Candidatus Mycoplasma haematoparvum and Mycoplasma haemocanis infections in dogs from the United States

Comparative Immunology, Microbiology and Infectious Diseases 35 (2012) 557–562

Contents lists available at SciVerse ScienceDirect

Comparative Immunology, Microbiology and Infectious Diseases journal homepage: www.elsevier.com/locate/cimid

Candidatus Mycoplasma haematoparvum and Mycoplasma haemocanis infections in dogs from the United States S.M. Compton, R.G. Maggi, E.B. Breitschwerdt ∗ Intracellular Pathogens Research Laboratory, Center for Comparative Medicine and Translational Research, College of Veterinary Medicine, North Carolina State University (NCSU), 1060 William Moore Dr., Raleigh, NC 27607, United States

a r t i c l e

i n f o

Article history: Received 21 March 2012 Received in revised form 13 June 2012 Accepted 19 June 2012 Keywords: Mycoplasma Hemoplasmas Erythrocytes PCR Disease

a b s t r a c t Mycoplasma haemocanis (Mhc) and Candidatus Mycoplasma haematoparvum (CMhp) have been described in dogs. Historically, microscopic visualization of hemotropic Mycoplasma spp. has occurred most often in immunocompromised or splenectomized dogs. The aim of this study was to determine the Mhc and CMhp prevalences among dogs from the United States. Novel 16S rRNA and RNAseP gene PCR assays were used to amplify hemotropic Mycoplasma species DNA for GenBank sequence alignment. Among the study population, hemoplasma prevalence was 1.3% (7 out of 506), with Mhc and CMhp prevalences of 0.6% and 0.8%, respectively. Two of six CMhp-infected dogs were co-infected with a Bartonella sp., and a third dog was seroreactive to Bartonella henselae antigens. The prevalence of Mhc and CMhp in this study was low; potential blood donors should be screened; and dogs and people can be co-infected with hemoplasma and Bartonella spp. © 2012 Elsevier Ltd. All rights reserved.

1. Introduction Hemotropic Mycoplasmas, or hemoplasmas have been characterized as cell wall-deficient, uncultivable bacteria, that colonize the outside of erythrocytes and infect a wide range of vertebrate hosts [1,2]. Until several years ago, the only canine-characterized hemotropic Mycoplasma sp. known worldwide was Mycoplasma haemocanis (Mhc). Chronic, sub-clinical hemoplasma infections have been reported in both immunocompetent and therapeutically or cancer-induced immunocompromised dogs [2]. As summarized in Wengi et al. [3], hemolytic anemia is the predominant clinicopathological abnormality that occurs in dogs in association with Mycoplasma sp. infection, particularly following splenectomy, in association with concurrent infections and after therapeutic immunosuppression. Diagnostically, hemotropic Mycoplasma organisms have not been successfully grown by in vitro culture; therefore, prior

∗ Corresponding author. Tel.: +1 919 513 8277; fax: +1 919 513 6336. E-mail address: ed [email protected] (E.B. Breitschwerdt). 0147-9571/$ – see front matter © 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.cimid.2012.06.004

to the advent of PCR testing hemoplasmas were only identified by light microscopy during cytological evaluation of blood smears. In 2004, a novel hemotropic mycoplasma was identified in a splenectomized immunocompromised dog with hemic lymphoid neoplasia with a proposed name of Candidatus Mycoplasma haematoparvum (CMhp) [2,4]. Subsequently, the molecular prevalence of CMhp has been determined in several countries, including Brazil, France, Spain, Switzerland, eastern Sudan, Tanzania, Trinidad, and the United Kingdom [3,5–10]. Studies from Brazil, France, Spain, Switzerland, eastern Sudan, Tanzania and Trinidad found prevalence’s of CMhp in 11 out of 147 (7.5%), 44 out of 460 (9.6%), 1 out of 182 (0.6%), 3 out of 889 (0.3%), 26 out of 78 (33.3%), 1 out of 100 (1%), and 5 out of 184 (2.7%) dogs, respectively [3,5,7–9]. Another study involving three Mediterranean countries (Italy, Spain, and Portugal), found of CMhp prevalences of 5% (30 out of 600), 2.0% (4 out of 200), and 0% (0 out of 50) dogs, respectively [11]. The molecular prevalence of Mhc for Brazil, France, Spain, Switzerland, eastern Sudan, Tanzania, and Trinidad was 2 out of 147 (1.4%), 15 out of 460 (3.3%), 26 out of 182

