- Email: [email protected]
Carbon nanotube-based DNA vaccine against koi herpesvirus given by intramuscular injection
Fish and Shellfish Immunology xxx (xxxx) xxx–xxx
Contents lists available at ScienceDirect
Fish and Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Carbon nanotube-based DNA vaccine against koi herpesvirus given by intramuscular injection Feng Hua,b, Yingying Lia, Qing Wanga,∗, Gaoxue Wangc, Bin Zhuc, Yingying Wanga, Weiwei Zenga, Jiyuan Yina, Chun Liua, Sven M. Bergmannd, Cunbin Shia a
Key Laboratory of Fishery Drug Development of Ministry of Agriculture and Rural Affairs, Key Laboratory of Aquatic Animal Immune Technology of Guangdong Province, Pearl River Fisheries Research Institute, Chinese Academy of Fishery Sciences, Guangzhou, Guangdong, PR China b College of Fisheries and Life Science, Shanghai Ocean University, Shanghai, PR China c College of Animal Science and Technology, Northwest A&F University, Yangling, PR China d German Reference Laboratory for KHVD, Institute of Infectology, Friedrich-Loffler-Institut (FLI), Federal Research Institute for Animal Health, Greifswald–Insel Riems, Germany
A R T I C LE I N FO
A B S T R A C T
Keywords: Koi herpes virus ORF149 Carbon nanotubes Immune response DNA vaccine
Koi herpesvirus (KHV) also named Cyprinid Herpesvirus 3 (CyHV-3) is one of the most threatening pathogens affecting common carp production as well as the valued ornamental koi carp. The current commercial vaccines available are costly and potentially cause severe stress caused by live virus. KHV ORF149 gene has been proved encoding one of the main immunogenic proteins for KHV. In this study, we coupled a plasmid expression vector for ORF149 to single walled carbon nanotubes (SWCNTs) for an anti-KHV vaccine. The vaccine conferred an 81.9% protection against intraperitoneal challenge with KHV. Importantly, SWCNTs as a promising vehicle can enhanced the protective effects 33.9% over that of the naked DNA vaccine at the same dose. The protection was longer and serum antibody production, enzyme activities and immune-related gene expression were all induced in fish vaccinated with the nanotube-DNA vaccine compared with the DNA alone. Thereby, this study demonstrates that the ORF149 DNA vaccine loaded onto SWCNTs as a novel vaccine might provide an effective method of coping with KHV disease using intra-muscular vaccination.
1. Introduction Aquaculture is a rapidly expanding economic sector worldwide and annual rate increases are estimated at 6.4% [1]. However, aquaculture is an economic activity with a high business risk. In fact, there are many factors that can cause adverse conditions that increase susceptibility to infections of the farmed species and that consequently pose a risk for the global production of aquaculture [2,3]. In particular, intensive rearing practices based on fish cultured in confined and controlled areas such as ponds or off-shore cages at high density all negatively affect the health status of cultured fish. This makes the control of disease outbreaks problematic and difficult [4,5]. Infection with Koi herpesvirus (KHV) [6] are a listed notifiable disease to the International Office of Epizootics (OIE, 2018). KHV has spread to most regions around the world due to the global fish trade and international ornamental koi shows [7]. First detected in the late 1990s, KHV has been found in Europe, Asia, North America and Africa and had caused serious worldwide losses in the carp and koi culture industries.
∗
As with all herpesviruses, KHV sets up a persistent infection in its host and can exist in a latent or state without obvious clinical signs [8]. Molecular analysis has demonstrated that the KHV isolates show little genomic variation as might be expected for a virus that is being rapidly disseminated by the global movement of infected fish [9]. KHVD is relatively host-specific, while only common carp and its ornamental subspecies, koi [10], are involved in the explosive losses reported globally [6]. In addition to its negative economical and societal impacts, KHV has also a negative environmental impact by affecting wild carp populations. In addition, hybrids of common carp and goldfish are partly susceptible to KHV infection although the mortality rate varies [11]. Cohabitation experiments indicated that some carp species such as goldfish, common bream (Abramis brama), silver carp and grass carp can carry KHV asymptomatically and transmit it to wild carp [12,13]. KHVD is highly contagious and extremely virulent with mortality rates of 80–100%. Carp of all ages can be infected with KHV but younger fish (1–3 months, 2.5–6 g) seem to be more susceptible to infection than mature fish (1 year old, 230 g) [14].
Corresponding author. Pearl River Fisheries Research Institute, Chinese Academy of Fishery Sciences, Guangzhou, Liwan District, 510380, PR China. E-mail address: [email protected] (Q. Wang).
https://doi.org/10.1016/j.fsi.2019.11.035 Received 30 September 2019; Received in revised form 31 October 2019; Accepted 15 November 2019 1050-4648/ © 2019 Elsevier Ltd. All rights reserved.
Please cite this article as: Feng Hu, et al., Fish and Shellfish Immunology, https://doi.org/10.1016/j.fsi.2019.11.035
Fish and Shellfish Immunology xxx (xxxx) xxx–xxx
F. Hu, et al.
The koi subspecies is of economic importance as an ornamental fish in China. Because of its numerous colors and color combinations, the koi has grown into one of the most popular pet hobbies in the world [15]. Within the past few decades, the commercial production of koi has emerged as a major segment of the pet industry and the koi (especially high quality individuals) trade plays a major role in meeting a growing worldwide demand [16]. Intensive koi farming is associated with risk for the incidence and spread of KHVD that cause skin lesions, severe fin erosion, flaking scales, dark skin coloration, especially gill necrosis, one of the most distinct symptom of KHVD [17][18][19], and even increased mortality and resulting in lower prices. Vaccine is widely accepted as an effective control against viral diseases [20]. Up to now, the commercialized KHV vaccine is attenuated vaccine, which has apparent stress response after immunization [21]. The efficacy of KHV inactivated virus vaccine is not satisfied. One of the most promising vaccine preparations against fish diseases is currently the DNA vaccine delivered intramuscularly that consists of plasmid DNA expression vectors that result in gene expression of pathogenic proteins in the muscle tissue of the vaccinated fish [22]. Compared with traditional vaccines, it is highly efficient, easy to prepare and has high stability. DNA vaccines prepared with KHV ORF25 and ORF81 as target genes have been shown to significantly reduce mortality to < 20% indicating that DNA vaccines have favorable immune effects against KHV [23,24]. However, intramuscular injection of naked DNA vaccines generally induce only transient immune protection in fish [25]. The current challenge for DNA vaccines is the discovery of an effective carrier that can result in persistence of the expressed antigen. Carbon nanotubes (CNTs) have been used as DNA carriers for vaccines and possess a large surface area in a small volume that translates to high surface reactivity and easy surface functionalization. Drugs and DNA have both been used as the cargo for CNTs for both diagnostic and therapeutic applications. These complexes can easily penetrate cell membrane and tissue barriers and achieve their biological effects by targeting the drug to the cell at a high dose [26–28]. Whether the CNT have correlation or negative impact to the fish immune-responses has been clarified by other researchers [28–30]. The previous research proved it does not take any negative effect on fish immune-responses and CNT itself could not induce immune protection. Fish nanocarrier vaccines have also been developed such as chitosan nanomaterials loaded with a salmon anemia DNA vaccine that can be used orally. This vaccine significantly improved immune protection [31,32]. Single walled carbon nanotubes (SWCNTs) DNA vaccine against spring viremia of carp virus (SVCV) and grass carp reovirus (GCRV) have proved effective [29,30,33]. Mandarin fish immunized with SWCNT-MCP by immersion vaccination resulted in increased survival against challenge of infectious spleen and kidney necrosis virus (ISKNV) [34]. In the current study we used the KHV ORF 149 gene of 2100 bp with 699 predicted amino acids and theoretical molecular weight of 72 kDa, containing only one potential N-glycosylation and 93 O-glycosylation sites. The envelope glycoprotein encoded by ORF149 is a neutralizing epitope and most likely functions in virus attachment and cell penetration, and is therefore a promising target antigen for vaccine development and diagnostic testing [35]. In present work, on the basis of hydroxyl and amino condensation reactions, functionalized singlewalled CNTs (o-SWCNTs) were used as carriers to load KHV ORF149 in an expression vector. We used this complex to immunize koi via intramuscular injection and evaluated the immune response elicited in vaccinated fish. This work provides a viable solution to KHVD and lays a foundation for future work on a wide range of CNTs-DNA vaccine delivery systems for fish.
2. Materials and methods 2.1. Cell line, virus, and fish The koi snout (KS) cell line and KHV-GZ1301 strain were kept in our lab. Culture conditions and calculation of 50% tissue culture infective doses (TCID50) were performed as previously described [36]. Briefly, cells were grown at 22 °C in Medium 199 (Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (Hyclone, Chicago, IL, USA). Healthy koi (15 ± 5 cm in length) without a history of KHVD were obtained from a commercial koi farm (Zhi Ming Koi. Foshan, China). Possible virus contamination in fish and feed was evaluated by PCR [37] to confirm they were free from KHV. 2.2. Preparation of carbon nanotubes covalent DNA complexes for vaccine Recombinant plasmid pcDNA-ORF149 (p149 in abbreviation) was established and kept in our lab. Single walled carbon nanotubes were kindly provided by Professor Wang Gaoxue of Northwest A&F University, Yangling, China. The SWCNTs-pcDNA-ORF149 (SWCNTsp149 in abbreviation) was prepared according to the method described as Zhu et al. [30]. 2.3. Vaccination Healthy koi (n = 900) were used for immune experiments. The experimental groups were set reference to the previous similar studies [29,30,33]. The fish were randomly divided into nine groups (100 fish per group) and immunized via intramuscular (i.m.) injection with the experimental vaccine p149, SWCNTs-p149 (dissolve in PBS, pH = 7.4) with the negative control (pcDNA vector), and inactivated virus (KHV GZ1301 was inactivated by 70 °C water bath for 18 h) also included as control. All fish were injected in the right dorsal epaxial muscle in front of the dorsal fin after being anaesthetized in 0.01% benzocaine [38]. According to our pre-test results of DNA concentration, the injection dosages were 0.2 mL of 1, 5 and 10 μg DNA linked to the carbon nanotubes (6 groups). Additionally, control groups consisted of injections of 10 μg pcDNA and PBS alone and a final untreated group. Each group (1–9) were maintained in separate tanks as outlined above. 2.4. Detection of injected DNA in fish tissues DNA was extracted from muscle tissues of 3 fish per group as described previously [39,40]. Briefly, muscle tissue samples were taken from at 3, 7, 14 and 28 days after vaccination and tissue samples (0.5–1.0 cm3) were taken from the area of injection. These were combined and pulverized in liquid nitrogen and the frozen powder was dissolved in 3 mL genomic DNA isolation buffer (1.0% sodium dodecyl sulfate, 100 mM NaCl, 50 mM TrisCl, 100 mM EDTA, pH 8.0, 20 μg mL−1 RNase) [39] and incubated for 1 h at 37 °C. Proteinase K (Thermo Fisher, USA) was added to a concentration of 150 mg mL−1 and the samples were incubated at 60 °C overnight. DNA was extracted using conventional phenol-chloroform procedures [41], and then subjected to PCR amplification with ORF149 primers and the s11 gene of the 40S rRNA subunit was used as an internal control (Table 1). 2.5. Detection of gene expression in vaccinated fish To examine the expression of ORF149 in the vaccinated fish, muscle tissues (see above) were taken from 3 fish per group fish at 14 and 28 days post vaccination. Total RNA were isolated from pulverized tissues using Trizol reagent (Invitrogen) and incubated with RNase-free DNase I (Life Technology, Gaithersburg, MD, USA) to eliminate genomic DNA. The RNA was reverse transcribed using random hexamers and M-MLV Reverse Transcriptase (Promega, Madison, WI, USA) using conditions provided by the manufacturer. The expression of plasmid constructs in 2
Fish and Shellfish Immunology xxx (xxxx) xxx–xxx
F. Hu, et al.
Table 1 Primers used in this study. FV primer 5′-3′ Primers used for amplification of KHV ORF149 ORF149 CAGAATTCCTGAGGACCATGCTCCGTC CACGAAAACGAACGAGCTCAC Primers used for detection of KHV Tk GGGTTACCTGTACGAG Sph GACACCACATCTGCAAGGAG Primers used for qRT-PCR Housingkeeping gene 40s CCGTGGGTGACATCGTTACA Cytokines cxca CTGGGATTCCTGACCATTGGT il1β AAGGAGGCCAGTGGCTCTGT CCTGAAGAAGAGGAGGAGGCTGTCA AJ245635 Interferon stimulated genes mx1 ACAATTTGCGGTCTTTGAGA CCCTGCCATTTCTCTTCG LHQP01004675.1 vip2 CTGTCGGACACATCAGC TCAATGGGCAAGACGAAA JX131617.1 Adaptive immune genes IgM CACAAGGCGGGAAATGAAGA Igt1 AAAGTGAAGGATGAAAGTGT
RV primer 3′-5′
Acc. No.
