Carbon source and cell density-dependent regulation of type III secretion system gene expression in Pseudomonas syringae pathovar tomato DC3000

Research in Microbiology 163 (2012) 531e539 www.elsevier.com/locate/resmic

Carbon source and cell density-dependent regulation of type III secretion system gene expression in Pseudomonas syringae pathovar tomato DC3000 Jennifer L. Stauber1, Ekaterina Loginicheva1, Lisa M. Schechter* Department of Biology, University of Missouri-St. Louis, 223 Research Building, 1 University Boulevard, St. Louis, MO 63121, USA Received 26 May 2012; accepted 13 August 2012 Available online 23 August 2012

Abstract Pseudomonas syringae utilizes a type III secretion system (T3SS) encoded by the hrp/hrc genes to translocate virulence proteins called effectors into plant cells. To ensure that the T3SS functions at appropriate times during infection, hrp/hrc and effector gene expression is modulated by environmental conditions and a complex network of transcription factors. The sigma factor HrpL activates hrp/hrc and effector genes, while s54 and enhancer binding proteins HrpR and HrpS regulate hrpL. To better understand how environmental conditions control the T3SS regulatory cascade in P. syringae pathovar tomato strain DC3000, we tested the effects of various growth media and carbon sources on expression of the hrpRS operon, hrpL, and the effector avrPto. Fructose optimally induced hrpRS expression, while most other carbon sources had only mild stimulatory effects. In contrast, hrpL and avrPto were highly induced by several sugars and organic acids, yet expression decreased as cultures reached higher cell densities. This cell density-dependent regulation was not due to alteration of the pH of the medium, although involvement of a quorum sensing signal was also not apparent. Our findings may explain conflicting results from previous studies and additionally indicate that culture conditions should be considered carefully when examining T3SS gene expression. Ó 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved. Keywords: Pseudomonas syringae; Type III secretion; hrpL; hrpR; hrpS; Transcription regulation

1. Introduction Pseudomonas syringae is a Gram-negative bacterial pathogen that causes necrotic water-soaked lesions, often surrounded by chlorotic haloes, on many important agricultural plants. The species is divided into more than 50 subspecific pathovars that have narrower host ranges (Ho¨fte and De Vos, 2006). For example, P. syringae pathovar syringae (Pss) B728a infects beans and Nicotiana benthamiana, whereas P. syringae pathovar tomato (Pst) DC3000 infects tomatoes and Arabidopsis thaliana (Cuppels, 1986; Loper and Lindow, 1987; Whalen et al., 1991; Vinatzer et al., 2006). P. syringae causes disease in susceptible hosts by multiplying in the space between plant cells, or the apoplast, within * Corresponding author. E-mail addresses: [email protected] (J.L. Stauber), elfz9@mail. umsl.edu (E. Loginicheva), [email protected] (L.M. Schechter). 1 These authors contributed equally to this work.

the leaf interior. Bacteria in the apoplast produce elicitors of plant defenses called microbe-associated molecular patterns (MAMPs). To counteract plant defenses, P. syringae secretes Avr and Hop proteins. These proteins, collectively called effectors, suppress activation of mitogen-activated protein kinase (MAPK) signaling cascades, defense-related gene expression, callose deposition in the plant cell wall and other plant defenses (Gohre and Robatzek, 2008). Effectors are injected into plant cells by a multicomponent protein export machine, or type III secretion system (T3SS), encoded by the hrp/hrc gene cluster. In order to deploy effectors at appropriate times during infection, P. syringae expresses hrp/hrc and avr/hop genes in response to specific environmental conditions (Tang et al., 2006). T3SS genes are induced when bacteria are in plant tissue or media thought to mimic conditions in the apoplast (Huynh et al., 1989; Ortiz-Martı´n et al., 2010a; Rahme et al., 1992; Rico and Preston, 2008; Thwaites et al., 2004; Xiao et al., 1992). In culture, T3SS gene expression is stimulated

0923-2508/$ - see front matter Ó 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved. http://dx.doi.org/10.1016/j.resmic.2012.08.005

532

J.L. Stauber et al. / Research in Microbiology 163 (2012) 531e539

at low osmolarity (below 50 mM) and acidic (pH 5.5e6.0) minimal media that contain fructose or other sugars as the carbon source (Huynh et al., 1989; Rahme et al., 1992; Xiao et al., 1992). T3SS gene expression is further induced by supplementing minimal media with iron (Bronstein et al., 2008; Kim et al., 2009, 2010). In contrast, T3SS genes are repressed in high osmolarity or more basic (pH w 8) media that contain complex nitrogen sources or certain organic acids (Huynh et al., 1989; Rahme et al., 1992; Xiao et al., 1992). Several regulatory proteins additionally control the expression of hrp/hrc and avr/hop genes (Fig. 1). HrpL is a sigma factor in the extracytoplasmic function (ECF) family that binds to a consensus sequence known as the hrp box (GGAACC-N16-CCACNNA) in hrp/hrc and avr/hop gene promoters (Ferreira et al., 2006; Fouts et al., 2002; Xiao et al., 1994; Xiao and Hutcheson, 1994). The expression of hrpL is positively controlled by HrpR and HrpS, two members of the bacterial enhancer binding protein (bEBP) family (Hendrickson et al., 2000; Xiao et al., 1994). HrpR and HrpS form heteromeric complexes that bind to the hrpL promoter region and stimulate transcription by s54-RNA polymerase (Hutcheson et al., 2001; Jovanovic et al., 2011). HrpRS complex formation or activity is controlled by at least three other proteins: i) Lon, a protease that degrades HrpR (Bretz et al., 2002); ii) HrpV, a negative regulator that binds to the HrpS protein and prevents HrpRS from activating hrpL (Jovanovic et al., 2011; Ortiz-Martı´n et al., 2010b; Preston et al., 1998; Wei et al., 2005); and iii) HrpG, a chaperonelike protein that acts as an anti-anti-activator by binding to HrpV, preventing its association with HrpS (Jovanovic et al., 2011; Wei et al., 2005). Transcription regulators encoded outside of the hrp/hrc gene cluster, including CorR, GacA, RhpR, PsrA, and AefR, also affect T3SS gene expression (Chatterjee et al., 2003, 2007; Deng et al., 2009; Marutani et al., 2008; Ortiz-Martı´n et al., 2010a; Sreedharan et al.,