558

S.M. Compton et al. / Comparative Immunology, Microbiology and Infectious Diseases 35 (2012) 557–562

(14.3%), 8 out of 889 (0.9%), 7 out of 78 (9.0%), 19 out of 100 (19.0%), and 9 out of 184 (4.9%), dogs respectively [3,5,7–9]. In the study of dogs from Italy, Spain, and Portugal, the Mhc prevalence was 22 out of 600 (3.7%), 1 out of 200 (0.5%), and 20 out of 50 (20.0%), respectively [11]. In these studies, one dog each from Spain and Tanzania and five dogs from Italy were co-infected with Mhc and CMhp [7,9,11]. Hemoplasma DNA was not amplified from dog blood samples (n = 227) in a study from the United Kingdom [10]. Real-time quantitative polymerase chain reaction (qPCR) targeting the 16S rRNA gene was used in all of these previous studies, except the Sudanese study, which used nested PCR to identify CMhp and Mhc. The objectives of this study were to determine the molecular prevalence of CMhp and Mhc DNA in healthy dogs, in age and sex-matched healthy Golden retrievers and Golden retrievers with lymphoma, and in sick dogs, suspected of a tick borne disease. We also attempted to determine if hemoplasmosis correlated with clinical or hematological abnormalities in hemoplasma-infected dogs.

blood samples from 383 sick dogs, residing predominantly in North Carolina, Virginia and other eastern states and suspected of infection with a tick-borne pathogen were included in this group. Gp IV samples were submitted for testing between June 2008 and January 2010. As diagnostic accessions, the age and sex of most of these dogs was not provided.

2. Materials and methods

2.3. DNA extraction, quality control, and Mycoplasma sp. PCR assay

2.2. Review of medical records When medical records were accessible, data from dogs infected with a hemotropic Mycoplasma were reviewed to assess health status, prominent disease manifestations and clinicopathological abnormalities. When tested, Babesia canis, Bartonella henselae, Bartonella vinsonii subsp. berkhoffii, Ehrlichia canis and Rickettsia rickettsii indirect immunofluorescent assay serology results and SNAP 4Dx Dirofilaria immitus antigen and Anaplasma spp., Borrelia burgdorferi, and Ehrlichia spp. antibody results were reviewed to determine exposure to canine vector-borne pathogens.

2.1. Samples Blood samples from four groups of dogs were tested as a component of this study. The populations included: group (Gp) I: healthy dogs from North Carolina (n = 63) and NCSU-VTH blood donors (n = 9)., Gp II healthy Golden retrievers (n = 35), Gp III Golden retrievers with lymphoma (n = 20) from throughout the United States and Gp IV blood samples submitted for diagnostic purposes from sick dogs (n = 383) suspected of a tick-borne infectious disease. With the owner’s permission, EDTA anti-coagulated blood samples were obtained by a veterinarian in Cary, North Carolina, from sixty healthy dogs (Gp I), when examined for routine health care issues such as vaccination, annual physical examination or deworming. These samples, collected between October of 2006 and February of 2007, were stored frozen and used on a periodic basis to evaluate vector-borne infectious disease status in a healthy dog population. Also included in Gp I were 9 healthy dogs that were screened as potential NCSU-VTH blood donors using a panel of serological assays for exposure to vector borne pathogens in the VBDDL and using the Bartonella alpha Proteobacteria growth medium (BAPGM) platform for microbiological detection of Bartonella sp. [12] Blood and lymph node samples from Gps II and III (age and sex-matched healthy and lymphoma Golden retrievers respectively) were tested for serological and PCR evidence of Anaplasma, Bartonella and Ehrlichia species infections as a component of a previously reported study [12]. These samples were obtained between November of 2004 through December 2006. Mycoplasma PCR was performed on stored frozen DNA extracted blood (n = 35) or lymph node aspirates (n = 29) from Gp II dogs and blood (n = 19) and lymph node aspirates (n = 14) from Gp III dogs. Gp IV consisted of diagnostic accessions submitted to the North Carolina State University, College of Veterinary Medicine Vector Borne Diseases Diagnostic Laboratory (VBDDL). Stored frozen