CACCCAGTAGATTATGC GACACATGTTACAATGGTCGC
AB375385.1 AB375381.1
TCAGGACATTGAACCTCACTGTCT
AB012087
GTTGGCTCTCTGTTTCAATGCA
AJ421443
GGAGGCACTATATCAACAGCA TGGTAACAGTGGGCTTATT
AB004105 AB598368
Restriction sites (EcoRI in the FW and XhoI in the RV primer) are underlined.
vaccinated fish was determined using PCR with ORF149 and s11 gene primers (Table 1).
control group was 100 TCID50 KHV. The plate was gently shaken and mixed in a CO2 incubator for 2–4 h followed by 0.1 mL CCB cells at 8 × 105 cells/mL and incubated at 28 °C for 5–7 days. Cytopathic effects (CPE) were observed using light microscopy. All samples were added in triplicate. The reciprocal of the highest dilution of the serum/ virus mixture that lacked CPE was taken as the neutralizing antibody titer.
2.6. Immune-related gene expression Immune-related gene expression used total RNA obtained from spleen tissues at day 28 post vaccination as per above and was were reverse transcribed using Select RT SuperMix plus gDNA wiper (Vazyme, Nanjing, China). Quantitative real-time PCR (qRT-PCR) was performed with an ABI 7500 machine (Applied Biosystems, Foster City, CA, USA) using AceQqPCR SYBR Green Master Mix (Vazyme) with the following procedure: 95 °C for 5 min and 35 cycles at 95 °C for 15 s, 60 °C for 45 s. The s11 gene was used for an internal control (Table 1). All qRT-PCR reactions were performed for three biological replicates and repeated with two independent samples. Relative mRNA expression was calculated using 2-△△Ct method with the formula, F = 2-△△Ct, △△Ct = (Ct,target gene-Ct, reference gene) – (Ct, target gene – Ct, reference gene)control [42].
2.9. Immune related enzymes activity assay Liver and serum samples were tested at day 28 post vaccination. The presence of lysozyme(LZM), superoxide dismutase (SOD), acid phosphatase(ACP) and alkaline phosphatase (AKP) were determined using LZM test kit, SOD Microplate test kit, ACP Microplate test kit and AKP Microplate test kit, respectively using protocols provided by the manufacturer (Jiancheng Bioengineering Institute, Nanjing, China). 2.10. Challenge experiment On day 28 post-vaccination, the fish were challenged by intraperitoneal injection with 300 μL 6.8 × 107 TCID50/mL of KHV and the half lethal dose of this virus preparation was 7.3 × 105 TCID50/mL determined as previously described [46]. Survival was recorded daily for 15 days after viral challenge and dead fish were removed from the tanks. PCR detection of KHV was used to confirm infection as per above (Table 1).
2.7. Measurement of antibody levels by ELISA Titers of antibodies in the serum of 3 fish per tank were measured weekly using Enzyme-Linked Immunosorbent Assay (ELISA) as described elsewhere [43–45]. Briefly, blood was collected from the caudal vein and stored overnight at 4 °C and then centrifuged at 5000×g for 15 min. The supernatant was collected and stored at −20 °C until use. ELISA plates were coated with purified KHV strain GZ1301 at 4 °C overnight. The wells were blocked with 5% skim milk and then washed three times with PBS/0.05% Tween-20. Serum samples were added and the plate was incubated at 37 °C for 1 h, followed by 100 μL of goat antimouse HRP-IgG (Sigma, St. Louis, MO, USA) was added and incubated for 40 min at 37 °C. The plate was washed and 100 μL TMB (Biopanda Diagnostics, Belfast, UK) solution was added to each well and incubated for 15 min at room temperature in the dark. The reaction was stopped with 50 μL of ELISA Stop Buffer (New Cell & Molecular Biotech, China) and the absorbance at 450 nm was measured using an ELISA reader.
2.11. Statistical analysis Data were expressed as mean ± SD and were analyzed using oneway ANOVA. Normality and homogeneity of variance were tested with Levene's test. Data that have homogeneous variance were log transformed to meet the assumptions of ANOVA. Significant differences were determined with Tukey's multiple range tests. All tests were performed using SPSS 18.0 software (IBM, Chicago, IL, USA). P values < 0.05 were as significant.
2.8. Serum neutralization test (SNT)
3. Results
The presence of neutralizing antibody in fish serum samples was examined at 28th day post vaccination. The serum samples were heated at 56 °C for 30 min to inactivate complement and diluted with PBS. KHV was diluted with PBS to 200 TCID50/0.025 mL. Diluted serum samples were added to a 96-well plate followed by a 0.025 mL of diluted virus solution and PBS for the negative control group. The positive
3.1. Persistence of pcDNA-ORF149 in muscle tissues The presence of p149 in muscle tissues was examined at specific times post-vaccination using PCR primers specific for ORF149. We found ORF149 DNA in samples taken 3, 7, 14 and 28 days post-vaccination but not from tissues of the control groups (Fig. 1). In addition, 3
Fish and Shellfish Immunology xxx (xxxx) xxx–xxx
F. Hu, et al.
Fig. 2. PCR detection of ORF149 transcription in vaccinated koi. Total RNA was extracted from koi muscle at 14 (A) and 28 (B) days post intramuscular injection. M, DNA marker; lane 1, PBS group; lane 2, pcDNA (10 μg) group; lane 3, inactivated virus vaccine; lane 4, p149 (1 μg) group; lane 5, p149 (5 μg) group; lane 6, p149 (10 μg) group; lane 7, SWCNTs-p149 (1 μg) group; lane 8, SWCNTs-p149 (5 μg) group; lane 9, SWCNTs-p149 (10 μg) group.
Fig. 1. Detection of vaccine DNA in fish muscle tissue by PCR. DNA was extracted from koi muscle at 3 (A), 7 (B), 14 (C) and 28 (D) days post intramuscular injection. M, DNA marker; lane 1, PBS group; lane 2, pcDNA (10 μg) group; lane 3, inactivated virus vaccine; lane 4, p149 (1 μg) group; lane 5, p149 (5 μg) group; lane 6, p149(10 μg) group; lane 7, SWCNTs-p149 (1 μg) group; lane 8, SWCNTs-p149 (5 μg) group; lane 9, SWCNTs-p149 (10 μg) group.
week 4 post-vaccination and they gradually decreased. However, no significant binding antibody activity was observed in control groups (Fig. 4).
the amplicons generated from the carbon nanotube-plasmid vaccines were much brighter than for the DNA vaccine given without nanotubes linkage. (Fig. 1).
3.5. Neutralization assay Koi immunized with inactivated or DNA vaccine developed detectable neutralizing antibody (Fig. 5). The neutralizing titers of the fish serum from SWCNTs-p149 groups were significantly higher than other experimental groups with maximal at 1:256 dilution. The negative control groups did not display any neutralization antibody activity.
3.2. Transcription of pcDNA-ORF149 gene in vivo A semi-quantitative analysis of ORF149 mRNA levels was performed. Amplicons were obtained from muscle samples taken at the site of injection at 14 and 28 days after immunization with p149 or SWCNTS-p149, the bands generated from the nanotube-coupled vaccine were qualitatively brighter than for the naked DNA vaccine. In addition, there was a dose-dependent increase in PCR amplicon brightness indicating a greater amount of template DNA resulted in greater amounts of mRNA (Fig. 2).
3.6. Immune related enzymes activity assay As shown in Fig. 6, enzyme activity including LZM, ACP, SOD and AKP of serum and liver in different treatment groups were recorded. These immune-related enzymes activity increased in vaccinated groups compared to controls. The enzymes activity in DNA vaccine groups displayed in a dose dependent manner and the level of enzyme activity in SWCNTs-p149 groups significantly higher than p149 which also less than that in inactivated virus vaccine.
3.3. Immune-related genes expression We also examined the expression of a series of immune-related genes in the spleen samples taken from all experimental groups. We found that, both ORF149 vaccines induced the immune-related genes including cxca, Igt1, IgM, Il1β, mx1 and vip2 4 to 25-fold higher. In addition, the relative levels of the mRNAs for these genes in the SWCNTS-p149 vaccine groups were significantly higher than in the inactivated virus and p149 vaccinated groups. Furthermore, these immune-related genes were significantly up-regulated 2.3–5.2-fold in a dose dependent manner and proportional to the DNA content in the vaccine dose (Fig. 3).
3.7. Protection against KHV infection Each experimental fish were challenged with 300 μL live KHV at 6.8 × 107 TCID50 mL−1 to determine whether the DNA vaccines were protective. The vaccine groups (inactivated virus, p149 and SWCNTp149) showed a significant improvement in survival compared with controls. The negative control PBS and pcDNA3.1 treatment groups had mortalities at 2 days after challenge and the cumulative mortalities reached 100% at days 8 and 9 respectively. The first mortality for the p149 vaccinated group (10 μg) was observed at day 7 days after challenge with a cumulative mortality of 52% by day 15. The SWCNT-p149 vaccinated group (10 μg) gave the highest protective efficacy and relative percentage survival (RPS) of 81.9% after 15 days (Table 2 and Fig. 7). Typical clinical symptoms of KHV infection were observed in all diseased fish, and no pathogen other than KHV was detected.
3.4. Detection of antibody The results of ELISA showed that there were significant enhancement of antibody level in fish vaccinated with inactivated virus vaccine, p149 and SWCNTs-p149. Furthermore, the antibody levels in fish injected with SWCNT-p149 was much higher than fish vaccinated with p149 at the same DNA concentration. In addition, using 10 μg SWCNTp149 generated much higher antibody levels than for the fish vaccinated with inactivated virus. Antibody levels reached a peak titer at
4. Discussion Common anti-KHV vaccines, such as inactivated vaccine [47], 4
Fish and Shellfish Immunology xxx (xxxx) xxx–xxx
F. Hu, et al.
Fig. 3. qRT-PCR analysis of the expression of immune-related genes in fish vaccinated with different ORF149 formulations. (A) cxca; (B) Igt1; (C) IgM; (D) il1β; (E) mx1; (F) vip2. Spleen samples were collected from the koi at 28 d post-vaccination. Data are means for three assays and presented as the means ± SD. a–g: within a column, different letters indicate significant differences (p < 0.05).
proteins ORF25 and ORF81 of KHV have been identified the potential as candidates for intra-muscular (i.m.) DNA vaccination of carp against KHV, which induced up to 87.5% survival via three consecutive i.m. injections of 1, 10 or 50 μg of pcDNA encoding the soluble form of the surface glycoproteins ORF25 or ORF81 [23,24]. While this is
attenuated vaccine [48], subunit vaccine [49] and DNA vaccine [50] have been investigated already. Formalin-inactivated KHV vaccine with liposome via oral vaccination can generate the RPS of 74.4% [51]. In contrast to live virus vaccines, subunit or DNA vaccines would provide suitable alternatives owing to their safety profile. The two membrane 5
Fish and Shellfish Immunology xxx (xxxx) xxx–xxx
F. Hu, et al.
Fig. 4. Serum antibody levels in vaccinated koi. Sera were collected from the fish at1-8 weeks post-vaccination, and serum antibodies were determined by ELISA. Data are means for three assays and presented as the means ± SD. a–h: within a column, different letters indicate significant differences (p < 0.05).
vary with vaccine formulation, fish size, and environment [54], the antibody level could reveal the immune effect of vaccine [55,56]. We found an enhancement of specific serum antibody response in vaccinated fish and peaked at week 4 post vaccination. The antibody levels in SWCNTs-coupled DNA vaccine were significantly higher than that in naked DNA vaccinated fish at the same dose and most likely reflects an greater antigen load in the fish. We also observed significant increases of non-specific parameters such as the activities of LZM, SOD, ACP and AKP were observed in vaccined fish. The fish in SWCNT-p149 vaccinated groups aroused higher level of non-specific parameters activities compared with that in naked p149 or inactivated vaccine groups, and no significant difference was observed in control groups. The reason why SWCNT significantly enhanced the immune protective effect of our vaccine is possibly due to increased numbers of cells (migration of head and leukocytes) participated in the process [57], in other words, SWCNTs make our DNA vaccine easier for attachment to specific target tissues and cells. This may also partly explain the improved immune response in fish vaccinated with SWCNT-p149. We further analyzed the expression of immune-related genes in vaccinated fish to verify the immune effects of prepared vaccine. We found significant increases in mRNA levels for cytokines (cxca, il1β), interferon stimulated genes (mx1, vip2) and adaptive immune genes (IgM, Igt1) in vaccinated fish compared with controls. Moreover, fish vaccinated with SWCNT-p149 induced higher levels of immune-related gene expression than fish immunized with naked p149 vaccine alone. The cxca and max1 play significant roles in the initiation and regulation of the inflammatory process and serve as an important component of innate immunity [58,59]. In addition, IgM expression was increased significantly in vaccinated fish spleens. IgM is a major component of the humoral immune system of teleost fish. IgM expression increases in many tissues and organs from the second week after immunization and maintained for one month [60] which corresponds with the result of antibody production in our study. Therefore, the change of cytokines, interferon stimulated genes and adaptive immune-related response was a consequence of DNA vaccine. Once vaccine was transported into fish immune-related organs, tissues and cells, the biological function of vaccine could be carried out [61]. This might be one of the reasons why SWCNTs can enhance immune protection via intramuscular injection. However, the underlying mechanism of protection needs further investigation.
