Candidate genes responsible for common and different pathology of infected muscle tissues between Trichinella spiralis and T. pseudospiralis infection

Parasitology International 57 (2008) 368–378

Contents lists available at ScienceDirect

Parasitology International j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / p a r i n t

Candidate genes responsible for common and different pathology of infected muscle tissues between Trichinella spiralis and T. pseudospiralis infection Zhiliang Wu ⁎, Isao Nagano, Yuzo Takahashi Department of Parasitology, Gifu University Graduate School of Medicine, Yanagido 1-1, Gifu 501-1194, Japan

A R T I C L E

I N F O

Article history: Received 22 January 2008 Received in revised form 7 March 2008 Accepted 25 March 2008 Available online 9 April 2008 Keywords: Trichinella spiralis T. pseudospiralis cDNA microarray Muscle Gene expression profile

A B S T R A C T The gene expression profiles were compared between Trichinella spiralis- and T. pseudospiralis-infected muscle tissues by means of a cDNA microarray. Out of 30,000genes, the expressions of 55 genes were upregulated in both T. spiralis and T. pseudospiralis infections, 24 genes were down-regulated in both Trichinella infections, 30 genes were up-regulated only in T. spiralis infection, 23 genes were down-regulated only in T. spiralis infection, 25 genes were up-regulated only in T. pseudospiralis infection, and 21 genes were downregulated only in T. pseudospiralis infection. Many of these differentially expressed genes were associated with satellite cell activation and proliferation (paired box gene 7, Pax7; Pax3; desmin; M-cadherin), myogenesis and muscle development (eyes absent 2 homolog, Eya2; myocyte enhancer factor 2C, MEF2C; pre B-cell leukemia transcription factor 1, Pbx1; chordin-like 2, Chrdl2), cell differentiation (galectin 1; insulin like growth factors, IGFs; c-ski; msh-like 1, Msx1; Numb), cell proliferation and cycle regulation (retinoblastoma 1, Rb1; granulin; p21, CDK4, cyclin A2), and apoptosis (tumor necrosis factor receptor 1, TNF-R1; programmed cell death protein 11, Pdcd11; Pdcd1; nuclear protein 1, Nuprl; clusterin, CLU). The differential expression of 17 genes was validated by quantitative real time PCR and 15 genes showed identical results with the microarray analysis. The present study listed the candidate genes that were commonly and differentially expressed between T. spiralis and/or T. pseudospiralis infection, thus suggesting that these genes need to be further investigated to reveal the mechanism of the common and/or different pathological changes induced by the two species Trichinella. © 2008 Elsevier Ireland Ltd. All rights reserved.

1. Introduction Trichinella is an intracellular parasite of skeletal muscle. To date, two clades have been identified in this genus, encapsulated and nonencapsulated which induce different pathology between them. Trichinella spiralis, as a representative of encapsulated species, is commonly documented. The infection of muscle cells by this species of parasite causes complicated pathological changes, eventually leading to the transformation of infected muscle cells into a new type of cells which is completely different from muscle cells, known as nurse cell [1]. Nurse cell formation is a complex process, involving the biological processes of cell growth, regeneration, differentiation, proliferation, cell cycle regulation, and transformation. The studies have revealed some facts that the early events that occur in the T. spiralis-infected muscle cell are analogues to those in muscle regeneration [2]. After invasion by newborn larvae, satellite cells are activated, proliferate and differentiate [3,4]. Unlike muscle regeneration, myoblasts (differentiated satellite cells) do not fuse to form new muscle fibers, instead, they transform into eosinophilic cytoplasm of the infected muscle cell. On the other hand,

⁎ Corresponding author. Tel.: +81 58 2306366; fax: +81 58 2306368. E-mail address: [email protected] (Z. Wu). 1383-5769/$ – see front matter © 2008 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.parint.2008.03.005

the infection causes the terminally differentiated muscle cell to withdraw from G0 of cell cycle and re-enter cell cycle progress. However, the re-entered cycle is arrested and the infected muscle cells transform into basophilic cytoplasm [5–9]. With the time of infection, the satellite cell-derived eosinophilic cytoplasm increases and infected cell-derived basophilic cytoplasm decreases, and as a consequence, eosinophilic cytoplasm replaces basophilic cytoplasm in a mature nurse cell. There are many enlarged nuclei (up to 100) in the basophilic cytoplasm at the early stage of infection [10]. A mature nurse cell is surrounded by a collagenous capsule and a circulatory rete, where the parasites live for years without being killed by the host immunity [11,12]. Although a similar infection process occurs in T. pseudospiralis infection as in T. spiralis, the pathology induced by this nonencapsulated species Trichinella is quite different, including that 1) the collagenous capsule is poorly developed and cannot be identified under light microscopy [13,14]; 2) not like in T. spiralis infection where the separation is formed to seal off damage by larvae within infected muscle cell, the separation is not formed in T. pseudospiralis-infected muscle cell and, as a result the whole length of the infected muscle cell is affected [4]; 3) there is more continuous and diffuse myopathy in the full length of T. pseudospiralis-infected muscle cells, which continues for an extended period of time [4,15]; 4) T. pseudospiralis infection induces a smaller inflammatory response,

Z. Wu et al. / Parasitology International 57 (2008) 368–378

which may be responsible for the immunomodulation by parasite's secretions or cuticle products [16,17]. Little is known concerning the molecular mechanism of these phenomena. It is proposed that the parasite reprograms host genomic transcription through their secreted molecules [1]. Therefore, to know how the parasite's molecules regulate host genomic transcription, it is important to know how the host cell changes and what kinds of genes and signaling pathways are involved in the processes. Our previous cDNA microarray analysis (1176 genes) suggested that many genes associated with cell differentiation, proliferation, cycle regulation, transformation and apoptosis are likely involved in the formation of nurse cell induced by T. spiralis infection [2]. Further studies have confirmed that several signal pathways participate in the processes, such as the TGF-beta signal in cell cycle arrest and transformation [18], myogenic regulatory factors in satellite cell activation and differentiation [4], mitochondria-mediated [19,20] and TNF-alpha signal pathways [9] in apoptosis. To further explore the mechanisms of molecular regulation during nurse cell formation and reveal the genes or signaling pathway that account for the different pathological changes induced by T. spiralis and T. pseudospiralis infection, a cDNA microarray analysis (30,000 genes) was performed, and the gene expression profiles of the infected muscle tissues were compared between T. spiralis and T. pseudospiralis infection. The important candidate genes related to muscle development and myogenesis, cell proliferation, differentiation, transformation, cell cycle, and apoptosis have been proposed. 2. Materials and methods 2.1. Parasites and infection To reduce the effects of inflammatory cells to the gene expression profiles in infected muscle tissues, nude mice were used as they cause less cellular filtration in the muscle tissues [17]. Mice were orally infected with 600 larvae of T. spiralis (ISS413) and T. pseudospiralis (ISS13). The muscles of the hind limbs from 3 normal, 3 T. spiralis-infected and 3 T. pseudospiralisinfected mice were collected at 23 days after oral infection, because the previous studies have shown that the peak of changed expression of most investigated genes occurred at this time [4,9,15,18–20]. The muscle samples were immediately subjected to RNA isolation. 2.2. RNA isolation Total RNA was isolated from muscle samples using TRIZOL (GIBCOBRL, Life Technologies, Inc., Carlsbad, CA, USA) according to the manufacturer's instructions. The isolated RNA was treated with RQ1 RNase-free DNase (Promega, Madison, WI, USA), and RNA purity was determined spectrophotometrically (1.8–2.0 in ratio of OD260/ OD280) and by formaldehyde agarose gel electrophoresis (more than 1.6 in ratio of 28SrRNA/18SrRNA). 2.3. cDNA microarray The cDNA microarray assay was performed using Mouse AceGene 1 Chip Version (HitachiSoft, Japan), which contained 30,000 genes of known functional ORF and ensemble annotated ORF. The following treatments (RNA purification, RNA quality and integrity analysis, probe preparation, and hybridization) were performed using Amino-allyl RNA amplification Kit Version 2 (Sigma) according to the manufacturer's user manual. In brief, cDNA synthesis was performed by incubating 3 μg total RNA with T7 oligo-dT primer and reverse transcriptase at 42 °C for 2 h. The amplification of amino-allyl aRNA in vitro transcription was performed by incubating cDNA products with HY T7 RNA polymerase at 37 °C for 6 h, and the amplified products were purified. Five μg amino-allyl aRNA was labeled with Cy3 or Cy5 mono-reactive Dye (Amersham Bioscience). The Cy-labeled aRNA was fragmented with

369

fragmentation buffer, and then it was mixed with hybridization buffer. The hybridization was incubated at 50 °C for 16 h in a hybridization chamber. The post hybridization washing was performed at 40 °C for 5 min in each solution of 4× SSC–0.1%SDS, 2× SSC–0.1%SDS, 2× SSC, and 1× SSC. All slides were scanned immediately following hybridization using a microarray scanner (Agilent Microarray Scanner G2567AA, Agilent Technologies, USA). Six RNA samples (from 2 normal mice, 2 T. spiralis-infected mice, and 2 T. pseudospiralis-infected mice) were used to perform 8 independent cDNA microarray analyses. To avoid any bias associated with unequal incorporation of the two Cy dyes into cDNA, flip labeling procedure (dye-swapping or reverse labeling with Cy3 and Cy5 dyes) was adapted. cDNA from each sample was labeled with Cy3 or Cy5 dye, and each pair of probes (T. spiralis-infected Cy3 and normal Cy5, T. spiralis-infected Cy5 and normal Cy3, T. pseudospiralis-infected Cy3 and normal Cy5, T. pseudospiralis-infected Cy5 and normal Cy3) was mixed and hybridized with separate chip. Each pair was repeated one times. To role out the possibility of larva-derived hybridization, probe prepared from larva RNA was used to hybridize the chip, and these results showed that there were no significant detectable signals. 2.4. Validation of differential gene expression with real time PCR Quantitative real time RT-PCR was performed for the validation of microarray results using Applied Biosystems 7000 DNA sequence detection system (Perkin Elmer Corp., CA, USA). Seventeen genes which showed significant differential expression after Trichinella infection and may play important roles during nurse cell formation were selected, and the primers of these genes were designed based on the sequences from GenBank database. The primer information was shown in Table 1. Total RNA was isolated and purified as mentioned above. Reverse transcription was performed using a SuperScript III Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. In brief, 20-μl reaction volume consisted of 3 μg of the sample RNA, 1 μl of 0.5 μg/μl Oligo (dT)12–18, 1 μl 10 mM dNTP Mix, 4 μl First-Stand Buffer, 1 μl 0.1 M DTT, 1 μl RNase Inhibitor, and 1 μl SuperScript III Reverse Transcriptase. The reaction mixture was incubated at 50 °C for 60 min and then inactivated by heating at 70 °C for 15 min. Real time PCR was performed as previous described [18]. In brief, optimal conditions for all investigated genes were established using SYBR Premix Ex Taq Kit (TAKARA BIO Inc., Ootsu, Shiga, Japan) according to manufacturer's instructions. Twenty μl of the reaction solution consisted of 2 μl of the template (appropriate dilution was determined by gene), 10 μl of SYBR Premix Ex Taq, 0.4 μl of 10 μM of each primer and 0.4 μl of ROX Reference Dye. PCR amplification was performed as follows: predenature for 1 cycle at 95 °C for 10 s, and 40 cycles at 95 °C for 5 s, 60 °C for 31 s. Melting curve analysis was done at 60 °C to 95 °C with 0.1 °C/s temperature transition. Table 1 Primer sequences used for real time PCR Gene

Accession no.