To determine the prevalence of Mycoplasma species in naturally infected dogs in this study, DNA extraction, PCR amplification and DNA sequencing were performed at the Intracellular Pathogens Research Laboratory (IPRL), College of Veterinary Medicine-NCSU. DNA extraction was performed using QIAamp DNA minikit using stored frozen blood or lymph node specimens (Gps I-IV). DNA quantity (absorbance 260 nm) and quality (absorbance ratio 260/280) was measured spectroscopically (Nanodrop, Thermo Scientific, Fisher, USA) for each extracted sample. The range of DNA for all samples was between 10 and 30 ng/␮l. All extracted DNA samples were eluted in nuclease-free water and stored at −20 ◦ C until use. Mycoplasma sp. PCR primers used in this study were developed after alignment of fifteen 16S rRNA gene sequences from hemotropic Mycoplasma species cited in GenBank as described by Varanat et al. in 2011 [13]. Methods for PCR amplification and DNA sequencing were described previously [13]. Briefly, PCR was performed using the primers 322s and 938as targeting a 600bp region of the 16S rRNA gene. Oligonucledotides Myco80: 5 GTGACTGGGGTGAAGTCGTAACAAGGTATCCCT 3 and Myco720as: 5 TCCTGTTGCTACTAAGATGTTTCAGTTCAC 3 were used as sense and antisense internal transcribed spacer (ITS) region primers, respectively. Following standard operating procedures at the IPRL, PCR sample preparation, DNA extraction, and PCR amplification and analysis were performed in three separate rooms to avoid DNA contamination. 16S rRNA PCR positive samples were subsequently tested using another primer set that targets the hemotropic Mycoplasma RNAseP gene. This primer set was designed to amplify a 170bp sequence. Oligonucledotides HemoMyco RNaseP30s: 5 GATKGTGYGAGYATATAAAAAATAAARCTCRAC 3 and HemoMyco RNAseP200as: 5 GMGGRGTTTACCGCGTTTCAC

S.M. Compton et al. / Comparative Immunology, Microbiology and Infectious Diseases 35 (2012) 557–562

559

Table 1 Signalment and demographic data for dogs infected with Candidatus Mycoplasma haematoparvum or Mycoplasma haemocanis. Group/dog #

Age (Yrs)

Breed

Sex

State of origin

Major clinical findings

PCR result

Co-infection

Labrador mix Pit bull

FS MC

NC PA

None haemolytic anemia

M. haemocanis Candidatus M. haematoparvum Candidatus M. haematoparvum Candidatus M. haematoparvum Candidatus M. haematoparvum

Bartonella henselaea Babesia gibsoni

M. haemocanis

None Detected

Gp I/1 Gp IV/2

3 14.9

Gp IV/3

8.4

Golden retriever

F

IL

Lyme disease

Gp IV/4

5

Golden retriever

FS

NC

Chylothorax

Gp IV/5

6

Rottweiler

MC

MN

Gp IV/7

3

Greyhound

MC

VA

Granulomatous hepatitis, modified transudate Rescue, diabetes mellitus, lethargy

a

Borrelia burgdorferia Bartonella vinsonii subsp. berkhoffii None detected

Serology result, whereas all other co-infection results are based upon PCR amplification and DNA sequencing.