2006; Xiao et al., 2007). Except for CorR, which directly activates hrpL (Sreedharan et al., 2006), the mechanisms by which these global regulators affect the T3SS regulatory cascade are undefined. In this study, we sought to better understand how environmental conditions influence expression of the T3SS regulatory cascade in Pst DC3000. Based on previous work, we hypothesized that T3SS genes would be positively regulated by sugars, but repressed by organic acids such as succinate and citrate (Huynh et al., 1989). Instead, our data shows that hrpL and avrPto are highly induced by both sugars and organic acids at low cell densities. However, transcription of these genes decreases as cultures reach higher cell densities. The hrpRS operon was also induced by sugars and citrate, but to a far lesser extent than hrpL and avrPto. 2. Materials and methods 2.1. Bacterial strains, plasmids, and culture conditions Bacterial strains and plasmids used in this study are listed in Table 1. Escherichia coli was grown in Luria-Bertani (LB) medium or LM, whereas P. syringae was cultured in King’s Broth (KB) or LM (Hanahan, 1983; King et al., 1954; Sambrook and Russell, 2001). For GUS assays, bacteria were grown in HoitinkeSinden medium amended with sucrose (HSS) [10 mM sucrose, 18.7 mM NH4Cl, 0.81 mM MgSO4, 30.1 mM KH2PO4, 15.8 mM K2HPO4, 2 mM FeCl3, pH 6.5] or hrp-derepressing minimal (HDM) medium [10 mM fructose, 50 mM potassium phosphate buffer, 7.6 mM (NH4)2SO4, 1.7 mM MgCl2, 1.7 mM NaCl, pH 6] (Huynh et al., 1989; Pen˜aloza-Va´zquez et al., 2000). When indicated, the fructose in HDM was replaced with 10 mM glucose, sucrose, mannitol, citrate or succinate. To prepare conditioned medium, DC3000 was suspended in HDM at an optical density at 600 nm (OD600) of 0.4, the culture was shaken for 16 h and the bacteria were removed by centrifugation and filtration through a 0.22 mM cellulose acetate filter. Because the pH of conditioned HDM was lower than 5.5, we readjusted it to 6.0 with a drop of 1 M K2HPO4. Antibiotics and other additives were used at the following concentrations: ampicillin, 100 mg/ml; kanamycin, 50 mg/ml; rifampicin, 50 mg/ml; bromo-chloroindolyl-galactopyranoside (X-gal), 20 mg/ml; and 5-bromo-4chloro-3-indolyl-beta-D-glucuronic acid (X-gluc), 20 mg/ml. 2.2. Construction and verification of T3SS reporter gene fusions

Fig. 1. A simplified model for T3SS gene expression regulation in P. syringae. Genes are represented by gray block arrows and proteins are shown as ovals. Positive regulation of gene expression or protein activity is represented by black arrows, whereas barred lines indicate negative regulation.

DC3000 chromosomal transcriptional uidA fusions were created by PCR amplification of the regions 1 kb upstream and downstream of the hrpRS, hrpL, or avrPto translation stop sites using the primer pairs listed in Table 2. The PCR products were then digested with relevant restriction enzymes and ligated into pUC18 (Table 1). The resulting plasmids were sequenced at the University of Missouri DNA Core Facility using a 3730 DNA Analyzer (Applied Biosystems). Next, the plasmids were digested with XhoI and ligated to a DNA

J.L. Stauber et al. / Research in Microbiology 163 (2012) 531e539

533

Table 1 Strains and plasmids used in this study. Genotype/description

Antibiotic resistancea

Reference or source

FF80lacZDM15 DlacZYA-argF )U169 deoR recA1 endA1 hsdR17 phoA supE44 thi-1 gyrA96 relA1 l

Nx

Invitrogen

P. syringae pv. tomato DC3000 SCH788 SCH791 SCH794

Wild-type DC3000 hrpRS::uidA DC3000 hrpL::uidA DC3000 avrPto::uidA

Rf Rf Rf Rf

(Cuppels, 1986) This study This study This study

Plasmids pUC18 pJS7 pJS8 pJS9 pCAM140 pK18mobsac pJS3 pJS1 pJS6

Cloning vector pUC18 derivative containing hrpRS::uidA pUC18 derivative containing hrpL::uidA pUC18 derivative containing avrPto::uidA Plasmid containing promoterless uidA gene Allele replacement vector pK18mobsac derivative containing hrpRS::uidA pK18mobsac derivative containing hrpL::uidA pK18mobsac derivative containing avrPto::uidA

Ap Ap Ap Ap Ap, Sp Km Km Km Km

(Norrander et al., 1983) This study This study This study (Wilson et al., 1995) (Schafer et al., 1994) This study This study This study

Strains E. coli DH5a

a

Abbreviations: Nx ¼ nalidixic acid, Rf ¼ rifampicin, Ap ¼ ampicillin, Sp ¼ spectinomycin, and Km ¼ kanamycin.

fragment containing a promoterless uidA gene, which was created by PCR amplification of pCAM140 sequences using P12 and P13 (Tables 1 and 2). Each uidA fusion was then subcloned into the suicide vector pK18mobsac (Table 1) and Table 2 List of primers. Primer

