briefly, 5 × 103 (Na51 2 CrO4)-labeled target cells suspended in 100 μl RPMI 1640 medium supplemented with 10% FBS were seeded into V-bottomed microtiter wells. The appropriate numbers of effecter cells suspended in 50 μl assay medium were added to the wells and incubated for 4 to 6 h, and 100 μl supernatant was collected from each well. The percentage of specific lysis was calculated as follows: (cpm experimental release − cpm spontaneous release) / (cpm maximal release − cpm spontaneous release) × 100.
2.7. Cytotoxic T lymphocytes assay To evaluate CTL, we used in vivo-passaged B16BL6 melanoma cell as target cell and Tcell in mouse splenocytes as effector cell [16]. Briefly, harvested target cells washed twice, resuspended at 1 × 106 cells in 200 ul of RPMI with 10% FBS and labeled with 100 uCi 51Cr(BMS, USA) for 2–3 h at 37 °C in a 5% CO2 incubator. After labeling, the cells were washed three times in RPMI with 10% FBS and seeded in U-shaped 96well microtiter plates at 1 × 104 cells/well. The effector T cells were isolated from murine splenocytes with Ficoll and nylon wool methods [17]. The effector cells in suspension were added to triplicate or quadruplicate wells to make three E/Tratios in a final volume of 200 ul per well. The plates were then incubated for 4 h at 37 °C in a 5% CO2 incubator, 100 ul of supernatants were collected from each well, and radioactivity was measured with a gamma counter. Total mean cytotoxicity± SE were calculated from triplicate or quadruplicate cpm values from individual groups.
2.8. In vivo survival assay The EL4 cells lymphoma cell lines, which are syngenic to C57BL6 mice, were maintained in vitro. EL4 cells were harvested and injected into the lateral tail vein of C57BL/6 mice at 2 × 104 cells per mouse. Various types of CpG ODNs were administered intraperitoneally at a dose of 10 μg/mouse four times during two weeks (day: 0, 3, 7, 10 and 14). Mice (6 to 10 mice per group) were checked daily for survival.
2.9. In vivo lung metastasis assay B16BL6 cells (2 × 104) in 0.2 ml of medium were injected intravenously. The schedule of CpG ODN therapy against metastasized mice
Cancer immunotherapeutic effects of novel CpG ODN in murine tumor model was the same as the EL4 tumor challenge model. Mice were killed by cervical dislocation on day 15 after B16BL6 tumor cell inoculation. The numbers of tumor nodules were determined by counting the metastatic foci macroscopically. Tumor nodules in at least six different lung sections were counted. The results were given as the Mean ± SD of B16BL6 nodules.
2.10. Statistical analysis Survival curves were estimated using the Kaplan–Meier method (Log-rank test) and analysis of differences in tumor nodules among the various groups was determined by one-way analysis of variance (ANOVA), Kruskal–Wallis test and Post test. All statistical tests were performed using GraphPad Prism (version 4.0, GraphPad Software, USA) or SPSS ver 12.0.
3. Results 3.1. KSK-CpG confers longer survival span against murine cancer in vivo To investigate the potential cancer immunotherapeutic effects of KSK-CpG, we checked the survival span of EL4 cells challenged by KSK-CpG. As seen in Fig. 1, there was a significant difference
1403
in survival span between the KSK-CpG group and the control group (p b 0.0001 or p b 0.05). In parallel, the survival span of the KSK-CpG group was comparable to that in both the mouse CpG (1826) and human CpG (2006) groups.
3.2. KSK-CpG inhibits lung metastasis in a murine cancer model Following an EL 4 therapy protocol, B16BL6 melanomaimplanted mice (8 mice per group) were treated to evaluate the inhibition of lung metastasis. Fig. 2 shows that tumor nodule counts from the lung tissue of mice treated with the KSK-CpG were significantly lower than those of other groups (p b 0.001 compared with control, p b 0.05 compared with non CpG).
3.3. KSK-CpG induces NK cell cytotoxicity and CTL activity To determine NK cell cytotoxicity and CTL activity following the KSK-CpG treatment, murine splenocytes and purified splenic T cells were used as effectors for each assay. As for NK activity, the percent lysis of target cell (YAC-1) following various CpG ODNs treatment was significantly higher than that of untreated or non
Figure 1 Survival prolonging effects of KSK-CpG in EL4 metastasized C57BL/6 mice model. On days 0, 3, 7, 10 and 14 and weekly thereafter, the mice were administered intraperitoneally at dose of 10 μg/mouse of the indicated ODN or control. A. KSK-CpG only. Mouse received 2 × 104 EL4 tumor cells intravenously (n = 12 per group). B. Comparing with mouse motif (1826). Mouse received 1 × 104 EL4 tumor cells intravenously (n = 7 per group). C. Comparing with human motif (2006). Mouse received 1 × 105 EL4 tumor cells intravenously (n = 7 per group). D. Overall survival. Mouse received 2 × 104 EL4 tumor cells intravenously (n = 6 per group). Analysis of each experiment yielded p b 0.0001 or p b 0.05.
1404
H.C. Cho et al.
Figure 2 Anti-metastasis effect of KSK-CpG in B16BL6 melanoma-challenged model. A. C57BL/6 mice were treated i.p. with of CpG ODNs after B16BL6 tumor challenge. Tumor nodules (Mean ± SD) were counted in lung sections (n = 8 per group). B. Photographs of the representative lungs of C57BL/6 mice after 15 day of tumor challenged mice treated with a PBS, non CpG, mouse CpG (1826), human CpG (2006), and the KSK-CpG as described in Materials and methods. CpG group (Fig. 3). In addition, we measured CTL activity of splenic T cells from B16BL6 tumor bearing mice following mouse or KSK-CpG treatment. While overall CTL activities of mouse or KSK-CpG group were low (the highest: below 7.5% lysis in E/T ratio, 100), CTL activity of KSK-CpG treated mice was
Figure 3 Mouse NK cell activity of various CpG ODNs. Various CpG ODNs (10 ug per mouse) were injected intravenously. In 18 h post-injection, the mice were sacrificed and non-adherent splenocytes were isolated and treated with each CpG ODN (10 ug/ml) for 2 h and cocultured with 5 × 103 Cr-labeled YAC-1 cells for measurement of NK activity.