3 were used as sense and antisense primers, respectively. DNA amplification of the RNaseP gene was performed at 25 ␮l final volume. PCR conditions were as follows: a denaturing cycle of 2 min at 95 ◦ C, followed by 55 cycles of 15 at 94 ◦ C, 10 at 61 ◦ C and 15 at 72 ◦ C. PCR amplification was finalized by a final cycle of 30 at 72 ◦ C. 2.4. DNA sequencing and analysis After blood or lymph node samples were confirmed positive by PCR amplification, DNA sequencing was performed to define the Mycoplasma species. Sequences were compared to the GenBank database using the Basic Local Alignment Search Tool. 2.5. Statistical analysis A Chi-squared test was used to compare the prevalence of Mycoplasma spp. DNA among the various groups and the frequency of diagnosis of CMhp versus Mhc in sick dogs. 3. Results Using 16S rRNA primers, CMhp or Mhc DNA was amplified and sequenced from 7 out of 506 dog blood samples (1.3%). Infection with Mhc was confirmed by amplifying and sequencing the RNase P gene in 3 of 4 16S PCR positive samples, however the RNase P PCR did not generate an amplicon from any CMhp-infected blood sample. Coinfection with more than one Mycoplasma sp. was not found in any sample. One of nine healthy blood donors, concurrently screened using the BAPGM platform was PCR positive for Mhc on two occasions. This potential blood donor was co-infected with B. henselae. The remaining Gp I healthy dogs included 42 females and 21 males that ranged in age from 9 months to 12 years with a median age of 5 years. Mhc was amplified from one of 60 blood samples from these Gp I healthy dogs. Although healthy at the time of sample collection, the Mhc infected dog was rescued by and belonged to a veterinary technician who worked at the veterinary practice. Gp II included 14 female and 21 male healthy Golden retrievers, ranging in age from 1 to 13 years with a median age of 7 years. Paired lymph node aspiration samples were

available for PCR for all Gp II dogs. Gp III dogs included Golden retrievers with lymphoma, of which there were 12 males and 7 females ranging in age from 1 to 13 years with a median age of 8 years. Paired lymph node aspiration samples were available from all but one of these dogs. No Mycoplasma sp. DNA was amplified from extracted DNA from blood or lymph node aspiration samples obtained from Golden retrievers in either Gp II or III. CMhp or Mhc DNA was amplified and sequenced from four and one Gp IV dogs, respectively (Table 1). There was no statistical difference in hemoplasma prevalence among healthy and sick dogs and there was no difference in diagnostic frequency of CMhp versus Mhc in the sick dog population. Of the five Gp IV dogs infected with a hemotropic Mycoplasma, there were three males and two females, ranging in age from 3 to 15 years. The age, breed, sex, state of origin, major clinical findings, Mycoplasma sp. detected and evidence of any co-infecting pathogen for these five dogs are summarized in Table 1. Detailed medical records were retrievable for review for dogs 4 and 5. Dog 4: Dog 4 was referred to the NCSU-CVM-VTH Cardiology Service in April 2009 for a suspected heart-based mass with accompanying pleural effusion. Chylothorax was diagnosed based upon pleural fluid analysis (white blood cell count 1860/␮l, 63% large mononuclear cells, 18% small mononuclear cells and 19% non-degenerate neutrophils, fluid triglycerides 1895 mg/dl). The mononuclear cells were composed of lymphocytes, reactive mesothelial cells and frequent plasma cells. B. vinsonii subsp. berkhoffii DNA was amplified and sequenced from a BAPGM (Bartonella alpha Proteobacteria growth medium) enrichment blood culture. A thoracic mass was not visualized by echocardiography or computed thoracic tomography and lymphangiogram. There was mild mediastinal and sternal lymphadenomegaly with likely thoracic duct rupture in the cranial mediastinum. Despite medical therapy, there was rapid re-accumulation of pleural fluid, which necessitated thoracotomy and thoracic duct ligation. Subacute pericarditis, characterized by mildly hyperplastic mesothelial cells with focal infiltration of neutrophils, plasma cells and lymphocytes with occasional dilated vessels, was diagnosed from a pericardial biopsy. Retrospective PCR testing documented Candidatus M. haematoparvum

560

S.M. Compton et al. / Comparative Immunology, Microbiology and Infectious Diseases 35 (2012) 557–562