Sequence

Galectin 1 Numb Pbx1 Msx1 Pax7 Rb1 Nupr1 Sparc Granulin Cyclin A2 Chordin 2 M-cadherin Pax3 CD36 UCP1 G3PDH

BC002063 NM_010949 NM_008783 NM_010835 NM_011039 NM_009029 NM_019738 NM_009242 NM_008175 NM_009828 NM_031258 NM_007662 NM_008781 NM_007643 NM_009463 M32599

cctggggaatgtctcaaagt/agcctggtcaaaggtgatg aaccagcctttgtccctacc/ggcgactgatgtggatgag ccagtgaggaagccaaagag/tgggagtagagggcgagtta cgccagaagcagtacctgtc/gaggaaaagagaggccgaag tccatcaagccaggagaca/aggaagaagtcccagcacag ctgccaacacccacaaaaat/tactcccatctgcttcatcg agactttggagagagcagacta/tagggcggttggtattg cgactcttcctgccacttct/ggttgttgccctcatctctc gctgcccaagcctcaag/aaatgcccttctccacactc ttacccgcagcaagaaaac/caaccagccagtccacaag cttacctccgttccccctac/gatttgggtgccaggactct gggctctctcttgggatgt/ggcactaagggtggcttct caggtaatgggacttctgacc/ggggacaatagggctgagat gctgtgtttggaggcattct/ccttgattttgctgctgttct ggcattcagaggcaaatcag/gcattgtaggtccccgtgta ggcattgtggaagggctcat/gacacattgggggtaggaacac

370

Z. Wu et al. / Parasitology International 57 (2008) 368–378

Specific external controls were constructed for target genes. The PCR fragment of each gene was cloned into a pT7Blue T-Vector (Novagen, Inc., Madison, WI, USA). The recombinant plasmids were introduced into competent cells of Escherichia coli JM 109. The plasmid DNA was isolated from E. coli using a FlexiPrep Kit (Amersham Pharmacia Biotech Inc., Piscataway, NJ, USA). Ten-fold serial dilutions (101 to 107 copies/2 µl) of the plasmids were used to generate standard curves for each gene. Differences in the amount of cDNA from different muscle samples were normalized by quantification of the housekeeping gene G3PDH and expression levels were represented as the copy number of target gene /107 G3PDH copies. Three independent experiments were performed and four-well repeats were measured for each sample. The values are expressed as mean± SD.

To confirm that the PCR product with each gene primer was from the muscle cell gene and not from the larva gene, PCR was performed using cDNA from the larva as a template; this failed to produce any bands. 2.5. Data analysis Eight arrays were performed with six independent samples from normal (n = 2), T. spiralis-infected mice (n = 2) and T. pseudospiralisinfected mice (n = 2). The microarray data were processed, normalized and statistically analyzed with the Agilent G2567AA Feature Extraction Software (v8.1) using default setting for all parameters according to the Agilent protocol. Files and images, including error values and p-values, were exported from the Agilent Feature Extraction software. Spots that

Table 2 Up-regulated expression of genes in both of T. spiralis and T. pseudospiralis infections Gene name

Accession no.

Mitogen-activated protein kinase 14 (Mapk14) Galectin 1 FMS-like tyrosine kinase 3 ligand (Flt3l) Cyclin-dependent kinase inhibitor 1A (P21) IGF binding protein 5 (Igfbp5) Apoptosis associated protein 3 ( THAP3) NFAT1-A Casitas B-lineage lymphoma (CBL) IGF binding protein 4 (Igfbp4) Numb gene homolog (Drosophila) (Numb) Dullard homolog (Xenopus laevis) Vimentin Proline dehydrogenase (oxidase) 2 (Prodh2) TNF receptor, member 1a (Tnfrsf1a) Ski proto-oncogene; (c-ski) Galectin 3 T-box 15 (Tbx15) Desmin Insulin receptor (INR) Clusterin (CLU) Insulin-like growth factor I receptor (IGF-IR) Cut-like 1 (Drosophila) (Cutl1) Paired box gene 7 (Pax7) Malignant T-cell amplified sequence 1 (Mcts1) Homeobox, msh-like 1 (Msx1) Cyclin-dependent kinase 4 (CDK4) Manic fringe homolog (Drosophila) (Mfng) B-cell leukemia/lymphoma 6 (Bcl6) Mesothelin Smad1 Eyes absent 2 homolog (Drosophila) (Eya2) Pre B-cell leukemia transcription factor 1 (Pbx1) Retinoblastoma 1 (Rb1) Insulin-like growth factor 1 IGF-1) Annexin A2 (Anxa2) Deltex 1 homolog (Drosophila) (Dtx1) Bone morphogenetic protein 4 (Bmp4) Peroxiredoxin 6 (Prdx6) Inhibitor of DNA binding 2 (Id2) Dickkopf homolog 4 (Dkk4) Programmed cell death protein 11 (Pdcd11) Myotrophin Bcl2-interacting killer-like (Biklk) StAR-related lipid transfer (START) 5 Epidermal growth factor receptor (EGFR) Mitogen-activated protein kinase 4 (Mapk4) Serine/threonine kinase 38 (Stk38) Myocyte enhancer factor 2C (MEF2C) Neurotrophin receptor interacting factor 2 CD152 (Ctla4) GTF2I repeat domain containing 2 (Gtf2ird2) Skeletal muscle ryanodine receptor (Ryr1) Ring-box 1 (Rbx1) Prothymosin alpha (PTMA) IL2-inducible T-cell kinase (ITK)

NM_011951 BC002063 S76459 NM_007669 BC003951 AG140910 U02079 NM_007619 NM_010517 NM_010949 AK012063 M24849 AK011039 NM_011609 AF435852 X16074 NM_011534 L22550 NM_010568 AF182509 AB006442 NM_009986 U20792 AK005292 NM_010835 NM_009870 NM_008595 NM_009744 NM_018857 NM_007421 BC003755 NM_008783 NM_009029 NM_010512 AK012563 NM_008052 NM_007554 NM_007453 M69293 BC018400 AF055668 NM_008098 NM_007546 NM_023377 U03425 AG081201 NM_134115 NM_025282 AJ319726 NM_009843 NM_053266 AJ310366 NM_019712 NM_008972 NM_010583

Fold change Ts/N

Tp/N⁎

8.06 ↑ 6.32 ↑ 5.89 ↑ 5.55 ↑ 5.21 ↑ 5.04 ↑ 5.02 ↑ 4.89 ↑ 4.86 ↑ 4.85 ↑ 4.78 ↑ 4.65 ↑ 4.62 ↑ 4.55 ↑ 4.50 ↑ 4.35 ↑ 4.23 ↑ 4.21 ↑ 4.11 ↑ 4.11 ↑ 4.05 ↑ 3.89 ↑ 3.88 ↑ 3.87 ↑ 3.85 ↑ 3.80 ↑ 3.69 ↑ 3.69 ↑ 3.65 ↑ 3.65 ↑ 3.45 ↑ 3.45 ↑ 3.41 ↑ 3.33 ↑ 3.25 ↑ 3.22 ↑ 3.02 ↑ 3.02 ↑ 2.91 ↑ 2.89 ↑ 2.89 ↑ 2.68 ↑ 2.66 ↑ 2.58 ↑ 2.56 ↑ 2.56 ↑ 2.53 ↑ 2.52 ↑ 2.45 ↑ 2.36 ↑ 2.27 ↑ 2.26 ↑ 2.21 ↑ 2.12 ↑ 2.09 ↑

9.23 ↑ 5.82 ↑ 6.03 ↑ 4.25 ↑ 5.13 ↑ 7.13 ↑ 2.98 ↑ 5.82 ↑ 3.65 ↑ 4.56 ↑ 3.56 ↑ 3.65 ↑ 4.95 ↑ 3.90 ↑ 2.31 ↑ 5.31 ↑ 4.16 ↑ 3.19 ↑ 2.76 ↑ 3.95 ↑ 3.52 ↑ 3.26 ↑ 3.85 ↑ 3.45 ↑ 2.89 ↑ 3.36 ↑ 4.11 ↑ 4.58 ↑ 3.69 ↑ 3.29 ↑ 3.25 ↑ 3.26 ↑ 2.86 ↑ 3.01 ↑ 2.78 ↑ 4.85 ↑ 4.26 ↑ 2.88 ↑ 3.69 ↑ 4.20 ↑ 3.28 ↑ 2.58 ↑ 4.22 ↑ 3.00 ↑ 2.89 ↑ 2.34 ↑ 2.79 ↑ 3.01 ↑ 2.35 ↑ 2.01 ↑ 3.09 ↑ 2.35 ↑ 2.31 ↑ 2.36 ↑ 3.99 ↑