Figure 4 In vivo CpG treatment induces CTL activity in B16BL6 tumor bearing mice. CTL acitivity of mouse CpG or KSK-CpG groups was higher than that of normal or B16BL6. Normal: B16BL6 tumorfree mice. B16BL6: B16BL6 tumor-bearing mice without treatment. Mouse CpG: B16BL6 tumor-bearing mice with 10ug mouse CpG per mouse. KSK-CpG: B16BL6 tumor-bearing mice with 10 µg KSK-CpG per mouse. ⁎⁎Mouse CpG vs. normal or B16BL6 (p b 0.01) in E/T ratio 100, ⁎mouse CpG vs. normal (p b 0.05) in E/T ratio 30, # KSK-CpG vs. normal or B16BL6 (p b 0.01) in E/T ratio 100.
Cancer immunotherapeutic effects of novel CpG ODN in murine tumor model
1405
Figure 5 Comparative IL-6 and IL-12 cytokine release from murine splenocytes stimulated by various CpG ODNs. A. IL-6 cytokine production B. IL-12 cytokine production. For measuring each cytokine production, 1 × 106 splenocytes were cultured on a 24-well plate before treated with the indicated dose of each CpG ODN (0, 1, 2, 5, 10 μg/ml), and cultured in at 37 °C in a 5% CO2 incubator for 24 h. After collecting supernatants, cytokine was measured by ELISA assay. The KSK-CpG dose-dependently induced IL-6 and IL-12 cytokine release, which was higher than human or non CpG ODN but less than mouse CpG ODN.
significantly higher than that of normal or untreated B16BL6 (p b 0.01) in E/T ratio 100 (Fig. 4), strongly suggesting that In vivo KSK-CpG treatment without antigen addition could activate CTL in tumor bearing mice.
3.4. KSK-CpG induces IL-6 and IL-12 cytokine release from murine splenocytes To comparatively quantitate IL-6 and IL-12 cytokine release from murine splenocytes, five different doses (0.5 μg/ml–10 ug/ml) of various CpG ODNs were incubated with the cells prior to the cytokine assay. Fig. 5 shows that the KSK-CpG dose-dependently induced IL-6 and IL-12 cytokine release, which was higher than
human or non CpG ODN but, less than mouse CpG ODN. Considering dose-dependent cytokine kinetics, overall IL-12 levels following KSK-CpG treatment was higher than IL-6 levels, showing that KSK-CpG is strong immunoadjuvant for induction of Th1 cytokine.
3.5. KSK-CpG has no direct cytotoxicity against B16BL6 melanoma cells To evaluate the direct cytotoxic action of KSK-CpG on cancer cells, an MTT assay was done. Fig. 6 clearly shows that KSK-CpG failed to cause direct cytotoxicity against the B16BL6 cancer cells, even at the highest concentration.
Figure 6 KSK-CpG has no direct cytotoxicity against B16BL6 melanoma cells. A. Cell survival following in vitro treatment of various doses of KSK-CpG on B16BL6 melanoma cells. 5 × 103 B16BL6 cells were cultured on a 96-well plate before treated with the indicated dose of KSK-CpG (0, 0.15625, 0.315, 0.625, 1.25, 5, 10 μg/ml), and cultured in at 37 °C in a 5% CO2 incubator for 24 h. After MTT assay, cell survival was measured by ELISA READER at the wavelength of 595 nm. B. Comparison of cell survival among other CpG ODNs and cisplantin. 5 × 103 B16BL6 cells were cultured on a 96-well plate before treated with each CpG ODN (0.6 μg/ml per well) and cisplantin (125 μg/ml) for positive control, and cultured at 37 °C in a 5% CO2 incubator for 24 h. After MTT assay, cell survival was measured by ELISA READER at the wavelength of 595 nm.
1406
4. Discussion This study demonstrates that KSK-CpG is an active cancer immunotherapeutic agent against highly malignant tumor challenged model. First, our major findings stem from in vivo observations of prolonged survival span and blocking of lung metastasis. As earlier described, KSK-CpG has several medicochemical features: closer to type C structure with partial palindromic sequence, strong antibody forming activity (B cell-adjuvantivity), strong NK cell activity and less toxicity to host and immune cells when compared to known human CpG 2006. However, this expecting immunotherapeutic activity has been unproven in aggressive murine tumor models. Thus, for objective comparison, we used two gold standard CpG ODNs, mouse type (1826) and human type (2006) CpG ODN, which have been proven effective by a multitude of studies [9,18– 21]. Surprisingly, in comparison with these representative CpG ODN (1826 and 2006) motifs, KSK-CpG seems to be at least equivalent or superior. In particular, the KSK-CpG was clearly active in a differentially dosed EL4-challenged model. Considering that EL4 cells are less sensitive to NK cell killing and might be lymphatic-borne and highly malignant, KSK-CpG might be beneficial for immunotherapy against NK-insensitive hematologic cancer. Next, we sought to uncover the immune mechanism that supports the findings of in vivo experiments by measuring NK cell cytotoxicity, CTL activity, and IL-6 or IL-12 cytokine release. We have previously shown the Th1 dominance of KSK-CpG [14], but direct evidence related to NK activity and Th1 cytokine release was lacking. Consistent with in vivo B16BL6 melanoma metastasis blocking data, Fig. 3 clearly shows that NK-enriched cells activated by in vitro treatment of the KSK-CpG could kill YAC-1 because B16BL6, YAC-1 cells are prone to death by NK cells. Likewise, CTL activity of KSKCpG treated mice was detectable and significantly higher than that of normal or untreated B16BL6 mice (p b 0.01) in E/ T ratio 100 (Fig. 4), strongly suggesting that in vivo CpG ODN treatment without antigen addition acvtivates CTL in tumor bearing mice. Given these, we speculate that NK cell and CTLs from KSK-CpG treated mice might constitute one of major effectors against murine hematoligic cancer metastasis. Consistently, KSK-CpG activates Th1 cell through induction of IL-6 and IL-12 expression in splenocytes. Fig. 6 shows that the escalated dose of the KSK-CpG induces IL-6 and IL-12 cytokine release in a dose-dependent manner. In particular, because overall IL-12 levels following KSK-CpG treatment was higher than IL-6 levels, effective Th1 induction is explainable. Importantly, Th1 cytokine induction of KSK-CpG is superior to that of human CpG 2006 for clnical trial. This excellent Th1 dominance provides key theory to break down immunotolerance exerted by tumor. Coupled with in vivo and in vitro evidences, we infer that the KSKCpG was active against highly malignant murine cancer via NK cell and CTL activation as well as by way of Th1 cytokine (IL-6 and IL-12) induction. This Th1 polarized action confirmed the previous immunoadjuvanticity [14]. Because KSK-CpG is close to type C and more targetable to human cells, potent NK activity as well as B and T cell adjuvanticity is possible. However, murine system used in this experiment is not optimal to gauge the immunoacivity of KSK-CpG as human motif.