DNA in the blood at the time of chylothorax diagnosis. Dog 5: Dog 5 was referred to the Clinical Oncology Service at the University of Minnesota, College of Veterinary Medicine because of lethargy, weight loss and abdominal effusion, which was characterized as a modified transudate. Although cancer was suspected, no masses were found within the abdominal cavity by survey radiographs and abdominal ultrasound. Portal pressures were normal and an angiogram did not identify a thrombosis or evidence of portal vein thrombosis. Because the liver biopsy histopathology identified severe pyogranulomatous portal inflammation, a diagnosis of bartonellosis was pursued. Antibodies were not detected by indirect fluorescent antibody testing using B. henselae and B. vinsonii subsp. berkhoffii antigens. Bartonella sp. DNA was not amplified from blood or BAPGM enrichment blood cultures. The liver biopsy was negative for organisms using GMS and acid-fast stains, and also stained negatively for copper accumulation. A definitive diagnosis was not obtained; however, in June 2010 the dog was treated for 6 weeks with azithromycin for a tentative diagnosis of B. henselae granulomatous hepatitis [14]. By the fall of 2010, the referring veterinarian reported complete resolution of the abdominal effusion. During an annual follow-up examination in June 2011, the dog was reportedly healthy with the exception of diffuse, multifocal, puritic skin lesions. The dog’s body weight had normalized (weight 45.5 kg), and there were no hematological or serum biochemical abnormalities. 4. Discussion In this study, the overall hemoplasma prevalence among dogs from the United States was 1.3% (7 out of 506), with Mhc and CMhp prevalences of 0.6% and 0.7%, respectively. There was no significant difference in the frequency of a specific Mycoplasma sp. (CMhp and Mhc) across groups and there was no significant difference in the frequencies of PCR positive versus PCR negative samples among the healthy (Gp1) versus sick dogs (Gp IV). Although potentially biased by the retrospective selection of dogs suspected of a tick borne infection for inclusion in this study, all Mycoplasma infected Gp I and IV dogs were of large breed and two of the sick Gp IV dogs were Golden retrievers. The PCR prevalence of hemotropic Mycoplasma sp. in dogs reported in previous studies from European and African regions has varied widely. Variations in the dog populations selected for testing in these studies, differences in climate, the frequencies of various behavioral activities such as fighting, the extent and timing of ectoparasite exposure and differences in PCR assays used in different research laboratories are most likely responsible variation in the prevalence of CMhp and Mhc described among previous studies. In this study, CMhp or Mhc DNA was the only hemotropic Mycoplasma sp. amplified and sequenced from the respective dog populations. In a previous study from our laboratory using the same, novel 16S primers Mycoplasma ovis DNA was amplified and sequenced from 3 of 6 hemoplasma infected dogs [13]. Among the healthy populations (Gps I and II) tested in our study, two dogs were infected