Description

Antimicrobial humoral response, protein kinase cascade; response to stress Galactose binding; myoblast differentiation; myoblast fusion; myotube growth Lymphocyte differentiation; apoptosis; proliferation and development of stem cells Cell cycle arrest; negative regulation of apoptosis; negative regulation of cell proliferation Regulation of cell growth; intracellular signaling cascade; skeletal muscle growth Metal ion binding; apoptosis Transcriptional activator activity; cytokine production; positive regulation of transcription Oncogene; calcium ion binding; suppressing transformation; muscle degeneration Cell proliferation and growth; DNA metabolism; skeletal muscle development Inhibiting Notch signaling; cell proliferation and differentiation and development Neural development; negative regulator of BMP signaling Intermediate filament protein; G-protein signaling; chemotaxis Proapoptotic gene, mitochondria-mediated apoptosis Apoptosis; cytokine and chemokine mediated signaling pathway; inflammatory response Cell growth and/or maintenance; cell differentiation and transformation Extracellular matrix organization and biogenesis; skeletal muscle development Basic transcription factor; development of limb; vertebral column and head Cytoskeleton organization and biogenesis; muscle contraction Carbohydrate metabolism; insulin receptor signaling pathway Apoptosis; anti- or proapoptotic activity; positively correlating with cell survival Death receptor; EGF receptor activity; organogenesis; cell development Basic transcription factor; development; cycle progression; motility and invasiveness Transcription factor; development; organogenesis; positively regulating cell differentiation Oncogene; positive regulation of cell proliferation; regulation of progression of cell cycle Transcription activator; organ morphogenesis; skeletal development Cell cycle; cell division; cell proliferation; G1/S transition of mitotic cell cycle Development, promoting differentiation by repression of Notch signaling Negative regulation of cell cycle; apoptosis; I-kappa B kinase/NF-kappa B cascade Cell adhesion; differentiation Negative regulation of cell proliferation, BMP and TGF-beta receptor signaling pathway Apoptotic program; development; myogenesis Cell growth and/or maintenance; embryonic development; hindbrain development Negative regulation of cell growth and progression through cell cycle Anti-apoptosis; organogenesis; growth factor and hormone activity; cell differentiation Cell proliferation and differentiation Regulator of Notch signaling; involving myogenesis and muscle development Skeletal development; angiogenesis; mesoderm cell fate determination; Hydrogen peroxide, lipid and phospholipid catabolism; response to oxidative stress Regulation of transcription; heart development; lymph node development Negative regulation of Wnt receptor singaling pathway; limb development Hydrolase activity; apoptosis; positive regulation of I-kappaB kinase/NF-kappaB cascade Protein binding; neuron differentiation Bcl family protein; induction of apoptosis Lipid transfer and metabolism; genetic disorders, autoimmune disease and cancer Cell proliferation and growth; regulation of cell cycle; cellular morphogenesis Cell cycle; protein amino acid phosphorylation Kinase activity; transferase activity; G-protein coupled receptor protein signaling pathway Regulation of transcription; myogenic differentiation Regulation of transcription; regulation of cell cycle; receptor activity; Cell surface antigen; immune response WBS related gene; skeletal muscle differentiation Calcium ion homeostasis; calcium ion transport; regulation of muscle contraction Cell cycle regulation of G1/S transition Cell proliferation Intracellular signaling cascade; cell defense response; regulating Th cell differentiation

⁎N: normal muscle; Ts: T. spiralis-infected muscle; Tp: T. pseudospiralis-infected muscle; ↑: up-regulation.

Z. Wu et al. / Parasitology International 57 (2008) 368–378

371

Table 3 Down-regulated expression of genes in both T. spiralis and T. pseudospiralis infections Gene name

Major urinary protein 1 (Mup1) CD36 antigen (CD36) Microsomal glutathione S-transferase 1(Mgsta1) Nudix-type motif 2 (Nudt2) Epoxide hydrolase 2 (Ephx2) Adenylosuccinate synthetase like 1 (Adssl1) Transferring (Trf) Uncoupling protein 1 (mitochondrial) (Ucp1) G0/G1 switch gene 2 (G0s2) Glutamate receptor interacting protein 1 (Grip1) Carbohydrate sulfotransferase 12 (Chst12) Aldolase 1A (Aldoa) Kruppel-like factor 12 (Klf12) TNF-alpha-induced protein 8 ( Tnfaip8) Glutathione S-transferase, alpha 3 (Gsta3) Jun oncogene (Jun) Calcitonin-related polypeptide, beta (Calcb) Protein phosphatase 1B (Ppm1b) Interferon, alpha-inducible protein 27 (Ifi27) Myeloid leukemia factor 1 (MLF1) Very low density lipoprotein receptor (Vldlr) Met proto-oncogene (Met) Lipoprotein lipase (Lpl) DnaJ (Hsp40) C7 (Dnajc7)

Accession no.

NM_031188 NM_007643 NM_019946 NM_025539 NM_007940 NM_007421 AF440692 NM_009463 NM_008059 AK016420 NM_021528 NM_007438 NM_010636 NM_134131 NM_010356 NM_010591 NM_054084 U09218 AY090098 NM_010801 NM_013703 M33424 NM_008509 NM_019795

Fold change N/Ts

N/Tp⁎

5.21 ↓ 4.55 ↓ 4.21 ↓ 4.05 ↓ 3.88 ↓ 3.78 ↓ 3.75 ↓ 3.56 ↓ 3.55 ↓ 3.22 ↓ 2.99 ↓ 2.89 ↓ 2.87 ↓ 2.87 ↓ 2.78 ↓ 2.68 ↓ 2.56 ↓ 2.41 ↓ 2.36 ↓ 2.32 ↓ 2.18 ↓ 2.10 ↓ 2.04 ↓ 2.01 ↓

3.55 ↓ 4.25 ↓ 4.56 ↓ 3.51 ↓ 3.45 ↓ 2.83 ↓ 2.90 ↓ 4.18 ↓ 4.56↓ 3.68 ↓ 2.85 ↓ 2.78 ↓ 2.68 ↓ 3.08 ↓ 2.99 ↓ 2.89 ↓ 3.11 ↓ 2.58 ↓ 2.13 ↓ 2.08 ↓ 2.58 ↓ 2.07 ↓ 2.64 ↓ 2.36 ↓

Description

Pheromone binding; transporter activity Binding protein; cell adhesion; receptor activity Glutathione transferase activity; protecting from oxidative stress Hydrolase activity; induction of apoptosis Hydrolase activity; xenobiotic metabolism; peroxisome; response to toxin Adenylosuccinate synthase activity; purine nucleotide biosynthesis Ion binding; differentiation; proliferation; apoptosis Oxidative phosphorylation uncoupler activity; transporter activity Regulation of progression through cell cycle Androgen receptor signaling pathway; positive regulation of transcription Transferase activity, carbohydrate metabolism; dermatan sulfate biosynthesis Fructose-bisphosphate aldolase activity; lyase activity; glycolysis; metabolism NNA binding protein; regulation of transcription Anti-apoptosis Glutathione transferase activity; oxidative stress; steroid biosynthesis Oncogene; cell growth, cycle and differentiation Calcium ion homeostasis; signal transduction Phosphoprotein phosphatase activity Aging; immune response; epithelial proliferation Cell differentiation; development; hemopoiesis; inhibiting cell cycle procession Cell proliferation; kinase activity; cell surface receptor linked signal transduction Transferase activity; kinase activity; cell growth; development; cell cycle Lipid metabolism; lipid transporter activity; hydrolase activity; Heat shock protein binding

⁎N: normal muscle; Ts: T. spiralis-infected muscle; Tp: T. pseudospiralis-infected muscle; ↓: down-regulation.

did not pass quality control procedures in this software were flagged and removed from further analysis. A possible dye bias was eliminated using an algorithm for the same extraction software. The fold change values for the differentially expressed genes were calculated from ratios of intensities between pair samples. The t-test p-values were utilized to detect the significance of differences between the two test

groups. Log ratios of intensities for individual genes were determined for each test/control sample, from which the mean value of log ratios for each sample group was also obtained. Four arrays for each sample pair (pair of normal and T. spiralis-infected muscle, and pair of normal and T. pseudospiralis-infected muscle), including fluorophore reversals, were combined to be analyzed. The genes with an average fold change

Table 4 Up-regulated expression of genes only in T. spiralis infection Gene name

Cathepsin S (Ctss) Nuclear protein 1 (Nupr1) Lysyl oxidase-like 1 (Loxl1) Chordin-like 2 (Chrdl2) Cyclin A2 Metallothionein 1 (Mt1) Secreted acidic cysteine rich glycoprotein (Sparc) Damage specific DNA binding protein 1 (Ddb1) Activating transcription factor 5 (Atf5) Cask-interacting protein 2 (Caskin2) Interferon activated gene 202B (Ifi202b) Metallothionein 2 (Mt2) Granulin (Grn) Ubiquitin carboxy-terminal hydrolase L1 (Uchl1) Melanoma antigen D2 (Maged2) Endoglin Chemokine (C-C motif) ligand 8 (Ccl8) S100 calcium binding protein A9 (S100A9) Procollagen I (Col1a2) S100 calcium binding protein A8 (S100A8) Paired box gene 3 (Pax3) Matrix Gla protein (Mgp) Interleukin 17 receptor (IL-17r) Procollagen, type V, alpha 2 (Col5a2) Annexin A1 (Anxa1) Chemokine-like factor (Cklf) Transgelin Tenascin-C Procollagen VI (Col6a3) Spondin 2, extracellular matrix protein (Spon2)

Accession no.