H.C. Cho et al. While KSK-CpG has cancer immunotherapeutic effects, these effects might be due to a direct detriment to cancer cells. MTT assay revealed that the KSK-CpG was not directly cytotoxic to B16BL6 melanoma cell. This was compatible with the absence of cytotoxicity of murine CpG ODN (1826) in neuroblastoma in vitro [22]. Moreover, the mice treated repeatedly with the KSK-CpG display less damage in the spleen and liver when compared to 1826 CpG ODN-treated mice (data not shown). Given this potential insensitivity to in vitro and in vivo toxicity, we speculate that our KSK-CpG could rapidly be applied in preclinical and clinical study. Collectively, these data demonstrate that KSK-CpG is active against the highly malignant B16BL6 and EL4 tumor mouse models via innate immune augmentation. The results of our study might hold important preclinical and clinical implications with cancer immunotherapeutic use in a wide array of cancers. Toward improving the therapeutic efficacy of CpG ODN, further studies are currently underway.
Acknowledgements This study was supported by a grant from National Cancer Control R&D Program 2002 and a grant (A050485) of the Korea Health 21 R&D Project Ministry of Health & Welfare, and by a grant (06132KFDA395) from Korea Food & Drug Administration in 2006, Republic of Korea.
References [1] Akira S, Takeda K, Kaisho T. Toll-like receptors: critical proteins linking innate and acquired immunity. Nat Immunol 2001;2:675–80. [2] Chu RS, Targoni OS, Krieg AM, Lehmann PV, Harding CV. CpG oligodeoxynucleotides act as adjuvants that switch on T helper 1(Th1) immunity. J Exp Med 1997;186:1623–31. [3] Duin DR, Medzhitov, Shaw AC. Triggering TLR signaling in vaccination. Trends Immunol 2006;27:49–55. [4] Klinman DM, Yi AK, Beaucage SL, Conover J, Krieg AM. CpG motifs present in bacterial DNA rapidly induce lymphocytes to secrete interleukin 6, interleukin 12, and interferon γ. Proc Natl Acad Sci U S A 1996;93:2879–83. [5] Krieg AM. CpG motifs in bacterial DNA and their immune effects. Annu Rev Immunol 2002;20:709–60. [6] Krieg AM, Yi AK, Matson S, Waldscjmidt TJ, Bishop GA, Teasdale R, et al. CpG motifs in bacterial DNA trigger direct B cell activation. Nature 1995;374:546–9. [7] Krug A, Rothenfusser S, Hornung V, Jahrsdörfer B, Blackewll S, Ballas ZK, et al. Identification of CpG oligonucleotide sequences with high induction of IFN-α/β in plasmacytoid dendritic cells. Eur J Immunol 2001;31:2154–63. [8] Takeda K, Akira S. Toll-like receptors in innate immunity. Int Immunol 2005;17:1-14. [9] Ballas ZK, Krieg AM, Warren T, Rasmussen W, Davis HL, Wldschmidt M, et al. Divergent therapeutic and immunologic effects of oligodeoxynucleotides with distinct CpG motifs. J Immunol 2001;167:4878–86. [10] Carpentier A, Laigle-Donadey F, Zohar S, Capelle L, Behin A, Tibi A, et al. Phase 1 trial of a CpG oligonucleotide for patients with recurrent glioblastoma. Neuro-oncology 2006;8:60–6. [11] Friedberg JW, Kim H, McCauley M, Hessel EM, Sims P, Fisher DC, et al. Combination immunotherapy with a CpG oligonucleotide (1018 ISS) and rituximab in patients with non-Hodgkin lymphoma: increased interferon-α/β-inducible gene expression, without significant toxicity. Blood 2005;105:489–95.