Fig. 5. Neutralization assay . KHV-neutralization titer of serum collected from the koi at 28th day after vaccination.
promising, fewer doseage or convenient vaccination routes would be preferred from a practical point of view. The only commercially available live attenuated vaccine for KHV is not resgistered for use in China. Live vaccines have inherent safety issues and subunit or DNA vaccines are preferred. Compared with traditional vaccines, DNA vaccines have been widely used for aquatic animal diseases because of easy preparation, stability and high efficiency. DNA vaccines are commercially available due to their good immunoprotective effects. A DNA vaccine against infectious haematopoietic necrosis (IHN) is licensed in Canada for use in Atlantic salmon [52]. In koi vaccination with the SVCV G gene resulted in an 88% survival against challenge with live virus [46]. Enhanced survival of olive flounder against viral hemorrhagic septicemia virus (VHSV) challenge was observed using a DNA vaccine plasmids co-expressing VHSV G and DDX41, a protein in the DEXD/H-box family [53]. In the current study, koi was immunized by the prepared koi herpes virus DNA vaccine coupled with single-walled carbon nanotubesvia intramuscular injection. After the challenge test, the results showed that the relative percentage survival (RPS) of the control group (PBS, pcDNA) was 0 although the p149 and the inactivated virus vaccine group gave some protection.The survival of fish vaccinated with SWCNT-p149 (10 μg) gave a 81.9% RPS indicating significant immune protection of koi against KHV. To further examine the immune response induced by our DNA vaccine, we also analyzed the changes of specific serum antibody and non-specific parameters in vaccinated fish. We found a powerful and long-lasting immune response in the vaccinated fish. Although antibody titers do not completely correlate with protection and can
5. Conclusion In summary, our results showed that functionalized SWCNT loaded with a KHV ORF149 gene expression vector conferred long and significant protection to koi fish against a KHV challenge. The best treatment inducing the highest immune protection is 10 μg SWCNTs-p149 by intramuscular injection. This study presents key findings that demonstrate the efficacy and commercial potential for this DNA vaccine. 6
Fish and Shellfish Immunology xxx (xxxx) xxx–xxx
F. Hu, et al.
Fig. 6. Immune related enzymes activity assay. Changes of immune parameters post-immunization by intra-muscular vaccination: (A) ACP; (B) AKP; (C) SOD and (D) LZM. Data are represented as mean ± SD. a–h: within a column, different letters indicate significant differences (p < 0.05). Three replicates were set for the tests, with three fish per replicate.
7
Fish and Shellfish Immunology xxx (xxxx) xxx–xxx
F. Hu, et al.
Table 2 Corresponding RPS values of vaccinated and control fish. Cumulative percentage mortality (%) and calculated RPS values following challenge with KHV in experimental groups of DNA vaccinated fish by intramuscular injection. Fish injected with
Cumulative mortality(15d)
RPS(15d)
PBS pcDNA Inactivated virus vaccine p149 1 μg p149 5 μg p149 10 μg SWCNTs-p149 1 μg SWCNTs-p149 5 μg SWCNTs-p149 10 μg
100% 100% 41% 85% 72% 52% 38.9% 27.7% 18.1%
0 0 59% 15% 28% 48% 61.1% 72.3% 81.9%
[9]
[10]
[11]
[12]
[13]
[14]
[15]
[16]
[17]
[18]
Fig. 7. Cumulative mortalities of vaccinated fish. Carps were vaccinated with p149, SWCNTs-p149, inactivated virus vaccine, pcDNA, or PBS and challenged with KHV. The accumulated mortalities were calculated at the end of the monitored period.
[19]
[20]
Acknowledgements This work was supported by the Natural Science Foundation of Guangdong Province (2018A0303130029), Guangdong Provincial Special Fund For Modern Agriculture Industry Technology Innovation Teams (2019KJ150), Central Public-interest Scientific Institution Basal Research Fund, CAFS(2019ZX-002)and the China Agricultural Research System (Grant number CARS-45).
[21]
[22]
[23]
References [24] [1] Food, Agriculture Organization, The State of World Fisheries and Aquaculture 2018, (2018), p. 210. [2] D. Carbone, C. Faggio, Importance of prebiotics in aquaculture as immunostimulants. Effects on immune system of Sparus aurata and Dicentrarchus labrax, Fish Shellfish Immunol. 54 (2016) 172–178, https://doi.org/10.1016/j.fsi. 2016.04.011. [3] M. Abdel-Tawwab, F.E. Abbass, Turmeric powder, Curcuma longa L., in common carp, Cyprinus carpio L., diets: growth performance, innate immunity, and challenge against pathogenic aeromonas hydrophila infection, J. World Aquac. Soc. 48 (2) (2017) 303–312, https://doi.org/10.1111/jwas.12349. [4] E. Awad, A. Awaad, Role of medicinal plants on growth performance and immune status in fish, Fish Shellfish Immunol. 67 (2017) 40–54, https://doi.org/10.1016/j. fsi.2017.05.034. [5] R. Harikrishnan, C. Balasundaram, M.S. Heo, Effect of Inonotus obliquus enriched diet on hematology, immune response, and disease protection in kelp grouper, Epinephelus bruneus against Vibrio harveyi, Aquaculture 344–349 (2012) 48–53, https://doi.org/10.1016/j.aquaculture.2012.03.010. [6] R.P. Hedrick, O. Gilad, S. Yun, J. V Spangenberg, G.D. Marty, R.W. Nordhausen, M.J. Kebus, H. Bercovier, A. Eldar, A herpesvirus associated with mass mortality of juvenile and adult koi, a strain of common carp, J. Aquat. Anim. Health 12 (1) (2000) 44–57, https://doi.org/10.1577/1548-8667(2000) 012<0044:AHAWMM>2.0.CO;2. [7] M. Boutier, Y. Gao, O. Donohoe, A. Vanderplasschen, Current knowledge and future prospects of vaccines against cyprinid herpesvirus 3 (CyHV-3), Fish Shellfish Immunol. 93 (2019) 531–541, https://doi.org/10.1016/j.fsi.2019.07.079. [8] S. St-Hilaire, N. Beevers, K. Way, R.M. Le Deuff, P. Martin, C. Joiner, Reactivation of
[25]
[26]
[27]
[28]
[29]
[30]
8
koi herpesvirus infections in common carp Cyprinus carpio, Dis. Aquat. Org. 67 (2005) 15–23, https://doi.org/10.3354/dao067015. O. Gilad, S. Yun, M.A. Adkison, K. Way, N.H. Willits, H. Bercovier, R.P. Hedrick, Molecular comparison of isolates of an emerging fish pathogen, koi herpesvirus, and the effect of water temperature on mortality of experimentally infected koi, J. Gen. Virol. 84 (2003) 2661–2668, https://doi.org/10.1099/vir.0.19323-0. S.M. Bergmann, J. Sadowski, M. Kiełpiński, M. Bartłomiejczyk, D. Fichtner, R. Riebe, M. Lenk, J. Kempter, Susceptibility of koi × crucian carp and koi × goldfish hybrids to koi herpesvirus (KHV) and the development of KHV disease (KHVD), J. Fish Dis. 33 (2010) 267–272, https://doi.org/10.1111/j.1365-2761. 2009.01127.x. R.P. Hedrick, T.B. Waltzek, T.S. McDowell, Susceptibility of koi carp, common carp, goldfish, and goldfish x common carp hybrids to cyprinid herpesvirus-2 and herpesvirus-3, J. Aquat. Anim. Health 18 (2006) 26–34, https://doi.org/10.1577/H05028.1. J. Kempter, M. Kidpinski, R. Paniez, J. Sadowski, B. Mysiłowski, S.M. Bergmann, Horizontaltransmission of koi herpes virus (KHV) from potential vector species to common carpHorizontal transmission of koi herpes virus (KHV) from potential vector species to common carp, Bull. Eur. Assoc. Fish Pathol. 32 (2012) 212–219. V. Radosavljević, S. Jeremić, M. Ćirković, B. Lako, V. Milićević, A. Potkonjak, V. Nikolin, Common fish species in polyculture with carp as cyprinid herpes virus 3 carriers, Acta Vet. 62 (2012) 675–681, https://doi.org/10.2298/AVB1206675R. A. Perelberg, M. Smirnov, M. Hutoran, A. Diamant, Y. Bererano, M. Kotler, Epidemiological description of a new viral disease afflicting cultured Cyprinus carpio in Israel, Isr. J. Aquacult. Bamidgeh 55 (2003) 5–12. P. Jha, S. Barat, The effect of stocking density on growth, survival rate, and number of marketable fish produced of koi carps, Cyprinus carpio vr. koi, in concrete tanks, J. Appl. Aquac. 17 (2005) 89–102, https://doi.org/10.1300/J028v17n03_07. L. David, S. Rothbard, I. Rubinstein, H. Katzman, G. Hulata, J. Hillel, U. Lavi, Aspects of red and black color inheritance in the Japanese ornamental (Koi) carp (Cyprinus carpio L.), Aquaculture 233 (2004) 129–147, https://doi.org/10.1016/j. aquaculture.2003.10.033. L. Lin, S. Chen, D.S. Russell, C.V. Löhr, R. Milston-Clements, T. Song, T. MillerMorgan, L. Jin, Analysis of stress factors associated with KHV reactivation and pathological effects from KHV reactivation, Virus Res 240 (2017) 200–206, https:// doi.org/10.1016/j.virusres.2017.08.010. O. Gilad, S. Yun, K.B. Andree, M.A. Adkison, A. Zlotkin, H. Bercovier, A. Eldar, R.P. Hedrick, Initial characteristics of koi herpesvirus and development of a polymerase chain reaction assay to detect the virus in koi, Cyprinus carpio koi, Dis. Aquat. Organ 48 (2) (2002) 101–108, https://doi.org/10.3354/dao048101. E. Pikarsky, A. Ronen, J. Abramowitz, B. Levavi-Sivan, M. Hutoran, Y. Shapira, M. Steinitz, A. Perelberg, D. Soffer, M. Kotler, Pathogenesis of Acute Viral Disease Induced in Fish by Carp Interstitial Nephritis and Gill Necrosis Virus, J. Virol 78 (17) (2004) 9544–9551, https://doi.org/10.1128/jvi.78.17.9544-9551.2004. L.-C. Cui, X.-T. Guan, Z.-M. Liu, C.-Y. Tian, Y.-G. Xu, Recombinant lactobacillus expressing G protein of spring viremia of carp virus (SVCV) combined with ORF81 protein of koi herpesvirus (KHV): a promising way to induce protective immunity against SVCV and KHV infection in cyprinid fish via oral vaccination, Vaccine 33 (27) (2015) 3092–3099, https://doi.org/10.1016/J.VACCINE.2015.05.002. A. Perelberg, A. Ronen, M. Hutoran, Y. Smith, M. Kotler, Protection of cultured Cyprinus carpio against a lethal viral disease by an attenuated virus vaccine, Vaccine 23 (2005) 3396–3403, https://doi.org/10.1016/j.vaccine.2005.01.096. Ø. Evensen, J.A.C. Leong, DNA vaccines against viral diseases of farmed fish, Fish Shellfish Immunol. 35 (2013) 1751–1758, https://doi.org/10.1016/j.fsi.2013.10. 021. J.X. Zhou, H. Wang, X.W. Li, X. Zhu, W.L. Lu, D.M. Zhang, Construction of KHV-CJ ORF25 DNA vaccine and immune challenge test, J. Fish Dis. 37 (4) (2014) 319–325, https://doi.org/10.1111/jfd.12105. J. Zhou, J. Xue, Q. Wang, X. Zhu, X. Li, W. Lv, D. Zhang, Vaccination of plasmid DNA encoding ORF81 gene of CJ strains of KHV provides protection to immunized carp, In Vitro Cell. Dev. Biol. Anim. 50 (2014) 489–495, https://doi.org/10.1007/ s11626-014-9737-2. K.A. Garver, C.M. Conway, D.G. Elliott, G. Kurath, Analysis of DNA-vaccinated fish reveals viral antigen in muscle, kidney and thymus, and transient histopathologic changes, Mar. Biotechnol. 7 (2005) 540–553, https://doi.org/10.1007/s10126004-5129-z. A. Bordat, T. Boissenot, J. Nicolas, N. Tsapis, Thermoresponsive polymer nanocarriers for biomedical applications, Adv. Drug Deliv. Rev. 3 (2019) 1215–1242, https://doi.org/10.1016/j.addr.2018.10.005. F. Khan, J.-W. Lee, P. Manivasagan, D.T.N. Pham, J. Oh, Y.-M. Kim, Synthesis and characterization of chitosan oligosaccharide-capped gold nanoparticles as an effective antibiofilm drug against the Pseudomonas aeruginosa PAO1, Microb. Pathog. 135 (2019), https://doi.org/10.1016/j.micpath.2019.103623. J. Yostawonkul, S. Kitiyodom, S. Kaewmalun, K. Suktham, N. Nittayasut, M. Khongkow, K. Namdee, U.R. Ruktanonchai, C. Rodkhum, N. Pirarat, S. Surassmo, T. Yata, Bifunctional clove oil nanoparticles for anesthesia and antibacterial activity in Nile tilapia (Oreochromis niloticus), Aquaculture 503 (2019) 589–595, https://doi.org/10.1016/j.aquaculture.2018.12.058. C. Zhang, Z. Zhao, J.W. Zha, G.X. Wang, B. Zhu, Single-walled carbon nanotubes as delivery vehicles enhance the immunoprotective effect of a DNA vaccine against spring viremia of carp virus in common carp, Fish Shellfish Immunol. 71 (2017) 191–201, https://doi.org/10.1016/j.fsi.2017.10.012. B. Zhu, G.L. Liu, Y.X. Gong, F. Ling, L.S. Song, G.X. Wang, Single-walled carbon nanotubes as candidate recombinant subunit vaccine carrier for immunization of grass carp against grass carp reovirus, Fish Shellfish Immunol. 41 (2014) 279–293, https://doi.org/10.1016/j.fsi.2014.09.014.