NM_021281 NM_019738 BC003973 NM_133709 NM_009828 NM_013602 NM_009242 AJ416426 NM_030693 NM_080643 NM_011940 AK002567 NM_008175 NM_011670 NM_030700 AK018588 NM_021443 NM_009114 NM_007743 NM_013650 NM_008781 NM_008597 AK010040 NM_007737 NM_010730 AY046597 NM_011526 NM_011607 BC005491 NM_133903

Fold change Ts/N

Tp/N⁎

8.17 ↑ 7.23 ↑ 5.22 ↑ 5.04 ↑ 4.98 ↑ 4.86 ↑ 4.69 ↑ 4.58 ↑ 4.11 ↑ 3.88 ↑ 3.88 ↑ 3.87 ↑ 3.79 ↑ 3.78 ↑ 3.47 ↑ 3.46 ↑ 3.36 ↑ 3.21 ↑ 3.13 ↑ 3.00 ↑ 2.89 ↑ 2.89 ↑ 2.85 ↑ 2.58 ↑ 2.58 ↑ 2.25 ↑ 2.20 ↑ 2.11 ↑ 2.09 ↑ 2.03 ↑

1.36 1.12 1.01 1.21 0.88 0.98 1.08 1.2 1.28 0.82 0.95 0.81 0.38 1.08 1.02 0.81 1.22 1.12 1.01 0.92 1.38 1.06 0.89 1.11 0.77 0.78 0.88 0.79 0.86 1.05

Description

Hydrolase activity; cysteine proteases; degradation of the extracellular matrix Apoptosis; response to stress; cell proliferation; cardiomyocyte hypertrophy Copper ion binding; metal ion binding; oxidoreductase activity Skeletal development; pattern specification; mesoderm formation Regulation of cell cycle; mitosis; cyclin-dependent protein kinase regulator activity Metal ion binding; metal ion homeostasis; negative regulation of neurogenesis Calcium ion binding; basement membrane; moderator of cell shape Nucleic acid binding protein; DNA repair Anti-apoptosis; transcription factor activity Protein binding; development Apoptosis; muscle development and differentiation; tumorigenesis Metal ion binding; metal ion homeostasis; nitric oxide mediated signal transduction Mitogen; cell cycle progression; cell motility; tumorigenesis Cell proliferation; neuromuscular process; neurogenesis; response to stress Embryogenesis; cell development; cell cycle progression; apoptosis Angiogenesis; heart development; regulating TGF-beta receptor signaling pathway Immune response; inflammatory response; chemotaxis; cytokine activity Calcium ion binding; actin cytoskeleton reorganization; leukocyte chemotaxis Cell adhesion; extracellular matrix structural constituent; phosphate transport Calcium ion binding; chemotaxis; sensory perception Cell migration; cell proliferation; development; muscle development Calcium ion binding; development; cell differentiation; regulating apoptosis Cell surface receptor linked signal transduction; interleukin-17 receptor activity Extracellulular matrix structural constituent; cell adhesion Calcium ion binding; regulation of cell proliferation; anti-inflammation Chemotaxis; cytokine activity; sensory perception; viral envelope Cytoskeleton organization; muscle development Extracellular matrix protein; promoting proliferation; development; angiogenesis Extracellulular matrix structural constituent; cell adhesion Extracellular matrix; cell adhesion; development; immune response

⁎N: normal muscle; Ts: T. spiralis-infected muscle; Tp: T. pseudospiralis-infected muscle; ↑: up-regulation.

372

Z. Wu et al. / Parasitology International 57 (2008) 368–378

Table 5 Down-regulated expression of genes only in T. spiralis infection Gene name

Accession no.

Fold change

Description

N/Ts

N/Tp⁎

Nanog homeobox (Nanog)

AK010332

4.22 ↓

1.31

Endomucin Forkhead box I1 (Foxi1) N-acetyltransferase 3 (Nat3) Sclerostin (Sost) Phospholipase C, beta 3 (Pygl) TNF receptor member 5 (Tnfrsf5) Bone morphogenetic protein 2 (Bmp2) Tropomyosin 2, beta (Tpm2) Desmoglein 1 gamma (Dsg1c) Interleukin 4 (IL4) Phosducin-like (Pdcl) Protocadherin gamma A7 (Pcdhga7) Liver glycogen phosphorylase Ubiquitin-conjugating enzyme E2 (Ube2v1) Vitamin d receptor (Vdr) N-acetyltransferase 5 (Nat5) Apolipoprotein C-I (Apoc1) Telomerase reverse transcriptase (Tert) Sorting nexin 13 (Snx13) Spi-C transcription factor (Spic) Aquaporin 9 (Aqp9) p58 interferon-induced protein kinase repressor (Prkrir)

AB034693 NM_023907 NM_008674 NM_024449 NM_008874 AJ401387 NM_007553 X58381 NM_181680 NM_021283 NM_026176 NM_033590 NM_133198 AF303829 NM_009504 NM_026425 NM_007469 AF029235 AG041211 NM_011461 NM_022026 AK013663

3.99 ↓ 3.56 ↓ 3.45 ↓ 3.32 ↓ 3.13 ↓ 3.05 ↓ 2.89 ↓ 2.86 ↓ 2.86 ↓ 2.79 ↓ 2.75 ↓ 2.58 ↓ 2.47 ↓ 2.46 ↓ 2.46 ↓ 2.33 ↓ 2.32↓ 2.26 ↓ 2.18 ↓ 2.12 ↓ 2.10 ↓ 2.04 ↓

1.18 0.85 0.91 1.24 1.35 1.38 0.86 1.07 1.00 1.28 1.44 0.95 0.91 1.08 1.35 0.84 1.14 0.85 0.99 0.78 1.08 1.85

Cell proliferation; embryonic development; embryonic pattern specification; regulation of cell differentiation; stem cell division Cell–cell adhesion; regulation of cell adhesion Sequence-specific DNA binding; transcription factor activity; development Metabolism; acetyltransferase activity; arylamine N-acetyltransferase activity Negative regulation of BMP signaling pathway Calcium ion binding; hydrolase activity; intracellular signaling cascade; lipid catabolism Signal transduction; immune response; apoptosis; transmembrane receptor activity Organogenesis; development; cardiac cell differentiation; cell fate commitment Cytoskeleton; muscle thin filament tropomyosin; actin binding; muscle contraction Cytoskeleton; calcium ion binding; cell adhesion; homophilic cell adhesion Growth factor and cytokine activity; negative regulation of differentiation Regulator of G-protein signaling activity; response to stimulus; signal transduction Calcium ion binding; homophilic cell adhesion Carbohydrate metabolism; glycogen metabolism; glycogen phosphorylase activity Activation of NF-kappaB transcription factor; cell differentiation; regulating cell cycle Development; organogenesis; skeletal development; calcium ion homeostasis Transferase activity; acyltransferase activity; N-acetyltransferase activity Lipid transporter activity; lipoprotein metabolism Telomerase activity; maintenance of genome stability; proliferation Intracellular signaling cascade; negative regulation of signal transduction Sequence-specific DNA binding; transcription factor activity Transporter activity; water channel activity Negative regulation of cell proliferation; response to stress

⁎N: normal muscle; Ts: T. spiralis-infected muscle; Tp: T. pseudospiralis-infected muscle; ↓: down-regulation.

greater than 2.0 or less than 0.5 were determined to be differentially expressed. 3. Results In this study, four independent experiments for each pair (normal and T. spiralis-infected muscle, normal and T. pseudospiralis-infected muscle) were performed. Six kinds of expression patterns, as shown in

Tables 2 to 7, were listed up as: up-regulated of 55 genes in both infections, down-regulated of 24 genes in both infections, upregulated of 30 genes only in T. spiralis infection, down-regulated of 23 genes only in T. spiralis infection, up-regulated of 25 genes only in T. pseudospiralis infection, and down-regulated of 21 genes only in T. pseudospiralis infection. Seventeen out of the differentially expressed genes were selected for further validation with quantitative real time PCR.

Table 6 Up-regulated expression of genes only in T. pseudospiralis infection Gene name

Arrestin, beta 2 (Arrb21) Netrin G1 (Ntng1) Neuroblast differentiation associated protein Programmed cell death 1 ligand 2 (Pdcd1lg2) M-cadherin Microphthalmia-associated transcription factor (Mltf) AT rich interactive domain 3B (Arid3b) Desmoglein 4 (Dsg4) Fas apoptotic inhibitory molecule 3 (Faim3) Protocadherin gamma B5 (Pcdhgb5) Regulatory factor X 3 (Rfx3) AT motif binding factor 1 (Atbf1) Deltex 2 homolog (Drosophila) (Dtx2) Protocadherin 8 (Pcdh8) Forkhead box H1 (Foxh1) Myeloblastosis oncogene (Myb) Vascular endothelial growth factor A (Vegfa) Suppressor of fused homolog (Sufu) UL16 binding protein 1 (Ulbp1) Interleukin 18 binding protein (Il18bp) Titin Protocadherin beta 21 (Pcdhb21) Protocadherin gamma subfamilyA11 (Pcdhga11) Dickkopf homolog 3 (Xenopus laevis) (Dkk3) c4b binding protein

Accession no.

Fold change Ts/N

Tp/N⁎

BC016642 AF475072 AG070124 NM_021396 NM_007662 AF222959

1.08 0.85 0.60 1.28 1.46 1.25

5.52 ↑ 5.48 ↑ 5.23 ↑ 5.15 ↑ 5.11 ↑ 4.78 ↑

NM_019689 AG170422 AK007714 NM_033577 BC017598 AK020706 AB015424 NM_021543 NM_007989 NM_033597 S37052 NM_015752 AK020784 NM_010531 AK009965 NM_053146 NM_033594 NM_015814 AG100405

1.11 1.08 1.21 1.10 1.31 1.17 1.05 1.22 1.15 0.89 0.98 0.93 0.86 1.02 1.00 0.79 0.58 1.13 1.10

4.66 ↑ 4.56 ↑ 4.35 ↑ 4.05 ↑ 3.90 ↑ 3.88 ↑ 3.85 ↑ 3.45 ↑ 3.25 ↑ 3.13 ↑ 3.09 ↑ 3.08 ↑ 3.04 ↑ 2.99 ↑ 2.88 ↑ 2.87 ↑ 2.30 ↑ 2.18 ↑ 2.05 ↑

Description

G-protein coupled receptor signaling pathway; chemotaxis; apoptosis; metastasis Development; axonogenesis; cell differentiation; neurogenesis Neuroblast differentiation Regulation of T-cell proliferation; antitumor immunity Calcium ion binding; cell adhesion; muscle development; differentiation Melanoblast and postnatal melanocyte survival; regulating proliferation; activating differentiation Transcription factor activity; chromatin assembly or disassembly Cytoskeleton; calcium ion binding; cell adhesion; keratinocyte differentiation Anti-apoptosis; cell defense response Calcium ion binding; cell adhesion protein Transcriptional repressor activity; determination of left/right symmetry Metal ion binding; neuron differentiation; regulation of transcription Ubiquitin-protein ligase activity; Notch signaling pathway Cell adhesion; morphogenesis of embryonic epithelium; somitogenesis Regulation of transcription, Cell growth; regulation of cell cycle; G1/S transition of mitotic cell cycle Cell proliferation, cycle and growth; mesoderm development; angiogenesis Negative regulation of smoothened signaling pathway; Immune response; natural killer cell activation; macrophage activation T-helper 1 type immune response; IFN-gamma-inducing factor Muscle contraction; myofibril assembly; response to oxidative stress Calcium ion binding; cell adhesion protein Spermatogenesis; calcium ion binding; homophilic cell adhesion Development; negative regulation of Wnt receptor signaling pathway Protection of apoptotic cells from complement

⁎ N: normal muscle; Ts: T. spiralis-infected muscle; Tp: T. pseudospiralis-infected muscle; ↑: up-regulation.