Cancer immunotherapeutic effects of novel CpG ODN in murine tumor model [12] Gerda Goess MP, Wagner C, Hormann M, Jandl T, Moser A, Britten CM, et al. Phase II trial of a Toll-Like Recetor 9activating oligonucleotide in patients with metastatic melanoma. J Clin Oncol 2006;24:5716–24. [13] Krieg AM. Development of TLR9 agonists for cancer therapy. J Clin Invest 2007;117:1184–94. [14] Park SJ, Cho HC, Bae KS, Kim SK. Immunoadjuvanticity of novel CpG ODN (oligodeoxynucleotide). Mol Cell Toxicol 2007;3:46–52. [15] Lee SM, Kim K, Kim Y, Kim HW, Shim BI, Lee SH, et al. The antiinflammatory effect of IH-901 in HT-29 cells. Mol Cell Toxicol 2007;3:254–61. [16] D'Agostini C, Pica F, Febbraro G, Grelli S, Chiavaroli C, Garaci E. Antitumor effect of OM-174 and Cyclophosphamide on murine B16 melanoma in different experimental conditions. Int Immunopharmacol 2005;5:1205–12. [17] Coligan JE, Kruisbeek AM, Margulies DH, Shevach EM, Strober W. Current protocols in immunology. New York: Wiely-interscience; 2000. p. 3.1.1–5. [18] Heckelsmiller K, Rall K, Beck S, Schlamp A, Seiderer J, Jahrsdorfer B, et al. Peritumoral CpG DNA elicits a coordinated
[19]
[20]
[21]
[22]
1407
response of CD8T cells and innate effectors to cure established tumors in a murine colon carcinoma model. J Immunol 2002;168:3892–9. Roda JM, Parihar R, Carson III WE. CpG-containing oligodeoxynucleotides act through TLR9 to enhance the NK cell cytokine response to antibody-coated tumor cells. J Immunol 2005;175:1619–27. Switaj T, Jalili A, Jakubowska AB, Drela N, Stoksik M, Nowis D, et al. CpG immunostimulatory oligodeoxynucleotide 1826 enhances antitumor effect of interleukin 12 gene-modified tumor vaccine in a melanoma model in mice. Clin Cancer Res 2004;10:4165–75. Weigel BJ, Rodeberg DA, Krieg AM, Blazar BR. CpG oligodeoxynucleotides potentiate the antitumor effects of chemotherapy or tumor resection in an orthotopic murine model of rhabdomyosarcoma. Clin Cancer Res 2003;9:3105–14. Carpentier AF, Chen L, Maltonti F, Delattre J. Oligodeoxynucleotides containing CpG motifs can induce rejection of a neuroblastoma in mice. Cancer Res 1999;59:5429–32.
w w w. e l s e v i e r. c o m / l o c a t e / i n t i m p
Cancer immunotherapeutic effects of novel CpG ODN in murine tumor model Hyeon Cheol Cho a,1 , Bo Hwan Kim a,1 , Kyunghoon Kim d , Ju Youn Park a , Jae-Ho Chang a , Soo-Ki Kim a,b,c,⁎ a
Department of Microbiology, Wonju College of Medicine, Yonsei University, Wonju 220-701, South Korea Institute of Lifelong Health, Wonju College of Medicine, Yonsei University, Wonju 220-701, South Korea c Institute of Basic Medical Science, Wonju College of Medicine, Yonsei University, Wonju 220-701, South Korea d Divison of Life Sciences, College of Natural Sciences, Kangwon National University, Chunchon, 200-701, South Korea b
Received 15 January 2008; received in revised form 25 April 2008; accepted 20 May 2008 KEYWORDS CpG ODN; Cancer; Immunotherapy; NK cell; Cytokine
Abstract While CpG oligodeoxynucleotides (ODN) are excellent candidates for cancer immunotherapeutics, the numbers of usable CpG ODNs are limited in current clinical settings. To resolve this, we investigated whether novel CpG ODN (KSK-CpG) would be an effective immunotherapeutic in a murine tumor model by affecting in vivo and in vitro parameters, such as survival span, the number of tumor nodules, natural killer (NK) cell and cytotoxic T lymphocyte (CTL) activity and interleukin (IL)-6 or IL-12 cytokine release in splenocytes. We found that KSK-CpG was effective in the murine cancer model by way of prolonging survival span, reducing the number of tumor nodules, augmenting NK cell and CTL cytotoxicity, as well as evoking IL-6 and IL-12 cytokine release in splenocytes. Collectively, these data demonstrate that KSK-CpG is active against the highly malignant B16BL6 and EL4 tumor mouse model via innate immune augmentation. Crown Copyright © 2008 Published by Elsevier B.V. All rights reserved.
1. Introduction Unmethylated CpG oligoneucleotide (ODN) motifs mimicking bacterial DNA are toll-like receptor (TLR) 9 agonists that confer innate immunocytes such as natural killer (NK) cells, monocytes, macrophages and dendritic cells to proliferate,
⁎ Corresponding author. Department of Microbiology, Wonju College of Medicine, Yonsei University, Wonju 220-701, South Korea. Tel.: +82 33 741 0323; fax: +82 33 742 5034. E-mail address: [email protected] (S.-K. Kim). 1 Equally contributed as 1st author.
mature and produce various cytokines and chemokines such as interleukin (IL)-6, IL-12, tumor necrosis factor (TNF) and interferon (IFN)-α/-β in vertebrates [1–8], consequently harnessing these immunocytes against cancer. Currently, the primary focus for the medicinal application of CpG ODNs has been for cancer immunotherapy in preclinical and clinical trials against cancer [9–13]. Although many CpG ODNs have been designed for cancer immunotherapeutics, the numbers of usable CpG ODNs are limited in current clinical settings. To resolve this, we first created novel CpG ODN (KSK-CpG) for human usage, and subsequently demonstrated that in vitro and in vivo treatment of splenocytes with KSK-CpG could potently elicit a Th1 immune response [14], suggesting
1567-5769/$ - see front matter. Crown Copyright © 2008 Published by Elsevier B.V. All rights reserved. doi:10.1016/j.intimp.2008.05.010
1402
H.C. Cho et al.
excellent adjuvanticity equivalent or superior to known human CpG 2006 used in current clinical settings [12]. This CpG ODN has human motif in 5′ upstream sequence and different sequence, activity and mechanism (closer to type C rather than B) when compared to human CpG Gold standard 2006 (type B). Given this finding, we investigated whether KSK-CpG would be an effective immunotherapeutic against a murine tumor model by leveling in vivo and in vitro parameters, including: survival span, the number of tumor nodules, natural killer (NK) cell and cytotoxic T lymphocytes (CTL) activation, and IL-6 or IL-12 cytokine release from splenocytes. Herein, we report that KSK-CpG is active against the highly malignant B16BL6 and EL4 tumor mouse models via innate immune augmentation.
