- Email: [email protected]
Capture of DNA in microfluidic channel using magnetic beads: Increasing capture efficiency with integrated microfluidic mixer
ARTICLE IN PRESS
Journal of Magnetism and Magnetic Materials 311 (2007) 396–400 www.elsevier.com/locate/jmmm
Capture of DNA in microfluidic channel using magnetic beads: Increasing capture efficiency with integrated microfluidic mixer T. Lund-Olesen, M. Dufva, M.F. Hansen MIC—Department of Micro and Nanotechnology, DTU Bldg. 345 East, Technical University of Denmark, DK-2800 Kgs. Lyngby, Denmark Available online 18 December 2006
Abstract We have studied the hybridization of target DNA in solution with probe DNA on magnetic beads immobilized on the channel sidewalls in a magnetic bead separator. The hybridization is carried out under a liquid flow and is diffusion limited. Two systems are compared: one with a straight microfluidic channel and one with an integrated staggered herringbone mixer. Fluorescence microscopy studies show that the hybridization is much more efficient in the system with the integrated mixer. The results, which are discussed in terms of a simple model, are relevant for any diffusion-limited reaction taking place on the surface in a microfluidic system. r 2006 Elsevier B.V. All rights reserved. Keywords: Magnetic bead; Magnetic separation; Microfluidic; Bioseparation; Lab on a chip
1. Introduction Microfluidic systems containing magnetic structures can be used for separation of magnetic microbeads coated with biomolecules. For sample pretreatment or analysis, it is sometimes convenient to immobilize magnetic beads functionalized with probe molecules in a magnetic separator before incubation with the sample. Thus, the target molecules of the sample will mainly be captured on the surface of the bead agglomerate making them easily accessible to washing, analyzing and other further processing. Mixing magnetic beads and sample before capture of the magnetic beads will typically be more efficient for capturing the target molecules, but subsequently the target molecules will be less accessible since they are distributed within the agglomerate of captured beads. The capture of target molecules on immobilized beads is limited by their diffusion in the solvent. Diffusion of DNA molecules is a slow process and several different solutions to move DNA by other means have been reported. The simplest way is to move the hybridization solution over capture sites immobilized in a channel [1]. Small droplets of hybridization solution separated by air can also be pumped Corresponding author. Tel.: +45 45256323.
E-mail address: [email protected] (T. Lund-Olesen). 0304-8853/$ - see front matter r 2006 Elsevier B.V. All rights reserved. doi:10.1016/j.jmmm.2006.10.1171
back and forth in a channel. The circulating flow inside each droplet creates a mixing effect and by pumping them back and forth less sample is needed. In this way DNA microarrays of 5000 different spots (capture sites) were hybridized with a total sample volume of 1 mL and the hybridization time was reduced from 18 h to 500 s [2]. Mixing during hybridization of DNA microarrays can also be obtained by cavitation micro streaming [3], by planetary centrifugal mixing [4], by use of flexible lids allowing actuation [5], by microfluidic recirculation [6], and by shear driven flow [7]. Mixing usually results in a 2–10-fold increase of the hybridization rate leading to an increased sensitivity for short hybridizations compared to diffusion. Mixing also makes hybridization even throughout the area on which hybridization should occur (e.g., a microarray). Mixing, therefore, makes hybridization reactions more reproducible [8]. We have recently described a dynamic microarray based on magnetic beads captured in a microfluidic channel integrated with permalloy magnetic elements [9]. Beads modified with specific DNA molecules were immobilized to the sidewall before hybridization with the sample. The beads could subsequently be removed and the system primed with other beads. Here, we characterize the flow through hybridization of DNA to functionalized magnetic beads immobilized at the sidewalls in a microfluidic channel having either a flat
ARTICLE IN PRESS T. Lund-Olesen et al. / Journal of Magnetism and Magnetic Materials 311 (2007) 396–400
bottom or a bottom with staggered herringbone mixer structures [10]. These structures create transverse liquid convection towards the beads. The convection ensures liquid exchange near the walls and thus maintains a high target molecule concentration near the immobilized beads. We demonstrate that this leads to a higher capture efficiency of the target molecules compared to systems without mixer structures. The idea of integrating a microfluidic mixer is demonstrated with magnetic beads immobilized on the sidewalls in a magnetic separator but the results are general for all microfluidic channels, where a given species in solution is interacting with a functionalized immobile surface. 2. Experimental 2.1. Microsystem design The basic principle of the microfluidic system is schematically illustrated in Fig. 1(a). The microsystems consist of a microfluidic channel (l w h ¼ 13500 400 80 mm3) with 30 permalloy magnetic elements (l w h ¼ 4300 150 50 mm3) placed at each side of the channel with their long axis perpendicular to the channel. The elements are numbered from 1 to 30 starting at the inlet of the microchannel. The spacing between the elements and the channel is 20 mm. When a homogeneous external magnetic field is applied along the elements, they are magnetized and the magnetic beads are captured at the channel sidewalls. We used the above design and one where a staggered herringbone microfluidic mixer [10] has been integrated in the channel. The mixer structures consist of 21 mm wide ridges that extend 30 mm up from the channel bottom. Fig. 1(b) shows a micrograph of a
Fig. 1. (a) Schematic of passive magnetic separator illustrating how the magnetic elements are magnetized by the external magnetic field and magnetic beads are captured at the sidewalls close to the elements and (b) micrograph of a system with integrated mixer and beads (gray areas) captured at the magnetic elements. The insets show schematics of the transverse liquid flow at two cross-sections in the channel.