Fish and Shellfish Immunology xxx (xxxx) xxx–xxx
F. Hu, et al.
133 (2018) 415–422, https://doi.org/10.1016/j.marpolbul.2018.06.001. [46] J.S. Akhila, Deepa Shyamjith, M.C. Alwar, Acute toxicity studies and determination of median lethal dose, Curr. Sci. 93 (2007) 917–920. [47] T. Schmid, L. Gaede, K. Böttcher, G. Bräuer, D. Fichtner, R. Beckmann, S. Speck, F. Becker, U. Truyen, Efficacy assessment of three inactivated koi herpes virus antigen preparations against experimental challenge virus infection in common carp, J. Fish Dis. 39 (2016) 1007–1013, https://doi.org/10.1111/jfd.12428. [48] M. Boutier, M. Ronsmans, P. Ouyang, G. Fournier, A. Reschner, K. Rakus, G.S. Wilkie, F. Farnir, C. Bayrou, F. Lieffrig, H. Li, D. Desmecht, A.J. Davison, A. Vanderplasschen, Rational development of an attenuated recombinant cyprinid herpesvirus 3 vaccine using prokaryotic mutagenesis and in vivo bioluminescent imaging, PLoS Pathog. 11 (2015), https://doi.org/10.1371/journal.ppat.1004690. [49] W. Fuchs, D. Fichtner, S.M. Bergmann, T.C. Mettenleiter, Generation and characterization of koi herpesvirus recombinants lacking viral enzymes of nucleotide metabolism, Arch. Virol. 156 (2011) 1059–1063, https://doi.org/10.1007/s00705011-0953-8. [50] C.W.E. Embregts, R. Tadmor-Levi, T. Veselý, D. Pokorová, L. David, G.F. Wiegertjes, M. Forlenza, Intra-muscular and oral vaccination using a Koi Herpesvirus ORF25 DNA vaccine does not confer protection in common carp (Cyprinus carpio L.), Fish Shellfish Immunol. 85 (2019) 90–98, https://doi.org/10.1016/j.fsi.2018.03.037. [51] S. Yasumoto, Y. Kuzuya, M. Yasuda, T. Yoshimura, T. Miyazaki, Oral immunization of common carp with a liposome vaccine fusing koi herpesvirus antigen, Fish Pathol. 41 (4) (2006) 141–145, https://doi.org/10.3147/jsfp.41.141. [52] M. Alonso, J.A.C. Leong, Licensed DNA vaccines against infectious hematopoietic necrosis virus (IHNV), Recent Pat. DNA Gene Sequences 7 (2013) 62–65, https:// doi.org/10.2174/1872215611307010009. [53] J.M.S. Lazarte, Y.R. Kim, J.S. Lee, S.P. Im, S.W. Kim, J.W. Jung, J. Kim, W.J. Lee, T.S. Jung, Enhancement of glycoprotein-based DNA vaccine for viral hemorrhagic septicemia virus (VHSV) via addition of the molecular adjuvant, DDX41, Fish Shellfish Immunol. 62 (2017) 356–365, https://doi.org/10.1016/j.fsi.2017.01.031. [54] Z.Y. Chen, X.Y. Lei, Q.Y. Zhang, The antiviral defense mechanisms in Mandarin fish induced by DNA vaccination against a rhabdovirus, Vet. Microbiol. 157 (2012) 264–275, https://doi.org/10.1016/j.vetmic.2011.12.025. [55] R. Hoare, T.P.H. Ngo, K.L. Bartie, A. Adams, Efficacy of a polyvalent immersion vaccine against Flavobacterium psychrophilum and evaluation of immune response to vaccination in rainbow trout fry (Onchorynchus mykiss L.), Vet. Res. 48 (1) (2017), https://doi.org/10.1186/s13567-017-0448-z. [56] N. Navot, E. Kimmel, R.R. Avtalion, Enhancement of antigen uptake and antibody production in goldfish (Carassius auratus) following bath immunization and ultrasound treatment, Vaccine 22 (2004) 2660–2666, https://doi.org/10.1016/j. vaccine.2003.10.043. [57] F. Tang, L. Li, D. Chen, Mesoporous silica nanoparticles: synthesis, biocompatibility and drug delivery, Adv. Mater. 24 (2012) 1504–1534, https://doi.org/10.1002/ adma.201104763. [58] H. Ishikawa, Z. Ma, G.N. Barber, STING regulates intracellular DNA-mediated, type i interferon-dependent innate immunity, Nature 461 (2009) 788–792, https://doi. org/10.1038/nature08476. [59] P. Wang, J. Hou, L. Lin, C. Wang, X. Liu, D. Li, F. Ma, Z. Wang, X. Cao, Inducible microRNA-155 feedback promotes type I IFN signaling in antiviral innate immunity by targeting suppressor of cytokine signaling 1, J. Immunol. 185 (2010) 6226–6233, https://doi.org/10.4049/jimmunol.1000491. [60] J. Tian, B. Sun, Y. Luo, Y. Zhang, P. Nie, Distribution of IgM, IgD and IgZ in Mandarin fish, Siniperca chuatsi lymphoid tissues and their transcriptional changes after Flavobacterium columnare stimulation, Aquaculture 288 (2009) 14–21, https://doi.org/10.1016/j.aquaculture.2008.11.023. [61] J.M. Richner, B.W. Jagger, C. Shan, C.R. Fontes, K.A. Dowd, B. Cao, S. Himansu, E.A. Caine, B.T.D. Nunes, D.B.A. Medeiros, A.E. Muruato, B.M. Foreman, H. Luo, T. Wang, A.D. Barrett, S.C. Weaver, P.F.C. Vasconcelos, S.L. Rossi, G. Ciaramella, I.U. Mysorekar, T.C. Pierson, P.Y. Shi, M.S. Diamond, Vaccine mediated protection against zika virus-induced congenital disease, Cell 170 (2017) 273–283, https:// doi.org/10.1016/j.cell.2017.06.040.
[31] M. Adomako, S. St-Hilaire, Y. Zheng, J. Eley, R.D. Marcum, W. Sealey, B.C. Donahower, S. Lapatra, P.P. Sheridan, Oral DNA vaccination of rainbow trout, Oncorhynchus mykiss (Walbaum), against infectious haematopoietic necrosis virus using PLGA [Poly(D,L-Lactic-Co-Glycolic Acid)] nanoparticles, J. Fish Dis. 35 (3) (2012) 203–214, https://doi.org/10.1111/j.1365-2761.2011.01338.x. [32] A. Rivas-Aravena, Y. Fuentes, J. Cartagena, T. Brito, V. Poggio, J. La Torre, H. Mendoza, F. Gonzalez-Nilo, A.M. Sandino, E. Spencer, Development of a nanoparticle-based oral vaccine for Atlantic salmon against ISAV using an alphavirus replicon as adjuvant, Fish Shellfish Immunol. 45 (2015) 157–166, https://doi.org/ 10.1016/j.fsi.2015.03.033. [33] Y. Wang, G.L. Liu, D.L. Li, F. Ling, B. Zhu, G.X. Wang, The protective immunity against grass carp reovirus in grass carp induced by a DNA vaccination using singlewalled carbon nanotubes as delivery vehicles, Fish Shellfish Immunol. 47 (2015) 732–742, https://doi.org/10.1016/j.fsi.2015.10.029. [34] Z. Zhao, C. Zhang, Y.J. Jia, D.K. Qiu, Q. Lin, N.Q. Li, Z. Bin Huang, X.Z. Fu, G.X. Wang, B. Zhu, Immersion vaccination of Mandarin fish Siniperca chuatsi against infectious spleen and kidney necrosis virus with a SWCNTs-based subunit vaccine, Fish Shellfish Immunol. 92 (2019) 133–140, https://doi.org/10.1016/j.fsi.2019.06. 001. [35] S.J. Monaghan, K.D. Thompson, J.E. Bron, S.M. Bergmann, T.S. Jung, T. Aoki, K.F. Muir, M. Dauber, S. Reiche, D. Chee, S.M. Chong, J. Chen, A. Adams, Expression of immunogenic structural proteins of cyprinid herpesvirus 3 in vitro assessed using immunofluorescence, Vet. Res. 47 (1) (2016), https://doi.org/10. 1186/s13567-015-0297-6. [36] H.J. Kim, S.R. Kwon, N.J. Olesen, K. Yuasa, The susceptibility of silver crucian carp (Carassius auratus langsdorfii) to infection with koi herpesvirus (KHV), J. Fish Dis. 42 (2019) 1333–1340, https://doi.org/10.1111/jfd.13054. [37] K. Yuasa, J. Kurita, M. Kawana, I. Kiryu, N. Ohseko, M. Sano, Development of mRNA-specific RT-PCR for the detection of koi herpesvirus (KHV) replication stage, Dis. Aquat. Org. 100 (1) (2012) 11–18 https://www.int-res.com/abstracts/dao/ v100/n1/p11-18/. [38] E. Lorenzen, K. Einer-Jensen, J.S. Rasmussen, T.E. Kjær, B. Collet, C.J. Secombes, N. Lorenzen, The protective mechanisms induced by a fish rhabdovirus DNA vaccine depend on temperature, Vaccine 27 (2009) 3870–3880, https://doi.org/10. 1016/j.vaccine.2009.04.012. [39] Y. Gao, C. Pei, X. Sun, C. Zhang, L. Li, X. Kong, Plasmid pcDNA3.1-s11 constructed based on the S11 segment of grass carp reovirus as DNA vaccine provides immune protection, Vaccine 36 (2018) 3613–3621, https://doi.org/10.1016/j.vaccine. 2018.05.043. [40] M.H. Jung, C. Nikapitiya, S.J. Jung, DNA vaccine encoding myristoylated membrane protein (MMP) of rock bream iridovirus (RBIV) induces protective immunity in rock bream (Oplegnathus fasciatus), Vaccine 36 (2018) 802–810, https://doi.org/ 10.1016/j.vaccine.2017.12.077. [41] M. Komrakova, C. Knorr, B. Brenig, G. Hoerstgen-Schwark, W. Holtz, Sex discrimination in rainbow trout (Oncorhynchus mykiss) using various sources of DNA and different genetic markers, Aquaculture 497 (2018) 373–379, https://doi.org/ 10.1016/j.aquaculture.2018.08.010. [42] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using realtime quantitative PCR and the 2-$Δ$$Δ$CT method, Methods 25 (2001) 402–408, https://doi.org/10.1006/meth.2001.1262. [43] T. Matsuyama, N. Sano, T. Takano, T. Sakai, M. Yasuike, A. Fujiwara, Y. Kawato, J. Kurita, K. Yoshida, Y. Shimada, C. Nakayasu, Antibody profiling using a recombinant protein–based multiplex ELISA array accelerates recombinant vaccine development: case study on red sea bream iridovirus as a reverse vaccinology model, Vaccine 36 (2018) 2643–2649, https://doi.org/10.1016/j.vaccine.2018.03. 059. [44] H.J. Gye, M.J. Oh, T. Nishizawa, Lack of nervous necrosis virus (NNV) neutralizing antibodies in convalescent sevenband grouper Hyporthodus septemfasciatus after NNV infection, Vaccine 36 (2018) 1863–1870, https://doi.org/10.1016/j.vaccine. 2018.02.063. [45] Y. Li, J. Wang, M. Zheng, Y. Zhang, S. Ru, Development of ELISAs for the detection of vitellogenin in three marine fish from coastal areas of China, Mar. Pollut. Bull.
