- Email: [email protected]
Carbon disulfide induces rat testicular injury via mitochondrial apoptotic pathway
Chemosphere xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
Chemosphere journal homepage: www.elsevier.com/locate/chemosphere
Carbon disulfide induces rat testicular injury via mitochondrial apoptotic pathway Yinsheng Guo a, Wei Wang a, Yu Dong a, Zhen Zhang a, Yijun Zhou a,b, Guoyuan Chen a,⇑ a Key Laboratory of Environment and Health, Ministry of Education & Ministry of Environmental Protection, School of Public Health, Tongji Medical College, Huazhong University of Science and Technology, 13 Hangkong Road, Wuhan 430030, Hubei, PR China b Department of Environmental Health, School of Public Health, Shanghai Jiaotong University, Shanghai 200025, PR China
h i g h l i g h t s
g r a p h i c a l a b s t r a c t
The exposure of CS2 induced
testicular germ cells apoptosis. All factors of mitochondrial apoptotic
pathway changed after CS2 exposure. Inhibitor of MPTP could efficiently
reverse the apoptosis. Mitochondrial apoptotic pathway
plays a role in CS2-induced testicular injury.
a r t i c l e
i n f o
Article history: Received 21 October 2013 Received in revised form 19 January 2014 Accepted 29 January 2014 Available online xxxx Keywords: Apoptosis CS2 Cyclosporin A MPTP Testes
a b s t r a c t Carbon disulfide (CS2), one of the most important volatile organic chemicals, was shown to have serious impairment to male reproductive system. But the underline mechanism is still unclear. In the present study, we aim to investigate the male germ cell apoptosis induced by CS2 exposure alone and by co-administration with cyclosporin A (CsA), which is the inhibitor of membrane permeability transition pore (MPTP). It was shown that CS2 exposure impaired ultrastructure of germ cells, increased the numbers of apoptotic germ cells, accumulated intracellular level of calcium, elevated ROS level, and increased activities of complexes of respiratory chain. Meanwhile, exposure to CS2 dramatically decreased the mitochondrial transmembrane potential (DWm) and levels of ATP and MPTP opening. Exposure to CS2 can also cause a significantly dose-dependent increase in the expression levels of Bax, Cytc, Caspase-9, and Caspase-3, but decreased the expression level of Bcl-2. Moreover, co-administration of CsA with CS2 can reverse or alleviate the above apoptotic damage effects of CS2 on testicular germ cells. Taken together, our findings suggested that CS2 can cause damage to testicular germ cells via mitochondrial apoptotic pathway, and MPTP play a crucial role in this process. Ó 2014 Elsevier Ltd. All rights reserved.
Abbreviations: CS2, carbon disulfide; CsA, cyclosporin A; Cytc, Cytochrome c; MPTP, mitochondrial membrane permeability transition pore; DWm, mitochondrial transmembrane potential; ROS, reactive oxygen species; VOCs, volatile organic chemicals. ⇑ Corresponding author. Tel.: +86 27 83692350; fax: +86 27 83692701. E-mail address: [email protected] (G. Chen).
1. Introduction Carbon disulfide (CS2) is one of the typical VOCs, which is frequently used in daily life as dry cleaning and insecticide. It is also widely used as an indispensable organic solvent in industrial
http://dx.doi.org/10.1016/j.chemosphere.2014.01.081 0045-6535/Ó 2014 Elsevier Ltd. All rights reserved.
Please cite this article in press as: Guo, Y., et al. Carbon disulfide induces rat testicular injury via mitochondrial apoptotic pathway. Chemosphere (2014), http://dx.doi.org/10.1016/j.chemosphere.2014.01.081
2
Y. Guo et al. / Chemosphere xxx (2014) xxx–xxx
productions. Therefore, humans as well as wildlife are easy to be exposed to CS2. Large numbers of experiments have indicated that extensive exposure to CS2 is associated with multisystem disturbance (Morvai et al., 2005; Ding et al., 2011), especially with the reproductive system (Xuan et al., 2009; Wang et al., 2011). Many human occupational hazard surveys suggest that CS2 exposure is related to sexual dysfunction and decreased sperm count and motility (Cirla et al., 1978; Ma et al., 2010). However, there are limited studies to elucidate how CS2 impairs the male reproductive system. Apoptosis is a form of programmed cell death which is crucial for mammalian development (Sheridan and Martin, 2010). However, excess germ cell apoptosis may lead to testicular dysfunction and decreased sperm count (Sawhney et al., 2005). Mitochondrial apoptotic pathway, also known as the intrinsic apoptotic pathway, is involved in germ cell apoptosis. A variety of key events are involved in this pathway, such as the participation of Bcl-2 family, changes of DWm, the decrease of ATP, the production of ROS, and the MPTP opening (Green and Reed, 1998). The MPTP opening plays a core role in all events above, since it allows the release of pro-apoptotic factors, such as Cytochrome c (Cytc) and Apaf 1, that can induce the process of apoptosis (Tsujimoto and Shimizu, 2007; Kinnally et al., 2011). Thus, in order to clarify the role of MPTP in the mechanism of CS2-induced apoptosis, CsA was introduced in this study. The objective of this study is to investigate the ultrastructural changes caused by CS2, and to elucidate whether CS2 induces male germ cell apoptosis via the mitochondrial apoptotic pathway, especially through MPTP opening, and how mitochondrial apoptotic pathway exerts its functions in this process. 2. Materials and methods 2.1. Animal model of CS2 toxicity and drug treatment Male Sprague–Dawley rats were obtained from the Experimental Animal Center of Huazhong University of Science &Technology, Tongji Medical College, China (animal protocols No. 4209800122). Forty-eight rats, aged 7 weeks, were randomly divided into six groups (n = 8 for each group) and housed in polycarbonate cages under controlled laboratory conditions (12 h light/dark cycle photoperiod, 25 °C, standard diets were received and tap water was accessible ad libitum). Animals from group I, II, III, IV, V and VI were statically inhaled air containing CS2 (purity P 98%, Siheweihua chemical plant, China) in organic glass exposure cabinets (self-developed by Tongji Medical College). The concentrations of CS2 were 0, 50, 250, 1250, 0, 1250 mg m3, respectively. During the inhalation period, eight rats of the same group were put in an exposure cabinet. Then, according to our experimental design, different doses of CS2 were dropwise added in the plate just in the middle of two fans. The airflow through the fan ensured that the concentration of CS2 remained constant in the exposure cabinets, during the 2 h d1 exposure. Animals were deprived of food and water during the treatment. The exposure time was 2 h d1, 5 d w1, for 10 weeks. In the last 6 weeks, animals were subjected to the following treatments by oral intake: group I, II, III and IV received milk; group V and VI received 12.5 mg1 kg1 d1 CsA (Dalian Meilun Biotechnology Co., Ltd.), using milk as solvent. Body weights of rats were measured twice per week. All procedures of animal experiments in our study followed the Guide for the Care and Use of Laboratory Animals established by Tongji Medical College. 2.2. Sample preparation After 10-week exposure, animals were sacrificed by decapitation. After weighting, testes were isolated, and then fixed in 4%
formaldehyde, treated into primary cells or stored at 80 °C till later analysis. 2.2.1. Hematoxylin and eosin (HE) staining After fixed, the testes were embedded in paraffin and sliced. The sections were stained with hematoxylin and eosin, and then examined by light microscope. 2.2.2. Immunohistochemistry staining We performed immunohistochemistry staining with antibodies to Bcl-2, Bax, and Cytc (Golden Bridge, Beijing, China). Specimens were fixed in 10% deparaffinized formalin. After microwave antigen retrieval, sections were deparaffinized and rehydrated. And then, sections were blocked in 3% goat serum and incubated with rabbit antibody (dilution 1:500) for 1 h. After that, the sections were incubated with anti-rabbit secondary (dilution 1:200) for 30 min. Slides labeled 3,30 -diaminobenzidine (Sigma, US). Pictures were acquired by an Olympus DP12 microscope (Olympus, US). 2.2.3. Electron microscopy After fixed, blocks of testes were diced. The slices were washed in ice-cold cacodylate buffer, and then postfixed in 1% OsO4 in phosphate buffer. Sections were examined with FEI Tecnai 12G2 transmission electron microscope (FEI, Eindhoven, Netherlands). 2.3. TUNEL assay The TUNEL assay was carried out according to the manufacturer’s protocol (Roche, Mannheim, Germany). After deparaffinized with 4% paraformaldehyde, the sections were rinsed with PBS and then incubated and permeabilized with 0.1% Triton X-100 for 15 min for FITC endlabeling the fragmented DNA. After washed with PBS, sections were incubated with 50 lL of TUNEL inspection fluid for 60 min at 37 °C in dark and then rinsed for three times. The TUNEL-positive cells were acquired by Olympus fluorescent microscopy with 488 nm/530 nm wavelengths. 2.4. Measurement of cell level 2.4.1. Primary culture Parts of testes from CS2-exposed rats were treated into primary culture for investigations in cell level. Briefly, tunicae and blood vessel of the testes were rejected. And then cut into small pieces and transferred into a flask. After digestion with trypsinization and collagenase I for 30 min, cells were seeded in 6-well plates at a density of 105 cells per well. Then cells were cultured in DMEM supplemented with 20% fetal bovine serum at 35 °C in a 5% CO2 humidified incubator, and experimental cells were assessed after incubated for 24 h. 2.4.2. Mitochondrial membrane potential determination JC-1 probe was employed to measure DW. Primary cells were incubated with 1 mL JC-1 staining solution (5 lg mL1) at 37 °C for 30 min and rinsed for three times. Then cells were placed in fresh medium without serum. The DW were monitored by an Olympus fluorescent microscope at 514 nm/585 nm. Mitochondrial depolarization was indicated by an increase in the ratio of red/green fluorescence intensity. 2.4.3. Measurement of intracellular Ca2+ and ROS To monitor the release of Ca2+, germ cells were loaded with 5 lM of Ca2+ indicator Fluo-3/AM (Beyotime, China) for 30 min at 37 °C. Cells were washed with D-Hank’s, and then incubated for 20 min at 37 °C. Changes in Ca2+ levels were measured by an Olympus Fluoview system (Olympus IX71, Germany). The mitochondrial mediated influx of Ca2+ was obtained by Image Pro Plus 6.0.