Z. Wu et al. / Parasitology International 57 (2008) 368–378

373

Table 7 Down-regulated expression of genes only in T. pseudospiralis infection Gene name

Accession no.

Fold change N/Ts

N/Tp⁎

CD1d1 antigen (Cd1d1)

NM_007639

1.25

4.55 ↓

Prohibitin (Phb)

NM_008831

1.05

4.39 ↓

Enabled homolog (Drosophila) (Enah) Alpha-glucanotransferase (AGL) Cyclin L2 Lck interacting transmembrane adaptor 1 (Lime1) Cullin 3 (Cul3) Cell division cycle 5 (Cdc5) Proliferating cell nuclear antigen (PCNA) Anaphase-promoting complex subunit 5 (Anapc5) Glyoxalase 1 (Glo1) Junction adhesion molecule 3 (Jam3) Tubulin, alpha 6 Proteasome subunit, beta type 4 (Psmb4) A kinase (PRKA) anchor protein 9 (Akap9) Bifunctional apoptosis regulator (Bfar) Aurora kinase B (Aurkb) N-myc downstream regulated gene 2 (Ndrg2) Cellular nucleic acid binding protein 1 Nitric oxide synthase 3 (Nos3) Brain ryanodine receptor (Ryr3)

AK020248 AG040123 BC003773 AK012881 NM_016716 AG190824 NM_011045 AK012579 AK005215 NM_023277 BC022182 BC008241 AK008727 AK013874 BC003261 NM_013864 NM_013493 NM_008713 D38218

0.75 1.08 0.86 1.21 1.05 0.88 1.45 1.17 1.15 1.01 1.31 1.11 0.97 0.86 1.05 0.97 1.01 0.85 1.63

4.22 ↓ 4.21 ↓ 4.05 ↓ 4.03 ↓ 3.86 ↓ 3.85 ↓ 3.66 ↓ 3.46 ↓ 3.31 ↓ 3.23 ↓ 3.11 ↓ 2.98 ↓ 2.90 ↓ 2.78 ↓ 2.54 ↓ 2.36 ↓ 2.15 ↓ 2.08 ↓ 2.08 ↓

Description

Antigen processing and presentation; positive regulation of innate immune response; positive regulation of interferon-gamma; interleukin-2 and interleukin-4 biosynthesis; Cell growth and/or maintenance; negative regulation of cell proliferation; regulation of cell cycle; DNA metabolism; negative regulation of transcription Development; cell differentiation; neurogenesis; actin cytoskeleton organization; Carbohydrate metabolism; glycogen biosynthesis Regulation of progression through cell cycle; regulation of transcription Immune response Cell proliferation; cell cycle arrest; G1/S transition of cell; induction of apoptosis Cell cycle; G2/M transition of mitotic cell cycle; nuclear mRNA splicing Cell proliferation; regulation of cell cycle; DNA repair; regulation of DNA replication Cell cycle; cell division; mitosis; ubiquitin cycle Lactoylglutathione lyase activity; anti-apoptosis Cell–cell adhesion Structural constituent of cytoskeleton; microtubule-based process and movement Hydrolase activity; endopeptidase activity; protein catabolism Signal transduction; synaptic transmission Structural molecule activity; anti-apoptosis; protein ubiquitination DNA methylation; protein kinase activity; cell cycle; mitosis Cell differentiation; nervous system development Positive regulation of cell proliferation; positive regulation of transcription Calcium ion binding; oxidoreductase activity; nitric oxide biosynthesis Positive regulation of interferon-gamma, interleukin-2 and interleukin-4 biosynthesis;

⁎N: normal muscle; Ts: T. spiralis-infected muscle; Tp: T. pseudospiralis-infected muscle; ↓: down-regulation.

3.1. Up-regulated expression of genes in both T. spiralis and T. pseudospiralis infection By comparing the expression profiles between T. spiralis and T. pseudospiralis infections, 55 genes were identified to be up-regulated in expression by 2–9 folds in both Trichinella infections, as shown in Table 2. Most of these genes are related to cell proliferation, differentiation, cell cycle regulation, transformation and apoptosis. The expression of paired box gene 7 (Pax7) was increased by 3.88 and 3.85 fold in T. spiralis and T. pseudospiralis infection respectively. The expression of desmin was increased by 4.21 and 3.19 fold. Both genes are satellite markers and increase expression when satellite cells are activated and proliferate during muscle development, myogenesis and regeneration. The regulator of the Notch signaling pathway, numb gene homolog (Numb), showed 4.85 and 4.56 fold increase in expression. Another two regulators of this signaling pathway, deltex 1 homolog (Dtx1) and manic fringe homolog (Mfng), also showed more than 3 fold increase in expression. Notch signaling pathway is an important pathway to involve in myogenic differentiation. Several key genes related to myogenic or cell differentiation were up-regulated in both Trichinella infections, including myocyte enhancer factor 2C (MEF2C, 2.52 and 3.01 fold in T. spiralis and T. pseudospiralis infection respectively), galectin 1 (6.32 and 5.82 fold), eyes absent 2 homolog (Eya2, 3.45 and 3.25 fold), msh-like 1 (Msx1, 3.85 and 2.89 fold), pre-B-cell leukemia transcription factor 1 (Pbx1, 3.45 and 3.26), and FMS-like tyrosine kinase 3 ligand (Flt3l, 5.89 and 6.03 fold). These genes are known to play roles in skeletal muscle myogenesis, development and regeneration. The expression of apoptosis associated genes, TNF-R1, B-cell leukemia/lymphoma 6 (Bcl6), Bcl2-interacting killer-like (Biklk), programmed cell death protein 11 (Pdcd11), proline oxidase 2 (Prodh2) and clusterin (CLU), showed more than 2 fold up-regulation in both infections. Several genes related to cell cycle regulation and proliferation were up-regulated in expression, for example, retinoblastoma 1 (Rb1), ringbox 1 (Rbx1), cut-like 1 (Cutl1), malignant T-cell amplified sequence 1 (Mcts-1), and CLU. These genes are involved in regulating cell cycle, for example, via cell cycle exit, transition, progression and arrest. The expression of the ski proto-oncogene was increased by 4.50 and 2.31 fold in T. spiralis and T. pseudospiralis infection respectively.

The expression of B-lineage lymphoma (Cbl) was up-regulated. These two oncogenes are involved in cell transformation as key players in signaling pathways. 3.2. Down-regulated expression of genes in both T. spiralis and T. pseudospiralis infection Both T. spiralis and T. pseudospiralis infection induced downregulated expression of 24 genes by 2–4 fold, as shown in Table 3. In comparison to uninfected muscle tissue, the expression of two proto-oncogenes, Jun proto-oncogene and Met proto-oncogene, was decreased by 2.68 and 2.89 fold as well as 2.10 and 2.07 fold in T. spiralis and T. pseudospiralis infection respectively. These genes are associated with cell growth, development, differentiation and cell cycle control. The expression of two genes related to cell cycle regulation was down-regulated more than two fold. One is myeloid leukemia factor 1 (Mlf1) which is a negative regulator of cell cycle progression and induces cell cycle arrest. Another gene is G0/G1 switch gene 2 (G0s2) which is associated with cell cycle withdraw. Several lipid metabolism associated genes showed decreased expression, such as, uncoupling protein 1 (Ucp1) that presents in the mitochondrial inner membrane and plays a role in skeletal muscle in regulating lipids as fuel substrates, and CD36 (fatty acid translocase) that is related to fatty acid synthesis and transportation. This downregulated expression may be responsible for the nutrition metabolism needed for the growth of muscle larvae. 3.3. Up-regulated expression of genes in T. spiralis infection The expressions of 30 genes were identified to be up-regulated only in T. spiralis infection, not in T. pseudospiralis, as shown in Table 4. Some of these genes were associated with embryonic development, cell proliferation, differentiation, and apoptosis, such as, Pax3 (increased 2.89 fold in T. spiralis infection) which acts as an upstream regulator of Myf5 and/or MyoD and plays a role in the survival and migration of myogenic progenitor cells, nuclear protein 1 (7.23 fold) which regulates cell proliferation and responses to stress, cycle A2 (4.98 fold) which plays role in cell cycle transition at G2/M, endoglin (3.46 fold) which is involved in vascular development and remodeling,

374

Z. Wu et al. / Parasitology International 57 (2008) 368–378

chordin-like 2 (Chrdl2, 5.04 fold) which plays roles in muscle differentiation, secreted protein acidic and rich in cysteine (Sparc, 4.69 fold) which influences cell proliferation, migration and differentiation by regulating cell shape, tenascin-C (2.11 fold) which is mainly expressed during embryonic development and remodeling of wound repair, interferon activated gene 202B (Ifi202b, 3.88 fold) which negatively regulates the final stage of muscle differentiation and inhibits apoptosis, melanoma antigen D2 (Maged2, 3.47 fold) which is related with embryogenesis, cell development, cell cycle progression and apoptosis, and granulin (3.79 fold) which is a secreted mitogen and has functions in cell cycle progression and cell motility. 3.4. Down-regulated expression of genes in T. spiralis infection T. spiralis infection induced decrease in expression of 23 genes by 2–4 fold, as shown in Table 5, for example, myogenesis and differentiation related genes Nanog homeobox (Nanog) and bone morphogenetic protein 2 (BMP2) which showed 4.22 and 2.89 fold decrease in expression, in comparison to uninfected muscle tissue. The expressions of some genes that negatively regulate transcription or signaling pathways were down-regulated more than 2 fold, such as, interleukin 4 (IL4)which negatively regulates differentiation, sclerostin (Sost) that negatively regulates BMP signaling pathway, and p58 interferon-induced protein kinase repressor (Prkrir) which negatively regulates cell proliferation.