9
Contents lists available at ScienceDirect
Fish and Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Carbon nanotube-based DNA vaccine against koi herpesvirus given by intramuscular injection Feng Hua,b, Yingying Lia, Qing Wanga,∗, Gaoxue Wangc, Bin Zhuc, Yingying Wanga, Weiwei Zenga, Jiyuan Yina, Chun Liua, Sven M. Bergmannd, Cunbin Shia a
Key Laboratory of Fishery Drug Development of Ministry of Agriculture and Rural Affairs, Key Laboratory of Aquatic Animal Immune Technology of Guangdong Province, Pearl River Fisheries Research Institute, Chinese Academy of Fishery Sciences, Guangzhou, Guangdong, PR China b College of Fisheries and Life Science, Shanghai Ocean University, Shanghai, PR China c College of Animal Science and Technology, Northwest A&F University, Yangling, PR China d German Reference Laboratory for KHVD, Institute of Infectology, Friedrich-Loffler-Institut (FLI), Federal Research Institute for Animal Health, Greifswald–Insel Riems, Germany
A R T I C LE I N FO
A B S T R A C T
Keywords: Koi herpes virus ORF149 Carbon nanotubes Immune response DNA vaccine
Koi herpesvirus (KHV) also named Cyprinid Herpesvirus 3 (CyHV-3) is one of the most threatening pathogens affecting common carp production as well as the valued ornamental koi carp. The current commercial vaccines available are costly and potentially cause severe stress caused by live virus. KHV ORF149 gene has been proved encoding one of the main immunogenic proteins for KHV. In this study, we coupled a plasmid expression vector for ORF149 to single walled carbon nanotubes (SWCNTs) for an anti-KHV vaccine. The vaccine conferred an 81.9% protection against intraperitoneal challenge with KHV. Importantly, SWCNTs as a promising vehicle can enhanced the protective effects 33.9% over that of the naked DNA vaccine at the same dose. The protection was longer and serum antibody production, enzyme activities and immune-related gene expression were all induced in fish vaccinated with the nanotube-DNA vaccine compared with the DNA alone. Thereby, this study demonstrates that the ORF149 DNA vaccine loaded onto SWCNTs as a novel vaccine might provide an effective method of coping with KHV disease using intra-muscular vaccination.
1. Introduction Aquaculture is a rapidly expanding economic sector worldwide and annual rate increases are estimated at 6.4% [1]. However, aquaculture is an economic activity with a high business risk. In fact, there are many factors that can cause adverse conditions that increase susceptibility to infections of the farmed species and that consequently pose a risk for the global production of aquaculture [2,3]. In particular, intensive rearing practices based on fish cultured in confined and controlled areas such as ponds or off-shore cages at high density all negatively affect the health status of cultured fish. This makes the control of disease outbreaks problematic and difficult [4,5]. Infection with Koi herpesvirus (KHV) [6] are a listed notifiable disease to the International Office of Epizootics (OIE, 2018). KHV has spread to most regions around the world due to the global fish trade and international ornamental koi shows [7]. First detected in the late 1990s, KHV has been found in Europe, Asia, North America and Africa and had caused serious worldwide losses in the carp and koi culture industries.
∗
As with all herpesviruses, KHV sets up a persistent infection in its host and can exist in a latent or state without obvious clinical signs [8]. Molecular analysis has demonstrated that the KHV isolates show little genomic variation as might be expected for a virus that is being rapidly disseminated by the global movement of infected fish [9]. KHVD is relatively host-specific, while only common carp and its ornamental subspecies, koi [10], are involved in the explosive losses reported globally [6]. In addition to its negative economical and societal impacts, KHV has also a negative environmental impact by affecting wild carp populations. In addition, hybrids of common carp and goldfish are partly susceptible to KHV infection although the mortality rate varies [11]. Cohabitation experiments indicated that some carp species such as goldfish, common bream (Abramis brama), silver carp and grass carp can carry KHV asymptomatically and transmit it to wild carp [12,13]. KHVD is highly contagious and extremely virulent with mortality rates of 80–100%. Carp of all ages can be infected with KHV but younger fish (1–3 months, 2.5–6 g) seem to be more susceptible to infection than mature fish (1 year old, 230 g) [14].
Corresponding author. Pearl River Fisheries Research Institute, Chinese Academy of Fishery Sciences, Guangzhou, Liwan District, 510380, PR China. E-mail address: [email protected] (Q. Wang).
https://doi.org/10.1016/j.fsi.2019.11.035 Received 30 September 2019; Received in revised form 31 October 2019; Accepted 15 November 2019 1050-4648/ © 2019 Elsevier Ltd. All rights reserved.
Please cite this article as: Feng Hu, et al., Fish and Shellfish Immunology, https://doi.org/10.1016/j.fsi.2019.11.035
Fish and Shellfish Immunology xxx (xxxx) xxx–xxx
F. Hu, et al.
The koi subspecies is of economic importance as an ornamental fish in China. Because of its numerous colors and color combinations, the koi has grown into one of the most popular pet hobbies in the world [15]. Within the past few decades, the commercial production of koi has emerged as a major segment of the pet industry and the koi (especially high quality individuals) trade plays a major role in meeting a growing worldwide demand [16]. Intensive koi farming is associated with risk for the incidence and spread of KHVD that cause skin lesions, severe fin erosion, flaking scales, dark skin coloration, especially gill necrosis, one of the most distinct symptom of KHVD [17][18][19], and even increased mortality and resulting in lower prices. Vaccine is widely accepted as an effective control against viral diseases [20]. Up to now, the commercialized KHV vaccine is attenuated vaccine, which has apparent stress response after immunization [21]. The efficacy of KHV inactivated virus vaccine is not satisfied. One of the most promising vaccine preparations against fish diseases is currently the DNA vaccine delivered intramuscularly that consists of plasmid DNA expression vectors that result in gene expression of pathogenic proteins in the muscle tissue of the vaccinated fish [22]. Compared with traditional vaccines, it is highly efficient, easy to prepare and has high stability. DNA vaccines prepared with KHV ORF25 and ORF81 as target genes have been shown to significantly reduce mortality to < 20% indicating that DNA vaccines have favorable immune effects against KHV [23,24]. However, intramuscular injection of naked DNA vaccines generally induce only transient immune protection in fish [25]. The current challenge for DNA vaccines is the discovery of an effective carrier that can result in persistence of the expressed antigen. Carbon nanotubes (CNTs) have been used as DNA carriers for vaccines and possess a large surface area in a small volume that translates to high surface reactivity and easy surface functionalization. Drugs and DNA have both been used as the cargo for CNTs for both diagnostic and therapeutic applications. These complexes can easily penetrate cell membrane and tissue barriers and achieve their biological effects by targeting the drug to the cell at a high dose [26–28]. Whether the CNT have correlation or negative impact to the fish immune-responses has been clarified by other researchers [28–30]. The previous research proved it does not take any negative effect on fish immune-responses and CNT itself could not induce immune protection. Fish nanocarrier vaccines have also been developed such as chitosan nanomaterials loaded with a salmon anemia DNA vaccine that can be used orally. This vaccine significantly improved immune protection [31,32]. Single walled carbon nanotubes (SWCNTs) DNA vaccine against spring viremia of carp virus (SVCV) and grass carp reovirus (GCRV) have proved effective [29,30,33]. Mandarin fish immunized with SWCNT-MCP by immersion vaccination resulted in increased survival against challenge of infectious spleen and kidney necrosis virus (ISKNV) [34]. In the current study we used the KHV ORF 149 gene of 2100 bp with 699 predicted amino acids and theoretical molecular weight of 72 kDa, containing only one potential N-glycosylation and 93 O-glycosylation sites. The envelope glycoprotein encoded by ORF149 is a neutralizing epitope and most likely functions in virus attachment and cell penetration, and is therefore a promising target antigen for vaccine development and diagnostic testing [35]. In present work, on the basis of hydroxyl and amino condensation reactions, functionalized singlewalled CNTs (o-SWCNTs) were used as carriers to load KHV ORF149 in an expression vector. We used this complex to immunize koi via intramuscular injection and evaluated the immune response elicited in vaccinated fish. This work provides a viable solution to KHVD and lays a foundation for future work on a wide range of CNTs-DNA vaccine delivery systems for fish.
2. Materials and methods 2.1. Cell line, virus, and fish The koi snout (KS) cell line and KHV-GZ1301 strain were kept in our lab. Culture conditions and calculation of 50% tissue culture infective doses (TCID50) were performed as previously described [36]. Briefly, cells were grown at 22 °C in Medium 199 (Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (Hyclone, Chicago, IL, USA). Healthy koi (15 ± 5 cm in length) without a history of KHVD were obtained from a commercial koi farm (Zhi Ming Koi. Foshan, China). Possible virus contamination in fish and feed was evaluated by PCR [37] to confirm they were free from KHV. 2.2. Preparation of carbon nanotubes covalent DNA complexes for vaccine Recombinant plasmid pcDNA-ORF149 (p149 in abbreviation) was established and kept in our lab. Single walled carbon nanotubes were kindly provided by Professor Wang Gaoxue of Northwest A&F University, Yangling, China. The SWCNTs-pcDNA-ORF149 (SWCNTsp149 in abbreviation) was prepared according to the method described as Zhu et al. [30]. 2.3. Vaccination Healthy koi (n = 900) were used for immune experiments. The experimental groups were set reference to the previous similar studies [29,30,33]. The fish were randomly divided into nine groups (100 fish per group) and immunized via intramuscular (i.m.) injection with the experimental vaccine p149, SWCNTs-p149 (dissolve in PBS, pH = 7.4) with the negative control (pcDNA vector), and inactivated virus (KHV GZ1301 was inactivated by 70 °C water bath for 18 h) also included as control. All fish were injected in the right dorsal epaxial muscle in front of the dorsal fin after being anaesthetized in 0.01% benzocaine [38]. According to our pre-test results of DNA concentration, the injection dosages were 0.2 mL of 1, 5 and 10 μg DNA linked to the carbon nanotubes (6 groups). Additionally, control groups consisted of injections of 10 μg pcDNA and PBS alone and a final untreated group. Each group (1–9) were maintained in separate tanks as outlined above. 2.4. Detection of injected DNA in fish tissues DNA was extracted from muscle tissues of 3 fish per group as described previously [39,40]. Briefly, muscle tissue samples were taken from at 3, 7, 14 and 28 days after vaccination and tissue samples (0.5–1.0 cm3) were taken from the area of injection. These were combined and pulverized in liquid nitrogen and the frozen powder was dissolved in 3 mL genomic DNA isolation buffer (1.0% sodium dodecyl sulfate, 100 mM NaCl, 50 mM TrisCl, 100 mM EDTA, pH 8.0, 20 μg mL−1 RNase) [39] and incubated for 1 h at 37 °C. Proteinase K (Thermo Fisher, USA) was added to a concentration of 150 mg mL−1 and the samples were incubated at 60 °C overnight. DNA was extracted using conventional phenol-chloroform procedures [41], and then subjected to PCR amplification with ORF149 primers and the s11 gene of the 40S rRNA subunit was used as an internal control (Table 1). 2.5. Detection of gene expression in vaccinated fish To examine the expression of ORF149 in the vaccinated fish, muscle tissues (see above) were taken from 3 fish per group fish at 14 and 28 days post vaccination. Total RNA were isolated from pulverized tissues using Trizol reagent (Invitrogen) and incubated with RNase-free DNase I (Life Technology, Gaithersburg, MD, USA) to eliminate genomic DNA. The RNA was reverse transcribed using random hexamers and M-MLV Reverse Transcriptase (Promega, Madison, WI, USA) using conditions provided by the manufacturer. The expression of plasmid constructs in 2
Fish and Shellfish Immunology xxx (xxxx) xxx–xxx
F. Hu, et al.
Table 1 Primers used in this study. FV primer 5′-3′ Primers used for amplification of KHV ORF149 ORF149 CAGAATTCCTGAGGACCATGCTCCGTC CACGAAAACGAACGAGCTCAC Primers used for detection of KHV Tk GGGTTACCTGTACGAG Sph GACACCACATCTGCAAGGAG Primers used for qRT-PCR Housingkeeping gene 40s CCGTGGGTGACATCGTTACA Cytokines cxca CTGGGATTCCTGACCATTGGT il1β AAGGAGGCCAGTGGCTCTGT CCTGAAGAAGAGGAGGAGGCTGTCA AJ245635 Interferon stimulated genes mx1 ACAATTTGCGGTCTTTGAGA CCCTGCCATTTCTCTTCG LHQP01004675.1 vip2 CTGTCGGACACATCAGC TCAATGGGCAAGACGAAA JX131617.1 Adaptive immune genes IgM CACAAGGCGGGAAATGAAGA Igt1 AAAGTGAAGGATGAAAGTGT
RV primer 3′-5′
Acc. No.