397
section of a system with integrated mixer structures and schematic insets of the transverse fluid flow indicating the mixer principle. The captured magnetic beads can be seen in Fig. 1(b) as the gray agglomerates near the ends of the magnetic elements. The mixer introduces transverse convection rolls, which lead to a larger liquid exchange near the channel walls. The fabrication of the systems and characterization of magnetic bead capture in the systems has been reported elsewhere [11–13]. There, it has been shown that the mixer significantly increases the amount of beads captured in the channel and makes the size of the captured bead collections more uniform. 2.2. Operation of microfluidic system The operation of the microfluidic system is similar to what has been described previously in Refs. [9,13] and will be briefly summarized here. Fig. 2 shows a schematic sketch of the setup. The microsystem is mounted in an aluminum holder with O-ring sealed connections and integrated temperature control. The holder is mounted inside a table-top electromagnet, which can provide magnetic flux densities up to 50 mT. The holder is connected to a fluid switch valve (B) via 0.8 mm ID Teflon tubing. Another short piece of tubing is connected from switch valve (B) to another switch valve (A) (see Fig. 2). Switch valve (A) can be switched between two syringe pumps that provide either suction or a buffer flow. A sample is introduced into the system in the following way: First, the switch valves are set such that the sample is sucked from the sample vial into the sample tube by the suction syringe pump. Then the two switch valves are rotated 901 to isolate a well-defined sample volume of E40 mL in the sample tube and valves and the sample is driven into the microsystem by the buffer flow from the buffer syringe pump. The sample tube and the switch valves can be cleaned by use of a large flow without interrupting the experiment.
Fig. 2. Schematic of the setup. A well-defined amount of sample is isolated between the two switch valves and driven through the system by the buffer syringe pump in the experiments.
ARTICLE IN PRESS 398
T. Lund-Olesen et al. / Journal of Magnetism and Magnetic Materials 311 (2007) 396–400
2.3. Magnetic beads
3. Results
MyOne Streptavidin Dynabeads (10–20 mg mL1) were used for all experiments (Invitrogen, USA). The beads have a diameter of 1.05 mm and a density of 1.7 g cm3. The magnetic parameters of the beads are reported in Ref. [14]. The beads were coated with biotinylated capture probes with the sequence 50 -Biotin-TTTTTTTTTTTTTTTTTTTT GGAGAAGTCTGCC as described elsewhere [9].
3.1. Bead immobilization
2.4. Immobilization of beads to the sidewalls of the microchannel To immobilize the beads to the channel sidewalls, a homogeneous magnetic field of 50 mT was applied on the microsystem. A bead solution volume of E40 mL was isolated in the sample tube and driven by a syringe pump into the microsystem by a buffer flow (5 SSC, 0.5% SDS) at 40–60 mL min1. This buffer flow was maintained until no more beads were seen entering the system. After the beads were immobilized, the sample tube was rinsed to remove remaining beads that had settled in the tubes and valves. This could be carried out with no interference with the beads immobilized in the microsystem. 2.5. DNA hybridization and wash The DNA hybridization was carried out by isolating a volume of E40 mL of target oligonucleotides with the sequence 50 -Cy5-CAGGGCAGTAACGGCAGACTT CTCCTCAGGAGTCAGATGCAC complementary to that on the beads in the sample tube, and driving it into the microsystem by use of a buffer (5 SSC, 0.5% SDS) at a fixed flow rate. Experiments were performed at 37 1C in both types of systems at a fixed DNA concentration of c ¼ 5 nM for the flow rates Q ¼ 5, 10 and 20 mL min1, and at a fixed flow rate of Q ¼ 10 mL min1 for the DNA concentrations c ¼ 1, 5 and 25 nM. A total buffer volume of 200 mL was used in each experiment.