3.5. Up-regulated expression of genes in T. pseudospiralis infection The expressions of 25 genes were up-regulated only in T. pseudospiralis infection by 2–5 fold, as shown in Table 6. The expression of M-cadherin, a marker of satellite cells, and up-regulated in myoblasts (activated satellite cell), developing and regenerating muscle, was increased by 5.11 fold in T. pseudospiralis infection. Cell cycle regulation related genes myeloblastosis oncogene (Myb) and AT rich interactive domain 3B (ARID3b) showed 3.13 and 4.66 fold increases in expression. Several myogenic and cell differentiation associated genes, such as, AT motif binding factor 1 (ATBF1), forkhead box H1 (FoxH1) and regulatory factor X3 (Rfx3), showed more than a 2 fold increase in expression. The expressions of several apoptosis-related genes were elevated in T. pseudospiralis infection, such as, arrestin, Fas apoptotic inhibitory molecule 3 (Faim3), and vascular endothelial growth factor A (VEGFA). 3.6. Down-regulated expression of genes in T. pseudospiralis infection Twenty-one genes were found to be down-regulated in expression by 2–4 fold only in T. pseudospiralis infection, as shown in Table 7, for example, N-myc downstream regulated gene 3 (Ndrg2, decreased by 2.36 fold) which effects cell differentiation through Myc (a controller of cell cycle and proliferation), proliferating cell nuclear antigen (PCNA, 3.66 fold) which is widely used as a proliferation marker of cell and plays a prominent role in DNA synthesis and cell proliferation,

Fig. 1. Validation of the microarray results of the genes that were up-regulated in both Trichinella spiralis and T. pseudospiralis infection (galectin 1, Numb, Pbx1, Msx1, Pax7 and Rb1). Total RNA was isolated from the uninfected (N), T. spiralis-infected (Ts23) and T. pseudospiralis-infected muscle tissue (Tp23) at 23 days p.i. The expression level of each gene was determined with quantitative real time PCR and was presented as copy numbers within 107 glyceraldehyde 3-phosphate dehydrogenase (G3PDH) copies. Four-well repeats for each sample were measured and three independent experiments were performed. The value was expressed as the mean ± S.D.

Z. Wu et al. / Parasitology International 57 (2008) 368–378

375

Fig. 2. Validation of the microarray results of the genes that were up-regulated in Trichinella spiralis (Nupr1, Sparc, granulin, cyclin A2, Chordin 2 and Pax3) and T. pseudospiralis infection (M-cadherin). Total RNA was isolated from the uninfected (N), T. spiralis-infected (Ts23) and T. pseudospiralis-infected muscle tissue (Tp23) at 23 days p.i. The expression level of each gene was determined with quantitative real time PCR and was presented as copy numbers within 107 glyceraldehyde 3-phosphate dehydrogenase (G3PDH) copies. Fourwell repeats for each sample were measured and three independent experiments were performed. The value was expressed as the mean ± S.D.

anaphase-promoting complex subunit 5 (Anapc5, 3.46 fold) which regulates cell cycle progression via its ubiquitin E3 ligase activeity, prohibitin (PHB, 4.39 fold) which is a regulator of cell cycle progression and plays roles in anti-proliferation and apoptosis, cell division cycle 5 (CDC5, 3.85 fold) that regulates G2/M transit of cell cycle, and cyclin L2 (4.05 fold) which regulates progression through cell cycle.

in T. spiralis infection, but down-regulated in T. pseudospiralis infection, which was corresponding to the result of microarray analysis (Table 4). One gene, M-cadherin, was confirmed to be up-regulated only during T. pseudospiralis infection, as shown in Fig. 2. The expression of two genes

3.7. Real time PCR confirmation of differential expression Quantitative real time PCR was used to confirm the differential expression in microarray analysis. Seventeen genes that showed very significant change in expression and may play important roles during nurse cell formation were selected, and 15 genes were confirmed to be differential expressions that were corresponding to the microarray results. Six genes that were up-regulated in both T. spiralis and T. pseudospiralis infection according to cDNA microarray analysis (shown in Table 2) were selected for the further confirmation with real time PCR, including galectin 1, Numb, Pbx1, Msx1, Pax7 and Rb1. The expression of the all six gene was up-regulated in both T. spiralis and T. pseudospiralis at 23 dpi, as shown in Fig. 1. The expressions of the genes Nupr1, Sparc, granulin, cyclin A2, Chordin 2 and Pax3 were up-regulated only in T. spiralis infection in microarray analysis. Real time PCR showed that the expression of all the six genes increased in T. spiralis infection, not in T. pseudospiralis infection, as shown in Fig. 2. The expression of two selected genes, UCP1 and CD36, was confirmed to be down-regulated in both T. spiralis and T. pseudospiralis infection, as shown in Fig. 3. The expression of granulin was up-regulated

Fig. 3. Validation of the microarray results of the genes that were down-regulated in both Trichinella spiralis and T. pseudospiralis infection (UCP1 and CD36). Total RNA was isolated from the uninfected (N), T. spiralis-infected (Ts23) and T. pseudospiralis-infected muscle tissue (Tp23) at 23 days p.i. The expression level of each gene was determined with quantitative real time PCR and was presented as copy numbers within 107 glyceraldehyde 3-phosphate dehydrogenase (G3PDH) copies. Four-well repeats for each sample were measured and three independent experiments were performed. The value was expressed as the mean ± S.D.

376

Z. Wu et al. / Parasitology International 57 (2008) 368–378

(VDR and Enah, data not shown) which were assigned as down-regulated in microarray analysis was found not to be different in real time PCR assay. 4. Discussion The muscle samples at 23 days after oral infection were analyzed using cDNA microarray analysis, because at the time of 23 days p.i., the pathological change of infected muscle cell was most extensive and the satellite cell-derived eosinophilic cytoplasm increased to account for about half of infected cell [3,4,14]. And also the previous reports showed that the peak expression of the most investigated genes occurred at 23 days p.i. [4,9,15,18–20]. Our previous cDNA microarray analysis (1178 genes) indicated that the expressions of 184 genes were up-regulated after T. spiralis infection [4]. In the present study, we listed the genes to be commonly and differentially expressed in the muscle tissues after T. spiralis and T. pseudospiralis infection, based on the results of cDNA microarray analysis (30,000 genes). In the following, we focus to discuss the potential involvement of some shared and unshared key genes in the phenomena occurred during the two kinds of Trichinella infection. 4.1. Satellite cell activation, proliferation and differentiation During the course of muscle development, a distinct subpopulation of myoblasts fails to differentiate, but it remains associated with the surface of the developing myofibers as quiescent muscle satellite cells [21]. When the muscle is damaged, these satellite cells are activated and proliferate, and then differentiate and fuse to each other or with existing damaged fibers for repair to form new myofiber [22]. It is thought that a similar process occurs in infected muscle cells. Previous studies have suggested that satellite cell activation and proliferation occur in Trichinella-infected muscle cells. A linear alignment of satellite cell nuclei is observed in the periphery of infected cells along their long axis of myofibers [3]. Myogenic regulatory factors, MyoD and myogenin, were over-expressed in both T. spiralis- and T. pseudospiralis-infected muscle tissues [4]. In the present study, microarray analysis showed that the expressions of Pax7 and desmin were up-regulated in both T. spiralisand T. pseudospiralis-infected muscle tissues, which was also confirmed by real time PCR. Pax7 and desmin are specifically expressed in quiescent and activated muscle satellite cells and have been used as a molecular marker of muscle satellite cell [23,24]. The over-expression of Pax7 and desmin indicates that the satellite cells in infected muscle were activated and proliferating. M-cadherin, a marker of satellite cells and expressed at the cell surface of proliferating satellite cells, is highly expressed during prenatal development in myogenic cells of somatic origin, in myoblasts forming small muscle bundles in developing limb bud, in myoblasts, and in regenerating skeletal muscle [25,26]. An over-expression of Mcadherin was observed in T. pseudospiralis, but not in T. spiralis (Table 6 and Fig. 2), thus suggesting the differential expression may play a role in the pathology induced by T. pseudospiralis by regulating the satellite cells of infected muscle cells. 4.2. Differentiation of satellite cells and dedifferentiation of infected muscle cells There are two kinds of differentiations that occur in the muscle cell after invasion of larvae, differentiation of satellite cells and dedifferentiation of infected muscle cells. In the present study, some genes were proposed to be related with differentiation following Trichinella infection. Notch signaling plays an important role in tissue morphogenesis both during development and during postnatal regeneration of skeletal muscle [27]. Three regulators of the Notch signaling pathway, Numb, Mfng and Dtx1, were up-regulated in both Trichinella infected muscle

tissues, suggesting that this signaling pathway is involved in the myogenesis and differentiation of satellite cells or infected muscle cells. Our previous cDNA microarray analysis indicated that T. spiralis infection induced the increase of the expression of Msx1 and Pbx1 [4]. The present study further confirmed that the expressions of the two genes were up-regulated in both Trichinella infections. Msx1 and Pbx1 are known to regulate proliferation, inhibit differentiation and trigger the dedifferentiation of multinucleate myotubes into monocleated cells which then re-enter the cell cycle and redifferentiate into myogenic cell, by regulating the expression of MRFs [28–30], suggesting these genes may play an important role in the dedifferentiation of infected muscle cells. Specific expression changes of some genes after T. spiralis or T. pseudospiralis infection may provide clues to reveal the mechanism of the different pathology changes. In T. spiralis infection, some cell differentiation related genes showed specific expression, for example, Pax3 and IFI202a (Table 4). Pax3 is known to play a role in the survival and migration of myogenic progenitor cells, acting as an upstream regulator of Myf5 and/ or MyoD [31,32]. IFI200a is up-regulated during myoblast differentiation, correlating with a decrease of MyoD expression [33,34]. Both Pax3 and IFI200a play their roles in muscle differentiation through regulating myogenic regulatory factors. Therefore, specific up-regulation of Pax3 and IFI200a expression in T. spiralis may be critical in the myogenesis occurring in infected muscle cells, which leads to the formation of nurse cells in T. spiralis infection. On the other hand, several genes related to cell differentiation showed a specific expression only in T. pseudospiralis infection, for example, ATBF1, FoxH1, Rfx3, and Sufu (Table 6). ATBF1 represses the expression of MyoD and myogenin, and elevates the expression of Id3 and cyclin D1, leading to inhibition of myogenic differentiation [35,36]. RFX3 is necessary for ciliated ependymal cell differentiation [37]. Sufu regulates cell proliferation and differentiation [38]. Therefore, these upregulations of expression suggest that the different mechanisms mediate the myogenesis and differentiation in T. pseudospiralis infection. The down-regulated expression of some genes may contribute to the differentiation of Trichinella-infected muscle cells. Nanog which was found to be down-regulate only in T. spiralis infection has been proposed to play a crucial role in the maintenance of the undifferentiated state of murine embryonic stem cells [39]. Depletion or disruption of Nanog from murine ES cells results in differentiation into extraembryonic endoderm lineage [40,41]. 4.3. Re-entry and arrest of cell cycle of infected muscle cell Following the invasion of new born larvae, T. spiralis-infected muscle cells withdraw from the G0 phase and re-enter the cell cycle, and then arrest at G2/M phase [6]. The molecular mechanism of cell cycle re-entry and arrest during infection remains unclear, but recent studies have provided further insight. In previous studies, an altered expression of cell cycle related factors was observed in T. spiralis-infected muscle tissue, such as, retinoblastoma (Rb), CDK4, cyclin C, cyclin B2, cyclin D2 and cyclin D3 [2]. In present study, several other genes related to cell cycle regulation showed a change in the expression in the both Trichinella infection, such as, CLU and G0S2 (Tables 2 and 3). An over-expression of CLU resulted in an increased accumulation of cells at the G0/G1 phases of the cell cycles, accompanied by slow down of cell cycle progression and a reduction of DNA synthesis [42]. High levels of CLU causes cell cycle arrest [43,44]. G0S2 is transiently induced upon re-entry of cells into the G1 phase of the cell cycle [45,46]. Therefore, the up-regulation of UCL and down-regulation of G0S2 induced by Trichinella infection may be response for the cell cycle arrest of infected muscle cells. Some genes effect cell proliferation by regulating the cell cycle. Id2 inhibits cell differentiation and drives proliferation by inhibiting the