2. Materials and methods 2.1. Mice The animal use and care protocols for these experiments were approved by the Institutional Review Board of the Yonsei Wonju College of Medicine at Wonju. Six-week-old female C57BL/6 and C3H/N mice were maintained in specific pathogen-free conditions and purchased from KOATECH (Pyungteack, Kyungkido). All mice were fed with a commercial diet and provided water ad libitum.
2.2. Cell lines and culture The murine cancer cell lines (YAC-1, B16BL6, and EL4) were obtained from the Korean Cell Line Bank (Seoul, Korea). YAC-1 cell line was used for NK cytotoxicity assay. B16BL6 was used for cytotoxic T lymphocytes assay as well as in vivo lung metastasis assay, and EL4 cell line were used for in vivo survival assay. All test cells were cultured in RPMI1640 medium with 2 mM L-glutamine adjusted to contain 1.5 g/l sodium bicarbonate, 4.5 g/l glucose, 10 mM 4-(2hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), and 1.0 mM sodium pyruvate, or Dulbeco's modified Eagle's medium (DMEM) with 4 mM L-glutamine adjusted to contain 1.5 g/l sodium bicarbonate and 4.5 g/l glucose. All media contained 1% penicillin-streptomycinamphotericin B and 10% fetal bovine serum (FBS).
2.3. CpG oligodeoxynucleotides CpG ODNs were completely phosphorothioate-modified. These were provided by MWG-Biotech AG (Ebersberg, Germany). The sequences used are shown in (Table 1). All CpG ODNs contained b0.1 EU/ml of endotoxin as determined by the Limulus assay (Bio-Whittaker, Walkersville, MD, USA).
2.4. Cytokine release assay The mouse spleen cells were plated onto 24-well dishes (1 × 106 cells per well). Each CpG ODN, dissolved in Tris EDTA (TE) buffer, was
Table 1
Sequence of CpG ODNs
Non-CpG ODN 5′ TCCAGGACTTCTCTCAGGTT 3′ 1826 (mouse motif): 5′ TCCATGACGTTCCTGACGTT 3′ 2006 (human motif) 5′ TCGTCGTTTTGTCGTTTTGTCGTT 3′ KSK-CpG (novel CpG ODN): 5′ TCGTCGTTTTCGTCGTCGTTTT 3′
added to the cultured cells at a final concentration of 0.5, 1, 2, 5, or 10 μg/ml. The cells were cultured at 37 °C in a humidified incubator with 5% CO2 and the culture supernatants were collected after 24 h. The concentrations of murine IL-6 and IL-12 in supernatants were measured by commercially available enzyme-linked immunosorbent assay (ELISA) kits (Komabiotech, Seoul, Korea). Color reaction developed was measured as OD unit at 450 nm on ELISA reader (Molecular Devices Emax, USA). The concentrations of each cytokine in pg/ml by kit's standard curve were plotted. The experiments were performed in triplicate for each concentration of all CpG ODNs.
2.5. Direct cytotoxicity assay of KSK-CpG on B16BL6 melanoma cells Direct cytotoxicity of KSK-CpG on B16BL6 melanoma cells was determined using 3-[4,5Dimethylthiazol-2-yl],5-diphenyltetrazolium bromide or triazolyl blue (MTT) assay [15]. In brief, 1 × 104 cells were grown in a 96 well plate and exposed to KSK-CpG ODN, the other CpG ODNs, cisplantin or control. After incubation for 48 h, the MTT assay was performed. The absorbance at 595 nm was recorded using a FluorS™ Multimager microplate reader (BIO-RAD, USA) and the cell survival was calculated by dividing the mean OD of oligo-containing wells by that of DMSO-control wells.
2.6. NK cytotoxicity assay The splenic NK cell activity was determined by 51Cr-release assays using YAC-1 cells as target. Briefly, 5 × 103 (Na51 2 CrO4)-labeled target cells suspended in 100 μl RPMI 1640 medium supplemented with 10% FBS were seeded into V-bottomed microtiter wells. The appropriate numbers of effecter cells suspended in 50 μl assay medium were added to the wells and incubated for 4 to 6 h, and 100 μl supernatant was collected from each well. The percentage of specific lysis was calculated as follows: (cpm experimental release − cpm spontaneous release) / (cpm maximal release − cpm spontaneous release) × 100.
2.7. Cytotoxic T lymphocytes assay To evaluate CTL, we used in vivo-passaged B16BL6 melanoma cell as target cell and Tcell in mouse splenocytes as effector cell [16]. Briefly, harvested target cells washed twice, resuspended at 1 × 106 cells in 200 ul of RPMI with 10% FBS and labeled with 100 uCi 51Cr(BMS, USA) for 2–3 h at 37 °C in a 5% CO2 incubator. After labeling, the cells were washed three times in RPMI with 10% FBS and seeded in U-shaped 96well microtiter plates at 1 × 104 cells/well. The effector T cells were isolated from murine splenocytes with Ficoll and nylon wool methods [17]. The effector cells in suspension were added to triplicate or quadruplicate wells to make three E/Tratios in a final volume of 200 ul per well. The plates were then incubated for 4 h at 37 °C in a 5% CO2 incubator, 100 ul of supernatants were collected from each well, and radioactivity was measured with a gamma counter. Total mean cytotoxicity± SE were calculated from triplicate or quadruplicate cpm values from individual groups.
2.8. In vivo survival assay The EL4 cells lymphoma cell lines, which are syngenic to C57BL6 mice, were maintained in vitro. EL4 cells were harvested and injected into the lateral tail vein of C57BL/6 mice at 2 × 104 cells per mouse. Various types of CpG ODNs were administered intraperitoneally at a dose of 10 μg/mouse four times during two weeks (day: 0, 3, 7, 10 and 14). Mice (6 to 10 mice per group) were checked daily for survival.