CACCCAGTAGATTATGC GACACATGTTACAATGGTCGC
AB375385.1 AB375381.1
TCAGGACATTGAACCTCACTGTCT
AB012087
GTTGGCTCTCTGTTTCAATGCA
AJ421443
GGAGGCACTATATCAACAGCA TGGTAACAGTGGGCTTATT
AB004105 AB598368
Restriction sites (EcoRI in the FW and XhoI in the RV primer) are underlined.
vaccinated fish was determined using PCR with ORF149 and s11 gene primers (Table 1).
control group was 100 TCID50 KHV. The plate was gently shaken and mixed in a CO2 incubator for 2–4 h followed by 0.1 mL CCB cells at 8 × 105 cells/mL and incubated at 28 °C for 5–7 days. Cytopathic effects (CPE) were observed using light microscopy. All samples were added in triplicate. The reciprocal of the highest dilution of the serum/ virus mixture that lacked CPE was taken as the neutralizing antibody titer.
2.6. Immune-related gene expression Immune-related gene expression used total RNA obtained from spleen tissues at day 28 post vaccination as per above and was were reverse transcribed using Select RT SuperMix plus gDNA wiper (Vazyme, Nanjing, China). Quantitative real-time PCR (qRT-PCR) was performed with an ABI 7500 machine (Applied Biosystems, Foster City, CA, USA) using AceQqPCR SYBR Green Master Mix (Vazyme) with the following procedure: 95 °C for 5 min and 35 cycles at 95 °C for 15 s, 60 °C for 45 s. The s11 gene was used for an internal control (Table 1). All qRT-PCR reactions were performed for three biological replicates and repeated with two independent samples. Relative mRNA expression was calculated using 2-△△Ct method with the formula, F = 2-△△Ct, △△Ct = (Ct,target gene-Ct, reference gene) – (Ct, target gene – Ct, reference gene)control [42].
2.9. Immune related enzymes activity assay Liver and serum samples were tested at day 28 post vaccination. The presence of lysozyme(LZM), superoxide dismutase (SOD), acid phosphatase(ACP) and alkaline phosphatase (AKP) were determined using LZM test kit, SOD Microplate test kit, ACP Microplate test kit and AKP Microplate test kit, respectively using protocols provided by the manufacturer (Jiancheng Bioengineering Institute, Nanjing, China). 2.10. Challenge experiment On day 28 post-vaccination, the fish were challenged by intraperitoneal injection with 300 μL 6.8 × 107 TCID50/mL of KHV and the half lethal dose of this virus preparation was 7.3 × 105 TCID50/mL determined as previously described [46]. Survival was recorded daily for 15 days after viral challenge and dead fish were removed from the tanks. PCR detection of KHV was used to confirm infection as per above (Table 1).
2.7. Measurement of antibody levels by ELISA Titers of antibodies in the serum of 3 fish per tank were measured weekly using Enzyme-Linked Immunosorbent Assay (ELISA) as described elsewhere [43–45]. Briefly, blood was collected from the caudal vein and stored overnight at 4 °C and then centrifuged at 5000×g for 15 min. The supernatant was collected and stored at −20 °C until use. ELISA plates were coated with purified KHV strain GZ1301 at 4 °C overnight. The wells were blocked with 5% skim milk and then washed three times with PBS/0.05% Tween-20. Serum samples were added and the plate was incubated at 37 °C for 1 h, followed by 100 μL of goat antimouse HRP-IgG (Sigma, St. Louis, MO, USA) was added and incubated for 40 min at 37 °C. The plate was washed and 100 μL TMB (Biopanda Diagnostics, Belfast, UK) solution was added to each well and incubated for 15 min at room temperature in the dark. The reaction was stopped with 50 μL of ELISA Stop Buffer (New Cell & Molecular Biotech, China) and the absorbance at 450 nm was measured using an ELISA reader.
2.11. Statistical analysis Data were expressed as mean ± SD and were analyzed using oneway ANOVA. Normality and homogeneity of variance were tested with Levene's test. Data that have homogeneous variance were log transformed to meet the assumptions of ANOVA. Significant differences were determined with Tukey's multiple range tests. All tests were performed using SPSS 18.0 software (IBM, Chicago, IL, USA). P values < 0.05 were as significant.
2.8. Serum neutralization test (SNT)
3. Results
The presence of neutralizing antibody in fish serum samples was examined at 28th day post vaccination. The serum samples were heated at 56 °C for 30 min to inactivate complement and diluted with PBS. KHV was diluted with PBS to 200 TCID50/0.025 mL. Diluted serum samples were added to a 96-well plate followed by a 0.025 mL of diluted virus solution and PBS for the negative control group. The positive
3.1. Persistence of pcDNA-ORF149 in muscle tissues The presence of p149 in muscle tissues was examined at specific times post-vaccination using PCR primers specific for ORF149. We found ORF149 DNA in samples taken 3, 7, 14 and 28 days post-vaccination but not from tissues of the control groups (Fig. 1). In addition, 3
Fish and Shellfish Immunology xxx (xxxx) xxx–xxx
F. Hu, et al.
Fig. 2. PCR detection of ORF149 transcription in vaccinated koi. Total RNA was extracted from koi muscle at 14 (A) and 28 (B) days post intramuscular injection. M, DNA marker; lane 1, PBS group; lane 2, pcDNA (10 μg) group; lane 3, inactivated virus vaccine; lane 4, p149 (1 μg) group; lane 5, p149 (5 μg) group; lane 6, p149 (10 μg) group; lane 7, SWCNTs-p149 (1 μg) group; lane 8, SWCNTs-p149 (5 μg) group; lane 9, SWCNTs-p149 (10 μg) group.
Fig. 1. Detection of vaccine DNA in fish muscle tissue by PCR. DNA was extracted from koi muscle at 3 (A), 7 (B), 14 (C) and 28 (D) days post intramuscular injection. M, DNA marker; lane 1, PBS group; lane 2, pcDNA (10 μg) group; lane 3, inactivated virus vaccine; lane 4, p149 (1 μg) group; lane 5, p149 (5 μg) group; lane 6, p149(10 μg) group; lane 7, SWCNTs-p149 (1 μg) group; lane 8, SWCNTs-p149 (5 μg) group; lane 9, SWCNTs-p149 (10 μg) group.
week 4 post-vaccination and they gradually decreased. However, no significant binding antibody activity was observed in control groups (Fig. 4).
the amplicons generated from the carbon nanotube-plasmid vaccines were much brighter than for the DNA vaccine given without nanotubes linkage. (Fig. 1).
3.5. Neutralization assay Koi immunized with inactivated or DNA vaccine developed detectable neutralizing antibody (Fig. 5). The neutralizing titers of the fish serum from SWCNTs-p149 groups were significantly higher than other experimental groups with maximal at 1:256 dilution. The negative control groups did not display any neutralization antibody activity.
3.2. Transcription of pcDNA-ORF149 gene in vivo A semi-quantitative analysis of ORF149 mRNA levels was performed. Amplicons were obtained from muscle samples taken at the site of injection at 14 and 28 days after immunization with p149 or SWCNTS-p149, the bands generated from the nanotube-coupled vaccine were qualitatively brighter than for the naked DNA vaccine. In addition, there was a dose-dependent increase in PCR amplicon brightness indicating a greater amount of template DNA resulted in greater amounts of mRNA (Fig. 2).
3.6. Immune related enzymes activity assay As shown in Fig. 6, enzyme activity including LZM, ACP, SOD and AKP of serum and liver in different treatment groups were recorded. These immune-related enzymes activity increased in vaccinated groups compared to controls. The enzymes activity in DNA vaccine groups displayed in a dose dependent manner and the level of enzyme activity in SWCNTs-p149 groups significantly higher than p149 which also less than that in inactivated virus vaccine.
3.3. Immune-related genes expression We also examined the expression of a series of immune-related genes in the spleen samples taken from all experimental groups. We found that, both ORF149 vaccines induced the immune-related genes including cxca, Igt1, IgM, Il1β, mx1 and vip2 4 to 25-fold higher. In addition, the relative levels of the mRNAs for these genes in the SWCNTS-p149 vaccine groups were significantly higher than in the inactivated virus and p149 vaccinated groups. Furthermore, these immune-related genes were significantly up-regulated 2.3–5.2-fold in a dose dependent manner and proportional to the DNA content in the vaccine dose (Fig. 3).
3.7. Protection against KHV infection Each experimental fish were challenged with 300 μL live KHV at 6.8 × 107 TCID50 mL−1 to determine whether the DNA vaccines were protective. The vaccine groups (inactivated virus, p149 and SWCNTp149) showed a significant improvement in survival compared with controls. The negative control PBS and pcDNA3.1 treatment groups had mortalities at 2 days after challenge and the cumulative mortalities reached 100% at days 8 and 9 respectively. The first mortality for the p149 vaccinated group (10 μg) was observed at day 7 days after challenge with a cumulative mortality of 52% by day 15. The SWCNT-p149 vaccinated group (10 μg) gave the highest protective efficacy and relative percentage survival (RPS) of 81.9% after 15 days (Table 2 and Fig. 7). Typical clinical symptoms of KHV infection were observed in all diseased fish, and no pathogen other than KHV was detected.
3.4. Detection of antibody The results of ELISA showed that there were significant enhancement of antibody level in fish vaccinated with inactivated virus vaccine, p149 and SWCNTs-p149. Furthermore, the antibody levels in fish injected with SWCNT-p149 was much higher than fish vaccinated with p149 at the same DNA concentration. In addition, using 10 μg SWCNTp149 generated much higher antibody levels than for the fish vaccinated with inactivated virus. Antibody levels reached a peak titer at
4. Discussion Common anti-KHV vaccines, such as inactivated vaccine [47], 4
Fish and Shellfish Immunology xxx (xxxx) xxx–xxx
F. Hu, et al.
Fig. 3. qRT-PCR analysis of the expression of immune-related genes in fish vaccinated with different ORF149 formulations. (A) cxca; (B) Igt1; (C) IgM; (D) il1β; (E) mx1; (F) vip2. Spleen samples were collected from the koi at 28 d post-vaccination. Data are means for three assays and presented as the means ± SD. a–g: within a column, different letters indicate significant differences (p < 0.05).
proteins ORF25 and ORF81 of KHV have been identified the potential as candidates for intra-muscular (i.m.) DNA vaccination of carp against KHV, which induced up to 87.5% survival via three consecutive i.m. injections of 1, 10 or 50 μg of pcDNA encoding the soluble form of the surface glycoproteins ORF25 or ORF81 [23,24]. While this is
attenuated vaccine [48], subunit vaccine [49] and DNA vaccine [50] have been investigated already. Formalin-inactivated KHV vaccine with liposome via oral vaccination can generate the RPS of 74.4% [51]. In contrast to live virus vaccines, subunit or DNA vaccines would provide suitable alternatives owing to their safety profile. The two membrane 5
Fish and Shellfish Immunology xxx (xxxx) xxx–xxx
F. Hu, et al.
Fig. 4. Serum antibody levels in vaccinated koi. Sera were collected from the fish at1-8 weeks post-vaccination, and serum antibodies were determined by ELISA. Data are means for three assays and presented as the means ± SD. a–h: within a column, different letters indicate significant differences (p < 0.05).
vary with vaccine formulation, fish size, and environment [54], the antibody level could reveal the immune effect of vaccine [55,56]. We found an enhancement of specific serum antibody response in vaccinated fish and peaked at week 4 post vaccination. The antibody levels in SWCNTs-coupled DNA vaccine were significantly higher than that in naked DNA vaccinated fish at the same dose and most likely reflects an greater antigen load in the fish. We also observed significant increases of non-specific parameters such as the activities of LZM, SOD, ACP and AKP were observed in vaccined fish. The fish in SWCNT-p149 vaccinated groups aroused higher level of non-specific parameters activities compared with that in naked p149 or inactivated vaccine groups, and no significant difference was observed in control groups. The reason why SWCNT significantly enhanced the immune protective effect of our vaccine is possibly due to increased numbers of cells (migration of head and leukocytes) participated in the process [57], in other words, SWCNTs make our DNA vaccine easier for attachment to specific target tissues and cells. This may also partly explain the improved immune response in fish vaccinated with SWCNT-p149. We further analyzed the expression of immune-related genes in vaccinated fish to verify the immune effects of prepared vaccine. We found significant increases in mRNA levels for cytokines (cxca, il1β), interferon stimulated genes (mx1, vip2) and adaptive immune genes (IgM, Igt1) in vaccinated fish compared with controls. Moreover, fish vaccinated with SWCNT-p149 induced higher levels of immune-related gene expression than fish immunized with naked p149 vaccine alone. The cxca and max1 play significant roles in the initiation and regulation of the inflammatory process and serve as an important component of innate immunity [58,59]. In addition, IgM expression was increased significantly in vaccinated fish spleens. IgM is a major component of the humoral immune system of teleost fish. IgM expression increases in many tissues and organs from the second week after immunization and maintained for one month [60] which corresponds with the result of antibody production in our study. Therefore, the change of cytokines, interferon stimulated genes and adaptive immune-related response was a consequence of DNA vaccine. Once vaccine was transported into fish immune-related organs, tissues and cells, the biological function of vaccine could be carried out [61]. This might be one of the reasons why SWCNTs can enhance immune protection via intramuscular injection. However, the underlying mechanism of protection needs further investigation.