Please cite this article in press as: Guo, Y., et al. Carbon disulfide induces rat testicular injury via mitochondrial apoptotic pathway. Chemosphere (2014), http://dx.doi.org/10.1016/j.chemosphere.2014.01.081
3
Y. Guo et al. / Chemosphere xxx (2014) xxx–xxx Table 1 PCR primer list for detection of genes expression. Gene
Forward primer
Reverse primer
Product size (bp)
Gene ID
GAPDH JNK Cytc Bcl-2 Bax Caspase-3 Caspase-9
GGGGCTCTCTGCTCCTCCCTG TCCAGTTCTCGTACCCGCTA CTTGGGCTAGAGAGCGGGA GAACTGGGGGAGGATTGTGG TTTCCTACTTCGGGACCCCC TCTACCGCACCCGGTTACTA CCACGGACACATGAGGTTGT
CGGCCAAATCCGTTCACACCG AGCATGGCGTGACACAGTAA TTAAATTCGGTCCGGGCTGG GGGGTGACATCTCCCTGTTG GAAGCCTCAGCCCATCTTCTT CGTACAGTTTCAGCATGGCG CAGGGCACACATGACAATGC
107 135 74 80 101 88 144
NM_017008.3 NM_053829.1 NM_012839.2 NM_016993.1 NM_017059.2 NM_012922.2 NM_031632.1
Table 2 Body and testes weight of rats (mean ± SD).
a
Group
n
CS2 (mg m3)
CsA (mg kg1)
Body weight (g)
Testes weight (g)
I II III IV V VI
8 8 8 8 8 8
0 50 250 1250 0 1250
0 0 0 0 12.5 12.5
341.86 ± 48.91 327.63 ± 21.91 358.57 ± 58.57 365.75 ± 57.01 316.01 ± 83.74 328.27 ± 43.44
3.24 ± 0.35 3.02 ± 0.18 2.56 ± 0.71a 2.56 ± 0.26a 3.52 ± 0.37 3.20 ± 0.24
Significative difference from controls p < 0.05 (ANOVA).
The oxidant-sensitive probe DCFH-DA was utilized in the measurement of ROS generation. Cells were stained and incubated for 20 min at 37 °C and rinsed. Fluorescence images were captured at 488 nm for excitation. The increase value compared to control was viewed as the increase of ROS. 2.5. Measurement of mitochondrial level Mitochondria were isolated from testes according to the protocols of Tissue Mitochondria Isolation Kit (Beyotime, China).
Real-time PCR was completed in a 10 lL final volume using Power SYBR Green PCR Master Mix reagents (Applied Biosystems, USA) in an ABI Prism 7900 sequence detection system (Applied Biosystems, USA). And each sample was carried out in triplicate. The primers used for amplification are shown in Table 1. Thermal cycling was carried out as follows: 95 °C for 10 min, followed by 40 cycles of denaturation at 95 °C for 15 s and annealing and extension 60 °C for 60 s. Changes in mRNA levels were corrected by the level of GAPDH. 2.7. Western blot analysis
2.5.1. ATP measurement Intracellular ATP was measured using an ATP Analysis Kit, according to the manufacturer’s protocol (Beyotime, China). Briefly, tissues were grounded with 200 lL lysis buffer and centrifuged at 8000g for 10 min. After that, 100 lL per sample was assessed with 100 lL ATP detection buffer. Luminescence was determined by a multi-fluorescence microplate. While protein concentrations were determined using a BCA Protein Assay Kit (Thermo, USA). 2.5.2. MPTP and the complexes of respiratory chain assays The expression of MPTP opening and the complexes of respiratory chain were assayed by enzyme-linked immunosorbent assay (ELISA) using assay kits (Genmed Scientifics Inc., USA). In brief, purified mitochondria was homogenized and then centrifuged at 800g for 15 min. The supernatants were used for detecting the level of MPTP protein and activities of the complexes I–V. Complex I was measured by the rate of ferricyanide reduction. Complex II was assayed by assessing the decrease in absorbance produced by the reduction of 2,6-DCIP. Complex III was determined by Cytc reduction. Complex IV was detected by following the decrease produced by the oxidation of reduced Cytc. Complex V was assessed by the change of ATP synthase. All enzyme activities were expressed as nmol mg1 protein.
Fifty mg tissues of testes were rinsed in saline, cut and then homogenized in low intensity RIPA lysis buffer (Beyotime, China), containing 1 mM phenylmethylsulfonyl fluoride. The homogenate was centrifuged and supernatant was collected. The concentrations of protein were detected by BCA protein assay kits. Fifty lg proteins from each group were separated by 12% SDS– PAGE. Proteins were electrophoretically transferred to a PVDF membrane, then blocked by 5% non-fat milk for 1 h at 37 °C and incubated with anti-Bcl-2, anti-Bax or anti-Cyt-c (EPI, USA) for 2 h at 37 °C. After washed, the membranes were incubated with HRP-conjugated secondary antibody for 1 h at 37 °C. The protein bands were visualized using the enhanced chemiluminescence method, and then quantified by Image J. 2.8. Statistical analysis Data are the mean of three replicates. Results were expressed as mean ± SD. The one-way ANOVA was performed to test the difference between the CS2-exposed groups following appropriate normalization and variance equalization. Dunnett-SNK test was adopted in comparisons of experimental groups and control group. SPSS 13.0 was used to perform statistical analyses, and statistical significance was set at p < 0.05.
2.6. RNA isolation and real-time PCR 3. Results Total RNA was isolated from rat testes using Trizol reagent, according to the manufacturer’s instruction (Promega, Madison, USA). The concentration of RNA was measured by the OD 260/ 280 ratio. Total RNA was reversely transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, USA).
3.1. Effects of CS2 exposure on body weight and testes weight The mean values for body weights of male rats among different CS2 exposure groups were not significantly different. Compared with the control group, the testicular weights were markedly
Please cite this article in press as: Guo, Y., et al. Carbon disulfide induces rat testicular injury via mitochondrial apoptotic pathway. Chemosphere (2014), http://dx.doi.org/10.1016/j.chemosphere.2014.01.081
4
Y. Guo et al. / Chemosphere xxx (2014) xxx–xxx
Fig. 1. (A) Seminiferous tubules were shown by H&E staining (magnification 400). (B) Testicular ultrastructure images of rats. Representative photos were taken from 4000 to 10 000. Normal sertoli cell (a) and spermatogonium (b) were shown. Series of the spermatogenic cycle (c) and regular morphological character of mitochondria (d) were observed in control and CsA-treated groups. After CS2 exposure, chromatin of sertoli cell was aggregated and deformed, and multiple vacuoles were appeared (e). In spermatocytes, multiple vacuoles were observed (f), series of the spermatogenic cycle were lost and no forming acrosome or mature acrosome was observed (g). The swollen mitochondria were captured (h). (C) Immunohistochemical staining of Bcl-2, Bax, and Cytc in testicular tissue (200). Images were arranged from I to VI according to group numbers.
Please cite this article in press as: Guo, Y., et al. Carbon disulfide induces rat testicular injury via mitochondrial apoptotic pathway. Chemosphere (2014), http://dx.doi.org/10.1016/j.chemosphere.2014.01.081
Y. Guo et al. / Chemosphere xxx (2014) xxx–xxx
5
Fig. 2. (A) Apoptosis were detected by TUNEL assay from group I–VI (200). Green color indicated TUNEL-positive cells. (B) Percentage of apoptotic cells was analyzed. Bars: error bars represent standard error of means; #p < 0.01, compared with control. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
decreased in group III (250 mg m3) and IV (1250 mg m3) (p < 0.05, Table 2). 3.2. CS2 induced morphological changes of testicular germ cells
3.2.1. Light microscopy observation In our study, regular histological morphology by H&E staining was observed in control, only CsA treatment and co-administration of CS2 and CsA groups (Fig. 1A I, V and VI). In group II (50 mg m3), seminiferous tubules became slightly sparse. In group III (250 mg m3), cytoplasm were rarefaction and parts of cell membrane were ruptured. In group IV (1250 mg m3), the arrangements of cells were remarkably disordered, and structure of seminiferous tubules were collapsed. All these features suggested the cellular damage of testes.
