- Email: [email protected]
Carboxypeptidase A4 promotes cell growth via activating STAT3 and ERK signaling pathways and predicts a poor prognosis in colorectal cancer
International Journal of Biological Macromolecules 138 (2019) 125–134
Contents lists available at ScienceDirect
International Journal of Biological Macromolecules journal homepage: http://www.elsevier.com/locate/ijbiomac
Carboxypeptidase A4 promotes cell growth via activating STAT3 and ERK signaling pathways and predicts a poor prognosis in colorectal cancer Hongda Pan a,b,c,d,⁎,1, Jingxin Pan b,1, Lei Ji c, Shibo Song d, Hong Lv c, Zhangru Yang c, Yibin Guo e,⁎ a
Department of Gastric Surgery, Fudan University Shanghai Cancer Center, 200032 Shanghai, China The Second Affiliated Hospital of Fujian Medical University, 362000 Quanzhou, China Department of Oncology, Shanghai Medical College, Fudan University, 200032 Shanghai, China d Department of Gastrointestinal Surgery, Beijing Hospital, 100730 Beijing, China e Department of Medical Genetics, Zhongshan School of Medicine, Sun Yat-sen University, 510080 Guangzhou, China b c
a r t i c l e
i n f o
Article history: Received 16 March 2019 Received in revised form 24 May 2019 Accepted 3 July 2019 Available online 04 July 2019 Keywords: Carboxypeptidase A4 Colorectal cancer STAT3 signaling pathway
a b s t r a c t Carboxypeptidase A4 (CPA4) is a novel cancer-related gene that is aberrantly expressed in various malignant tumors. However, the roles and mechanisms of CPA4 have not been explored in colorectal cancer (CRC). In this study, we investigated the functions and mechanisms by which CPA4 promotes CRC progression. Quantitative real-time PCR (qRT-PCR) and western blot showed that CPA4 mRNA and CPA4 protein levels were up-regulated in CRC compared to levels in adjacent normal tissue. Immunohistochemistry (IHC) results indicating high CPA4 levels were positively associated with poor prognoses. In addition, Cell Counting Kit-8 (CCK-8), colony formation, flow cytometry, and transwell assays demonstrated that CPA4 overexpression facilitated the growth of CRC cells, whereas CPA4 knockdown resulted in decreased proliferation, G1/S phase transition arrest, and apoptosis. Subcutaneous tumorigenesis was performed in nude mice to confirm the tumor-promoting effects of CPA4 in vivo. Western blot revealed that activation of the STAT3 and ERK pathways is one of the oncogenic functions of CPA4 in CRC. Accordingly, CPA4 promotes CRC cell growth via activating the STAT3 and ERK pathways and may be a prognostic factor or therapeutic target for CRC. © 2019 Elsevier B.V. All rights reserved.
1. Introduction Colorectal cancer (CRC) is the third most common malignant tumor and the third leading cause of death globally, with around 1,800,000 new cases and 861,000 deaths in 2018 [1]. According to data from the Chinese National Cancer Center, CRC is the fourth most common cancer in women and the fifth most common cancer in men [2]. CRC is a heterogeneous disease with complex mechanisms of pathogenesis. Although clinicians have made great efforts to improve the comprehensive treatments available, the survival outcomes of CRC
⁎ Correspondence to: H. Pan, Department of Gastric Surgery, Fudan University Shanghai Cancer Center, Department of Oncology, Shanghai Medical College, Fudan University, 270 Dong An Road, Shanghai 200032, China. ⁎⁎ Correspondence to: Y. Guo, Department of Medical Genetics, Zhongshan School of Medicine, Sun Yat-sen University, No.74, Zhongshan Road 2, Guangzhou 510080, China. E-mail addresses: [email protected] (H. Pan), [email protected] (Y. Guo). 1 Hongda Pan and Jingxin Pan contributed equally to this article.
https://doi.org/10.1016/j.ijbiomac.2019.07.028 0141-8130/© 2019 Elsevier B.V. All rights reserved.