2.9. In vivo lung metastasis assay B16BL6 cells (2 × 104) in 0.2 ml of medium were injected intravenously. The schedule of CpG ODN therapy against metastasized mice
Cancer immunotherapeutic effects of novel CpG ODN in murine tumor model was the same as the EL4 tumor challenge model. Mice were killed by cervical dislocation on day 15 after B16BL6 tumor cell inoculation. The numbers of tumor nodules were determined by counting the metastatic foci macroscopically. Tumor nodules in at least six different lung sections were counted. The results were given as the Mean ± SD of B16BL6 nodules.
2.10. Statistical analysis Survival curves were estimated using the Kaplan–Meier method (Log-rank test) and analysis of differences in tumor nodules among the various groups was determined by one-way analysis of variance (ANOVA), Kruskal–Wallis test and Post test. All statistical tests were performed using GraphPad Prism (version 4.0, GraphPad Software, USA) or SPSS ver 12.0.
3. Results 3.1. KSK-CpG confers longer survival span against murine cancer in vivo To investigate the potential cancer immunotherapeutic effects of KSK-CpG, we checked the survival span of EL4 cells challenged by KSK-CpG. As seen in Fig. 1, there was a significant difference
1403
in survival span between the KSK-CpG group and the control group (p b 0.0001 or p b 0.05). In parallel, the survival span of the KSK-CpG group was comparable to that in both the mouse CpG (1826) and human CpG (2006) groups.
3.2. KSK-CpG inhibits lung metastasis in a murine cancer model Following an EL 4 therapy protocol, B16BL6 melanomaimplanted mice (8 mice per group) were treated to evaluate the inhibition of lung metastasis. Fig. 2 shows that tumor nodule counts from the lung tissue of mice treated with the KSK-CpG were significantly lower than those of other groups (p b 0.001 compared with control, p b 0.05 compared with non CpG).
3.3. KSK-CpG induces NK cell cytotoxicity and CTL activity To determine NK cell cytotoxicity and CTL activity following the KSK-CpG treatment, murine splenocytes and purified splenic T cells were used as effectors for each assay. As for NK activity, the percent lysis of target cell (YAC-1) following various CpG ODNs treatment was significantly higher than that of untreated or non
Figure 1 Survival prolonging effects of KSK-CpG in EL4 metastasized C57BL/6 mice model. On days 0, 3, 7, 10 and 14 and weekly thereafter, the mice were administered intraperitoneally at dose of 10 μg/mouse of the indicated ODN or control. A. KSK-CpG only. Mouse received 2 × 104 EL4 tumor cells intravenously (n = 12 per group). B. Comparing with mouse motif (1826). Mouse received 1 × 104 EL4 tumor cells intravenously (n = 7 per group). C. Comparing with human motif (2006). Mouse received 1 × 105 EL4 tumor cells intravenously (n = 7 per group). D. Overall survival. Mouse received 2 × 104 EL4 tumor cells intravenously (n = 6 per group). Analysis of each experiment yielded p b 0.0001 or p b 0.05.
1404
H.C. Cho et al.
Figure 2 Anti-metastasis effect of KSK-CpG in B16BL6 melanoma-challenged model. A. C57BL/6 mice were treated i.p. with of CpG ODNs after B16BL6 tumor challenge. Tumor nodules (Mean ± SD) were counted in lung sections (n = 8 per group). B. Photographs of the representative lungs of C57BL/6 mice after 15 day of tumor challenged mice treated with a PBS, non CpG, mouse CpG (1826), human CpG (2006), and the KSK-CpG as described in Materials and methods. CpG group (Fig. 3). In addition, we measured CTL activity of splenic T cells from B16BL6 tumor bearing mice following mouse or KSK-CpG treatment. While overall CTL activities of mouse or KSK-CpG group were low (the highest: below 7.5% lysis in E/T ratio, 100), CTL activity of KSK-CpG treated mice was
Figure 3 Mouse NK cell activity of various CpG ODNs. Various CpG ODNs (10 ug per mouse) were injected intravenously. In 18 h post-injection, the mice were sacrificed and non-adherent splenocytes were isolated and treated with each CpG ODN (10 ug/ml) for 2 h and cocultured with 5 × 103 Cr-labeled YAC-1 cells for measurement of NK activity.
Figure 4 In vivo CpG treatment induces CTL activity in B16BL6 tumor bearing mice. CTL acitivity of mouse CpG or KSK-CpG groups was higher than that of normal or B16BL6. Normal: B16BL6 tumorfree mice. B16BL6: B16BL6 tumor-bearing mice without treatment. Mouse CpG: B16BL6 tumor-bearing mice with 10ug mouse CpG per mouse. KSK-CpG: B16BL6 tumor-bearing mice with 10 µg KSK-CpG per mouse. ⁎⁎Mouse CpG vs. normal or B16BL6 (p b 0.01) in E/T ratio 100, ⁎mouse CpG vs. normal (p b 0.05) in E/T ratio 30, # KSK-CpG vs. normal or B16BL6 (p b 0.01) in E/T ratio 100.
Cancer immunotherapeutic effects of novel CpG ODN in murine tumor model
1405
Figure 5 Comparative IL-6 and IL-12 cytokine release from murine splenocytes stimulated by various CpG ODNs. A. IL-6 cytokine production B. IL-12 cytokine production. For measuring each cytokine production, 1 × 106 splenocytes were cultured on a 24-well plate before treated with the indicated dose of each CpG ODN (0, 1, 2, 5, 10 μg/ml), and cultured in at 37 °C in a 5% CO2 incubator for 24 h. After collecting supernatants, cytokine was measured by ELISA assay. The KSK-CpG dose-dependently induced IL-6 and IL-12 cytokine release, which was higher than human or non CpG ODN but less than mouse CpG ODN.
significantly higher than that of normal or untreated B16BL6 (p b 0.01) in E/T ratio 100 (Fig. 4), strongly suggesting that In vivo KSK-CpG treatment without antigen addition could activate CTL in tumor bearing mice.