Bcl-2 was observed in group IV (1250 mg m3). Moreover, CsA reversed this down-regulation. There were higher expressions of Bax and Cytc in CS2-exposed groups, compared with the control (p < 0.05). The highest density of Bax and Cytc were observed in group IV (1250 mg m3). In addition, CsA treatment modulated these up-regulations. 3.3. Effects of CS2 exposure on apoptotic cells The green fluorescence stained cells were labeled as apoptosis. Fig. 2 showed that apoptosis were significantly increased in CS2exposed groups in a dose-dependent manner when compared with control (p < 0.01). In addition, treatment of CsA conspicuously reduced the number of apoptotic cells induced by CS2. 3.4. Effects of CS2 exposure on mitochondrial apoptotic pathway
3.2.2. Ultrastructural observation Regular morphological character of sertoli cell (Fig. 1B. a), spermatogonium (Fig. 1B. b), series of the spermatogenic cycle (Fig. 1B. c) and mitochondria (Fig. 1B. d) from control and CsA-treated groups were observed by transmission electron microscope. In CS2-exposed groups, chromatin of sertoli cell was deformed, vacuoles were increased dramatically, and membranes junctions were disrupted (Fig. 1B. e). In spermatocyte, vacuoles were also increased dramatically (Fig. 1B. f), the spermatogenic cycle and mature spermatids were lost (Fig. 1B. g). In addition, the mitochondrial cristae were distended (Fig. 1B. h). 3.2.3. Immunohistochemistry analysis Photomicrographs of immunohistochemically stained specimens were shown in Fig. 1C. The results of immunohistochemically stained revealed that there were low expressions of Bcl-2 in CS2-exposed groups compared with the control. The minimum density of
3.4.1. The loss of DWm As shown in Fig. 3A, after quantification, the ratio of red (high DWm)/green (low DWm) fluorescence was significantly decreased in all CS2-exposed groups, compared with the control (p < 0.01), with the minimum ratio observed in group VI (1250 mg m3). The decline of DWm suggested that mitochondrial function was dysregulated by CS2 exposure. While indistinguishable percentage changes were found between only CsA-treated group and the control group. However, statistical significance of decrease in DWm was shown between the group VI and control. Meanwhile, the level of DWm in group VI was significantly higher than that in all CS2-exposed groups. These phenomena indicated that CsA-treatment inhibited the adverse effect of CS2 on DWm to a certain extent. And these results suggested that there are some other mechanisms involved in CS2-induced apoptosis in testicular germ cells.
Please cite this article in press as: Guo, Y., et al. Carbon disulfide induces rat testicular injury via mitochondrial apoptotic pathway. Chemosphere (2014), http://dx.doi.org/10.1016/j.chemosphere.2014.01.081
6
Y. Guo et al. / Chemosphere xxx (2014) xxx–xxx
Fig. 3. (A) The decline of DWm was measured by fluorescent microscope (400). Red/green fluorescence intensity value was calculated. (B) The influences of CS2 combined with CsA on intracellular Ca2+ (200). Statistical analyses of intracellular Ca2+ in different groups were shown. (C) Representative images (200) of the changes of ROS were captured. Statistical analyses of ROS in different groups were shown. Bars: error bars represent standard error of means; #p < 0.01, compared with control. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
3.4.2. The release of calcium A dose-dependent increase of intracellular Ca2+ was observed in CS2-exposed groups, compared with the control (p < 0.01) (Fig. 3B). While no significant elevation in Ca2+ was detected in CsA-treated groups. These findings demonstrated that CS2 could increase the level of intracellular Ca2+ and CsA blocked the accumulation of Ca2+. 3.4.3. ROS synthesis After CS2 exposure, levels of intracellular ROS were found markedly increased, compared with the control (p < 0.01). Quantification data showed that CsA treatment led to a reduction in intracellular ROS production (Fig. 3C). These results indicated that ROS played a role in CS2-induced apoptotic pathway.
3.4.4. The decrease of ATP Results of all CS2-exposed groups showed ATP levels were significantly lower than the control (p < 0.01), in a dose-dependent manner (Fig. 4A). The samples from three CS2-exposed groups had ATP levels of 7.5, 6, and 4 nmol mg1 protein, respectively. Supplementation of CsA increased the level of ATP to 22.5 nmol mg1 protein, which showed no significant change compared with the control. These results indicated that the energy productions in mitochondria were restrained after CS2-exposure and CsA prevented this down-regulation of ATP level induced by CS2. 3.4.5. The expression of MPTP opening Fig. 4B revealed a significant decrease in the levels of MPTP opening between three doses of CS2-exposed groups and the con-
Please cite this article in press as: Guo, Y., et al. Carbon disulfide induces rat testicular injury via mitochondrial apoptotic pathway. Chemosphere (2014), http://dx.doi.org/10.1016/j.chemosphere.2014.01.081
Y. Guo et al. / Chemosphere xxx (2014) xxx–xxx
7
Fig. 4. (A) Analysis of ATP level. (B) The effects of CS2 combined with CsA on the MPTP opening. (C) The effects of CS2 on the activity of mitochondrial respiratory chain complexes I–V. Bars: error bars represent standard error of means; p < 0.05, #p < 0.01, compared with control.
trol (p < 0.05) and the minimum level of MPTP opening was observed in group IV (1250 mg m3). 3.4.6. The complexes of respiratory chain I–V Results showed that the viability of all complexes was prominently increased after CS2-exposure (p < 0.05). Moreover, administration of CsA reversed or weakened this increased activity (Fig. 4C). 3.4.7. mRNA expressions of mitochondrial apoptotic relative genes The genes below were chosen based on the list of genes established in SABioscience™ for mitochondrial apoptotic pathway. As shown in Fig. 5A, the expressions of mitochondrial pathwayassociated factors, including JNK, Bax, Cytc, Apaf-1, Caspase-9 and Caspase-3, were dramatically increased since group II (50 mg m3). Meanwhile, the expression of Bcl-2 was significantly decreased. Moreover, CsA administration reversed these expressions. These results indicated that CS2 exposure caused abnormal expressions of mitochondrial pathway-associated genes and CsA repressed the effects of CS2 on mRNA expressions. 3.4.8. The levels of proteins after CS2 exposure As shown in Fig. 5B, treatment of CS2 significantly increased the levels of Bax and Cytc in a dose-dependent manner when compared with control (p < 0.05). Maximal levels of Bax and Cytc were observed in group IV (1250 mg m3), compared with control (p < 0.01). Meanwhile, immunoblots showed significant decrease in the level of Bcl-2, compared with control (p < 0.01), with minimum level in group IV (1250 mg m3). In addition, expressions of Bcl-2, Bax and Cytc were reversed by CsA treatment (Fig. 5C).
4. Discussion Many researches indicated that CS2 could induce reproductive toxicity (Tepe and Zenick, 1984; Mihalache and Mihalache, 1989). An excellent study (Vanhoorne et al., 1994) reported that human exposed to 10 ppm CS2 presented changes of seminal characteristics. Mihalache and Mihalache reported that male rats poisoned by intraperitoneal administration of 5, 10, 15, 25 mg kg1 of CS2 once a week for 6 months produced changes including interstitial edema, congestion, seminiferous tubules basement membrane thickening and spermatogenesis suppression at different stages. In this study, three doses of CS2 were chosen. The deleterious effects had occurred just at 50 mg m3, exacerbated at 250 mg m3 and 1250 mg m3. These results revealed that low dose exposure of CS2 is able to cause serious injury on germ cells and the toxic effects occur in a dose-dependent manner. Abnormally increased levels of apoptosis is one of the main mechanisms how toxicants induce reproductive system injury (Kaczmarek et al., 2011; Jiang et al., 2013). Recent researches showed that toxicants such as microcystins and doxorubicin induce testes injury via male germ cells apoptosis (Li et al., 2011; Das et al., 2012). Similarly, VOCs, just like CS2, di (2-ethylhexyl) phthalate and methoxychlor are also reported to induce apoptosis of germ cells (Vaithinathan et al., 2010; Erkekoglu et al., 2012). Our previous study has found that more apoptotic germ cells are observed in the CS2-exposed people than the unexposed people (Ma et al., 2010). Therefore, apoptosis is attractive for explaining CS2-induced testicular injury. After 10-week CS2 exposure, the testicular weight was significantly decreased. Meanwhile, striking ultrastructural changes were
Please cite this article in press as: Guo, Y., et al. Carbon disulfide induces rat testicular injury via mitochondrial apoptotic pathway. Chemosphere (2014), http://dx.doi.org/10.1016/j.chemosphere.2014.01.081
8
Y. Guo et al. / Chemosphere xxx (2014) xxx–xxx
Fig. 5. (A) Relative mRNA expressions of mitochondrial pathway were detected after CS2 exposure. (B) The expressions of Bcl-2, Bax and Cytc protein in three CS2-exposed groups were detected by western blot. (C) The protein levels of group I, V and VI were shown. Actin blot showed equal protein loading. Graph representing statistic results corresponded to the blots. Bars: error bars represent standard error of means; p < 0.05, #p < 0.01, compared with control.
observed by light and electric microscopy and all ultrastructural changes indicated that early apoptosis occurred. Moreover, the outcomes of TUNEL assay also showed that the numbers of apoptotic germ cells were significantly increased. These results directly proved that CS2 induced early apoptosis on germ cells. In the present study, mRNA expressions of JNK, Bax, Cytc, Apaf 1, Caspase-9 and Caspase-3 were observed up-regulated and Bcl-2 was observed down-regulated from real-time PCR assay. As shown by the immunohistochemical staining and Western Blot analyses, the expression levels of these proteins were consistent with the expression level of their mRNAs. There are some previous studies which also reported that some factors changed in mitochondrial apoptotic pathway (Harris and Thompson, 2000; Ricci et al., 2004). Changes observed by us are consistent with their results. In addition, one of our previous studies also supported our results about expressions of mitochondrial apoptotic pathway relative proteins (Huang et al., 2013). All above suggested the involvement of mitochondrial apoptotic pathway in CS2-induced apoptosis. If this is the case, the possible mechanism of CS2 impairs testicular
germ cells is as follows: when CS2-induced apoptotic pathway was triggered, protein expression of Bcl-2 was down-regulated and Bax was up-regulated. On the other side, CS2 increased the production of ROS by increasing the activity of respiratory chain complexes. ROS induced the free radical attack of membrane phospholipids and loss of DWm. Besides, concurrent stimulus of CS2 exposure resulted in the release of Ca2+ from the endoplasmic reticulum, and then caused Ca2+ to overload in mitochondria. All the changes above induced the MPTP opening, which released Cytc and in turn increased the activation of Caspase-9 and Caspase-3. Finally, mitochondrial matrixes got distended and apoptosis occurred. As noted above, MPTP opening played a crucial role in mitochondrial apoptotic pathway. One previous study showed that MPTP closes in the early stage of apoptosis (Lemasters and Holmuhamedov, 2006), while the expression of MPTP opening was decreased in present study. Thus, the decreased expression of MPTP opening exactly proved that CS2 could induce apoptosis via mitochondrial apoptotic pathway.