The beads were immobilized in the microchannel as described in the experimental section. A thorough study of the capture of magnetic beads in the microfluidic channel is reported elsewhere [13]. For both systems, the amount of beads captured at each capture site decreases down the channel and is small at the last elements. This decrease is larger for the system without mixer than for that with mixer. The experimental parameters were chosen to get visible collections of beads as far down the channel as possible, such that a reliable quantification of the fluorescence signal could take place. Fig. 3 shows fluorescence micrographs of bead collections with captured DNA. 3.2. Effect of mixing on hybridization In all experiments discussed below, beads functionalized with DNA were immobilized in the two systems and hybridized with Cy5 labeled DNA. Fig. 3 shows a Cy5 fluorescence micrograph obtained after an experiment in which a volume of 40 mL of DNA solution with c ¼ 5 nM was driven into the two systems at a flow rate of Q ¼ 5 mL min1 by a buffer flow as described in the experimental section. From the figure it is clearly seen that the fluorescence intensity drops significantly with increasing element number for the system without mixer (Fig. 3(a)) whereas it remains essentially constant for the system with mixer (Fig. 3(b)). The decreasing size of the spots reflects the decreasing amounts of immobilized beads as the element number increases. It is also clearly seen that the fluorescence signal is most intense near the surface of the agglomerate of immobilized beads (see, e.g., element number 2 in Fig. 3(a)). This reflects that the diffusion of the DNA into the agglomerate is limited. To ensure a meaningful quantification of the micrographs, the fluorescence intensity assigned to each element was quantified in a
2.6. Quantification of hybridized DNA Cy5 fluorescence images were taken using a Leica MZ FL III microscope equipped with a Sony DFW-X710 CCD camera. All images were taken using an exposure time of 17.5 s. The intensity of the outer part of the fluorescent spot at each element was subsequently quantified using ScanAlyze [15]. 2.7. Microsystem cleaning After each experiment the microfluidic system was cleaned in zero applied magnetic field by applying a few mL of buffer at a high flow rate (E5 mL min1). It has been established that such a procedure effectively cleans the system from beads and DNA [9].
Fig. 3. Cy5 fluorescence micrographs for experiments: (a) without mixer and (b) with mixer taken at different sites down through the channel (identified by the element number out of 30). Conditions: Q ¼ 5 mL/min, c ¼ 5 nM, and V ¼ 40 mL.
ARTICLE IN PRESS small area near the rim of the agglomerate where the intensity is highest. 3.3. Dependency of hybridization signal on flow rate Fig. 4 shows the fluorescence signals quantified as described above in a series of experiments in which a volume of 40 mL of DNA solution with the concentration c ¼ 5 nM was driven by a buffer flow into the two systems at the flow rates Q ¼ 5, 10 and 20 mL min1. For the system without mixer (Fig. 4(a)), the fluorescence intensity is initially high but then drops significantly as the element number increases. The intensity level is generally higher for low flow rates. For the system with mixer (Fig. 4(b)), the fluorescence intensity depends weakly on the element number and appears to drop linearly with increasing element number. The intensity level for this system also decreases with increasing flow rate. A comparison of the fluorescence intensities for identical flow-through experiments in the two systems reveals that the level in the system with mixer at element numbers larger than about five is 2–3 times higher than that in the system without mixer. The intensities observed at the first few elements are more comparable for the two systems.
Fluorescence intensity / 103
T. Lund-Olesen et al. / Journal of Magnetism and Magnetic Materials 311 (2007) 396–400
30
399
25nM 5nM 1nM
20
10
0
0
5
10 15 20 Element number
25
30
Fig. 5. Fluorescence intensity vs. element number for the indicated target DNA concentrations in a system without mixer (filled symbols) and with mixer (open symbols). The flow rate was Q ¼ 10 mL min1.
decrease for the system with mixer. For c ¼ 1 nM, no fluorescence is observable in the system without mixer for element numbers larger than 15. The intensity level scales linearly with the concentration when increased from 1 to 5 nM, but when the concentration is increased to 25 nM this linear scaling no longer holds. This is most likely due to saturation of the pixel values. 4. Discussion
3.4. Dependency of hybridization signal on DNA concentration Fig. 5 shows the fluorescence signals quantified as described above in a series of experiments in which 40 mL DNA solution with concentrations c ¼ 1, 5 and 25 nM was driven by a buffer flow into the two systems at the flow rate Q ¼ 10 mL min1. The fluorescence intensities obtained for the two systems are very similar for the first few elements, but for element number higher than about five, the intensity drops significantly in the system without mixer whereas it remains nearly constant with a small linear Q = 5 µL/min Q = 10 µL/min Q = 20 µL/min
Fluorescence intensity / 103
15 10
a
5 0
b
15 10 5 0
0
5
10 15 20 Element number
25
30
Fig. 4. Fluorescence intensity vs. element number for the indicated flow rates in a system: (a) without mixer and (b) with mixer. The DNA concentration was c ¼ 5 nM.