Z. Wu et al. / Parasitology International 57 (2008) 368–378

Rb family [47,48], while MLF1 has strong ability to inhibit cell growth and proliferation in normal hematopoiesis, by affecting cell cycle inhibitors [49]. In both Trichinella infections, Id2 was up-regulated and MLF1 was down-regulated (Tables 2 and 3). These activities play the same role of promoting proliferation. Another two noteworthy genes are Myb and Ndrg2. The expression of Myb is proportional to the degree of cell proliferation, and the expression levels are low in the cells at arrested cycle [50,51]. On the other hand, expression of Ndrg2 is down-regulated by Myc via transcriptional repression. A high level of Ndrg2 is observed as Myc expression is reduced in differentiated cells, whereas a low level of Ndrg2 is seen following increased Myc expression upon serum stimulation [52]. The expression changes of the both genes were observed only in T. pseudospiralis infection, in an opposite pattern, upand down-regulation respectively (Tables 6 and 7). They play a similar role of suppressing differentiation and promoting proliferation through regulating the cell cycle, which might be important in inducing different pathology in T. pseudospiralis infection. 4.4. Apoptosis and anti-apoptosis in infected muscle cell During the process of nurse cell formation, there are two kinds of cytoplasm within the nurse cell, basophilic and eosinophilic cytoplasm [3]. Basophilic cytoplasm is formed by the transformation of the infected muscle cell after newborn-larva invasion [53,54]. The eosinophilic cytoplasm is derived from satellite cells and joins the nurse cell. Morphological and molecular biological data suggest that the basophilic change is a result of apoptosis and anti-apoptosis occurring in infected muscle cells. Morphological signs of apoptosis in infected muscle cells were identified as reported by Matsuo et al. [3] and Boonmars et al. [19]. Studies of the molecular mechanism of the apoptosis have indicated that both the mitochondrial mediated pathway and the death receptor pathway are involved in apoptosis [9, 19–20]. The process of pathological change in infected muscle cells is a process of degeneration and regeneration. The existence and change of two kinds of cytoplasm are associated with apoptosis. Both T. spiralis and T. pseudospiralis infection induced up-regulation expression of some apoptosis-related genes, such as Bcl6 (Table 2), a gene with bifunctional of inducing apoptosis and preventing apoptosis when over-expressed [55,56]. Several other genes related to apoptosis showed up-regulation in expression after infection, such as, nuclear protein 1 (Nupr1) and Biklk that are essential initiators of programmed cell death, Pdcd11 that induces apoptosis by inducing transcription of FasL, Prodh1 and Prodh2 that is a proapoptotic gene to induce mitochondria-mediated apoptosis. The up-regulated expression of these genes suggests that they engage in the apoptosis in infected muscle cell through different mechanisms. 4.5. Transformation of infected muscle cell The early events that occur in infected muscle cells are similar to those occurring during muscle regeneration, such as, activation, proliferation and differentiation of satellite cells. The difference is that differentiated satellite cells (myoblasts) fuse and form new myofibers in muscle cell regeneration, while infected muscle cell does not regenerate into a new myofibers, instead they transform into a cell that is completely different from muscle cell. Therefore, transformation is a critical process in nurse cell formation. A previous study indicated that c-ski is involved in the transformation of T. spiralisinfected muscle cells [18]. The present study indicated that some other transformation related genes showed changed expression in infected muscle tissues, which provides new insight to reveal the mechanism of transformation in Trichinella infection.

377

One of the candidate genes involved in the transformation of infected muscle cells is MCT-1 which was up-regulated in both T. spiralis and T. pseudospiralis infection. Known as an oncogene, MCT-1 has transforming capacity in NIH3T3 cells and human mammary epithelial cells [57,58]. Several other candidate genes proposed to be involved in the transformation of infected muscle cells were Cbl, Mitf and tenascin-C. Cbl was identified as transforming protein and plays a role in suppressing transformation through negatively regulating PTK signaling [59]. Flt3 is frequently involved in leukemic transformation [60]. Mitf induces anchorage-independent growth of NIH-3T3 cells in cooperation with STAT3C [61]. Tenascin-C is associated with tumorigenesis in malignant transformation, uncontrolled proliferation, metastasis and angiogenesis [62]. Therefore, the expression changes of these genes suggest their potential function in the transformation in Trichinella infection. 4.6. Immune response T. spiralis and T. pseudospiralis infection induce different immunological response and inflammation in muscle tissues [17,63,64]. To reduce the effects of inflammation response to the gene expression profiles, we used nude mice. The changed expression of some genes related to immune response was observed, for example, CD152 and ITK which were up-regulated in both Trichinella infections, Ccl8 and IL-17R which were up-regulated only in T. spiralis infection, and CD1d1 and Lim1 which were down-regulated only in T. pseudospiralis infection, suggesting these factors are likely responsible for the immune modulation and different inflammation response between the two species Trichinella infection. In summary, this study identified the candidate genes that may be involved in common and different pathological changes after Trichinella infection. Many of these genes are related to the differentiation, proliferation, transformation and apoptosis that occur in muscle development, myogenesis and regeneration, thus indicating that the processes of pathological changes during Trichinella infection utilize the mechanism of muscle development and repair. The present results provided start-line information on the molecular mechanism of the unique pathology of Trichinella infection. However, the results obtained in the present study were from infected muscle tissues which included infected muscle cells, uninfected muscle cells and inflammatory cells. Therefore, further confirmation of the expression changes and kinetics with more quantitative techniques, and localization of the altered expression with immunohistochemistry techniques, will help to reveal the potential functions of these candidate genes during Trichinella infection. Acknowledgement This study was supported by a Grant-in-Aid for Scientific Research (17590370) from the Ministry of Education, Culture, Sports, Science and Technology of Japan. References [1] Despommier DD. How does Trichinella spiralis make itself at home? Parasitol Today 1998;14:318–23. [2] Wu Z, Nagano I, Boonmars T, Takahashi Y. A spectrum of functional genes mobilized after Trichinella spiralis infection in skeletal muscle. Parasitology 2005;130:561–73. [3] Matsuo A, Wu Z, Nagano I, Takahashi Y. Five types of nuclei present in the capsule of Trichinella spiralis. Parasitology 2000;121:203–10. [4] Wu Z, Matsuo A, Nakada T, Nagano I, Takahashi Y. Different response of satellite cells in the kinetics of myogenic regulatory factors and ultrastructural pathology after Trichinella spiralis and T. pseudospiralis infection. Parasitology 2001;123:85–94. [5] Despommier DD, Aron L, Turgeon L. Trichinella spiralis: growth of the intracellular (muscle) larva. Exp Parasitol 1975;37:108–16. [6] Jasmer DP. Trichinella spiralis infected skeletal muscle cells arrest in G2/M and cease muscle gene expression. J Cell Biol 1993;121:785–93. [7] Jasmer DP, Neary SM. Trichinella spiralis: inhibition of muscle larva growth and development is associated with a delay in expression of infected skeletal muscle characteristics. Exp Parasitol 1994;78:317–25.