Please cite this article in press as: Guo, Y., et al. Carbon disulfide induces rat testicular injury via mitochondrial apoptotic pathway. Chemosphere (2014), http://dx.doi.org/10.1016/j.chemosphere.2014.01.081
Y. Guo et al. / Chemosphere xxx (2014) xxx–xxx
CsA is well known as a kind of immunosuppressive agent for its ability to prevent the MPTP opening (Connern and Halestrap, 1994; Leventhal et al., 2000), but it is uncertain whether CsA performs protective effects on testes. Our findings showed that, after treated with CsA, the percentages of apoptotic cells were significantly decreased in CS2-exposed testes. Moreover, the abnormal expressions of Bax/Bcl-2 and the release of Cytc were decreased. In addition, the levels of Ca2+, ROS and expressions of MPTP opening were closer to the normal range. Our results are in line with previous reports which use CsA as MPTP inhibitor (Gharanei et al., 2013). Thus, these findings provided a direct evidence to prove the involvement of mitochondrial apoptotic pathway and the key role of MPTP in CS2-induced apoptosis. Besides, CsA had a protective effect on CS2-induced apoptosis via preventing the MPTP opening. Altogether, this study elucidated a novel mechanism for CS2-induced male reproductive toxicity. Our results indicated that CS2 could cause damage to testicular germ cells by inducing apoptosis. Moreover, CS2 induced apoptosis via mitochondrial apoptotic pathway and the MPTP opening played a crucial role in this process. In addition, our findings further implied the potential utilization of CsA against toxic effects of CS2 in clinical treatment. Acknowledgments The authors would like to thank all the participants in our study. This study was supported by the National Science Foundation of China, Grant 30872091 and 81172637. References Cirla, A.M., Bertazzi, P.A., Tomasini, M., Villa, A., Graziano, C., Invernizzi, R., Gilioli, R., 1978. Study of endocrinological functions and sexual behaviour in carbon disulphide workers. Med. Lav. 69, 118–129. Connern, C.P., Halestrap, A.P., 1994. Recruitment of mitochondrial cyclophilin to the mitochondrial inner membrane under conditions of oxidative stress that enhance the opening of a calcium-sensitive non-specific channel. Biochem. J. 302, 321–324. Das, J., Ghosh, J., Manna, P., Sil, P.C., 2012. Taurine protects rat testes against doxorubicin-induced oxidative stress as well as p53, Fas and caspase 12mediated apoptosis. Amino Acids 42, 1839–1855. Ding, N., Xiang, Y., Jiang, H., Zhang, W., Liu, H., Li, Z., 2011. Carbon disulfide inhibits neurite outgrowth and neuronal migration of dorsal root ganglion in vitro. Int. J. Neurosci. 121, 649–654. Erkekoglu, P., Zeybek, N.D., Giray, B., Asan, E., Hincal, F., 2012. The effects of di (2ethylhexyl) phthalate exposure and selenium nutrition on sertoli cell vimentin structure and germ-cell apoptosis in rat testis. Arch. Environ. Contam. Toxicol. 62, 539–547. Gharanei, M., Hussain, A., Janneh, O., Maddock, H.L., 2013. Doxorubicin induced myocardial injury is exacerbated following ischaemic stress via opening of the mitochondrial permeability transition pore. Toxicol. Appl. Pharmacol. 268, 149– 156.
9
Green, D.R., Reed, 1998. Mitochondria and apoptosis. Apoptosis 281, 1309–1312. Harris, M.H., Thompson, C.B., 2000. The role of the Bcl-2 family in the regulation of outer mitochondrial membrane permeability. Cell Death Differ. 7, 1182–1191. Huang, X.Y., Zhang, Z., Zhou, Y.J., Guo, Y.S., Wang, W., Dong, Y., Wang, N., Ding, Q., Ji, J.J., Chen, G.Y., 2013. Effect of carbon disulfide on mitochondrial apoptosisrelated proteins in cytoplasm of testicular tissue among male rats. Zhonghua Lao Dong Wei Sheng Zhi Ye Bing Za Zhi 10, 730–733. Jiang, X., Zhang, C., Xin, Y., Huang, Z., Tan, Y., Huang, Y., Wang, Y., Feng, W., Li, X., Li, W., Qu, Y., Cai, L., 2013. Protective effect of FGF21 on type 1 diabetes-induced testicular apoptotic cell death probably via both mitochondrial- and endoplasmic reticulum stress-dependent pathways in the mouse model. Toxicol. Lett. 219, 65–76. Kaczmarek, K., Studencka, M., Meinhardt, A., Wieczerzak, K., Thoms, S., Engel, W., Grzmil, P., 2011. Overexpression of peroxisomal testis-specific 1 protein induces germ cell apoptosis and leads to infertility in male mice. Mol. Biol. Cell 22, 1766–1779. Kinnally, K.W., Peixoto, P.M., Ryu, S.Y., Dejean, L.M., 2011. Is mPTP the gatekeeper for necrosis, apoptosis, or both? Biochim. Biophys. Acta 1813, 616–622. Lemasters, J.J., Holmuhamedov, E., 2006. Voltage-dependent anion channel (VDAC) as mitochondrial governator – thinking outside the box. Biochim. Biophys. Acta 1762, 181–190. Leventhal, L., Sortwell, C.E., Hanbury, R., Collier, T.J., Kordower, J.H., Palfi, S., 2000. Cyclosporin A protects striatal neurons in vitro and in vivo from 3nitropropionic acid toxicity. J. Comp. Neurol. 425, 471–478. Li, G.Y., Xie, P., Li, H.Y., Hao, L., Xiong, Q., Qiu, T., 2011. Involment of p53, Bax, and Bcl-2 pathway in microcystins-induced apoptosis in rat testis. Environ. Toxicol. 26, 111–117. Ma, J.Y., Ji, J.J., Qing, D., Liu, W.D., Wang, S.Q., Ning, W., Chen, G.Y., 2010. The effects of carbon disulfide on male sexual function and semen quality. Toxicol. Ind. Health 26, 375–382. Mihalache, C., Mihalache, G., 1989. Histologic aspects of the testis in experimental carbon disulfide poisoning. Rev. Med. Chir. Soc. Med. Nat. Iasi 93, 339–341. Morvai, V., Szakmary, E., Ungvary, G., 2005. The effects of carbon disulfide and ethanol on the circulatory system of rats. J. Toxicol. Environ. Health A 68, 797– 809. Ricci, J.E., Munoz-Pinedo, C., Fitzgerald, P., Bailly-Maitre, B., Perkins, G.A., Yadava, N., Scheffler, I.E., Ellisman, M.H., Green, D.R., 2004. Disruption of mitochondrial function during apoptosis is mediated by caspase cleavage of the p75 subunit of complex I of the electron transport chain. Cell 117, 773–786. Sawhney, P., Giammona, C.J., Meistrich, M.L., Richburg, J.H., 2005. Cisplatin-induced long-term failure of spermatogenesis in adult C57/Bl/6J mice. J. Androl. 26, 136– 145. Sheridan, C., Martin, S.J., 2010. Mitochondrial fission/fusion dynamics and apoptosis. Mitochondrion 10, 640–648. Tepe, S.J., Zenick, H., 1984. The effects of carbon disulfide on the reproductive system of the male rat. Toxicology 32, 47–56. Tsujimoto, Y., Shimizu, S., 2007. Role of the mitochondrial membrane permeability transition in cell death. Apoptosis 12, 835–840. Vaithinathan, S., Saradha, B., Mathur, P.P., 2010. Methoxychlor induces apoptosis via mitochondria- and FasL-mediated pathways in adult rat testis. Chem. Biol. Interact 185, 110–118. Vanhoorne, M., Comhaire, F., De Bacquer, D., 1994. Epidemiological study of the effects of carbon disulfide on male sexuality and reproduction. Arch. Environ. Health 49, 273–278. Wang, F., Cai, S., Wang, Z., Xi, C., 2011. Synthesis of 2-mercaptobenzothiazoles via DBU-promoted tandem reaction of o-haloanilines and carbon disulfide. Org. Lett. 13, 3202–3205. Xuan, Y., Hu, J., Xu, K., Hou, X., Lv, Y., 2009. Development of sensitive carbon disulfide sensor by using its cataluminescence on nanosized-CeO2. Sens. Actuators B: Chem. 136, 218–223.