Sequence (50 e 30 )a

Purpose

P8

GGGAATTCGACGCGGTGCTTC AGGAG AAAAACTCGAGTCAGATCTGCA ATTCTTTGATGCGTC TGCAGATCTGACTCGAGTTTTTT GCAAAGACGCTGG CATCTAGAGCCGCCGTCCCGA GTAG GCCTCGAGGAGTCCCTTATGTTA CGTC CGCTCGAGGGTACCAGGAGAG TTGTTGATTC GTGAATTCCAGCCCGGTGTCC TGATCG TCGAGATCTCGAGTCAGGCGA ACGGGTCGAT TCGCCTGACTCGAGATCTCGA TCATTTTTTCTGG GCTCTAGATGCCCGCTTCGTC TACCTG CCGAATTCCAGAGTCACACCA GGACAGTC ACACACGGCTCGAGATCATTG CCAGTTACGG GCAATGATCTCGAGCCGTGT GTGGCGTCA GGGATATCAGCCTGGCCTT GAGTCTTGG

Cloning hrpRS region

P9 P10 P11 P12 P13 P14 P15 P16 P17 P18 P19 P20 P21 a

Cloning hrpRS region Cloning hrpRS region Cloning hrpRS region Cloning uidA Cloning uidA

allele replacement was performed as previously described (Kvitko and Collmer, 2011). The DC3000 uidA reporter strains were confirmed by performing two PCR reactions spanning each junction of the uidA insertion. The primers hybridized to uidA and chromosomal sequences outside of the DC3000 DNA cloned in pJS1, pJS3, or pJS6, allowing detection of strains containing incorrect insertions or integrated plasmids. Three biological replicates of each reporter fusion strain were constructed and all behaved similarly in GUS assays. We also tested whether the uidA insertions disrupted expression of the hrpRS operon or hrpL by examining the ability of the reporter strains to cause the hypersensitive response (HR) in Nicotiana tabacum cultivar Xanthi leaves. Both reporter strains induced the HR comparable to wild-type DC3000 (data not shown). 2.3. b-glucuronidase (GUS) assays

Cloning hrpL region Cloning hrpL region Cloning hrpL region Cloning hrpL region Cloning avrPto region Cloning avrPto region Cloning avrPto region Cloning avrPto region

Engineered restriction enzyme sites are underlined.

Bacterial strains were inoculated from plates into liquid KB and shaken at 30
C for 1e2 days. Cells were harvested by centrifugation, washed three times with 10 mM MgCl2, resuspended in a w50 ml 10 mM MgCl2 and inoculated into 6 ml culture medium. Specific media and conditions for individual assays are provided in the figure legends. All assay cultures were incubated at 23
C with shaking and samples were collected in 96-well plates after recording the OD600. GUS activity was determined by a fluorometric assay as previously described (Gallagher, 1992). Briefly, frozen samples were lysed in GUS extraction buffer [50 mM NaHPO4 (pH 7.0), 10 mM EDTA (pH 8.0), 0.1% sarcosyl, 0.1% TritonX 100, 10 mM b-mercaptoethanol] and aliquots (8e10 ml) were transferred to white 96-well plates. Each well was

534

J.L. Stauber et al. / Research in Microbiology 163 (2012) 531e539

supplemented with 50 ml GUS extraction buffer containing 1 mg/ml 4-methylumbelliferyl b-D-glucuronide (MUG), the substrate for b-glucuronidase. Reactions were incubated at 37
C for 10 min and terminated by adding 200 ml 0.2 M Na2CO3. The fluorescent product, 4-methylumbelliferone (MU), was quantified in a VICTOR2 multilabel plate reader (PerkineElmer) and the pmol MU produced in each well was determined by comparison to a standard curve. GUS activity was calculated as (pmol MU)/[(ml culture) (min assay)] and normalized to the CFU/ml in each sample. Therefore, one unit of GUS activity is defined as the pmol MU released per minute. The CFU/ml was determined by comparison to a standard growth curve generated by counting the number of viable cells per ml in HDM, HSS, or KB cultures at several OD600 measurements. 3. Results 3.1. Pst DC3000 T3SS uidA reporters are differentially regulated in diverse growth media To monitor gene expression at multiple levels of the T3SS regulatory cascade, we constructed DC3000 strains containing chromosomal transcriptional reporter gene fusions to hrpS, hrpL, or avrPto. A promoterless version of uidA, which encodes b-glucuronidase, was inserted immediately downstream from the translation stop sites of each gene without disrupting adjacent coding regions. We confirmed that these uidA reporters were regulated in a manner consistent with previously published results by determining GUS activities over time during growth in King’s B (KB), HoitinkeSinden with sucrose (HSS) or hrp-derepressing minimal (HDM) media. The reporter strains were first grown to saturation in KB and washed in 10 mM MgCl2 before suspension in the different media. We found that the hrpL and avrPto genes exhibited similar expression patterns in each medium. GUS activities in the hrpL::uidA and avrPto::uidA reporter strains remained low in KB throughout the experiment (Fig. 2A). Comparable levels of GUS activity were observed when the reporter strains were assayed in 10 mM MgCl2, showing that T3SS genes were not expressed in the wash solution. In contrast, hrpL::uidA and avrPto::uidA were induced in HDM within 6 h postinoculation (hpi). By 22 hpi, hrpL::uidA and avrPto::uidA expression levels were at least 19-fold higher in HDM than in KB. The hrpL::uidA and avrPto::uidA fusions were also induced in HSS, although to a lesser extent. In comparison to the expression levels in KB, HSS induced hrpL::uidA by 3.5fold and avrPto::uidA by 5-fold at 22 hpi (Fig. 2A). These results are in agreement with previous studies on T3SS gene regulation (Huynh et al., 1989; Sreedharan et al., 2006), indicating that the hrpL::uidA and avrPto::uidA reporter strains can be used to accurately measure T3SS gene expression. In contrast to the hrpL::uidA and avrPto::uidA results, hrpRS::uidA expression was not as highly induced in HDM and HSS. In comparison to KB, HDM stimulated hrpRS::uidA

Fig. 2. The effect of the culture medium on Pst DC3000 T3SS gene expression and growth rate. A. Expression of hrpRS::uidA, hrpL::uidA, and avrPto::uidA in DC3000. Reporter strains were inoculated into KB, HSS, HDM or 10 mM MgCl2 at an OD600 w0.05 and samples were collected at 0.5, 4, 6, 22 and 28 h post-inoculation (hpi). Each point on the graph represents the average GUS activity from six samples and error bars represent standard deviations. One unit of GUS activity is defined as the pmol MU released per minute, as described in Materials and methods. Similar results were obtained in two separate assays using independently constructed biological replicates. B. DC3000 avrPto::uidA growth in HDM, HSS, KB, and 10 mM MgCl2. The OD600 of each culture was determined at the same time points listed in part A. Data are graphed on a semi-logarithmic scale.

by approximately 5-fold at 22 hpi, whereas hrpL::gusA was induced by 19-fold (Fig. 2A). In addition, HSS did not stimulate hrpRS in comparison to 10 mM MgCl2 at any time point. Thus, unlike hrpL and avrPto, hrpRS expression was not significantly stimulated by HSS.