The hybridization of probe and target DNA oligonucleotides has a non-trivial dependence on concentration, temperature, ionic strength, and potentially other parameters. However, it is likely that the limiting factor for hybridization in the experiments is the availability of target DNA. The liquid flow is laminar in both the studied systems. In the system without mixer, the DNA in the solution is depleted near the channel sidewalls as the solution passes the beads and the probe and target DNA hybridizes, and the replenishment of DNA from the central part of the channel is limited by diffusion. The typical diffusion distance L traversed by the DNA molecules in a time t is pffiffiffiffiffiffiffiffi L 2Dt, (1) where D is the diffusion constant. For the DNA oligonucleotides in the present study, D4 1011 m2 s1. At a flow rate of Q ¼ 10 mL min1, the average linear fluid velocity E5 mm s1, and hence the fluid is on average in the channel for tE2 s. The corresponding diffusion distance is LE13 mm. This implies that the probe DNA immobilized on the two-channel sidewalls only interacts with a boundary layer of total thickness 25 mm out of the full channel width of 400 mm. Thus, this approach is not efficient for the hybridization with the target DNA in the sample. When the flow rate is low, more target DNA will have time to diffuse to the immobilized probe DNA at each element, and a higher fluorescence intensity is expected in agreement with the experimental results of Fig. 4(a). The fact that the DNA is depleted near the wall is also clearly observed in the hybridization experiments vs. target DNA
ARTICLE IN PRESS 400
T. Lund-Olesen et al. / Journal of Magnetism and Magnetic Materials 311 (2007) 396–400
concentration in Fig. 5, where the intensity rapidly drops as the element number increases. In the system with mixer, the mixing ensures that new target DNA molecules are supplied and available as the probe and target DNA molecules hybridize. The influence of the diffusion therefore becomes less important. The linear decrease in the fluorescence signal with increasing element number can be understood as follows. To a first approximation, assuming perfect mixing, the immobilized DNA at each magnetic element captures the same fraction f0 of the target DNA left in the channel. The fraction of target DNA hybridized at the nth element is therefore n1 fn ¼ f0 1 f0 f 0 1 ðn 1Þf 0 ; ð2Þ where the latter approximation is valid for f051. According to this approximation, the fluorescence intensity should decrease linearly with the element number in agreement with the experimental observations. The experimental fact that the decrease vs. element number is small is consistent with the assumption of f051. Figs. 4 and 5 clearly demonstrate that the mixer leads to hybridization with a substantially higher fraction of the target DNA. 5. Conclusion We presented and characterized the hybridization of fluorescence-labeled DNA with target DNA on beads immobilized on the channel sidewalls in two version of a microfluidic system—one without a mixer and one with an integrated mixer. The results suggest that only a small fraction of the target DNA hybridizes in the system without a mixer due to depletion of the target DNA near the channel sidewall, where the probe DNA is immobilized. A simple analysis indicates that the diffusion of the DNA target molecules is the limiting factor. This will become increasingly important for larger biomolecules and cells. In
the system with mixer, the supply of target DNA near the channel sidewall is continuously replenished and a significantly larger fraction of the target DNA hybridizes. In this system the diffusion lengths are significantly shorter and the system clearly outperforms that without mixer. A simple analysis seems able to explain the experimental observation of a weakly linearly decreasing fluorescence intensity. These results are important for the design and use of microfluidic systems not only for the capture of biological targets on magnetic beads but also generally for any diffusion-limited reaction that takes place on the surface in a microfluidic system.
References [1] M. Nørholm, H. Bruus, M.H. Jakobsen, et al., Lab Chip 4 (2004) 28. [2] C.W. Wei, J.-Y. Cheng, C.T. Huang, et al., Nucleic Acids Res. 33 (2005) e78. [3] R.H. Liu, R. Lenigk, R.L. Druyor-Sanchez, et al., Anal. Chem. 75 (2003) 1911. [4] M.A. Bynum, G.B. Gordon, Anal. Chem. 76 (2004) 7039. [5] N.B. Adey, M. Lei, M.T. Howard, et al., Anal. Chem. 74 (2002) 6413. [6] P.K. Yuen, G. Li, Y. Bao, U.R. Mu¨ller, Lab Chip 3 (2003) 46. [7] K. Pappaert, J. Vanderhoeven, P. Van Hummelen, et al., J. Chromatogr. A 1014 (2003) 1. [8] C.J. Schaupp, G. Jiang, T.G. Myers, et al., Biotechniques 38 (2005) 117. [9] K. Smistrup, B.G. Kjeldsen, J.L. Reimers, et al., Lab Chip 5 (2005) 1315. [10] A.D. Stroock, S.K.W. Dertinger, A. Ajdari, et al., Science 295 (2002) 647. [11] T. Lund-Olesen, H. Bruus, M.F. Hansen, in :Proceedings of MEMS’2006, Istanbul, Turkey, January 23–26, 2006, pp. 386. [12] M.F. Hansen, T. Lund-Olesen, K. Smistrup, et al., Proceedings of Intermag’2006, San Diego, USA, May 8–12, 2006, p. 247. [13] T. Lund-Olesen, H. Bruus, M.F. Hansen, Biomed. Microdev. (2006) in press, doi:10.1007/S10544-006-9021-7. [14] G. Fonnum, C. Johansson, A. Molteberg, et al., J. Magn. Magn. Mater. 293 (2005) 41. [15] M. Eisen, http://rana.lbl.gov/EisenSoftware.htm.