Please cite this article in press as: Guo, Y., et al. Carbon disulfide induces rat testicular injury via mitochondrial apoptotic pathway. Chemosphere (2014), http://dx.doi.org/10.1016/j.chemosphere.2014.01.081
Contents lists available at ScienceDirect
Chemosphere journal homepage: www.elsevier.com/locate/chemosphere
Carbon disulfide induces rat testicular injury via mitochondrial apoptotic pathway Yinsheng Guo a, Wei Wang a, Yu Dong a, Zhen Zhang a, Yijun Zhou a,b, Guoyuan Chen a,⇑ a Key Laboratory of Environment and Health, Ministry of Education & Ministry of Environmental Protection, School of Public Health, Tongji Medical College, Huazhong University of Science and Technology, 13 Hangkong Road, Wuhan 430030, Hubei, PR China b Department of Environmental Health, School of Public Health, Shanghai Jiaotong University, Shanghai 200025, PR China
h i g h l i g h t s
g r a p h i c a l a b s t r a c t
The exposure of CS2 induced
testicular germ cells apoptosis. All factors of mitochondrial apoptotic
pathway changed after CS2 exposure. Inhibitor of MPTP could efficiently
reverse the apoptosis. Mitochondrial apoptotic pathway
plays a role in CS2-induced testicular injury.
a r t i c l e
i n f o
Article history: Received 21 October 2013 Received in revised form 19 January 2014 Accepted 29 January 2014 Available online xxxx Keywords: Apoptosis CS2 Cyclosporin A MPTP Testes
a b s t r a c t Carbon disulfide (CS2), one of the most important volatile organic chemicals, was shown to have serious impairment to male reproductive system. But the underline mechanism is still unclear. In the present study, we aim to investigate the male germ cell apoptosis induced by CS2 exposure alone and by co-administration with cyclosporin A (CsA), which is the inhibitor of membrane permeability transition pore (MPTP). It was shown that CS2 exposure impaired ultrastructure of germ cells, increased the numbers of apoptotic germ cells, accumulated intracellular level of calcium, elevated ROS level, and increased activities of complexes of respiratory chain. Meanwhile, exposure to CS2 dramatically decreased the mitochondrial transmembrane potential (DWm) and levels of ATP and MPTP opening. Exposure to CS2 can also cause a significantly dose-dependent increase in the expression levels of Bax, Cytc, Caspase-9, and Caspase-3, but decreased the expression level of Bcl-2. Moreover, co-administration of CsA with CS2 can reverse or alleviate the above apoptotic damage effects of CS2 on testicular germ cells. Taken together, our findings suggested that CS2 can cause damage to testicular germ cells via mitochondrial apoptotic pathway, and MPTP play a crucial role in this process. Ó 2014 Elsevier Ltd. All rights reserved.
Abbreviations: CS2, carbon disulfide; CsA, cyclosporin A; Cytc, Cytochrome c; MPTP, mitochondrial membrane permeability transition pore; DWm, mitochondrial transmembrane potential; ROS, reactive oxygen species; VOCs, volatile organic chemicals. ⇑ Corresponding author. Tel.: +86 27 83692350; fax: +86 27 83692701. E-mail address: [email protected] (G. Chen).
1. Introduction Carbon disulfide (CS2) is one of the typical VOCs, which is frequently used in daily life as dry cleaning and insecticide. It is also widely used as an indispensable organic solvent in industrial
http://dx.doi.org/10.1016/j.chemosphere.2014.01.081 0045-6535/Ó 2014 Elsevier Ltd. All rights reserved.
Please cite this article in press as: Guo, Y., et al. Carbon disulfide induces rat testicular injury via mitochondrial apoptotic pathway. Chemosphere (2014), http://dx.doi.org/10.1016/j.chemosphere.2014.01.081
2
Y. Guo et al. / Chemosphere xxx (2014) xxx–xxx
productions. Therefore, humans as well as wildlife are easy to be exposed to CS2. Large numbers of experiments have indicated that extensive exposure to CS2 is associated with multisystem disturbance (Morvai et al., 2005; Ding et al., 2011), especially with the reproductive system (Xuan et al., 2009; Wang et al., 2011). Many human occupational hazard surveys suggest that CS2 exposure is related to sexual dysfunction and decreased sperm count and motility (Cirla et al., 1978; Ma et al., 2010). However, there are limited studies to elucidate how CS2 impairs the male reproductive system. Apoptosis is a form of programmed cell death which is crucial for mammalian development (Sheridan and Martin, 2010). However, excess germ cell apoptosis may lead to testicular dysfunction and decreased sperm count (Sawhney et al., 2005). Mitochondrial apoptotic pathway, also known as the intrinsic apoptotic pathway, is involved in germ cell apoptosis. A variety of key events are involved in this pathway, such as the participation of Bcl-2 family, changes of DWm, the decrease of ATP, the production of ROS, and the MPTP opening (Green and Reed, 1998). The MPTP opening plays a core role in all events above, since it allows the release of pro-apoptotic factors, such as Cytochrome c (Cytc) and Apaf 1, that can induce the process of apoptosis (Tsujimoto and Shimizu, 2007; Kinnally et al., 2011). Thus, in order to clarify the role of MPTP in the mechanism of CS2-induced apoptosis, CsA was introduced in this study. The objective of this study is to investigate the ultrastructural changes caused by CS2, and to elucidate whether CS2 induces male germ cell apoptosis via the mitochondrial apoptotic pathway, especially through MPTP opening, and how mitochondrial apoptotic pathway exerts its functions in this process. 2. Materials and methods 2.1. Animal model of CS2 toxicity and drug treatment Male Sprague–Dawley rats were obtained from the Experimental Animal Center of Huazhong University of Science &Technology, Tongji Medical College, China (animal protocols No. 4209800122). Forty-eight rats, aged 7 weeks, were randomly divided into six groups (n = 8 for each group) and housed in polycarbonate cages under controlled laboratory conditions (12 h light/dark cycle photoperiod, 25 °C, standard diets were received and tap water was accessible ad libitum). Animals from group I, II, III, IV, V and VI were statically inhaled air containing CS2 (purity P 98%, Siheweihua chemical plant, China) in organic glass exposure cabinets (self-developed by Tongji Medical College). The concentrations of CS2 were 0, 50, 250, 1250, 0, 1250 mg m3, respectively. During the inhalation period, eight rats of the same group were put in an exposure cabinet. Then, according to our experimental design, different doses of CS2 were dropwise added in the plate just in the middle of two fans. The airflow through the fan ensured that the concentration of CS2 remained constant in the exposure cabinets, during the 2 h d1 exposure. Animals were deprived of food and water during the treatment. The exposure time was 2 h d1, 5 d w1, for 10 weeks. In the last 6 weeks, animals were subjected to the following treatments by oral intake: group I, II, III and IV received milk; group V and VI received 12.5 mg1 kg1 d1 CsA (Dalian Meilun Biotechnology Co., Ltd.), using milk as solvent. Body weights of rats were measured twice per week. All procedures of animal experiments in our study followed the Guide for the Care and Use of Laboratory Animals established by Tongji Medical College. 2.2. Sample preparation After 10-week exposure, animals were sacrificed by decapitation. After weighting, testes were isolated, and then fixed in 4%
formaldehyde, treated into primary cells or stored at 80 °C till later analysis. 2.2.1. Hematoxylin and eosin (HE) staining After fixed, the testes were embedded in paraffin and sliced. The sections were stained with hematoxylin and eosin, and then examined by light microscope. 2.2.2. Immunohistochemistry staining We performed immunohistochemistry staining with antibodies to Bcl-2, Bax, and Cytc (Golden Bridge, Beijing, China). Specimens were fixed in 10% deparaffinized formalin. After microwave antigen retrieval, sections were deparaffinized and rehydrated. And then, sections were blocked in 3% goat serum and incubated with rabbit antibody (dilution 1:500) for 1 h. After that, the sections were incubated with anti-rabbit secondary (dilution 1:200) for 30 min. Slides labeled 3,30 -diaminobenzidine (Sigma, US). Pictures were acquired by an Olympus DP12 microscope (Olympus, US). 2.2.3. Electron microscopy After fixed, blocks of testes were diced. The slices were washed in ice-cold cacodylate buffer, and then postfixed in 1% OsO4 in phosphate buffer. Sections were examined with FEI Tecnai 12G2 transmission electron microscope (FEI, Eindhoven, Netherlands). 2.3. TUNEL assay The TUNEL assay was carried out according to the manufacturer’s protocol (Roche, Mannheim, Germany). After deparaffinized with 4% paraformaldehyde, the sections were rinsed with PBS and then incubated and permeabilized with 0.1% Triton X-100 for 15 min for FITC endlabeling the fragmented DNA. After washed with PBS, sections were incubated with 50 lL of TUNEL inspection fluid for 60 min at 37 °C in dark and then rinsed for three times. The TUNEL-positive cells were acquired by Olympus fluorescent microscopy with 488 nm/530 nm wavelengths. 2.4. Measurement of cell level 2.4.1. Primary culture Parts of testes from CS2-exposed rats were treated into primary culture for investigations in cell level. Briefly, tunicae and blood vessel of the testes were rejected. And then cut into small pieces and transferred into a flask. After digestion with trypsinization and collagenase I for 30 min, cells were seeded in 6-well plates at a density of 105 cells per well. Then cells were cultured in DMEM supplemented with 20% fetal bovine serum at 35 °C in a 5% CO2 humidified incubator, and experimental cells were assessed after incubated for 24 h. 2.4.2. Mitochondrial membrane potential determination JC-1 probe was employed to measure DW. Primary cells were incubated with 1 mL JC-1 staining solution (5 lg mL1) at 37 °C for 30 min and rinsed for three times. Then cells were placed in fresh medium without serum. The DW were monitored by an Olympus fluorescent microscope at 514 nm/585 nm. Mitochondrial depolarization was indicated by an increase in the ratio of red/green fluorescence intensity. 2.4.3. Measurement of intracellular Ca2+ and ROS To monitor the release of Ca2+, germ cells were loaded with 5 lM of Ca2+ indicator Fluo-3/AM (Beyotime, China) for 30 min at 37 °C. Cells were washed with D-Hank’s, and then incubated for 20 min at 37 °C. Changes in Ca2+ levels were measured by an Olympus Fluoview system (Olympus IX71, Germany). The mitochondrial mediated influx of Ca2+ was obtained by Image Pro Plus 6.0.