patients are far from ideal. Therefore, it is critical to explore the regulatory mechanisms of CRC to promote the development of promising diagnostic biomarkers as well as optimal therapeutic targets. Carboxypeptidase A4 (CPA4) is a member of the metallocarboxypeptidase family. CPA4 functions in neuropeptide processing and regulation in the extracellular environment, which are closely related to cancer progression [3]. Previous studies have suggested that CPA4 is an imprinted gene and it may become a strong candidate gene for predicting the aggressiveness of prostate cancer [4]. CPA4 is secreted as an N-glycan and elevated levels of CPA4 can be detected in the media of breast cancer cell lines, and may be useful as a glycan-based biomarker for the prognosis of breast cancer [5]. Altered expression of CPA4 has also been detected in head and neck squamous cell carcinoma tissues, and higher expression of CPA4 is related to poor survival [6]. Several studies have demonstrated that CPA4 is aberrantly expressed in a wide variety of cancers, and elevated CPA4 expression levels are associated with advanced tumor stage, metastasis, and poor prognosis [7–12]. However, the function and mechanism by which CPA4 contributes to cancer development and progression are unclear.
126
H. Pan et al. / International Journal of Biological Macromolecules 138 (2019) 125–134
In our study, we demonstrated a significant correlation between high CPA4 expression and poor prognosis in CRC patients. The oncogenic function of CPA4 was examined by in vitro and in vivo
experiments. Moreover, we found that CPA4 promoted CRC progression via STAT3 and ERK signaling pathways. This study thus reports the oncogenic and prognostic roles of CPA4 in CRC.
Fig. 1. CPA4 was overexpressed in colorectal cancer (CRC) tissues and cells, and correlated with survival in HCC patients. (A) and (B) CPA4 mRNA levels in 42 pairs of tumor samples and matched normal tissues were determined by qRT-PCR. Compared to matched normal tissues, CPA4 expression was upregulated in 76.2% (32/42) of CRC samples. (C) and (D) mRNA and protein levels of CPA4 in a human colon cell line and five CRC cell lines as measured by qRT-PCR and western blot, respectively. (E) Representative IHC staining for CPA4 in CRC and normal tissues (scale bar: 200 μm and 50 μm). (F) High CPA4 expression correlated with poorer overall survival in CRC patients. (G) and (H) CPA4 expression was increased in tumor tissues compared with normal colorectal tissues in TCGA-COAD and TCGA-READ datasets.
H. Pan et al. / International Journal of Biological Macromolecules 138 (2019) 125–134
2. Methods 2.1. Patients and specimens In total, 42 pairs of matched CRC and adjacent normal tissues were collected from the Department of Gastrointestinal Surgery, Beijing Hospital (BJH). All tissues were frozen immediately in liquid nitrogen after surgical excision and stored at −80 °C. Archived formalin fixed, paraffin-embedded specimens of 120 CRC patients who underwent surgical resection from July 2011 to May 2013 at BJH were retrieved from the Department of Pathology. Clinicopathological information was retrieved from the hospital database, which was updated until May 2018. Written informed consent was obtained from all patients and the study was approved by the ethics committees of BJH. 2.2. Cell lines and culture The human colon cell line NCM460 and CRC cell lines HCT116, LS123, SW480, SW620, and RKO were purchased from the American Type Culture Collection (Manassas, VA, USA). Cell lines were cultured in Dulbecco's modified Eagle's medium (DMEM) (Gibco) containing 10% fetal bovine serum (FBS). The STAT3 inhibitor cryptotanshinone and ERK inhibitor U0126 (Selleck Chemicals, USA) were dissolved in DMSO prior to use. All cells were grown at 37 °C in a 5% CO2, humidified atmosphere. 