Journal of Magnetism and Magnetic Materials 311 (2007) 396–400 www.elsevier.com/locate/jmmm
Capture of DNA in microfluidic channel using magnetic beads: Increasing capture efficiency with integrated microfluidic mixer T. Lund-Olesen, M. Dufva, M.F. Hansen MIC—Department of Micro and Nanotechnology, DTU Bldg. 345 East, Technical University of Denmark, DK-2800 Kgs. Lyngby, Denmark Available online 18 December 2006
Abstract We have studied the hybridization of target DNA in solution with probe DNA on magnetic beads immobilized on the channel sidewalls in a magnetic bead separator. The hybridization is carried out under a liquid flow and is diffusion limited. Two systems are compared: one with a straight microfluidic channel and one with an integrated staggered herringbone mixer. Fluorescence microscopy studies show that the hybridization is much more efficient in the system with the integrated mixer. The results, which are discussed in terms of a simple model, are relevant for any diffusion-limited reaction taking place on the surface in a microfluidic system. r 2006 Elsevier B.V. All rights reserved. Keywords: Magnetic bead; Magnetic separation; Microfluidic; Bioseparation; Lab on a chip
1. Introduction Microfluidic systems containing magnetic structures can be used for separation of magnetic microbeads coated with biomolecules. For sample pretreatment or analysis, it is sometimes convenient to immobilize magnetic beads functionalized with probe molecules in a magnetic separator before incubation with the sample. Thus, the target molecules of the sample will mainly be captured on the surface of the bead agglomerate making them easily accessible to washing, analyzing and other further processing. Mixing magnetic beads and sample before capture of the magnetic beads will typically be more efficient for capturing the target molecules, but subsequently the target molecules will be less accessible since they are distributed within the agglomerate of captured beads. The capture of target molecules on immobilized beads is limited by their diffusion in the solvent. Diffusion of DNA molecules is a slow process and several different solutions to move DNA by other means have been reported. The simplest way is to move the hybridization solution over capture sites immobilized in a channel [1]. Small droplets of hybridization solution separated by air can also be pumped Corresponding author. Tel.: +45 45256323.
E-mail address: [email protected] (T. Lund-Olesen). 0304-8853/$ - see front matter r 2006 Elsevier B.V. All rights reserved. doi:10.1016/j.jmmm.2006.10.1171
back and forth in a channel. The circulating flow inside each droplet creates a mixing effect and by pumping them back and forth less sample is needed. In this way DNA microarrays of 5000 different spots (capture sites) were hybridized with a total sample volume of 1 mL and the hybridization time was reduced from 18 h to 500 s [2]. Mixing during hybridization of DNA microarrays can also be obtained by cavitation micro streaming [3], by planetary centrifugal mixing [4], by use of flexible lids allowing actuation [5], by microfluidic recirculation [6], and by shear driven flow [7]. Mixing usually results in a 2–10-fold increase of the hybridization rate leading to an increased sensitivity for short hybridizations compared to diffusion. Mixing also makes hybridization even throughout the area on which hybridization should occur (e.g., a microarray). Mixing, therefore, makes hybridization reactions more reproducible [8]. We have recently described a dynamic microarray based on magnetic beads captured in a microfluidic channel integrated with permalloy magnetic elements [9]. Beads modified with specific DNA molecules were immobilized to the sidewall before hybridization with the sample. The beads could subsequently be removed and the system primed with other beads. Here, we characterize the flow through hybridization of DNA to functionalized magnetic beads immobilized at the sidewalls in a microfluidic channel having either a flat
ARTICLE IN PRESS T. Lund-Olesen et al. / Journal of Magnetism and Magnetic Materials 311 (2007) 396–400
bottom or a bottom with staggered herringbone mixer structures [10]. These structures create transverse liquid convection towards the beads. The convection ensures liquid exchange near the walls and thus maintains a high target molecule concentration near the immobilized beads. We demonstrate that this leads to a higher capture efficiency of the target molecules compared to systems without mixer structures. The idea of integrating a microfluidic mixer is demonstrated with magnetic beads immobilized on the sidewalls in a magnetic separator but the results are general for all microfluidic channels, where a given species in solution is interacting with a functionalized immobile surface. 2. Experimental 2.1. Microsystem design The basic principle of the microfluidic system is schematically illustrated in Fig. 1(a). The microsystems consist of a microfluidic channel (l w h ¼ 13500 400 80 mm3) with 30 permalloy magnetic elements (l w h ¼ 4300 150 50 mm3) placed at each side of the channel with their long axis perpendicular to the channel. The elements are numbered from 1 to 30 starting at the inlet of the microchannel. The spacing between the elements and the channel is 20 mm. When a homogeneous external magnetic field is applied along the elements, they are magnetized and the magnetic beads are captured at the channel sidewalls. We used the above design and one where a staggered herringbone microfluidic mixer [10] has been integrated in the channel. The mixer structures consist of 21 mm wide ridges that extend 30 mm up from the channel bottom. Fig. 1(b) shows a micrograph of a
Fig. 1. (a) Schematic of passive magnetic separator illustrating how the magnetic elements are magnetized by the external magnetic field and magnetic beads are captured at the sidewalls close to the elements and (b) micrograph of a system with integrated mixer and beads (gray areas) captured at the magnetic elements. The insets show schematics of the transverse liquid flow at two cross-sections in the channel.