with Mhc. Interestingly, both of these dogs were rescued by veterinary professionals from environments in which vector exposure was substantial and the opportunity for dog fights was likely. Based upon the retrospective testing performed as a function of this study, the blood donor was most likely infected with Mhc during the period that the dog was used as a donor. Fortunately, this dog was removed from the blood donor program when it was established using the BAPGM enrichment blood culture platform that the dog was infected with B. henselae. Thus, evolving evidence supports screening of canine blood donors for both hemotropic Mycoplasma and Bartonella spp. Screening would be of particular importance for dogs that are adopted or rescued from environments in which dog fighting and flea and tick exposures are likely. Two dogs were co-infected with a Bartonella spp. and M. haemocanis and a third M. haemocanis dog was B. henselae seroreactive. Recently, human case studies from Brazil and the United States have described human patients infected with B. henselae and Mycoplasma haemofelis or B. henselae and a Mycoplasma sp. most closely related to Mycoplasma ovis [15,16]. The patient from Brazil was immunocompromised due to HIV infection [15], whereas the patient from the United States was a veterinarian who was therapeutically immunocompromised as a result of treatments for multiple sclerosis [16]. Although presumably infrequent, these two recent human case reports identified hemotropic Mycoplasma sp. suggesting that opportunistic infection can also occur in immuncompromised individuals. Also, a recent study from China identified Mycoplasma suis in pigs, swine workers, and veterinarians associated with rural pig farms. That study reported 32 of 65 humans (49%) were PCR positive for M. suis [17]. In another study involving patients undergoing hematological examination from the United Kingdom and HIV-positive South African women, one HIVpositive patient was infected with another hemotropic Mycoplasma sp. resembling M. haemofelis [18]. There are several limitations to the current study. Some of the EDTA anti-coagulated blood samples tested in this study had been stored for several years prior to DNA extraction and PCR testing. Long-term storage may or may not have influenced test sensitivity. Also, most of the Gp I healthy control dog population was derived from a single veterinary practice in Cary, North Carolina, which for the most part represents dogs that reside in affluent neighborhoods and receive routine and exceptional veterinary care. The only infected dogs among the healthy dog population were rescues. Climate, exposure to tick and flea populations, the degree to which urban, suburban and rural dogs are allowed to fight and numerous other potential risk factors vary substantially among dogs in towns and cities throughout the United States, thus extrapolation of healthy dog data from this study should be done with caution. The sick dog population (Gp IV) was selected by attending veterinarians throughout the United States for tick-borne disease testing. Thus most of these dogs were selected because of particular clinical signs or disease manifestations, such as fever, anemia, thrombocytopenia hypoalbuminemia, hyperglobulinemia or protein-losing nephropathy, which are clinical and hematological abnormalities associated

S.M. Compton et al. / Comparative Immunology, Microbiology and Infectious Diseases 35 (2012) 557–562

with various tick-transmitted pathogens. Although it does not appear that Mhc or CMhp are highly pathogenic in dogs, presumably, the hemoplasma prevalence may have been higher if only dogs with hemolytic anemia or thrombocytopenia were selected for PCR testing [3,7,9]. In a previous study, we reported that 18% of healthy and lymphoma Golden retrievers were infected with a Bartonella sp., whereas the same Golden retriever populations tested in this study were hemoplasma PCR negative [19]. Among the four dogs infected with CMhp, only one dog had a hemolytic anemia and that dog was co-infected with Babesia gibsoni. It is of potential clinical interest that chylothorax and a modified transudate were each identified in one dog infected with CMhp. Although causation for these serious medical conditions has not been established [20], it is possible that Bartonella and hemotropic Mycoplasma sp. are co-factors in some patients with effusive pleural or pericardial disease or alternatively, detection of organisms that induce persistent intravascular infections in dogs is facilitated by a serious systemic illness that suppresses the immune system and increases Bartonella and Mycoplasma sp. numbers and thereby diagnostic detection by PCR in patient samples. As hemotropic Mycoplasma sp. have not been cultured in vitro, diagnosticians and researchers have historically relied on organism visualization in blood smears or more recently PCR amplification of organism specific DNA sequences. The sensitivity and specificity of PCR is clearly superior to blood smear examination [21]. In addition because of the lack of in vitro isolation of these organisms, serological testing is not available to determine if there has been prior exposure. Historically, researchers have targeted the 16S rRNA gene for PCR amplification using 16S rRNA universal primers [22] or 16S rRNA for hemoplasma-species specific for example M. haemofelis or Candidatus M. haemominutum species [23–25]. Due to the potential low hemoplasma load in dog blood samples or the potential infection with other Mycoplasma sp. not commonly described, a novel PCR assay targeting the 16S rRNA region of the hemotropic mycoplasma group was developed. Based upon testing with a cloned target, this PCR assay was highly sensitive and future diagnostic utilization might facilitate the potential detection of hemoplasma species, not yet described in dogs. The RNase P primers used in this study confirmed Mhc infection in most of the 16S rDNA PCR positive samples, but these primers failed to amplify CMhp from clinical samples. Presumably, the lack of RNAse P gene amplification is due to decreased sensitivity of these primers for this species, as compared to targeting the 16S rRNA gene primers. In conclusion, the overall prevalence of hemoplasma infections among the dogs in this study was low. Additional studies are needed to determine the prevalence among various geographic regions, among diverse dog populations and particularly in sick dogs with defined disease manifestations. In addition, greater attention should be focused on the potential for co-infection with hemotopic Mycoplasma sp. and Bartonella sp. Prior to utilization as blood donors, dogs should be screened for evidence of hemoplasma infection by PCR testing and if positive, excluded from the donor program. Until the risk and frequency of infection with a cat or dog adapted hemotropic Mycoplasma is better