Fig. 5. Neutralization assay . KHV-neutralization titer of serum collected from the koi at 28th day after vaccination.
promising, fewer doseage or convenient vaccination routes would be preferred from a practical point of view. The only commercially available live attenuated vaccine for KHV is not resgistered for use in China. Live vaccines have inherent safety issues and subunit or DNA vaccines are preferred. Compared with traditional vaccines, DNA vaccines have been widely used for aquatic animal diseases because of easy preparation, stability and high efficiency. DNA vaccines are commercially available due to their good immunoprotective effects. A DNA vaccine against infectious haematopoietic necrosis (IHN) is licensed in Canada for use in Atlantic salmon [52]. In koi vaccination with the SVCV G gene resulted in an 88% survival against challenge with live virus [46]. Enhanced survival of olive flounder against viral hemorrhagic septicemia virus (VHSV) challenge was observed using a DNA vaccine plasmids co-expressing VHSV G and DDX41, a protein in the DEXD/H-box family [53]. In the current study, koi was immunized by the prepared koi herpes virus DNA vaccine coupled with single-walled carbon nanotubesvia intramuscular injection. After the challenge test, the results showed that the relative percentage survival (RPS) of the control group (PBS, pcDNA) was 0 although the p149 and the inactivated virus vaccine group gave some protection.The survival of fish vaccinated with SWCNT-p149 (10 μg) gave a 81.9% RPS indicating significant immune protection of koi against KHV. To further examine the immune response induced by our DNA vaccine, we also analyzed the changes of specific serum antibody and non-specific parameters in vaccinated fish. We found a powerful and long-lasting immune response in the vaccinated fish. Although antibody titers do not completely correlate with protection and can
5. Conclusion In summary, our results showed that functionalized SWCNT loaded with a KHV ORF149 gene expression vector conferred long and significant protection to koi fish against a KHV challenge. The best treatment inducing the highest immune protection is 10 μg SWCNTs-p149 by intramuscular injection. This study presents key findings that demonstrate the efficacy and commercial potential for this DNA vaccine. 6
Fish and Shellfish Immunology xxx (xxxx) xxx–xxx
F. Hu, et al.
Fig. 6. Immune related enzymes activity assay. Changes of immune parameters post-immunization by intra-muscular vaccination: (A) ACP; (B) AKP; (C) SOD and (D) LZM. Data are represented as mean ± SD. a–h: within a column, different letters indicate significant differences (p < 0.05). Three replicates were set for the tests, with three fish per replicate.
7
Fish and Shellfish Immunology xxx (xxxx) xxx–xxx
F. Hu, et al.
Table 2 Corresponding RPS values of vaccinated and control fish. Cumulative percentage mortality (%) and calculated RPS values following challenge with KHV in experimental groups of DNA vaccinated fish by intramuscular injection. Fish injected with
Cumulative mortality(15d)
RPS(15d)
PBS pcDNA Inactivated virus vaccine p149 1 μg p149 5 μg p149 10 μg SWCNTs-p149 1 μg SWCNTs-p149 5 μg SWCNTs-p149 10 μg
100% 100% 41% 85% 72% 52% 38.9% 27.7% 18.1%
0 0 59% 15% 28% 48% 61.1% 72.3% 81.9%
[9]
[10]
[11]
[12]
[13]
[14]
[15]
[16]
[17]
[18]
Fig. 7. Cumulative mortalities of vaccinated fish. Carps were vaccinated with p149, SWCNTs-p149, inactivated virus vaccine, pcDNA, or PBS and challenged with KHV. The accumulated mortalities were calculated at the end of the monitored period.
[19]
[20]
Acknowledgements This work was supported by the Natural Science Foundation of Guangdong Province (2018A0303130029), Guangdong Provincial Special Fund For Modern Agriculture Industry Technology Innovation Teams (2019KJ150), Central Public-interest Scientific Institution Basal Research Fund, CAFS(2019ZX-002)and the China Agricultural Research System (Grant number CARS-45).
[21]
[22]
[23]
References [24] [1] Food, Agriculture Organization, The State of World Fisheries and Aquaculture 2018, (2018), p. 210. [2] D. Carbone, C. Faggio, Importance of prebiotics in aquaculture as immunostimulants. Effects on immune system of Sparus aurata and Dicentrarchus labrax, Fish Shellfish Immunol. 54 (2016) 172–178, https://doi.org/10.1016/j.fsi. 2016.04.011. [3] M. Abdel-Tawwab, F.E. Abbass, Turmeric powder, Curcuma longa L., in common carp, Cyprinus carpio L., diets: growth performance, innate immunity, and challenge against pathogenic aeromonas hydrophila infection, J. World Aquac. Soc. 48 (2) (2017) 303–312, https://doi.org/10.1111/jwas.12349. [4] E. Awad, A. Awaad, Role of medicinal plants on growth performance and immune status in fish, Fish Shellfish Immunol. 67 (2017) 40–54, https://doi.org/10.1016/j. fsi.2017.05.034. [5] R. Harikrishnan, C. Balasundaram, M.S. Heo, Effect of Inonotus obliquus enriched diet on hematology, immune response, and disease protection in kelp grouper, Epinephelus bruneus against Vibrio harveyi, Aquaculture 344–349 (2012) 48–53, https://doi.org/10.1016/j.aquaculture.2012.03.010. [6] R.P. Hedrick, O. Gilad, S. Yun, J. V Spangenberg, G.D. Marty, R.W. Nordhausen, M.J. Kebus, H. Bercovier, A. Eldar, A herpesvirus associated with mass mortality of juvenile and adult koi, a strain of common carp, J. Aquat. Anim. Health 12 (1) (2000) 44–57, https://doi.org/10.1577/1548-8667(2000) 012<0044:AHAWMM>2.0.CO;2. [7] M. Boutier, Y. Gao, O. Donohoe, A. Vanderplasschen, Current knowledge and future prospects of vaccines against cyprinid herpesvirus 3 (CyHV-3), Fish Shellfish Immunol. 93 (2019) 531–541, https://doi.org/10.1016/j.fsi.2019.07.079. [8] S. St-Hilaire, N. Beevers, K. Way, R.M. Le Deuff, P. Martin, C. Joiner, Reactivation of
[25]
[26]
[27]
[28]
[29]
[30]
8
koi herpesvirus infections in common carp Cyprinus carpio, Dis. Aquat. Org. 67 (2005) 15–23, https://doi.org/10.3354/dao067015. O. Gilad, S. Yun, M.A. Adkison, K. Way, N.H. Willits, H. Bercovier, R.P. Hedrick, Molecular comparison of isolates of an emerging fish pathogen, koi herpesvirus, and the effect of water temperature on mortality of experimentally infected koi, J. Gen. Virol. 84 (2003) 2661–2668, https://doi.org/10.1099/vir.0.19323-0. S.M. Bergmann, J. Sadowski, M. Kiełpiński, M. Bartłomiejczyk, D. Fichtner, R. Riebe, M. Lenk, J. Kempter, Susceptibility of koi × crucian carp and koi × goldfish hybrids to koi herpesvirus (KHV) and the development of KHV disease (KHVD), J. Fish Dis. 33 (2010) 267–272, https://doi.org/10.1111/j.1365-2761. 2009.01127.x. R.P. Hedrick, T.B. Waltzek, T.S. McDowell, Susceptibility of koi carp, common carp, goldfish, and goldfish x common carp hybrids to cyprinid herpesvirus-2 and herpesvirus-3, J. Aquat. Anim. Health 18 (2006) 26–34, https://doi.org/10.1577/H05028.1. J. Kempter, M. Kidpinski, R. Paniez, J. Sadowski, B. Mysiłowski, S.M. Bergmann, Horizontaltransmission of koi herpes virus (KHV) from potential vector species to common carpHorizontal transmission of koi herpes virus (KHV) from potential vector species to common carp, Bull. Eur. Assoc. Fish Pathol. 32 (2012) 212–219. V. Radosavljević, S. Jeremić, M. Ćirković, B. Lako, V. Milićević, A. Potkonjak, V. Nikolin, Common fish species in polyculture with carp as cyprinid herpes virus 3 carriers, Acta Vet. 62 (2012) 675–681, https://doi.org/10.2298/AVB1206675R. A. Perelberg, M. Smirnov, M. Hutoran, A. Diamant, Y. Bererano, M. Kotler, Epidemiological description of a new viral disease afflicting cultured Cyprinus carpio in Israel, Isr. J. Aquacult. Bamidgeh 55 (2003) 5–12. P. Jha, S. Barat, The effect of stocking density on growth, survival rate, and number of marketable fish produced of koi carps, Cyprinus carpio vr. koi, in concrete tanks, J. Appl. Aquac. 17 (2005) 89–102, https://doi.org/10.1300/J028v17n03_07. L. David, S. Rothbard, I. Rubinstein, H. Katzman, G. Hulata, J. Hillel, U. Lavi, Aspects of red and black color inheritance in the Japanese ornamental (Koi) carp (Cyprinus carpio L.), Aquaculture 233 (2004) 129–147, https://doi.org/10.1016/j. aquaculture.2003.10.033. L. Lin, S. Chen, D.S. Russell, C.V. Löhr, R. Milston-Clements, T. Song, T. MillerMorgan, L. Jin, Analysis of stress factors associated with KHV reactivation and pathological effects from KHV reactivation, Virus Res 240 (2017) 200–206, https:// doi.org/10.1016/j.virusres.2017.08.010. O. Gilad, S. Yun, K.B. Andree, M.A. Adkison, A. Zlotkin, H. Bercovier, A. Eldar, R.P. Hedrick, Initial characteristics of koi herpesvirus and development of a polymerase chain reaction assay to detect the virus in koi, Cyprinus carpio koi, Dis. Aquat. Organ 48 (2) (2002) 101–108, https://doi.org/10.3354/dao048101. E. Pikarsky, A. Ronen, J. Abramowitz, B. Levavi-Sivan, M. Hutoran, Y. Shapira, M. Steinitz, A. Perelberg, D. Soffer, M. Kotler, Pathogenesis of Acute Viral Disease Induced in Fish by Carp Interstitial Nephritis and Gill Necrosis Virus, J. Virol 78 (17) (2004) 9544–9551, https://doi.org/10.1128/jvi.78.17.9544-9551.2004. L.-C. Cui, X.-T. Guan, Z.-M. Liu, C.-Y. Tian, Y.-G. Xu, Recombinant lactobacillus expressing G protein of spring viremia of carp virus (SVCV) combined with ORF81 protein of koi herpesvirus (KHV): a promising way to induce protective immunity against SVCV and KHV infection in cyprinid fish via oral vaccination, Vaccine 33 (27) (2015) 3092–3099, https://doi.org/10.1016/J.VACCINE.2015.05.002. A. Perelberg, A. Ronen, M. Hutoran, Y. Smith, M. Kotler, Protection of cultured Cyprinus carpio against a lethal viral disease by an attenuated virus vaccine, Vaccine 23 (2005) 3396–3403, https://doi.org/10.1016/j.vaccine.2005.01.096. Ø. Evensen, J.A.C. Leong, DNA vaccines against viral diseases of farmed fish, Fish Shellfish Immunol. 35 (2013) 1751–1758, https://doi.org/10.1016/j.fsi.2013.10. 021. J.X. Zhou, H. Wang, X.W. Li, X. Zhu, W.L. Lu, D.M. Zhang, Construction of KHV-CJ ORF25 DNA vaccine and immune challenge test, J. Fish Dis. 37 (4) (2014) 319–325, https://doi.org/10.1111/jfd.12105. J. Zhou, J. Xue, Q. Wang, X. Zhu, X. Li, W. Lv, D. Zhang, Vaccination of plasmid DNA encoding ORF81 gene of CJ strains of KHV provides protection to immunized carp, In Vitro Cell. Dev. Biol. Anim. 50 (2014) 489–495, https://doi.org/10.1007/ s11626-014-9737-2. K.A. Garver, C.M. Conway, D.G. Elliott, G. Kurath, Analysis of DNA-vaccinated fish reveals viral antigen in muscle, kidney and thymus, and transient histopathologic changes, Mar. Biotechnol. 7 (2005) 540–553, https://doi.org/10.1007/s10126004-5129-z. A. Bordat, T. Boissenot, J. Nicolas, N. Tsapis, Thermoresponsive polymer nanocarriers for biomedical applications, Adv. Drug Deliv. Rev. 3 (2019) 1215–1242, https://doi.org/10.1016/j.addr.2018.10.005. F. Khan, J.-W. Lee, P. Manivasagan, D.T.N. Pham, J. Oh, Y.-M. Kim, Synthesis and characterization of chitosan oligosaccharide-capped gold nanoparticles as an effective antibiofilm drug against the Pseudomonas aeruginosa PAO1, Microb. Pathog. 135 (2019), https://doi.org/10.1016/j.micpath.2019.103623. J. Yostawonkul, S. Kitiyodom, S. Kaewmalun, K. Suktham, N. Nittayasut, M. Khongkow, K. Namdee, U.R. Ruktanonchai, C. Rodkhum, N. Pirarat, S. Surassmo, T. Yata, Bifunctional clove oil nanoparticles for anesthesia and antibacterial activity in Nile tilapia (Oreochromis niloticus), Aquaculture 503 (2019) 589–595, https://doi.org/10.1016/j.aquaculture.2018.12.058. C. Zhang, Z. Zhao, J.W. Zha, G.X. Wang, B. Zhu, Single-walled carbon nanotubes as delivery vehicles enhance the immunoprotective effect of a DNA vaccine against spring viremia of carp virus in common carp, Fish Shellfish Immunol. 71 (2017) 191–201, https://doi.org/10.1016/j.fsi.2017.10.012. B. Zhu, G.L. Liu, Y.X. Gong, F. Ling, L.S. Song, G.X. Wang, Single-walled carbon nanotubes as candidate recombinant subunit vaccine carrier for immunization of grass carp against grass carp reovirus, Fish Shellfish Immunol. 41 (2014) 279–293, https://doi.org/10.1016/j.fsi.2014.09.014.