397
section of a system with integrated mixer structures and schematic insets of the transverse fluid flow indicating the mixer principle. The captured magnetic beads can be seen in Fig. 1(b) as the gray agglomerates near the ends of the magnetic elements. The mixer introduces transverse convection rolls, which lead to a larger liquid exchange near the channel walls. The fabrication of the systems and characterization of magnetic bead capture in the systems has been reported elsewhere [11–13]. There, it has been shown that the mixer significantly increases the amount of beads captured in the channel and makes the size of the captured bead collections more uniform. 2.2. Operation of microfluidic system The operation of the microfluidic system is similar to what has been described previously in Refs. [9,13] and will be briefly summarized here. Fig. 2 shows a schematic sketch of the setup. The microsystem is mounted in an aluminum holder with O-ring sealed connections and integrated temperature control. The holder is mounted inside a table-top electromagnet, which can provide magnetic flux densities up to 50 mT. The holder is connected to a fluid switch valve (B) via 0.8 mm ID Teflon tubing. Another short piece of tubing is connected from switch valve (B) to another switch valve (A) (see Fig. 2). Switch valve (A) can be switched between two syringe pumps that provide either suction or a buffer flow. A sample is introduced into the system in the following way: First, the switch valves are set such that the sample is sucked from the sample vial into the sample tube by the suction syringe pump. Then the two switch valves are rotated 901 to isolate a well-defined sample volume of E40 mL in the sample tube and valves and the sample is driven into the microsystem by the buffer flow from the buffer syringe pump. The sample tube and the switch valves can be cleaned by use of a large flow without interrupting the experiment.
Fig. 2. Schematic of the setup. A well-defined amount of sample is isolated between the two switch valves and driven through the system by the buffer syringe pump in the experiments.
ARTICLE IN PRESS 398
T. Lund-Olesen et al. / Journal of Magnetism and Magnetic Materials 311 (2007) 396–400
2.3. Magnetic beads
3. Results
MyOne Streptavidin Dynabeads (10–20 mg mL1) were used for all experiments (Invitrogen, USA). The beads have a diameter of 1.05 mm and a density of 1.7 g cm3. The magnetic parameters of the beads are reported in Ref. [14]. The beads were coated with biotinylated capture probes with the sequence 50 -Biotin-TTTTTTTTTTTTTTTTTTTT GGAGAAGTCTGCC as described elsewhere [9].
3.1. Bead immobilization
2.4. Immobilization of beads to the sidewalls of the microchannel To immobilize the beads to the channel sidewalls, a homogeneous magnetic field of 50 mT was applied on the microsystem. A bead solution volume of E40 mL was isolated in the sample tube and driven by a syringe pump into the microsystem by a buffer flow (5 SSC, 0.5% SDS) at 40–60 mL min1. This buffer flow was maintained until no more beads were seen entering the system. After the beads were immobilized, the sample tube was rinsed to remove remaining beads that had settled in the tubes and valves. This could be carried out with no interference with the beads immobilized in the microsystem. 2.5. DNA hybridization and wash The DNA hybridization was carried out by isolating a volume of E40 mL of target oligonucleotides with the sequence 50 -Cy5-CAGGGCAGTAACGGCAGACTT CTCCTCAGGAGTCAGATGCAC complementary to that on the beads in the sample tube, and driving it into the microsystem by use of a buffer (5 SSC, 0.5% SDS) at a fixed flow rate. Experiments were performed at 37 1C in both types of systems at a fixed DNA concentration of c ¼ 5 nM for the flow rates Q ¼ 5, 10 and 20 mL min1, and at a fixed flow rate of Q ¼ 10 mL min1 for the DNA concentrations c ¼ 1, 5 and 25 nM. A total buffer volume of 200 mL was used in each experiment.