J.L. Stauber et al. / Research in Microbiology 163 (2012) 531e539

535

3.2. Sugars differentially affect DC3000 T3SS gene expression Although fructose is the carbon source normally added to HDM, induction of P. syringae T3SS gene expression occurs in media containing other sugars and sugar alcohols, such as sucrose, glucose and mannitol (Huynh et al., 1989; Rahme et al., 1992; Sreedharan et al., 2006; Xiao et al., 1992). We examined how HDM containing these other carbon sources affected hrpRS::uidA, hrpL::uidA, and avrPto::uidA in DC3000. Fructose induced high levels of hrpL::uidA expression that continued to increase over the course of the experiment (Fig. 3A). Glucose and mannitol similarly induced hrpL::uidA expression by 9 hpi, but at 26 hpi, the GUS activities plateaued. Since the GUS enzyme is highly stable (Jefferson et al., 1986, 1987), our results suggest that hrpL::uidA transcription decreased in the presence of glucose and mannitol during the time period between 9 and 26 hpi. Although sucrose induction of hrpL::uidA was delayed, the level of hrpL expression was similar in sucrose, glucose, and mannitol by 26 hpi. We also observed that the expression patterns of avrPto and hrpRS were similar to hrpL in the presence of the various carbon sources (Fig. 3A). Overall, these results indicate that fructose optimally induces DC3000 T3SS expression in comparison to sucrose, glucose and mannitol. More importantly, this experiment shows that the time of induction must be taken into consideration when comparing expression of T3SS genes in different conditions. 3.3. DC3000 T3SS gene expression is induced by organic acids Because tricarboxylic acid (TCA) cycle intermediates repress avrB expression in P. syringae pathovar glycinea (Psg) race 0 (Huynh et al., 1989), we suspected that organic acids would not induce T3SS genes in Pst DC3000. To test this hypothesis, we measured GUS activities in the DC3000 hrpRS::uidA, hrpL::uidA, and avrPto::uidA strains during growth in HDM containing citrate or succinate. For comparison, the reporter strains were also assayed in HDM containing fructose. Similar to the results with sugars, we found that the effect of organic acids on DC3000 hrpL::uidA expression depended upon the time at which bacterial samples were collected. Unexpectedly, we found that citrate and succinate induced hrpL::uidA expression during the first 6e8 h of the experiment (Fig. 4A). However, hrpL::uidA expression levels peaked by 6 hpi in succinate and by 10 hpi in citrate, whereas fructose continued to induce hrpL::uidA throughout the experiment. Thus, fructose still optimally induced hrpL::uidA expression compared to organic acids. Although the expression patterns of avrPto::uidA in organic acids followed the same trends as hrpL::uidA, hrpRS::uidA was differentially affected by citrate and succinate (Fig. 4A). Citrate stimulated hrpRS::uidA expression to an intermediate level, whereas succinate had no inducing effect. These results suggest that succinate influences the T3SS regulatory cascade by a different mechanism than citrate.

Fig. 3. The effect of sugars on Pst DC3000 T3SS gene expression and growth rate. A. Expression of hrpRS::uidA, hrpL::uidA, and avrPto::uidA in DC3000. Reporter strains were inoculated into 10 mM MgCl2 or HDM containing 10 mM fructose, sucrose, glucose or mannitol as the carbon source. Samples were taken at 2.5, 5, 9.5, and 26 hpi. Each point on the graph represents the average GUS activity of four samples, with error bars representing the standard deviation. Similar GUS activities were observed in two independent experiments. B. Growth of DC3000 avrPto::uidA in 10 mM MgCl2 or HDM containing 10 mM fructose, sucrose, glucose, or mannitol. The OD600 of each culture was determined at the same time points listed in part A. Data is graphed on a semi-logarithmic scale.

3.4. DC3000 T3SS gene expression is inversely proportional to the bacterial growth rate While measuring T3SS gene expression in Pst DC3000, we noticed that the bacterial growth rates varied substantially

536

J.L. Stauber et al. / Research in Microbiology 163 (2012) 531e539

intermediate levels in glucose, sucrose, mannitol or citrate, and slowest in fructose. Almost identical growth rates were observed for the DC3000 hrpL::uidA and hrpRS::uidA strains in each carbon source tested (data not shown). Interestingly, the Pst DC3000 growth rate was generally inversely related to the level of hrpL::uidA and avrPto::uidA expression in all of the media examined. For example, DC3000 avrPto::uidA cultures grew quickly in HDM containing succinate, reaching an OD600 of w0.7 by 24 h (Fig. 4B). However, avrPto expression peaked within 6 hpi in succinate and then decreased as the OD600 of the culture surpassed 0.2 (Fig. 4A). In fructose, avrPto expression was induced to the highest level, but the OD600 of the DC3000 avrPto::uidA strain was only w0.1 by 24 h of growth (Fig. 4). In fact, GUS activities in the hrpL::uidA and avrPto::uidA strains plateaued once the OD600 of the culture approached or surpassed w0.2 regardless of the carbon source (Figs. 2e4). The expression of hrpRS::uidA also followed this trend in some cases, but was not apparent in HSS or HDM containing succinate. 3.5. DC3000 T3SS genes are regulated by cell density We suspected that the decreases in T3SS gene expression in certain carbon sources could be due to changes in the culture pH over time. However, we found that the pH of each culture in Figs. 3 and 4 did not change over the course these experiments. Therefore, we tested whether cell density might play a role in controlling hrpL. For this experiment, hrpRS::uidA and hrpL::uidA expression was measured after suspending bacteria at a variety of cell densities in HDM containing fructose, followed by growth for 6 h (Fig. 5). Over this time period, the culture turbidities did not significantly change. Our results showed that even in the optimal medium for T3SS gene