378

Z. Wu et al. / Parasitology International 57 (2008) 368–378

[8] Vassilatis DK, Polvere RI, Despommier DD, Gold AM, Van der Ploeg LH. Developmental expression of a 43-kDa secreted glycoprotein from Trichinella spiralis. Mol Biochem Parasitol 1996;78:13–23. [9] Wu Z, Nagano I, Boonmars T, Takahashi Y. Tumor necrosis factor receptor-mediated apoptosis in Trichinella spiralis-infected muscle cells. Parasitology 2005;131:373–81. [10] Despommier DD, Symmans WF, Dell R. Changes in nurse cell nuclei during synchronous infection with Trichinella spiralis. J Parasitol 1991;77:290–5. [11] Teppema JS, Robinson JE, Ruitenberg EJ. Ultrastructural aspects of capsule formation in Trichinella spiralis infection in the rat. Parasitology 1973;66:291–6. [12] Baruch AM, Despommier DD. Blood vessels in Trichinella spiralis infections: a study using vascular casts. J Parasitol 1991;77:99–103. [13] Xu D, Wu Z, Nagano I, Takahashi Y. A muscle larva of Trichinella pseudospiralis is intracellular but does not form a typical cyst wall. Parasitol Int 1997;46:1–5. [14] Boonmars T, Wu Z, Nagano I, Nakada T, Takahashi Y. Differences and similarities of nurse cells in cysts of Trichinella spiralis and T. pseudospiralis. J Helminthol 2004;78:7–16. [15] Boonmars T, Wu Z, Nagano I, Takahashi. Trichinella pseudospiralis infection is characterized by more continuous and diffuse myopathy than T. spiralis infection. Parasitol Res 2005;97:13–20. [16] Alford K, Obendorf DL, Fredeking TM, Haehling E, Stewart GL. Comparison of the inflammatory responses of mice infected with American and Australian Trichinella pseudospiralis or Trichinella spiralis. Int J Parasitol 1998;28:343–8. [17] Li CK, Ko RC. Inflammatory response during the muscle phase of Trichinella spiralis and T. pseudospiralis infections. Parasitol Res 2001;87:708–14. [18] Wu Z, Nagano I, Boonmars T, Takahashi Y. Involvement of the c-Ski oncoprotein in cell cycle arrest and transformation during nurse cell formation after Trichinella spiralis infection. Int J Parasitol 2006;36:1159–66. [19] Boonmars T, Wu Z, Nagano I, Takahashi Y. Expression of apoptosis-related factors in muscles infected with Trichinella spiralis. Parasitology 2004;128:323–32. [20] Boonmars T, Wu Z, Nagano I, Takahashi. What is the role of p53 during the cyst formation of Trichinella spiralis? A comparable study between knockout mice and wild type mice. Parasitology 2005;131:705–12. [21] Gros J, Manceau M, Thome V, Marcelle CA. Common somitic origin for embryonic muscle progenitors and satellite cells. Nature 2005;435:954–8. [22] Wozniak AC, Kong J, Bock E, Pilipowicz O, Anderson JE. Signaling satellite-cell activation in skeletal muscle: markers, models, stretch, and potential alternate pathways. Muscle Nerve 2005;31:283–300. [23] Seale P, Sabourin LA, Girgis-Gabardo A, Mansouri A, Gruss P, Rudnicki MA. Pax7 is required for the specification of myogenic satellite cells. Cell 2000;102:777–86. [24] Hawke TJ, Garry DJ. Myogenic satellite cells: physiology to molecular biology. J Appl Physiol 2001;91:534–51. [25] Cornelison DD, Wold BJ. Single-cell analysis of regulatory gene expression in quiescent and activated mouse skeletal muscle satellite cells. Dev Biol 1997;191:270–83. [26] Wrobel E, Brzoska E, Moraczewski J. M-cadherin and beta-catenin participate in differentiation of rat satellite cells. Eur J Cell Biol 2007;86:99–109. [27] Artavanis-Tsakonas S, Rand MD, Lake RJ. Notch signaling: cell fate control and signal integration in development. Science 1999;284:770–6. [28] Odelberg SJ, Kollhoff A, Keating MK. Dedifferentiation of mammalian myotubes induced by msx1. Cell 2000;103:1099–109. [29] Hu G, Lee H, Price SM, Shen MM, Abate-Shen C. Msx homeobox genes inhibit differentiation through upregulation of cyclin D1. Development 2001;128:2373–84. [30] Berkes CA, Bergstrom DA, Penn BH, Seaver KJ, Knoepfler PS, Tapscott SJ. Pbx marks genes for activation by MyoD indicating a role for a homeodomain protein in establishing myogenic potential. Mol Cell 2004;14:465–77. [31] Tajbakhsh S, Rocancourt D, Cossu G, Buckingham M. Redefining the genetic hierarchies controling skeletal myogenesis: Pax3 and Myf5 act upstream of MyoD. Cell 1997;89:127–38. [32] Buckingham M. Myogenic progenitor cells and skeletal myogenesis in vertebrates. Curr Opin Genet Dev 2006;16:525–32. [33] Datta B, Min W, Burma S, Lengyel P. Increase in p202 expression during skeletal muscle differentiation: inhibition of MyoD protein expression and activity by p202. Mol Cell Biol 1998;18:1074–83. [34] Wang H, Ding B, Liu CJ, Ma XY, Deschamps S, Roe BA, et al. The increase in levels of interferon-inducible proteins p202a and p202b and RNA-dependent protein kinase (PKR) during myoblast differentiation is due to transactivation by MyoD: their tissue distribution in uninfected mice does not depend on interferons. J Interf Cytok Res 2002;22:729–37. [35] Berry FB, Miura Y, Mihara K, Kaspar P, Sakata N, Hashimoto-Tamaoki T, et al. Positive and negative regulation of myogenic differentiation of C2C12 cells by isoforms of the multiple homeodomain zinc finger transcription factor ATBF1. J Biol Chem 2001;276:25057–65. [36] Jung CG, Kim HJ, Kawaguchi M, Khanna KK, Hida H, Asai K, et al. Homeotic factor ATBF1 induces the cell cycle arrest associated with neuronal differentiation. Development 2005;132:5137–45.

[37] Baas D, Meiniel A, Benadiba C, Bonnafe E, Meiniel O, Reith W, et al. A deficiency in RFX3 causes hydrocephalus associated with abnormal differentiation of ependymal cells. Eur J Neurosci 2006;24:1020–30. [38] Katoh Y, Katoh M. Hedgehog signaling pathway and gastrointestinal stem cell signaling network (review). Int J Mol Med 2006;18:1019–23. [39] Sun Y, Li H, Yang H, Rao MS, Zhan M. Mechanisms controlling embryonic stem cell self-renewal and differentiation. Crit Rev Eukar Gene Exp 2006;16:211–31. [40] Hyslop L, Stojkovic M, Armstrong L, Walter T, Stojkovic P, Przyborski S, et al. Downregulation of NANOG induces differentiation of human embryonic stem cells to extraembryonic lineages. Stem Cell 2005;23:1035–43. [41] Hough SR, Clements I, Welch PJ, Wiederholt KA. Differentiation of mouse embryonic stem cells after RNA interference-mediated silencing of OCT4 and Nanog. Stem Cell 2006;24:1467–75. [42] Shannan B, Seifert M, Boothman DA, Tilgen W, Reichrath J. Clusterin and DNA repair: a new function in cancer for a key player in apoptosis and cell cycle control. J Mol Histol 2006;37:183–8. [43] Scaltriti M, Bettuzzi S, Sharrard RM, Caporali A, Caccamo AE, Maitland NJ. Clusterin overexpression in both malignant and nonmalignant prostate epithelial cells induces cell cycle arrest and apoptosis. Brit J Cancer 2004;91:1842–50. [44] Scaltriti M, Santamaria A, Paciucci R, Bettuzzi S. Intracellular clusterin induces G2-M phase arrest and cell death in PC-3 prostate cancer cells1. Cancer Res 2004;64:6174–82. [45] Russell L, Forsdyke DR. A human putative lymphocyte G0/G1 switch gene containing a CpG-rich island encodes a small basic protein with the potential to be phosphorylated. DNA Cell Biol 1991;10:581–91. [46] Zandbergen F, Mandard S, Escher P, Tan NS, Patsouris D, Jatkoe T, et al. The G0/G1 switch gene 2 is a novel PPAR target gene. Biochem J 2005;392:313–24. [47] Zebedee Z, Hara E. Id proteins in cell cycle control and cellular senescence. Oncogene 2001;220:8317–25. [48] Lasorella A, Rothschild G, Yokota Y, Russell RG, Iavarone A. Id2 mediates tumor initiation, proliferation, and angiogenesis in Rb mutant mice. Mol Cell Biol 2005;25:3563–74. [49] Matsumoto N, Yoneda-Kato N, Iguchi T, Kishimoto Y, Kyo T, Sawada H, et al. Elevated MLF1 expression correlates with malignant progression from myelodysplastic syndrome. Leukemia 2000;14:1757–65. [50] Lam EWF, Bennet JD, Watson RJ. Cell-cycle regulation of human B-myb transcription. Gene 1995;160:277–81. [51] Lam EWF, Robinson C, Watson RJ. Characterization and cell-cycle regulated expression of mouse BMyb. Oncogene 1992;7:1885–90. [52] Zhang J, Li F, Liu X, Shen L, Liu J, Su J, et al. The repression of human differentiationrelated gene NDRG2 expression by Myc via Miz-1-dependent interaction with the NDRG2 core promoter. J Biol Chem 2006;281:39159–68. [53] Blotna-Filipiak M, Gabryel P, Gustowska L, Kucharska E, Wranicz MJ. Trichinella spiralis: induction of the basophilic transformation of muscle cells by synchronous newborn larvae. II. Electron microscopy study. Parasitol Res 1998;84:823–7. [54] Wranicz MJ, Gustowska L, Gabryel P, Kucharska E, Cabaj W. Trichinella spiralis: induction of the basophilic transformation of muscle cells by synchronous newborn larvae. Parasitol Res 1998;84:403–7. [55] Yamochi T, Kaneita Y, Akiyama T, Mori S, Moriyama M. Adenovirus-mediated high expression of BCL-6 in CV-1 cells induces apoptotic cell death accompanied by down-regulation of BCL-2 and BCL-X(L). Oncogene 1999;18:487–94. [56] Kojima S, Hatano M, Okada S, Fukuda T, Toyama Y, Yuasa S, et al. Testicular germ cell apoptosis in Bcl6-deficient mice. Development 2001;128:57–65. [57] Prosniak M, Dierov J, Okami K, Tilton B, Jameson B, Sawaya BE, et al. A novel candidate oncogene, MCT-1, is involved in cell cycle progression. Cancer Res 1998;58:4233–7. [58] Hsu HL, Shi B, Gartenhaus RB. The MCT-1 oncogene product impairs cell cycle checkpoint control and transforms human mammary epithelial cells. Oncogene 2005;24:4956–64. [59] Swaminathan G, Tsygankov AY. The Cbl family proteins: ring leaders in regulation of cell signaling. J Cell Physiol 2006;209:21–43. [60] Sargin B, Choudhary C, Crosetto N, Schmidt MH, Rensinghoff M, Thiessen C, et al. Flt3-dependent transformation by inactivating c-Cbl mutations in AML. Blood 2007;110:1004–12. [61] Joo A, Aburatani H, Morii E, Iba H, Yoshimura A. STAT3 and MITF cooperatively induce cellular transformation through upregulation of c-fos expression. Oncogene 2004;23:726–34. [62] Orend G, Chiquet-Ehrismann R. Tenascin-C induced signaling in cancer. Cancer Lett 2006;244:143–63. [63] Alford K, Obendorf DL, Fredeking TM, Haehling E, Stewart GL. Comparison of the inflammatory responses of mice infected with American and Australian Trichinella pseudospiralis or Trichinella spiralis. Int J Parasitol 1998;28:343–8. [64] Lee KM, Ko RC. Cell-mediated response at the muscle phase of Trichinella pseudospiralis and Trichinella spiralis infections. Parasitol Res 2006;99:70–7.