The beads were immobilized in the microchannel as described in the experimental section. A thorough study of the capture of magnetic beads in the microfluidic channel is reported elsewhere [13]. For both systems, the amount of beads captured at each capture site decreases down the channel and is small at the last elements. This decrease is larger for the system without mixer than for that with mixer. The experimental parameters were chosen to get visible collections of beads as far down the channel as possible, such that a reliable quantification of the fluorescence signal could take place. Fig. 3 shows fluorescence micrographs of bead collections with captured DNA. 3.2. Effect of mixing on hybridization In all experiments discussed below, beads functionalized with DNA were immobilized in the two systems and hybridized with Cy5 labeled DNA. Fig. 3 shows a Cy5 fluorescence micrograph obtained after an experiment in which a volume of 40 mL of DNA solution with c ¼ 5 nM was driven into the two systems at a flow rate of Q ¼ 5 mL min1 by a buffer flow as described in the experimental section. From the figure it is clearly seen that the fluorescence intensity drops significantly with increasing element number for the system without mixer (Fig. 3(a)) whereas it remains essentially constant for the system with mixer (Fig. 3(b)). The decreasing size of the spots reflects the decreasing amounts of immobilized beads as the element number increases. It is also clearly seen that the fluorescence signal is most intense near the surface of the agglomerate of immobilized beads (see, e.g., element number 2 in Fig. 3(a)). This reflects that the diffusion of the DNA into the agglomerate is limited. To ensure a meaningful quantification of the micrographs, the fluorescence intensity assigned to each element was quantified in a
2.6. Quantification of hybridized DNA Cy5 fluorescence images were taken using a Leica MZ FL III microscope equipped with a Sony DFW-X710 CCD camera. All images were taken using an exposure time of 17.5 s. The intensity of the outer part of the fluorescent spot at each element was subsequently quantified using ScanAlyze [15]. 2.7. Microsystem cleaning After each experiment the microfluidic system was cleaned in zero applied magnetic field by applying a few mL of buffer at a high flow rate (E5 mL min1). It has been established that such a procedure effectively cleans the system from beads and DNA [9].
Fig. 3. Cy5 fluorescence micrographs for experiments: (a) without mixer and (b) with mixer taken at different sites down through the channel (identified by the element number out of 30). Conditions: Q ¼ 5 mL/min, c ¼ 5 nM, and V ¼ 40 mL.
ARTICLE IN PRESS small area near the rim of the agglomerate where the intensity is highest. 3.3. Dependency of hybridization signal on flow rate Fig. 4 shows the fluorescence signals quantified as described above in a series of experiments in which a volume of 40 mL of DNA solution with the concentration c ¼ 5 nM was driven by a buffer flow into the two systems at the flow rates Q ¼ 5, 10 and 20 mL min1. For the system without mixer (Fig. 4(a)), the fluorescence intensity is initially high but then drops significantly as the element number increases. The intensity level is generally higher for low flow rates. For the system with mixer (Fig. 4(b)), the fluorescence intensity depends weakly on the element number and appears to drop linearly with increasing element number. The intensity level for this system also decreases with increasing flow rate. A comparison of the fluorescence intensities for identical flow-through experiments in the two systems reveals that the level in the system with mixer at element numbers larger than about five is 2–3 times higher than that in the system without mixer. The intensities observed at the first few elements are more comparable for the two systems.
Fluorescence intensity / 103
T. Lund-Olesen et al. / Journal of Magnetism and Magnetic Materials 311 (2007) 396–400
30
399
25nM 5nM 1nM
20
10
0
0
5
10 15 20 Element number
25
30
Fig. 5. Fluorescence intensity vs. element number for the indicated target DNA concentrations in a system without mixer (filled symbols) and with mixer (open symbols). The flow rate was Q ¼ 10 mL min1.
decrease for the system with mixer. For c ¼ 1 nM, no fluorescence is observable in the system without mixer for element numbers larger than 15. The intensity level scales linearly with the concentration when increased from 1 to 5 nM, but when the concentration is increased to 25 nM this linear scaling no longer holds. This is most likely due to saturation of the pixel values. 4. Discussion
3.4. Dependency of hybridization signal on DNA concentration Fig. 5 shows the fluorescence signals quantified as described above in a series of experiments in which 40 mL DNA solution with concentrations c ¼ 1, 5 and 25 nM was driven by a buffer flow into the two systems at the flow rate Q ¼ 10 mL min1. The fluorescence intensities obtained for the two systems are very similar for the first few elements, but for element number higher than about five, the intensity drops significantly in the system without mixer whereas it remains nearly constant with a small linear Q = 5 µL/min Q = 10 µL/min Q = 20 µL/min
Fluorescence intensity / 103
15 10
a
5 0
b
15 10 5 0
0
5
10 15 20 Element number
25
30
Fig. 4. Fluorescence intensity vs. element number for the indicated flow rates in a system: (a) without mixer and (b) with mixer. The DNA concentration was c ¼ 5 nM.