Fig. 4. The effect of organic acids on Pst DC3000 T3SS gene expression and growth rate. A. Expression of hrpRS::uidA, hrpL::uidA, and avrPto::uidA. DC3000 reporter strains were inoculated into HDM containing 10 mM succinate, citrate, or fructose as the carbon source and the pH of each culture was adjusted to 6.0. Samples were collected at 0.5, 2, 5.5, 8, 10, 20 and 23.5 hpi. Each point on the graph represents the average GUS activity of four samples, with error bars representing the standard deviation. Similar GUS activities were observed in two independent experiments. B. Growth of DC3000 avrPto::uidA in HDM containing 10 mM succinate, citrate or fructose. The OD600 of each culture was determined at the same time points listed in part A. Data is graphed on a semi-logarithmic scale.

depending on the medium. HSS supported more robust growth of DC3000 than HDM (Fig. 2B). Carbon sources also had diverse effects on the growth rate of DC3000 in HDM (Figs. 3 and 4B). The avrPto::uidA strain grew fastest in succinate, at

Fig. 5. The effect of cell density on hrpRS and hrpL expression in Pst DC3000. Reporter strains were inoculated into HDM at OD600 readings of 0.05, 0.2, 0.4 or 0.7. Samples were collected at 6 hpi. Each point on the graph represents the average GUS activity of samples taken from three cultures, with error bars representing the standard deviation. Similar results were obtained in an independent experiment.

J.L. Stauber et al. / Research in Microbiology 163 (2012) 531e539

induction, hrpL::uidA expression decreased at higher cell densities. An w11-fold difference in hrpL::uidA expression was observed between higher (OD600 ¼ 0.7) and lower (OD600 ¼ 0.05) cell density DC3000 cultures. In contrast, the difference in hrpRS::uidA expression between high and low cell density cultures was less than 2-fold. Thus, hrpRS transcription was only marginally regulated in response to cell density. Cell-density control of gene expression is commonly mediated by quorum sensing, a process in which bacteria release chemical signals that accumulate extracellularly as the population increases (Waters and Bassler, 2005). To determine whether quorum sensing represses hrpL, hrpL::uidA expression was measured after DC3000 growth in conditioned HDM. This medium was generated by growing DC3000 to a high cell density in HDM and then removing the bacteria by centrifugation and filtration. The conditioned medium and freshly made HDM were inoculated with DC3000 hrpL::uidA and GUS activity was determined at 6 h. The results show that hrpL::uidA expression was only slightly (less than 2-fold) reduced in conditioned medium in comparison to fresh HDM (Fig. 6). Therefore, cell-density dependent repression of hrpL may not be mediated by a classical quorum sensing mechanism. 4. Discussion Although P. syringae T3SS genes are highly induced in planta, they are not expressed during bacterial growth in rich media. The molecular mechanisms underlying this environmental regulation are not well understood. In this study, we examined the effects of different media, carbon sources and cell

Fig. 6. The effect of conditioned medium on hrpL expression. DC3000 hrpL::uidA was inoculated into freshly made or conditioned HDM at OD600 ¼ 0.05. The conditioned medium was prepared by growing DC3000 to a high cell density (OD600 > 0.8) in HDM and then removing the bacteria, as described in Materials and methods. Samples were collected at 6 hpi. Each point on the graph represents the average GUS activity of samples taken from three cultures, with error bars representing the standard deviation. Similar results were obtained in an independent experiment.

537

density on hrpRS, hrpL and avrPto expression in Pst DC3000. The breadth of conditions tested and the techniques employed allowed us to observe T3SS gene expression patterns that were not detected in other pathovars of P. syringae (Huynh et al., 1989; Rahme et al., 1992; Xiao et al., 1992). Prior to this work, little was known about the regulation of hrpRS expression by environmental conditions. We found that hrpRS was induced in HDM, but not HSS or KB (Fig. 2). Other studies in Pst DC3000 and P. syringae pathovar phaseolicola (Psp) 1448a have also shown that hrpR mRNA levels are higher in HDM than in rich media (Thwaites et al., 2004; Xiao et al., 2007). Our results additionally indicate that fructose optimally stimulates hrpRS expression in comparison to glucose, sucrose, mannitol, citrate and succinate (Figs. 3 and 4). In all media tested, hrpRS expression was stimulated to a lesser degree than hrpL or avrPto. This finding suggests that small increases in hrpRS mRNA levels lead to larger changes in the expression of downstream genes in the regulatory cascade. The substantial induction of hrpL by HDM could also be due to coordinate increases in HrpR stability and HrpG binding to HrpV (Bretz et al., 2002; Wei et al., 2005). Regardless of whether a sugar, sugar alcohol or organic acid was the carbon source, hrpL::uidA and avrPto::uidA were similarly induced at early time points after DC3000 inoculation into HDM (Figs. 3 and 4). However, as each culture approached an OD600 of w0.2, GUS activities plateaued. Based on these results, we propose that fructose optimally induces hrpL::uidA and avrPto::uidA due to slow bacterial growth. Carbon sources that promote faster DC3000 growth induce hrpL::uidA and avrPto::uidA for shorter time periods and to lower overall levels. An alternative explanation for the plateau in GUS activity could be that certain carbon sources, such as succinate, stimulate increased proteolysis of GUS at later time points in the experiment. We do not favor this theory because GUS activities in DC3000 hrpL::uidA also decreased in fructose when bacteria were grown for a relatively short time period at higher cell densities (Fig. 5). Previous studies have shown that the effects of specific carbon sources on hrp/hrc gene expression vary depending on the P. syringae pathovar. T3SS genes in Psg race 0 are induced by fructose, sucrose or mannitol, but repressed by succinate or citrate (Huynh et al., 1989). However, T3SS genes in Psp NPS3121 are induced by fructose and citrate, but not succinate or mannitol (Rahme et al., 1992; Tang et al., 2006). Furthermore, succinate induces T3SS gene expression equally as well as fructose in Pss 61 (Xiao et al., 1992). These conflicting findings may indicate that sugars such as fructose uniformly induce T3SS genes in P. syringae, whereas organic acids differentially affect T3SS expression in various pathovars. On the other hand, our results may provide another explanation for some of the contradictory findings. For example, we found that succinate induced hrpL and avrPto expression at 6 hpi when the OD600 of the culture was below 0.2. By 10 hpi, the OD600 of the culture reached 0.4 and hrpL and avrPto expression decreased (Fig. 4). In the studies on other pathovars, bacteria were also initially suspended in minimal medium at low cell densities. However, the effect of succinate