561

understood, veterinary professionals should use precautions to avoid bites, scratches and arthropod exposure. Acknowledgements We thank Drs Mike Henson and Jane Armstrong, University of Minnesota for providing case details for dog 5, Beth Pultorak for statistical analysis, Julie Bradley for technical assistance and Tonya Lee for preparation of the manuscript. We would also like to thank Dr. Betsy Sigmon for providing samples for the healthy dog population and providing case details for the M. haemocanis infected Gp I dog. References [1] Chalker VJ. Canine mycoplasmas. Research in Veterinary Science 2005;79(1):1–8. [2] Sykes JE, Ball LM, Bailiff NL, Fry MM. ‘Candidatus Mycoplasma haematoparvum’, a novel small hemotropic mycoplasma from a dog. International Journal of Systematic and Evolutionary Microbiology 2005;55(Pt 1):27–30. [3] Wengi N, Willi B, Boretti FS, Cattori V, Riond B, Meli ML, et al. Realtime PCR-based prevalence study, infection follow-up and molecular characterization of canine hemotropic mycoplasmas. Veterinary Microbiology 2008;126(1–3):132–41. [4] Sykes JE, Bailiff NL, Ball LM, Foreman O, George JW, Fry MM. Identification of a novel hemotropic mycoplasma in a splenectomized dog with hemic neoplasia. Journal of the American Veterinary Medical Association 2004;224(12):1946–51. [5] Biondo AW, dos Santos AP, Sá Guimaráes AM, da Costa Vieira RF, Vidotto O, de Barros Macieira D, et al. A review of the occurrence of hemoplasmas (hemotrophic mycoplasmas) in Brazil. Revista Brasileira de Parasitologia Veterinaria 2009;18(3):1–7. [6] Kenny MJ, Shaw SE, Beugnet F, Tasker S. Demonstration of two distinct hemotropic Mycoplasmas in French dogs. Journal of Clinical Microbiology 2004;42(11):5397–9. [7] Roura X, Peters IR, Altet L, Tabar MD, Barker EN, Planellas M, et al. Prevalence of hemotropic mycoplasmas in healthy and unhealthy cats and dogs in Spain. Journal of Veterinary Diagnostic Investigation 2010;22(2):270–4. [8] Inokuma H, Oyamada M, Davoust B, Boni M, Dereure J, Bucheton B, et al. Epidemiological survey of Ehrlichia canis and related species infection in dogs in eastern Sudan. Annals of the New York Academy of Sciences 2006;1078:461–3. [9] Barker EN, Tasker S, Day MJ, Warman SM, Woolley K, Birtles R, et al. Development and use of real-time PCR to detect and quantify Mycoplasma haemocanis and “Candidatus Mycoplasma haematoparvum” in dogs. Veterinary Microbiology 2010;140(1–2):167–70. [10] Warman SM, Helps CR, Barker EN, Day S, Sturgess K, Day MJ, et al. Haemoplasma infection is not a common cause of canine immunemediated haemolytic anaemia in the UK. Journal of Small Animal Practice 2010;51(10):534–9. [11] Novacco M, Meli ML, Gentilini F, Marsilio F, Ceci C, Pennisi MG, et al. Prevalence and geographical distribution of canine hemotropic mycoplasma infections in Mediterranean countries and analysis of risk factors for infection. Veterinary Microbiology 2010;142(3–4):276–84. [12] Duncan AW, Maggi RG, Breitschwerdt EB. A combined approach for the enhanced detection and isolation of Bartonella species in dog blood samples: pre-enrichment liquid culture followed by PCR and subculture onto agar plates. Journal of Microbiological Methods 2007;69(2):273–81. [13] Varanat M, Maggi RG, Linder KE, Breitschwerdt EB. Molecular prevalence of Bartonella, Babesia, and hemotropic Mycoplasma sp. in dogs with splenic disease. Journal of Veterinary Internal Medicine 2011;25:1284–91. [14] Gillespie TN, Washabau RJ, Goldschmidt MH, Cullen JM, Rogala AR, Breitschwerdt EB. Detection of Bartonella henselae and Bartonella clarridgeiae DNA in hepatic specimens from two dogs with hepatic disease. Journal of the American Veterinary Medical Association 2003;222(1):47–51. [15] dos Santos AP, Biondo AW, Dora JM, Goldani LZ, de Oliveira ST, de Sá Guimaraes AM, et al. Hemoplasma infection in HIV-positive patient, Brazil. Emerging Infectious Diseases 2008;14(12):1922–4.