Fish and Shellfish Immunology xxx (xxxx) xxx–xxx
F. Hu, et al.
133 (2018) 415–422, https://doi.org/10.1016/j.marpolbul.2018.06.001. [46] J.S. Akhila, Deepa Shyamjith, M.C. Alwar, Acute toxicity studies and determination of median lethal dose, Curr. Sci. 93 (2007) 917–920. [47] T. Schmid, L. Gaede, K. Böttcher, G. Bräuer, D. Fichtner, R. Beckmann, S. Speck, F. Becker, U. Truyen, Efficacy assessment of three inactivated koi herpes virus antigen preparations against experimental challenge virus infection in common carp, J. Fish Dis. 39 (2016) 1007–1013, https://doi.org/10.1111/jfd.12428. [48] M. Boutier, M. Ronsmans, P. Ouyang, G. Fournier, A. Reschner, K. Rakus, G.S. Wilkie, F. Farnir, C. Bayrou, F. Lieffrig, H. Li, D. Desmecht, A.J. Davison, A. Vanderplasschen, Rational development of an attenuated recombinant cyprinid herpesvirus 3 vaccine using prokaryotic mutagenesis and in vivo bioluminescent imaging, PLoS Pathog. 11 (2015), https://doi.org/10.1371/journal.ppat.1004690. [49] W. Fuchs, D. Fichtner, S.M. Bergmann, T.C. Mettenleiter, Generation and characterization of koi herpesvirus recombinants lacking viral enzymes of nucleotide metabolism, Arch. Virol. 156 (2011) 1059–1063, https://doi.org/10.1007/s00705011-0953-8. [50] C.W.E. Embregts, R. Tadmor-Levi, T. Veselý, D. Pokorová, L. David, G.F. Wiegertjes, M. Forlenza, Intra-muscular and oral vaccination using a Koi Herpesvirus ORF25 DNA vaccine does not confer protection in common carp (Cyprinus carpio L.), Fish Shellfish Immunol. 85 (2019) 90–98, https://doi.org/10.1016/j.fsi.2018.03.037. [51] S. Yasumoto, Y. Kuzuya, M. Yasuda, T. Yoshimura, T. Miyazaki, Oral immunization of common carp with a liposome vaccine fusing koi herpesvirus antigen, Fish Pathol. 41 (4) (2006) 141–145, https://doi.org/10.3147/jsfp.41.141. [52] M. Alonso, J.A.C. Leong, Licensed DNA vaccines against infectious hematopoietic necrosis virus (IHNV), Recent Pat. DNA Gene Sequences 7 (2013) 62–65, https:// doi.org/10.2174/1872215611307010009. [53] J.M.S. Lazarte, Y.R. Kim, J.S. Lee, S.P. Im, S.W. Kim, J.W. Jung, J. Kim, W.J. Lee, T.S. Jung, Enhancement of glycoprotein-based DNA vaccine for viral hemorrhagic septicemia virus (VHSV) via addition of the molecular adjuvant, DDX41, Fish Shellfish Immunol. 62 (2017) 356–365, https://doi.org/10.1016/j.fsi.2017.01.031. [54] Z.Y. Chen, X.Y. Lei, Q.Y. Zhang, The antiviral defense mechanisms in Mandarin fish induced by DNA vaccination against a rhabdovirus, Vet. Microbiol. 157 (2012) 264–275, https://doi.org/10.1016/j.vetmic.2011.12.025. [55] R. Hoare, T.P.H. Ngo, K.L. Bartie, A. Adams, Efficacy of a polyvalent immersion vaccine against Flavobacterium psychrophilum and evaluation of immune response to vaccination in rainbow trout fry (Onchorynchus mykiss L.), Vet. Res. 48 (1) (2017), https://doi.org/10.1186/s13567-017-0448-z. [56] N. Navot, E. Kimmel, R.R. Avtalion, Enhancement of antigen uptake and antibody production in goldfish (Carassius auratus) following bath immunization and ultrasound treatment, Vaccine 22 (2004) 2660–2666, https://doi.org/10.1016/j. vaccine.2003.10.043. [57] F. Tang, L. Li, D. Chen, Mesoporous silica nanoparticles: synthesis, biocompatibility and drug delivery, Adv. Mater. 24 (2012) 1504–1534, https://doi.org/10.1002/ adma.201104763. [58] H. Ishikawa, Z. Ma, G.N. Barber, STING regulates intracellular DNA-mediated, type i interferon-dependent innate immunity, Nature 461 (2009) 788–792, https://doi. org/10.1038/nature08476. [59] P. Wang, J. Hou, L. Lin, C. Wang, X. Liu, D. Li, F. Ma, Z. Wang, X. Cao, Inducible microRNA-155 feedback promotes type I IFN signaling in antiviral innate immunity by targeting suppressor of cytokine signaling 1, J. Immunol. 185 (2010) 6226–6233, https://doi.org/10.4049/jimmunol.1000491. [60] J. Tian, B. Sun, Y. Luo, Y. Zhang, P. Nie, Distribution of IgM, IgD and IgZ in Mandarin fish, Siniperca chuatsi lymphoid tissues and their transcriptional changes after Flavobacterium columnare stimulation, Aquaculture 288 (2009) 14–21, https://doi.org/10.1016/j.aquaculture.2008.11.023. [61] J.M. Richner, B.W. Jagger, C. Shan, C.R. Fontes, K.A. Dowd, B. Cao, S. Himansu, E.A. Caine, B.T.D. Nunes, D.B.A. Medeiros, A.E. Muruato, B.M. Foreman, H. Luo, T. Wang, A.D. Barrett, S.C. Weaver, P.F.C. Vasconcelos, S.L. Rossi, G. Ciaramella, I.U. Mysorekar, T.C. Pierson, P.Y. Shi, M.S. Diamond, Vaccine mediated protection against zika virus-induced congenital disease, Cell 170 (2017) 273–283, https:// doi.org/10.1016/j.cell.2017.06.040.
[31] M. Adomako, S. St-Hilaire, Y. Zheng, J. Eley, R.D. Marcum, W. Sealey, B.C. Donahower, S. Lapatra, P.P. Sheridan, Oral DNA vaccination of rainbow trout, Oncorhynchus mykiss (Walbaum), against infectious haematopoietic necrosis virus using PLGA [Poly(D,L-Lactic-Co-Glycolic Acid)] nanoparticles, J. Fish Dis. 35 (3) (2012) 203–214, https://doi.org/10.1111/j.1365-2761.2011.01338.x. [32] A. Rivas-Aravena, Y. Fuentes, J. Cartagena, T. Brito, V. Poggio, J. La Torre, H. Mendoza, F. Gonzalez-Nilo, A.M. Sandino, E. Spencer, Development of a nanoparticle-based oral vaccine for Atlantic salmon against ISAV using an alphavirus replicon as adjuvant, Fish Shellfish Immunol. 45 (2015) 157–166, https://doi.org/ 10.1016/j.fsi.2015.03.033. [33] Y. Wang, G.L. Liu, D.L. Li, F. Ling, B. Zhu, G.X. Wang, The protective immunity against grass carp reovirus in grass carp induced by a DNA vaccination using singlewalled carbon nanotubes as delivery vehicles, Fish Shellfish Immunol. 47 (2015) 732–742, https://doi.org/10.1016/j.fsi.2015.10.029. [34] Z. Zhao, C. Zhang, Y.J. Jia, D.K. Qiu, Q. Lin, N.Q. Li, Z. Bin Huang, X.Z. Fu, G.X. Wang, B. Zhu, Immersion vaccination of Mandarin fish Siniperca chuatsi against infectious spleen and kidney necrosis virus with a SWCNTs-based subunit vaccine, Fish Shellfish Immunol. 92 (2019) 133–140, https://doi.org/10.1016/j.fsi.2019.06. 001. [35] S.J. Monaghan, K.D. Thompson, J.E. Bron, S.M. Bergmann, T.S. Jung, T. Aoki, K.F. Muir, M. Dauber, S. Reiche, D. Chee, S.M. Chong, J. Chen, A. Adams, Expression of immunogenic structural proteins of cyprinid herpesvirus 3 in vitro assessed using immunofluorescence, Vet. Res. 47 (1) (2016), https://doi.org/10. 1186/s13567-015-0297-6. [36] H.J. Kim, S.R. Kwon, N.J. Olesen, K. Yuasa, The susceptibility of silver crucian carp (Carassius auratus langsdorfii) to infection with koi herpesvirus (KHV), J. Fish Dis. 42 (2019) 1333–1340, https://doi.org/10.1111/jfd.13054. [37] K. Yuasa, J. Kurita, M. Kawana, I. Kiryu, N. Ohseko, M. Sano, Development of mRNA-specific RT-PCR for the detection of koi herpesvirus (KHV) replication stage, Dis. Aquat. Org. 100 (1) (2012) 11–18 https://www.int-res.com/abstracts/dao/ v100/n1/p11-18/. [38] E. Lorenzen, K. Einer-Jensen, J.S. Rasmussen, T.E. Kjær, B. Collet, C.J. Secombes, N. Lorenzen, The protective mechanisms induced by a fish rhabdovirus DNA vaccine depend on temperature, Vaccine 27 (2009) 3870–3880, https://doi.org/10. 1016/j.vaccine.2009.04.012. [39] Y. Gao, C. Pei, X. Sun, C. Zhang, L. Li, X. Kong, Plasmid pcDNA3.1-s11 constructed based on the S11 segment of grass carp reovirus as DNA vaccine provides immune protection, Vaccine 36 (2018) 3613–3621, https://doi.org/10.1016/j.vaccine. 2018.05.043. [40] M.H. Jung, C. Nikapitiya, S.J. Jung, DNA vaccine encoding myristoylated membrane protein (MMP) of rock bream iridovirus (RBIV) induces protective immunity in rock bream (Oplegnathus fasciatus), Vaccine 36 (2018) 802–810, https://doi.org/ 10.1016/j.vaccine.2017.12.077. [41] M. Komrakova, C. Knorr, B. Brenig, G. Hoerstgen-Schwark, W. Holtz, Sex discrimination in rainbow trout (Oncorhynchus mykiss) using various sources of DNA and different genetic markers, Aquaculture 497 (2018) 373–379, https://doi.org/ 10.1016/j.aquaculture.2018.08.010. [42] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using realtime quantitative PCR and the 2-$Δ$$Δ$CT method, Methods 25 (2001) 402–408, https://doi.org/10.1006/meth.2001.1262. [43] T. Matsuyama, N. Sano, T. Takano, T. Sakai, M. Yasuike, A. Fujiwara, Y. Kawato, J. Kurita, K. Yoshida, Y. Shimada, C. Nakayasu, Antibody profiling using a recombinant protein–based multiplex ELISA array accelerates recombinant vaccine development: case study on red sea bream iridovirus as a reverse vaccinology model, Vaccine 36 (2018) 2643–2649, https://doi.org/10.1016/j.vaccine.2018.03. 059. [44] H.J. Gye, M.J. Oh, T. Nishizawa, Lack of nervous necrosis virus (NNV) neutralizing antibodies in convalescent sevenband grouper Hyporthodus septemfasciatus after NNV infection, Vaccine 36 (2018) 1863–1870, https://doi.org/10.1016/j.vaccine. 2018.02.063. [45] Y. Li, J. Wang, M. Zheng, Y. Zhang, S. Ru, Development of ELISAs for the detection of vitellogenin in three marine fish from coastal areas of China, Mar. Pollut. Bull.
9