538

J.L. Stauber et al. / Research in Microbiology 163 (2012) 531e539

on T3SS gene expression was examined at only one time point: 6 hpi in Pss 61, 10 hpi in Psp NPS3121, and 12 hpi in Psg race 0 (Huynh et al., 1989; Rahme et al., 1992; Xiao et al., 1992). Accordingly, these studies concluded that succinate induces T3SS genes in Pss 61, but represses T3SS genes in Psp NPS3121 and Psg race 0. Differences in the times of induction and the cell densities of the cultures may have contributed to the disparate conclusions. Overall, our work should serve as a cautionary note to those studying T3SS gene expression in P. syringae. To optimally induce T3SS genes (at least in DC3000), bacteria must be at low cell densities. Because succinate and citrate are tricarboxylic acid (TCA) cycle intermediates and preferred substrates for P. syringae growth, it was suggested that these organic acids repress T3SS genes in Psg race 0 by a catabolite repression mechanism (Huynh et al., 1989). However, we found that both succinate and citrate induced hrpL expression in low-density DC3000 cultures. Therefore, our results do not support the theory that organic acids repress T3SS genes via catabolite repression. Instead, we hypothesize that the differential effects of carbon sources on T3SS genes are due to changes in cell density. In support of this hypothesis, we found that even in HDM containing fructose as the carbon source, hrpL expression was highest when bacteria were at OD600 w0.05 and decreased significantly at higher cell densities (Fig. 5). Interestingly, cell density did not have a considerable affect on hrpRS expression. Therefore, the density-dependent repression of hrpL may be mediated by other factors in the T3SS regulatory cascade, such as HrpV, Lon, or CorR (Fig. 1). Our finding that hrpL is repressed in DC3000 at higher cell densities is unusual, as many bacterial pathogens upregulate virulence gene expression at high population densities (Antunes et al., 2010; Mole et al., 2007). However, cell density-dependent repression of T3SS gene expression has also been observed in Pseudomonas aeruginosa (Shen et al., 2008). Because density-dependent gene regulation is commonly mediated by quorum sensing, we tested whether DC3000 releases an inhibitory chemical signal into the culture medium during growth. Unexpectedly, our results show that medium conditioned by DC3000 has little repressive affect on hrpL expression (Fig. 6). Therefore, hrpL may not be repressed by a classical quorum sensing mechanism, although we cannot rule out the possibility that the signal is unstable or that it was removed during preparation of the conditioned medium. It is also conceivable that growth phase, rather than cell density, controls hrpL expression. For example, DC3000 may enter stationary phase at an OD600 of 0.2 in HDM, which may cause the observed decrease in hrpL expression (Figs. 3 and 4). However, we do not favor this idea, as DC3000 actively grows in HDM to an OD600 above 0.8. We are currently investigating other mechanisms that might mediate density-dependent repression of hrpL. Although our experiments were performed on bacteria grown in culture, cell density-dependent regulation of T3SS gene expression in P. syringae may be critical during plant infection. This idea is supported by a previous study in which T3SS gene mRNA levels were measured during Psp 1448a