The hybridization of probe and target DNA oligonucleotides has a non-trivial dependence on concentration, temperature, ionic strength, and potentially other parameters. However, it is likely that the limiting factor for hybridization in the experiments is the availability of target DNA. The liquid flow is laminar in both the studied systems. In the system without mixer, the DNA in the solution is depleted near the channel sidewalls as the solution passes the beads and the probe and target DNA hybridizes, and the replenishment of DNA from the central part of the channel is limited by diffusion. The typical diffusion distance L traversed by the DNA molecules in a time t is pffiffiffiffiffiffiffiffi L 2Dt, (1) where D is the diffusion constant. For the DNA oligonucleotides in the present study, D4 1011 m2 s1. At a flow rate of Q ¼ 10 mL min1, the average linear fluid velocity E5 mm s1, and hence the fluid is on average in the channel for tE2 s. The corresponding diffusion distance is LE13 mm. This implies that the probe DNA immobilized on the two-channel sidewalls only interacts with a boundary layer of total thickness 25 mm out of the full channel width of 400 mm. Thus, this approach is not efficient for the hybridization with the target DNA in the sample. When the flow rate is low, more target DNA will have time to diffuse to the immobilized probe DNA at each element, and a higher fluorescence intensity is expected in agreement with the experimental results of Fig. 4(a). The fact that the DNA is depleted near the wall is also clearly observed in the hybridization experiments vs. target DNA
ARTICLE IN PRESS 400
T. Lund-Olesen et al. / Journal of Magnetism and Magnetic Materials 311 (2007) 396–400
concentration in Fig. 5, where the intensity rapidly drops as the element number increases. In the system with mixer, the mixing ensures that new target DNA molecules are supplied and available as the probe and target DNA molecules hybridize. The influence of the diffusion therefore becomes less important. The linear decrease in the fluorescence signal with increasing element number can be understood as follows. To a first approximation, assuming perfect mixing, the immobilized DNA at each magnetic element captures the same fraction f0 of the target DNA left in the channel. The fraction of target DNA hybridized at the nth element is therefore n1 fn ¼ f0 1 f0 f 0 1 ðn 1Þf 0 ; ð2Þ where the latter approximation is valid for f051. According to this approximation, the fluorescence intensity should decrease linearly with the element number in agreement with the experimental observations. The experimental fact that the decrease vs. element number is small is consistent with the assumption of f051. Figs. 4 and 5 clearly demonstrate that the mixer leads to hybridization with a substantially higher fraction of the target DNA. 5. Conclusion We presented and characterized the hybridization of fluorescence-labeled DNA with target DNA on beads immobilized on the channel sidewalls in two version of a microfluidic system—one without a mixer and one with an integrated mixer. The results suggest that only a small fraction of the target DNA hybridizes in the system without a mixer due to depletion of the target DNA near the channel sidewall, where the probe DNA is immobilized. A simple analysis indicates that the diffusion of the DNA target molecules is the limiting factor. This will become increasingly important for larger biomolecules and cells. In
the system with mixer, the supply of target DNA near the channel sidewall is continuously replenished and a significantly larger fraction of the target DNA hybridizes. In this system the diffusion lengths are significantly shorter and the system clearly outperforms that without mixer. A simple analysis seems able to explain the experimental observation of a weakly linearly decreasing fluorescence intensity. These results are important for the design and use of microfluidic systems not only for the capture of biological targets on magnetic beads but also generally for any diffusion-limited reaction that takes place on the surface in a microfluidic system.
References [1] M. Nørholm, H. Bruus, M.H. Jakobsen, et al., Lab Chip 4 (2004) 28. [2] C.W. Wei, J.-Y. Cheng, C.T. Huang, et al., Nucleic Acids Res. 33 (2005) e78. [3] R.H. Liu, R. Lenigk, R.L. Druyor-Sanchez, et al., Anal. Chem. 75 (2003) 1911. [4] M.A. Bynum, G.B. Gordon, Anal. Chem. 76 (2004) 7039. [5] N.B. Adey, M. Lei, M.T. Howard, et al., Anal. Chem. 74 (2002) 6413. [6] P.K. Yuen, G. Li, Y. Bao, U.R. Mu¨ller, Lab Chip 3 (2003) 46. [7] K. Pappaert, J. Vanderhoeven, P. Van Hummelen, et al., J. Chromatogr. A 1014 (2003) 1. [8] C.J. Schaupp, G. Jiang, T.G. Myers, et al., Biotechniques 38 (2005) 117. [9] K. Smistrup, B.G. Kjeldsen, J.L. Reimers, et al., Lab Chip 5 (2005) 1315. [10] A.D. Stroock, S.K.W. Dertinger, A. Ajdari, et al., Science 295 (2002) 647. [11] T. Lund-Olesen, H. Bruus, M.F. Hansen, in :Proceedings of MEMS’2006, Istanbul, Turkey, January 23–26, 2006, pp. 386. [12] M.F. Hansen, T. Lund-Olesen, K. Smistrup, et al., Proceedings of Intermag’2006, San Diego, USA, May 8–12, 2006, p. 247. [13] T. Lund-Olesen, H. Bruus, M.F. Hansen, Biomed. Microdev. (2006) in press, doi:10.1007/S10544-006-9021-7. [14] G. Fonnum, C. Johansson, A. Molteberg, et al., J. Magn. Magn. Mater. 293 (2005) 41. [15] M. Eisen, http://rana.lbl.gov/EisenSoftware.htm.