Please cite this article in press as: Guo, Y., et al. Carbon disulfide induces rat testicular injury via mitochondrial apoptotic pathway. Chemosphere (2014), http://dx.doi.org/10.1016/j.chemosphere.2014.01.081
3
Y. Guo et al. / Chemosphere xxx (2014) xxx–xxx Table 1 PCR primer list for detection of genes expression. Gene
Forward primer
Reverse primer
Product size (bp)
Gene ID
GAPDH JNK Cytc Bcl-2 Bax Caspase-3 Caspase-9
GGGGCTCTCTGCTCCTCCCTG TCCAGTTCTCGTACCCGCTA CTTGGGCTAGAGAGCGGGA GAACTGGGGGAGGATTGTGG TTTCCTACTTCGGGACCCCC TCTACCGCACCCGGTTACTA CCACGGACACATGAGGTTGT
CGGCCAAATCCGTTCACACCG AGCATGGCGTGACACAGTAA TTAAATTCGGTCCGGGCTGG GGGGTGACATCTCCCTGTTG GAAGCCTCAGCCCATCTTCTT CGTACAGTTTCAGCATGGCG CAGGGCACACATGACAATGC
107 135 74 80 101 88 144
NM_017008.3 NM_053829.1 NM_012839.2 NM_016993.1 NM_017059.2 NM_012922.2 NM_031632.1
Table 2 Body and testes weight of rats (mean ± SD).
a
Group
n
CS2 (mg m3)
CsA (mg kg1)
Body weight (g)
Testes weight (g)
I II III IV V VI
8 8 8 8 8 8
0 50 250 1250 0 1250
0 0 0 0 12.5 12.5
341.86 ± 48.91 327.63 ± 21.91 358.57 ± 58.57 365.75 ± 57.01 316.01 ± 83.74 328.27 ± 43.44
3.24 ± 0.35 3.02 ± 0.18 2.56 ± 0.71a 2.56 ± 0.26a 3.52 ± 0.37 3.20 ± 0.24
Significative difference from controls p < 0.05 (ANOVA).
The oxidant-sensitive probe DCFH-DA was utilized in the measurement of ROS generation. Cells were stained and incubated for 20 min at 37 °C and rinsed. Fluorescence images were captured at 488 nm for excitation. The increase value compared to control was viewed as the increase of ROS. 2.5. Measurement of mitochondrial level Mitochondria were isolated from testes according to the protocols of Tissue Mitochondria Isolation Kit (Beyotime, China).
Real-time PCR was completed in a 10 lL final volume using Power SYBR Green PCR Master Mix reagents (Applied Biosystems, USA) in an ABI Prism 7900 sequence detection system (Applied Biosystems, USA). And each sample was carried out in triplicate. The primers used for amplification are shown in Table 1. Thermal cycling was carried out as follows: 95 °C for 10 min, followed by 40 cycles of denaturation at 95 °C for 15 s and annealing and extension 60 °C for 60 s. Changes in mRNA levels were corrected by the level of GAPDH. 2.7. Western blot analysis
2.5.1. ATP measurement Intracellular ATP was measured using an ATP Analysis Kit, according to the manufacturer’s protocol (Beyotime, China). Briefly, tissues were grounded with 200 lL lysis buffer and centrifuged at 8000g for 10 min. After that, 100 lL per sample was assessed with 100 lL ATP detection buffer. Luminescence was determined by a multi-fluorescence microplate. While protein concentrations were determined using a BCA Protein Assay Kit (Thermo, USA). 2.5.2. MPTP and the complexes of respiratory chain assays The expression of MPTP opening and the complexes of respiratory chain were assayed by enzyme-linked immunosorbent assay (ELISA) using assay kits (Genmed Scientifics Inc., USA). In brief, purified mitochondria was homogenized and then centrifuged at 800g for 15 min. The supernatants were used for detecting the level of MPTP protein and activities of the complexes I–V. Complex I was measured by the rate of ferricyanide reduction. Complex II was assayed by assessing the decrease in absorbance produced by the reduction of 2,6-DCIP. Complex III was determined by Cytc reduction. Complex IV was detected by following the decrease produced by the oxidation of reduced Cytc. Complex V was assessed by the change of ATP synthase. All enzyme activities were expressed as nmol mg1 protein.
Fifty mg tissues of testes were rinsed in saline, cut and then homogenized in low intensity RIPA lysis buffer (Beyotime, China), containing 1 mM phenylmethylsulfonyl fluoride. The homogenate was centrifuged and supernatant was collected. The concentrations of protein were detected by BCA protein assay kits. Fifty lg proteins from each group were separated by 12% SDS– PAGE. Proteins were electrophoretically transferred to a PVDF membrane, then blocked by 5% non-fat milk for 1 h at 37 °C and incubated with anti-Bcl-2, anti-Bax or anti-Cyt-c (EPI, USA) for 2 h at 37 °C. After washed, the membranes were incubated with HRP-conjugated secondary antibody for 1 h at 37 °C. The protein bands were visualized using the enhanced chemiluminescence method, and then quantified by Image J. 2.8. Statistical analysis Data are the mean of three replicates. Results were expressed as mean ± SD. The one-way ANOVA was performed to test the difference between the CS2-exposed groups following appropriate normalization and variance equalization. Dunnett-SNK test was adopted in comparisons of experimental groups and control group. SPSS 13.0 was used to perform statistical analyses, and statistical significance was set at p < 0.05.
2.6. RNA isolation and real-time PCR 3. Results Total RNA was isolated from rat testes using Trizol reagent, according to the manufacturer’s instruction (Promega, Madison, USA). The concentration of RNA was measured by the OD 260/ 280 ratio. Total RNA was reversely transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, USA).
3.1. Effects of CS2 exposure on body weight and testes weight The mean values for body weights of male rats among different CS2 exposure groups were not significantly different. Compared with the control group, the testicular weights were markedly
Please cite this article in press as: Guo, Y., et al. Carbon disulfide induces rat testicular injury via mitochondrial apoptotic pathway. Chemosphere (2014), http://dx.doi.org/10.1016/j.chemosphere.2014.01.081
4
Y. Guo et al. / Chemosphere xxx (2014) xxx–xxx
Fig. 1. (A) Seminiferous tubules were shown by H&E staining (magnification 400). (B) Testicular ultrastructure images of rats. Representative photos were taken from 4000 to 10 000. Normal sertoli cell (a) and spermatogonium (b) were shown. Series of the spermatogenic cycle (c) and regular morphological character of mitochondria (d) were observed in control and CsA-treated groups. After CS2 exposure, chromatin of sertoli cell was aggregated and deformed, and multiple vacuoles were appeared (e). In spermatocytes, multiple vacuoles were observed (f), series of the spermatogenic cycle were lost and no forming acrosome or mature acrosome was observed (g). The swollen mitochondria were captured (h). (C) Immunohistochemical staining of Bcl-2, Bax, and Cytc in testicular tissue (200). Images were arranged from I to VI according to group numbers.
Please cite this article in press as: Guo, Y., et al. Carbon disulfide induces rat testicular injury via mitochondrial apoptotic pathway. Chemosphere (2014), http://dx.doi.org/10.1016/j.chemosphere.2014.01.081
Y. Guo et al. / Chemosphere xxx (2014) xxx–xxx
5
Fig. 2. (A) Apoptosis were detected by TUNEL assay from group I–VI (200). Green color indicated TUNEL-positive cells. (B) Percentage of apoptotic cells was analyzed. Bars: error bars represent standard error of means; #p < 0.01, compared with control. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
decreased in group III (250 mg m3) and IV (1250 mg m3) (p < 0.05, Table 2). 3.2. CS2 induced morphological changes of testicular germ cells
3.2.1. Light microscopy observation In our study, regular histological morphology by H&E staining was observed in control, only CsA treatment and co-administration of CS2 and CsA groups (Fig. 1A I, V and VI). In group II (50 mg m3), seminiferous tubules became slightly sparse. In group III (250 mg m3), cytoplasm were rarefaction and parts of cell membrane were ruptured. In group IV (1250 mg m3), the arrangements of cells were remarkably disordered, and structure of seminiferous tubules were collapsed. All these features suggested the cellular damage of testes.