infection of beans. T3SS gene transcription was initially highly induced, but mRNA levels drastically decreased by 24 h post-infection when bacterial numbers had increased by 50-fold (Thwaites et al., 2004). Considering that the primary function of P. syringae type III secreted effectors is to disarm plant defense responses, the T3SS is immediately essential for survival of bacteria entering the apoplast. The first bacteria to enter this location may be at low population densities, which would stimulate T3SS gene expression. Once the bacteria suppress plant defenses and multiply to high levels in the apoplast, T3SS genes may be downregulated, allowing P. syringae to conserve energy, produce other virulence factors or focus on acquiring nutrients. Acknowledgments This work was supported by the U.S. National Science Foundation (award MCB-0845837), a Research Board award from the University of Missouri, and start-up funds from the University of Missouri-St. Louis. We are grateful to Mike Nichols for the use of his plate reader and Brian Kvitko for advice on using pK18mobsac. We are also indebted to Catherine Lee and Bethany Zolman for critical comments on the manuscript. References Antunes, L.C.M., Ferreira, R.B.R., Buckner, M.M.C., Finlay, B.B., 2010. Quorum sensing in bacterial virulence. Microbiology 156, 2271e2282. Bretz, J., Losada, L., Lisboa, K., Hutcheson, S.W., 2002. Lon protease functions as a negative regulator of type III protein secretion in Pseudomonas syringae. Mol. Microbiol. 45, 397e409. Bronstein, P., Filiatrault, M., Myers, C., Rutzke, M., Schneider, D., Cartinhour, S., 2008. Global transcriptional responses of Pseudomonas syringae DC3000 to changes in iron bioavailability in vitro. BMC Microbiol. 8, 209. Chatterjee, A., Cui, Y., Yang, H., Collmer, A., Alfano, J.R., Chatterjee, A.K., 2003. GacA, the response regulator of a two-component system, acts as a master regulator in Pseudomonas syringae pv. tomato DC3000 by controlling regulatory RNA, transcriptional activators, and alternate sigma factors. Mol. Plant-Microbe Interact. 16, 1106e1117. Chatterjee, A., Cui, Y., Hasegawa, H., Chatterjee, A.K., 2007. PsrA, the Pseudomonas sigma regulator, controls regulators of epiphytic fitness, quorum-sensing signals, and plant interactions in Pseudomonas syringae pv. tomato strain DC3000. Appl. Environ. Microbiol. 73, 3684e3694. Cuppels, D.A., 1986. Generation and characterization of Tn5 insertion mutations in Pseudomonas syringae pv. tomato. Appl. Environ. Microbiol. 51, 323e327. Deng, X., Xiao, Y., Lan, L., Zhou, J.M., Tang, X., 2009. Pseudomonas syringae pv. phaseolicola mutants compromised for type III secretion system gene induction. Mol. Plant-Microbe Interact. 22, 964e976. Ferreira, A.O., Myers, C.R., Gordon, J.S., Martin, G.B., Vencato, M., Collmer, A., Wehling, M.D., Alfano, J.R., Moreno-Hagelsieb, G., Lamboy, W.F., DeClerck, G., Schneider, D.J., Cartinhour, S.W., 2006. Whole-genome expression profiling defines the HrpL regulon of Pseudomonas syringae pv. tomato DC3000, allows de novo reconstruction of the Hrp cis element, and identifies novel coregulated genes. Mol. PlantMicrobe Interact. 19, 1167e1179. Fouts, D.E., Abramovitch, R.B., Alfano, J.R., Baldo, A.M., Buell, C.R., Cartinhour, S., Chatterjee, A.K., D’Ascenzo, M., Gwinn, M.L., Lazarowitz, S.G., Lin, N.-C., Martin, G.B., Rehm, A.H., Schneider, D.J., van Dijk, K., Tang, X., Collmer, A., 2002. Genomewide identification of

J.L. Stauber et al. / Research in Microbiology 163 (2012) 531e539 Pseudomonas syringae pv. tomato DC3000 promoters controlled by the HrpL alternative sigma factor. Proc. Natl. Acad. Sci. U S A 99, 2275e2280. Gallagher, S.R., 1992. Quantitation of GUS activity by fluorometry. In: Gallagher, S.R. (Ed.), GUS Protocols: Using the GUS Gene as a Reporter of Gene Expression. Academic Press, San Diego, pp. 47e59. Gohre, V., Robatzek, S., 2008. Breaking the barriers: microbial effector molecules subvert plant immunity. Annu. Rev. Phytopathol. 46, 189e215. Hanahan, D., 1983. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166, 557e580. Hendrickson, E.L., Guevera, P., Ausubel, F.M., 2000. The alternative sigma factor RpoN is required for hrp activity in Pseudomonas syringae pv. maculicola and acts at the level of hrpL transcription. J. Bacteriol. 182, 3508e3516. Ho¨fte, M., De Vos, P., 2006. Plant pathogenic Pseudomonas species. In: Gnanamanickam, S.S. (Ed.), Plant-associated Bacteria. Springer Netherlands, Dordrecht, pp. 507e533. Hutcheson, S.W., Bretz, J., Sussan, T., Jin, S., Pak, K., 2001. Enhancer-binding proteins HrpR and HrpS interact to regulate hrp-encoded type III protein secretion in Pseudomonas syringae strains. J. Bacteriol. 183, 5589e5598. Huynh, T.V., Dahlbeck, D., Staskawicz, B.J., 1989. Bacterial blight of soybean: regulation of a pathogen gene determining host cultivar specificity. Science 245, 1374e1377. Jefferson, R.A., Burgess, S.M., Hirsh, D., 1986. Beta-glucuronidase from Escherichia coli as a gene-fusion marker. Proc. Natl. Acad. Sci. U S A 83, 8447e8451. Jefferson, R.A., Kavanagh, T.A., Bevan, M.W., 1987. GUS fusions: b-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO. J. 6, 3901e3907. Jovanovic, M., James, E.H., Burrows, P.C., Rego, F.G.M., Buck, M., Schumacher, J., 2011. Regulation of the co-evolved HrpR and HrpS AAAþ proteins required for Pseudomonas syringae pathogenicity. Nat. Commun. 2, 177. Kim, B.J., Park, J.H., Park, T.H., Bronstein, P.A., Schneider, D.J., Cartinhour, S.W., Shuler, M.L., 2009. Effect of iron concentration on the growth rate of Pseudomonas syringae and the expression of virulence factors in hrp-inducing minimal medium. Appl. Environ. Microbiol. 75, 2720e2726. Kim, B.J., Schneider, D.J., Cartinhour, S.W., Shuler, M.L., 2010. Complex responses to culture conditions in Pseudomonas syringae pv. tomato DC3000 continuous cultures: the role of iron in cell growth and virulence factor induction. Biotechnol. Bioeng. 105, 955e964. King, E.O., Ward, M.K., Raney, D.E., 1954. Two simple media for the demonstration of pyocyanin and fluorescin. J. Lab. Clin. Med. 44, 301e307. Kvitko, B.H., Collmer, A., 2011. Construction of Pseudomonas syringae pv. tomato DC3000 mutant and polymutant strains. In: McDowell, J.M. (Ed.), Methods in Molecular Biology. Humana Press, Totowa, NJ, pp. 109e128. Loper, J.E., Lindow, S.E., 1987. Lack of evidence for in situ fluorescent pigment production by Pseudomonas syringae pv. syringae on bean leaf surfaces. Phytopathology 77, 1449e1454. Marutani, M., Taguchi, F., Ogawa, Y., Hossain, M., Inagaki, Y., Toyoda, K., Shiraishi, T., Ichinose, Y., 2008. Gac two-component system in Pseudomonas syringae pv. tabaci is required for virulence but not for hypersensitive reaction. Mol. Genet. Genomics. 279, 313e322. Mole, B.M., Baltrus, D.A., Dangl, J.L., Grant, S.R., 2007. Global virulence regulation networks in phytopathogenic bacteria. Trends Microbiol. 15, 363e371. Norrander, J., Kempe, T., Messing, J., 1983. Construction of improved M13 vectors using oligodeoxynucleotide-directed mutagenesis. Gene 26, 101e106. Ortiz-Martı´n, I., Thwaites, R., Macho, A.P., Mansfield, J.W., Beuzon, C.R., 2010a. Positive regulation of the Hrp type III secretion system in Pseudomonas syringae pv. phaseolicola. Mol. Plant-Microbe Interact. 23, 665e681. Ortiz-Martı´n, I., Thwaites, R., Mansfield, J.W., Beuzo´n, C.R., 2010b. Negative regulation of the Hrp type III secretion system in Pseudomonas syringae pv. phaseolicola. Mol. Plant-Microbe Interact. 23, 682e701.