3.4. KSK-CpG induces IL-6 and IL-12 cytokine release from murine splenocytes To comparatively quantitate IL-6 and IL-12 cytokine release from murine splenocytes, five different doses (0.5 μg/ml–10 ug/ml) of various CpG ODNs were incubated with the cells prior to the cytokine assay. Fig. 5 shows that the KSK-CpG dose-dependently induced IL-6 and IL-12 cytokine release, which was higher than
human or non CpG ODN but, less than mouse CpG ODN. Considering dose-dependent cytokine kinetics, overall IL-12 levels following KSK-CpG treatment was higher than IL-6 levels, showing that KSK-CpG is strong immunoadjuvant for induction of Th1 cytokine.
3.5. KSK-CpG has no direct cytotoxicity against B16BL6 melanoma cells To evaluate the direct cytotoxic action of KSK-CpG on cancer cells, an MTT assay was done. Fig. 6 clearly shows that KSK-CpG failed to cause direct cytotoxicity against the B16BL6 cancer cells, even at the highest concentration.
Figure 6 KSK-CpG has no direct cytotoxicity against B16BL6 melanoma cells. A. Cell survival following in vitro treatment of various doses of KSK-CpG on B16BL6 melanoma cells. 5 × 103 B16BL6 cells were cultured on a 96-well plate before treated with the indicated dose of KSK-CpG (0, 0.15625, 0.315, 0.625, 1.25, 5, 10 μg/ml), and cultured in at 37 °C in a 5% CO2 incubator for 24 h. After MTT assay, cell survival was measured by ELISA READER at the wavelength of 595 nm. B. Comparison of cell survival among other CpG ODNs and cisplantin. 5 × 103 B16BL6 cells were cultured on a 96-well plate before treated with each CpG ODN (0.6 μg/ml per well) and cisplantin (125 μg/ml) for positive control, and cultured at 37 °C in a 5% CO2 incubator for 24 h. After MTT assay, cell survival was measured by ELISA READER at the wavelength of 595 nm.
1406
4. Discussion This study demonstrates that KSK-CpG is an active cancer immunotherapeutic agent against highly malignant tumor challenged model. First, our major findings stem from in vivo observations of prolonged survival span and blocking of lung metastasis. As earlier described, KSK-CpG has several medicochemical features: closer to type C structure with partial palindromic sequence, strong antibody forming activity (B cell-adjuvantivity), strong NK cell activity and less toxicity to host and immune cells when compared to known human CpG 2006. However, this expecting immunotherapeutic activity has been unproven in aggressive murine tumor models. Thus, for objective comparison, we used two gold standard CpG ODNs, mouse type (1826) and human type (2006) CpG ODN, which have been proven effective by a multitude of studies [9,18– 21]. Surprisingly, in comparison with these representative CpG ODN (1826 and 2006) motifs, KSK-CpG seems to be at least equivalent or superior. In particular, the KSK-CpG was clearly active in a differentially dosed EL4-challenged model. Considering that EL4 cells are less sensitive to NK cell killing and might be lymphatic-borne and highly malignant, KSK-CpG might be beneficial for immunotherapy against NK-insensitive hematologic cancer. Next, we sought to uncover the immune mechanism that supports the findings of in vivo experiments by measuring NK cell cytotoxicity, CTL activity, and IL-6 or IL-12 cytokine release. We have previously shown the Th1 dominance of KSK-CpG [14], but direct evidence related to NK activity and Th1 cytokine release was lacking. Consistent with in vivo B16BL6 melanoma metastasis blocking data, Fig. 3 clearly shows that NK-enriched cells activated by in vitro treatment of the KSK-CpG could kill YAC-1 because B16BL6, YAC-1 cells are prone to death by NK cells. Likewise, CTL activity of KSKCpG treated mice was detectable and significantly higher than that of normal or untreated B16BL6 mice (p b 0.01) in E/ T ratio 100 (Fig. 4), strongly suggesting that in vivo CpG ODN treatment without antigen addition acvtivates CTL in tumor bearing mice. Given these, we speculate that NK cell and CTLs from KSK-CpG treated mice might constitute one of major effectors against murine hematoligic cancer metastasis. Consistently, KSK-CpG activates Th1 cell through induction of IL-6 and IL-12 expression in splenocytes. Fig. 6 shows that the escalated dose of the KSK-CpG induces IL-6 and IL-12 cytokine release in a dose-dependent manner. In particular, because overall IL-12 levels following KSK-CpG treatment was higher than IL-6 levels, effective Th1 induction is explainable. Importantly, Th1 cytokine induction of KSK-CpG is superior to that of human CpG 2006 for clnical trial. This excellent Th1 dominance provides key theory to break down immunotolerance exerted by tumor. Coupled with in vivo and in vitro evidences, we infer that the KSKCpG was active against highly malignant murine cancer via NK cell and CTL activation as well as by way of Th1 cytokine (IL-6 and IL-12) induction. This Th1 polarized action confirmed the previous immunoadjuvanticity [14]. Because KSK-CpG is close to type C and more targetable to human cells, potent NK activity as well as B and T cell adjuvanticity is possible. However, murine system used in this experiment is not optimal to gauge the immunoacivity of KSK-CpG as human motif.