Bcl-2 was observed in group IV (1250 mg m3). Moreover, CsA reversed this down-regulation. There were higher expressions of Bax and Cytc in CS2-exposed groups, compared with the control (p < 0.05). The highest density of Bax and Cytc were observed in group IV (1250 mg m3). In addition, CsA treatment modulated these up-regulations. 3.3. Effects of CS2 exposure on apoptotic cells The green fluorescence stained cells were labeled as apoptosis. Fig. 2 showed that apoptosis were significantly increased in CS2exposed groups in a dose-dependent manner when compared with control (p < 0.01). In addition, treatment of CsA conspicuously reduced the number of apoptotic cells induced by CS2. 3.4. Effects of CS2 exposure on mitochondrial apoptotic pathway
3.2.2. Ultrastructural observation Regular morphological character of sertoli cell (Fig. 1B. a), spermatogonium (Fig. 1B. b), series of the spermatogenic cycle (Fig. 1B. c) and mitochondria (Fig. 1B. d) from control and CsA-treated groups were observed by transmission electron microscope. In CS2-exposed groups, chromatin of sertoli cell was deformed, vacuoles were increased dramatically, and membranes junctions were disrupted (Fig. 1B. e). In spermatocyte, vacuoles were also increased dramatically (Fig. 1B. f), the spermatogenic cycle and mature spermatids were lost (Fig. 1B. g). In addition, the mitochondrial cristae were distended (Fig. 1B. h). 3.2.3. Immunohistochemistry analysis Photomicrographs of immunohistochemically stained specimens were shown in Fig. 1C. The results of immunohistochemically stained revealed that there were low expressions of Bcl-2 in CS2-exposed groups compared with the control. The minimum density of
3.4.1. The loss of DWm As shown in Fig. 3A, after quantification, the ratio of red (high DWm)/green (low DWm) fluorescence was significantly decreased in all CS2-exposed groups, compared with the control (p < 0.01), with the minimum ratio observed in group VI (1250 mg m3). The decline of DWm suggested that mitochondrial function was dysregulated by CS2 exposure. While indistinguishable percentage changes were found between only CsA-treated group and the control group. However, statistical significance of decrease in DWm was shown between the group VI and control. Meanwhile, the level of DWm in group VI was significantly higher than that in all CS2-exposed groups. These phenomena indicated that CsA-treatment inhibited the adverse effect of CS2 on DWm to a certain extent. And these results suggested that there are some other mechanisms involved in CS2-induced apoptosis in testicular germ cells.
Please cite this article in press as: Guo, Y., et al. Carbon disulfide induces rat testicular injury via mitochondrial apoptotic pathway. Chemosphere (2014), http://dx.doi.org/10.1016/j.chemosphere.2014.01.081
6
Y. Guo et al. / Chemosphere xxx (2014) xxx–xxx
Fig. 3. (A) The decline of DWm was measured by fluorescent microscope (400). Red/green fluorescence intensity value was calculated. (B) The influences of CS2 combined with CsA on intracellular Ca2+ (200). Statistical analyses of intracellular Ca2+ in different groups were shown. (C) Representative images (200) of the changes of ROS were captured. Statistical analyses of ROS in different groups were shown. Bars: error bars represent standard error of means; #p < 0.01, compared with control. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
3.4.2. The release of calcium A dose-dependent increase of intracellular Ca2+ was observed in CS2-exposed groups, compared with the control (p < 0.01) (Fig. 3B). While no significant elevation in Ca2+ was detected in CsA-treated groups. These findings demonstrated that CS2 could increase the level of intracellular Ca2+ and CsA blocked the accumulation of Ca2+. 3.4.3. ROS synthesis After CS2 exposure, levels of intracellular ROS were found markedly increased, compared with the control (p < 0.01). Quantification data showed that CsA treatment led to a reduction in intracellular ROS production (Fig. 3C). These results indicated that ROS played a role in CS2-induced apoptotic pathway.
3.4.4. The decrease of ATP Results of all CS2-exposed groups showed ATP levels were significantly lower than the control (p < 0.01), in a dose-dependent manner (Fig. 4A). The samples from three CS2-exposed groups had ATP levels of 7.5, 6, and 4 nmol mg1 protein, respectively. Supplementation of CsA increased the level of ATP to 22.5 nmol mg1 protein, which showed no significant change compared with the control. These results indicated that the energy productions in mitochondria were restrained after CS2-exposure and CsA prevented this down-regulation of ATP level induced by CS2. 3.4.5. The expression of MPTP opening Fig. 4B revealed a significant decrease in the levels of MPTP opening between three doses of CS2-exposed groups and the con-
Please cite this article in press as: Guo, Y., et al. Carbon disulfide induces rat testicular injury via mitochondrial apoptotic pathway. Chemosphere (2014), http://dx.doi.org/10.1016/j.chemosphere.2014.01.081
Y. Guo et al. / Chemosphere xxx (2014) xxx–xxx
7
Fig. 4. (A) Analysis of ATP level. (B) The effects of CS2 combined with CsA on the MPTP opening. (C) The effects of CS2 on the activity of mitochondrial respiratory chain complexes I–V. Bars: error bars represent standard error of means; p < 0.05, #p < 0.01, compared with control.
trol (p < 0.05) and the minimum level of MPTP opening was observed in group IV (1250 mg m3). 3.4.6. The complexes of respiratory chain I–V Results showed that the viability of all complexes was prominently increased after CS2-exposure (p < 0.05). Moreover, administration of CsA reversed or weakened this increased activity (Fig. 4C). 3.4.7. mRNA expressions of mitochondrial apoptotic relative genes The genes below were chosen based on the list of genes established in SABioscience™ for mitochondrial apoptotic pathway. As shown in Fig. 5A, the expressions of mitochondrial pathwayassociated factors, including JNK, Bax, Cytc, Apaf-1, Caspase-9 and Caspase-3, were dramatically increased since group II (50 mg m3). Meanwhile, the expression of Bcl-2 was significantly decreased. Moreover, CsA administration reversed these expressions. These results indicated that CS2 exposure caused abnormal expressions of mitochondrial pathway-associated genes and CsA repressed the effects of CS2 on mRNA expressions. 3.4.8. The levels of proteins after CS2 exposure As shown in Fig. 5B, treatment of CS2 significantly increased the levels of Bax and Cytc in a dose-dependent manner when compared with control (p < 0.05). Maximal levels of Bax and Cytc were observed in group IV (1250 mg m3), compared with control (p < 0.01). Meanwhile, immunoblots showed significant decrease in the level of Bcl-2, compared with control (p < 0.01), with minimum level in group IV (1250 mg m3). In addition, expressions of Bcl-2, Bax and Cytc were reversed by CsA treatment (Fig. 5C).
4. Discussion Many researches indicated that CS2 could induce reproductive toxicity (Tepe and Zenick, 1984; Mihalache and Mihalache, 1989). An excellent study (Vanhoorne et al., 1994) reported that human exposed to 10 ppm CS2 presented changes of seminal characteristics. Mihalache and Mihalache reported that male rats poisoned by intraperitoneal administration of 5, 10, 15, 25 mg kg1 of CS2 once a week for 6 months produced changes including interstitial edema, congestion, seminiferous tubules basement membrane thickening and spermatogenesis suppression at different stages. In this study, three doses of CS2 were chosen. The deleterious effects had occurred just at 50 mg m3, exacerbated at 250 mg m3 and 1250 mg m3. These results revealed that low dose exposure of CS2 is able to cause serious injury on germ cells and the toxic effects occur in a dose-dependent manner. Abnormally increased levels of apoptosis is one of the main mechanisms how toxicants induce reproductive system injury (Kaczmarek et al., 2011; Jiang et al., 2013). Recent researches showed that toxicants such as microcystins and doxorubicin induce testes injury via male germ cells apoptosis (Li et al., 2011; Das et al., 2012). Similarly, VOCs, just like CS2, di (2-ethylhexyl) phthalate and methoxychlor are also reported to induce apoptosis of germ cells (Vaithinathan et al., 2010; Erkekoglu et al., 2012). Our previous study has found that more apoptotic germ cells are observed in the CS2-exposed people than the unexposed people (Ma et al., 2010). Therefore, apoptosis is attractive for explaining CS2-induced testicular injury. After 10-week CS2 exposure, the testicular weight was significantly decreased. Meanwhile, striking ultrastructural changes were
Please cite this article in press as: Guo, Y., et al. Carbon disulfide induces rat testicular injury via mitochondrial apoptotic pathway. Chemosphere (2014), http://dx.doi.org/10.1016/j.chemosphere.2014.01.081
8
Y. Guo et al. / Chemosphere xxx (2014) xxx–xxx
Fig. 5. (A) Relative mRNA expressions of mitochondrial pathway were detected after CS2 exposure. (B) The expressions of Bcl-2, Bax and Cytc protein in three CS2-exposed groups were detected by western blot. (C) The protein levels of group I, V and VI were shown. Actin blot showed equal protein loading. Graph representing statistic results corresponded to the blots. Bars: error bars represent standard error of means; p < 0.05, #p < 0.01, compared with control.
observed by light and electric microscopy and all ultrastructural changes indicated that early apoptosis occurred. Moreover, the outcomes of TUNEL assay also showed that the numbers of apoptotic germ cells were significantly increased. These results directly proved that CS2 induced early apoptosis on germ cells. In the present study, mRNA expressions of JNK, Bax, Cytc, Apaf 1, Caspase-9 and Caspase-3 were observed up-regulated and Bcl-2 was observed down-regulated from real-time PCR assay. As shown by the immunohistochemical staining and Western Blot analyses, the expression levels of these proteins were consistent with the expression level of their mRNAs. There are some previous studies which also reported that some factors changed in mitochondrial apoptotic pathway (Harris and Thompson, 2000; Ricci et al., 2004). Changes observed by us are consistent with their results. In addition, one of our previous studies also supported our results about expressions of mitochondrial apoptotic pathway relative proteins (Huang et al., 2013). All above suggested the involvement of mitochondrial apoptotic pathway in CS2-induced apoptosis. If this is the case, the possible mechanism of CS2 impairs testicular
germ cells is as follows: when CS2-induced apoptotic pathway was triggered, protein expression of Bcl-2 was down-regulated and Bax was up-regulated. On the other side, CS2 increased the production of ROS by increasing the activity of respiratory chain complexes. ROS induced the free radical attack of membrane phospholipids and loss of DWm. Besides, concurrent stimulus of CS2 exposure resulted in the release of Ca2+ from the endoplasmic reticulum, and then caused Ca2+ to overload in mitochondria. All the changes above induced the MPTP opening, which released Cytc and in turn increased the activation of Caspase-9 and Caspase-3. Finally, mitochondrial matrixes got distended and apoptosis occurred. As noted above, MPTP opening played a crucial role in mitochondrial apoptotic pathway. One previous study showed that MPTP closes in the early stage of apoptosis (Lemasters and Holmuhamedov, 2006), while the expression of MPTP opening was decreased in present study. Thus, the decreased expression of MPTP opening exactly proved that CS2 could induce apoptosis via mitochondrial apoptotic pathway.