539

Pen˜aloza-Va´zquez, A., Preston, G.M., Collmer, A., Bender, C.L., 2000. Regulatory interactions between the Hrp type III protein secretion system and coronatine biosynthesis in Pseudomonas syringae pv. tomato DC3000. Microbiology 146, 2447e2456. Preston, G., Deng, W.-L., Huang, H.-C., Collmer, A., 1998. Negative regulation of hrp genes in Pseudomonas syringae by HrpV. J. Bacteriol. 180, 4532e4537. Rahme, L.G., Mindrinos, M.N., Panopoulos, N.J., 1992. Plant and environmental sensory signals control the expression of hrp genes in Pseudomonas syringae pv. phaseolicola. J. Bacteriol. 174, 3499e3507. Rico, A., Preston, G.M., 2008. Pseudomonas syringae pv. tomato DC3000 uses constitutive and apoplast-induced nutrient assimilation pathways to catabolize nutrients that are abundant in the tomato apoplast. Mol. PlantMicrobe Interact 21, 269e282. Sambrook, J., Russell, D., 2001. Molecular Cloning: a Laboratory Manual, third ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Schafer, A., Tauch, A., Jager, W., Kalinowski, J., Thierbach, G., Puhler, A., 1994. Small mobilizeable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene 145, 69e73. Shen, D.K., Filopon, D., Chaker, H., Boullanger, S., Derouazi, M., Polack, B., Toussaint, B., 2008. High-cell-density regulation of the Pseudomonas aeruginosa type III secretion system: implications for tryptophan catabolites. Microbiology 154, 2195e2208. Sreedharan, A., Penaloza-Vazquez, A., Kunkel, B.N., Bender, C.L., 2006. CorR regulates multiple components of virulence in Pseudomonas syringae pv. tomato DC3000. Mol. Plant-Microbe Interact. 19, 768e779. Tang, X., Xiao, Y., Zhou, J.-M., 2006. Regulation of the type III secretion system in phytopathogenic bacteria. Mol. Plant-Microbe Interact 19, 1159e1166. Thwaites, R., Spanu, P.D., Panopoulos, N.J., Stevens, C., Mansfield, J.W., 2004. Transcriptional regulation of components of the type III secretion system and effectors in Pseudomonas syringae pv. phaseolicola. Mol. Plant-Microbe Interact. 17, 1250e1258. Vinatzer, B.A., Teitzel, G.M., Lee, M.-W., Jelenska, J., Hotton, S., Fairfax, K., Jenrette, J., Greenberg, J.T., 2006. The type III effector repertoire of Pseudomonas syringae pv. syringae B728a and its role in survival and disease on host and non-host plants. Mol. Microbiol. 62, 26e44. Waters, C.M., Bassler, B.L., 2005. Quorum sensing: cell-to-cell communication in bacteria. Annu. Rev. Cell. Dev. Biol. 21, 319e346. Wei, C.F., Deng, W.L., Huang, H.C., 2005. A chaperone-like HrpG protein acts as a suppressor of HrpV in regulation of the Pseudomonas syringae pv. syringae type III secretion system. Mol. Microbiol. 57, 520e536. Whalen, M.C., Innes, R.W., Bent, A.F., Staskawicz, B.J., 1991. Identification of Pseudomonas syringae pathogens of Arabidopsis and a bacterial locus determining avirulence on both Arabidopsis and soybean. Plant Cell 3, 49e59. Wilson, K.J., Sessitsch, A., Corbo, J.C., Giller, K.E., Akkermans, A.D., Jefferson, R.A., 1995. b-glucuronidase (GUS) transposons for ecological and genetic studies of rhizobia and other gram-negative bacteria. Microbiology 141, 1691e1705. Xiao, Y., Lu, Y., Heu, S., Hutcheson, S.W., 1992. Organization and environmental regulation of the Pseudomonas syringae pv. syringae 61 hrp cluster. J. Bacteriol. 174, 1734e1741. Xiao, Y., Heu, S., Yi, J., Lu, Y., Hutcheson, S.W., 1994. Identification of a putative alternate sigma factor and characterization of a multicomponent regulatory cascade controlling the expression of Pseudomonas syringae pv. syringae Pss61 hrp and hrmA genes. J. Bacteriol. 176, 1025e1036. Xiao, Y., Hutcheson, S., 1994. A single promoter sequence recognized by a newly identified alternate sigma factor directs expression of pathogenicity and host range determinants in Pseudomonas syringae. J. Bacteriol. 176, 3089e3091. Xiao, Y., Lan, L., Yin, C., Deng, X., Baker, D., Zhou, J.-M., Tang, X., 2007. Two-component sensor RhpS promotes induction of Pseudomonas syringae type III secretion system by repressing negative regulator RhpR. Mol. Plant-Microbe Interact 20, 223e234.