H.C. Cho et al. While KSK-CpG has cancer immunotherapeutic effects, these effects might be due to a direct detriment to cancer cells. MTT assay revealed that the KSK-CpG was not directly cytotoxic to B16BL6 melanoma cell. This was compatible with the absence of cytotoxicity of murine CpG ODN (1826) in neuroblastoma in vitro [22]. Moreover, the mice treated repeatedly with the KSK-CpG display less damage in the spleen and liver when compared to 1826 CpG ODN-treated mice (data not shown). Given this potential insensitivity to in vitro and in vivo toxicity, we speculate that our KSK-CpG could rapidly be applied in preclinical and clinical study. Collectively, these data demonstrate that KSK-CpG is active against the highly malignant B16BL6 and EL4 tumor mouse models via innate immune augmentation. The results of our study might hold important preclinical and clinical implications with cancer immunotherapeutic use in a wide array of cancers. Toward improving the therapeutic efficacy of CpG ODN, further studies are currently underway.
Acknowledgements This study was supported by a grant from National Cancer Control R&D Program 2002 and a grant (A050485) of the Korea Health 21 R&D Project Ministry of Health & Welfare, and by a grant (06132KFDA395) from Korea Food & Drug Administration in 2006, Republic of Korea.
References [1] Akira S, Takeda K, Kaisho T. Toll-like receptors: critical proteins linking innate and acquired immunity. Nat Immunol 2001;2:675–80. [2] Chu RS, Targoni OS, Krieg AM, Lehmann PV, Harding CV. CpG oligodeoxynucleotides act as adjuvants that switch on T helper 1(Th1) immunity. J Exp Med 1997;186:1623–31. [3] Duin DR, Medzhitov, Shaw AC. Triggering TLR signaling in vaccination. Trends Immunol 2006;27:49–55. [4] Klinman DM, Yi AK, Beaucage SL, Conover J, Krieg AM. CpG motifs present in bacterial DNA rapidly induce lymphocytes to secrete interleukin 6, interleukin 12, and interferon γ. Proc Natl Acad Sci U S A 1996;93:2879–83. [5] Krieg AM. CpG motifs in bacterial DNA and their immune effects. Annu Rev Immunol 2002;20:709–60. [6] Krieg AM, Yi AK, Matson S, Waldscjmidt TJ, Bishop GA, Teasdale R, et al. CpG motifs in bacterial DNA trigger direct B cell activation. Nature 1995;374:546–9. [7] Krug A, Rothenfusser S, Hornung V, Jahrsdörfer B, Blackewll S, Ballas ZK, et al. Identification of CpG oligonucleotide sequences with high induction of IFN-α/β in plasmacytoid dendritic cells. Eur J Immunol 2001;31:2154–63. [8] Takeda K, Akira S. Toll-like receptors in innate immunity. Int Immunol 2005;17:1-14. [9] Ballas ZK, Krieg AM, Warren T, Rasmussen W, Davis HL, Wldschmidt M, et al. Divergent therapeutic and immunologic effects of oligodeoxynucleotides with distinct CpG motifs. J Immunol 2001;167:4878–86. [10] Carpentier A, Laigle-Donadey F, Zohar S, Capelle L, Behin A, Tibi A, et al. Phase 1 trial of a CpG oligonucleotide for patients with recurrent glioblastoma. Neuro-oncology 2006;8:60–6. [11] Friedberg JW, Kim H, McCauley M, Hessel EM, Sims P, Fisher DC, et al. Combination immunotherapy with a CpG oligonucleotide (1018 ISS) and rituximab in patients with non-Hodgkin lymphoma: increased interferon-α/β-inducible gene expression, without significant toxicity. Blood 2005;105:489–95.
Cancer immunotherapeutic effects of novel CpG ODN in murine tumor model [12] Gerda Goess MP, Wagner C, Hormann M, Jandl T, Moser A, Britten CM, et al. Phase II trial of a Toll-Like Recetor 9activating oligonucleotide in patients with metastatic melanoma. J Clin Oncol 2006;24:5716–24. [13] Krieg AM. Development of TLR9 agonists for cancer therapy. J Clin Invest 2007;117:1184–94. [14] Park SJ, Cho HC, Bae KS, Kim SK. Immunoadjuvanticity of novel CpG ODN (oligodeoxynucleotide). Mol Cell Toxicol 2007;3:46–52. [15] Lee SM, Kim K, Kim Y, Kim HW, Shim BI, Lee SH, et al. The antiinflammatory effect of IH-901 in HT-29 cells. Mol Cell Toxicol 2007;3:254–61. [16] D'Agostini C, Pica F, Febbraro G, Grelli S, Chiavaroli C, Garaci E. Antitumor effect of OM-174 and Cyclophosphamide on murine B16 melanoma in different experimental conditions. Int Immunopharmacol 2005;5:1205–12. [17] Coligan JE, Kruisbeek AM, Margulies DH, Shevach EM, Strober W. Current protocols in immunology. New York: Wiely-interscience; 2000. p. 3.1.1–5. [18] Heckelsmiller K, Rall K, Beck S, Schlamp A, Seiderer J, Jahrsdorfer B, et al. Peritumoral CpG DNA elicits a coordinated
[19]
[20]
[21]
[22]
1407
response of CD8T cells and innate effectors to cure established tumors in a murine colon carcinoma model. J Immunol 2002;168:3892–9. Roda JM, Parihar R, Carson III WE. CpG-containing oligodeoxynucleotides act through TLR9 to enhance the NK cell cytokine response to antibody-coated tumor cells. J Immunol 2005;175:1619–27. Switaj T, Jalili A, Jakubowska AB, Drela N, Stoksik M, Nowis D, et al. CpG immunostimulatory oligodeoxynucleotide 1826 enhances antitumor effect of interleukin 12 gene-modified tumor vaccine in a melanoma model in mice. Clin Cancer Res 2004;10:4165–75. Weigel BJ, Rodeberg DA, Krieg AM, Blazar BR. CpG oligodeoxynucleotides potentiate the antitumor effects of chemotherapy or tumor resection in an orthotopic murine model of rhabdomyosarcoma. Clin Cancer Res 2003;9:3105–14. Carpentier AF, Chen L, Maltonti F, Delattre J. Oligodeoxynucleotides containing CpG motifs can induce rejection of a neuroblastoma in mice. Cancer Res 1999;59:5429–32.