Please cite this article in press as: Guo, Y., et al. Carbon disulfide induces rat testicular injury via mitochondrial apoptotic pathway. Chemosphere (2014), http://dx.doi.org/10.1016/j.chemosphere.2014.01.081
Y. Guo et al. / Chemosphere xxx (2014) xxx–xxx
CsA is well known as a kind of immunosuppressive agent for its ability to prevent the MPTP opening (Connern and Halestrap, 1994; Leventhal et al., 2000), but it is uncertain whether CsA performs protective effects on testes. Our findings showed that, after treated with CsA, the percentages of apoptotic cells were significantly decreased in CS2-exposed testes. Moreover, the abnormal expressions of Bax/Bcl-2 and the release of Cytc were decreased. In addition, the levels of Ca2+, ROS and expressions of MPTP opening were closer to the normal range. Our results are in line with previous reports which use CsA as MPTP inhibitor (Gharanei et al., 2013). Thus, these findings provided a direct evidence to prove the involvement of mitochondrial apoptotic pathway and the key role of MPTP in CS2-induced apoptosis. Besides, CsA had a protective effect on CS2-induced apoptosis via preventing the MPTP opening. Altogether, this study elucidated a novel mechanism for CS2-induced male reproductive toxicity. Our results indicated that CS2 could cause damage to testicular germ cells by inducing apoptosis. Moreover, CS2 induced apoptosis via mitochondrial apoptotic pathway and the MPTP opening played a crucial role in this process. In addition, our findings further implied the potential utilization of CsA against toxic effects of CS2 in clinical treatment. Acknowledgments The authors would like to thank all the participants in our study. This study was supported by the National Science Foundation of China, Grant 30872091 and 81172637. References Cirla, A.M., Bertazzi, P.A., Tomasini, M., Villa, A., Graziano, C., Invernizzi, R., Gilioli, R., 1978. Study of endocrinological functions and sexual behaviour in carbon disulphide workers. Med. Lav. 69, 118–129. Connern, C.P., Halestrap, A.P., 1994. Recruitment of mitochondrial cyclophilin to the mitochondrial inner membrane under conditions of oxidative stress that enhance the opening of a calcium-sensitive non-specific channel. Biochem. J. 302, 321–324. Das, J., Ghosh, J., Manna, P., Sil, P.C., 2012. Taurine protects rat testes against doxorubicin-induced oxidative stress as well as p53, Fas and caspase 12mediated apoptosis. Amino Acids 42, 1839–1855. Ding, N., Xiang, Y., Jiang, H., Zhang, W., Liu, H., Li, Z., 2011. Carbon disulfide inhibits neurite outgrowth and neuronal migration of dorsal root ganglion in vitro. Int. J. Neurosci. 121, 649–654. Erkekoglu, P., Zeybek, N.D., Giray, B., Asan, E., Hincal, F., 2012. The effects of di (2ethylhexyl) phthalate exposure and selenium nutrition on sertoli cell vimentin structure and germ-cell apoptosis in rat testis. Arch. Environ. Contam. Toxicol. 62, 539–547. Gharanei, M., Hussain, A., Janneh, O., Maddock, H.L., 2013. Doxorubicin induced myocardial injury is exacerbated following ischaemic stress via opening of the mitochondrial permeability transition pore. Toxicol. Appl. Pharmacol. 268, 149– 156.
9
Green, D.R., Reed, 1998. Mitochondria and apoptosis. Apoptosis 281, 1309–1312. Harris, M.H., Thompson, C.B., 2000. The role of the Bcl-2 family in the regulation of outer mitochondrial membrane permeability. Cell Death Differ. 7, 1182–1191. Huang, X.Y., Zhang, Z., Zhou, Y.J., Guo, Y.S., Wang, W., Dong, Y., Wang, N., Ding, Q., Ji, J.J., Chen, G.Y., 2013. Effect of carbon disulfide on mitochondrial apoptosisrelated proteins in cytoplasm of testicular tissue among male rats. Zhonghua Lao Dong Wei Sheng Zhi Ye Bing Za Zhi 10, 730–733. Jiang, X., Zhang, C., Xin, Y., Huang, Z., Tan, Y., Huang, Y., Wang, Y., Feng, W., Li, X., Li, W., Qu, Y., Cai, L., 2013. Protective effect of FGF21 on type 1 diabetes-induced testicular apoptotic cell death probably via both mitochondrial- and endoplasmic reticulum stress-dependent pathways in the mouse model. Toxicol. Lett. 219, 65–76. Kaczmarek, K., Studencka, M., Meinhardt, A., Wieczerzak, K., Thoms, S., Engel, W., Grzmil, P., 2011. Overexpression of peroxisomal testis-specific 1 protein induces germ cell apoptosis and leads to infertility in male mice. Mol. Biol. Cell 22, 1766–1779. Kinnally, K.W., Peixoto, P.M., Ryu, S.Y., Dejean, L.M., 2011. Is mPTP the gatekeeper for necrosis, apoptosis, or both? Biochim. Biophys. Acta 1813, 616–622. Lemasters, J.J., Holmuhamedov, E., 2006. Voltage-dependent anion channel (VDAC) as mitochondrial governator – thinking outside the box. Biochim. Biophys. Acta 1762, 181–190. Leventhal, L., Sortwell, C.E., Hanbury, R., Collier, T.J., Kordower, J.H., Palfi, S., 2000. Cyclosporin A protects striatal neurons in vitro and in vivo from 3nitropropionic acid toxicity. J. Comp. Neurol. 425, 471–478. Li, G.Y., Xie, P., Li, H.Y., Hao, L., Xiong, Q., Qiu, T., 2011. Involment of p53, Bax, and Bcl-2 pathway in microcystins-induced apoptosis in rat testis. Environ. Toxicol. 26, 111–117. Ma, J.Y., Ji, J.J., Qing, D., Liu, W.D., Wang, S.Q., Ning, W., Chen, G.Y., 2010. The effects of carbon disulfide on male sexual function and semen quality. Toxicol. Ind. Health 26, 375–382. Mihalache, C., Mihalache, G., 1989. Histologic aspects of the testis in experimental carbon disulfide poisoning. Rev. Med. Chir. Soc. Med. Nat. Iasi 93, 339–341. Morvai, V., Szakmary, E., Ungvary, G., 2005. The effects of carbon disulfide and ethanol on the circulatory system of rats. J. Toxicol. Environ. Health A 68, 797– 809. Ricci, J.E., Munoz-Pinedo, C., Fitzgerald, P., Bailly-Maitre, B., Perkins, G.A., Yadava, N., Scheffler, I.E., Ellisman, M.H., Green, D.R., 2004. Disruption of mitochondrial function during apoptosis is mediated by caspase cleavage of the p75 subunit of complex I of the electron transport chain. Cell 117, 773–786. Sawhney, P., Giammona, C.J., Meistrich, M.L., Richburg, J.H., 2005. Cisplatin-induced long-term failure of spermatogenesis in adult C57/Bl/6J mice. J. Androl. 26, 136– 145. Sheridan, C., Martin, S.J., 2010. Mitochondrial fission/fusion dynamics and apoptosis. Mitochondrion 10, 640–648. Tepe, S.J., Zenick, H., 1984. The effects of carbon disulfide on the reproductive system of the male rat. Toxicology 32, 47–56. Tsujimoto, Y., Shimizu, S., 2007. Role of the mitochondrial membrane permeability transition in cell death. Apoptosis 12, 835–840. Vaithinathan, S., Saradha, B., Mathur, P.P., 2010. Methoxychlor induces apoptosis via mitochondria- and FasL-mediated pathways in adult rat testis. Chem. Biol. Interact 185, 110–118. Vanhoorne, M., Comhaire, F., De Bacquer, D., 1994. Epidemiological study of the effects of carbon disulfide on male sexuality and reproduction. Arch. Environ. Health 49, 273–278. Wang, F., Cai, S., Wang, Z., Xi, C., 2011. Synthesis of 2-mercaptobenzothiazoles via DBU-promoted tandem reaction of o-haloanilines and carbon disulfide. Org. Lett. 13, 3202–3205. Xuan, Y., Hu, J., Xu, K., Hou, X., Lv, Y., 2009. Development of sensitive carbon disulfide sensor by using its cataluminescence on nanosized-CeO2. Sens. Actuators B: Chem. 136, 218–223.
Please cite this article in press as: Guo, Y., et al. Carbon disulfide induces rat testicular injury via mitochondrial apoptotic pathway. Chemosphere (2014), http://dx.doi.org/10.1016/j.chemosphere.2014.01.081