562

S.M. Compton et al. / Comparative Immunology, Microbiology and Infectious Diseases 35 (2012) 557–562

[16] Sykes JE, Lindsay LL, Maggi RG, Breitschwerdt EB. Human coinfection with Bartonella henselae and two hemotropic mycoplasma variants resembling Mycoplasma ovis. Journal of Clinical Microbiology 2010;48(10):3782–5. [17] Yuan CL, Liang AB, Yao CB, Yang ZB, Zhu JG, Cui L, et al. Prevalence of Mycoplasma suis (Eperythrozoon suis) infection in swine and swinefarm workers in Shanghai, China. American Journal of Veterinary Research 2009;70(7):890–4. [18] Tasker S, Peters IR, Mumford AD, Day MJ, Gruffydd-Jones TJ, Day S, et al. Investigation of human haemotropic Mycoplasma infections using a novel generic haemoplasma qPCR assay on blood samples and blood smears. Journal of Medical Microbiology 2010;59(Pt 11):1285–92. [19] Duncan AW, Marr HS, Birkenheuer AJ, Maggi RG, Williams LE, Correa MT, et al. Bartonella DNA in the blood and lymph nodes of Golden retrievers with lymphoma and in healthy controls. Journal of Veterinary Internal Medicine 2008;22(1): 89–95. [20] Cherry NA, Diniz PPVP, Maggi RG, Hummel JB, Hardie EM, Behrend EN, et al. Isolation or molecular detection of Bartonella henselae and Bartonella vinsonii subsp. berkhoffii from dogs with idiopathic cavitary effusions. Journal of Veterinary Internal Medicine 2009;23(1):186–9.

[21] Tasker S, Binns SH, Day TJ, Gruffydd-Jones TJ, Harbour DA, Helps CR, et al. Use of a PCR assay to assess the prevalence and risk factors for Mycoplasma haemofelis and ‘Candidatus Mycoplasma haemominutum’ in cats in the United Kingdom. Veterinary Record 2003;152(7):193–8. [22] Willi B, Boretti FS, Cattori V, Tasker S, Meli ML, Reusch C, et al. Identification, molecular characterization, and experimental transmission of a new hemoplasma isolate from a cat with hemolytic anemia in Switzerland. Journal of Clinical Microbiology 2005;43(6):2581–5. [23] Berent LM, Messick JB, Cooper SK. Detection of Haemobartonella felis in cats with experimentally induced acute and chronic infections, using a polymerase chain reaction assay. American Journal of Veterinary Research 1998;59(10):1215–20. ˜ A, Barba[24] Criado-Fornelio A, Martinez-Marcos A, Buling-Sarana Carretero JC. Molecular studies on Babesia, Theileria and Hepatozoon in southern Europe. Part II. Phylogenetic analysis and evolutionary history. Veterinary Parasitology 2003;114(3):173–94. [25] Hackett TB, Jensen WA, Lehman TL, Hohenhaus AE, Crawford PC, Giger U, et al. Prevalence of DNA of Mycoplasma haemofelis, ‘Candidatus Mycoplasma haemominutum,’ Anaplasma phagocytophilum, and species of Bartonella, Neorickettsia, and Ehrlichia in cats used as blood donors in the United States. Journal of the American Veterinary Medical Association 2006;229(5):700–5.