2.3. Lentivirus constructs and transfection CPA4 short hairpin RNAs (shCPA4), the CPA4 overexpression plasmid, and the scramble shRNA control were purchased from GeneChem Company (Shanghai, China). The target sequences of the shRNAs were as follows: shCPA4#1: 5′-GTATGACAACGGCATCAAA-3′ and shCPA4#2: 5′-GGAAATCTCCCTCCTCCTTCA-3′. HCT116 and LS123 cells were transfected with the shCPA4 plasmid, and SW620 and RKO cells were transfected with the CPA4 overexpression plasmid. Cells transfected with scramble vector were used as controls. The shRNAs and plasmids were transfected into cells using Lipofectamine 2000 (Invitrogen) following the manufacturer's protocol. Levels of CPA4 were measured by western blot. 2.4. RNA extraction and qRT-PCR analysis Total RNA from human tissue samples and cultured cells was purified using TRIzol (Invitrogen, Carlsbad, CA, USA). Complementary DNA (cDNA) was synthesized using the PrimeScript RT Reagent Kit (Takara, Shiga, Japan). qRT-PCR was performed using SYBR Green Premix Ex Taq (Takara, Shiga, Japan) with an ABI 7500 PCR system (Applied Biosystems). The primer sequences used were: CPA4 forward: 5′-ATTG GACATTCGTTTGAAAACCG-3′; CPA4 reverse: 5′- GGGAGATCCACTCTCG GGA-3′; GAPDH forward: 5′- TGACTTCAACAGCGACACCCA -3′; GAPDH reverse: 5′- CACCCTGTTGCTGTAGCCAAA -3′. GAPDH was measured as an endogenous control. The relative expression levels of the target genes were calculated by the 2-ΔCT method and normalized to the relative expression level detected in the corresponding control cells, which was defined as 1. For the correlation study, the expression level (defined as the fold change) of CPA4 was calculated by 2-ΔΔCT. 2.5. Protein extraction and western blot analysis Total protein was extracted from each sample for 60 min on ice in RIPA buffer (Thermo Scientific, USA) containing protease and phosphatase inhibitors (Cell Signaling Technology, USA). Cell lysates were centrifuged at 12,000 ×g, 4 °C, for 15 min, and the protein concentrations of the resulting supernatants were determined using a BCA Protein Assay Kit (Thermo Scientific, USA). Protein samples (30 μg) were then separated on a 10% SDS-PAGE gel (Life Technology, USA) and
127
transferred to a 0.45-μm PVDF membrane (Millipore, USA). The membrane was then incubated with the appropriate monoclonal antibody at 4 °C for 24 h. CPA4 was detected with a mouse polyclonal antiCPA4 antibody (Abcam, USA). GAPDH (CST, USA) expression was used as an equal loading control. The secondary antibody used was goat anti-mouse IgG-HRP (Abcam, USA). The signal detection from each blot was performed using a visual imaging system (Bio-Rad, USA). The grey values of western blot bands were measured using Image J software (National Institutes of Health, USA) to quantify relative expression levels. 2.6. Intracellular signaling arrays To explore downstream intracellular signaling, a PathScan intracellular signaling array was utilized. Briefly, 2 days after transfection, HCT116 and LS123 cells were lysed on ice for 5 min using 0.1 mL of cell lysis buffer. Lysates were then centrifuged at 4 °C, 10,000 rpm for 15 min. Phosphorylation or cleavage of intracellular signaling intermediates was examined using the PathScan array kit (Cell Signaling Technology, Danvers, MA, USA, #7323). 2.7. Immunohistochemistry (IHC) Paraffin-embedded tissues were cut into 5-μm sections. IHC analysis was performed using a standard immunoperoxidase staining procedure. Primary antibodies against CPA4 (Abcam, UK) were used at a concentration of 1:200. IHC signal intensities were scored as follows: 0 (no staining), 1 (staining in b1% of cells), 2 (staining in 1–10% of cells), or 3 (staining in N10% of cells). The samples classified as 0 and 1 were considered low CPA4 expression samples, while those classified as 2 and 3 were considered high CPA4 expression samples. 2.8. Cell proliferation, colony-formation, cell migration, and invasion assays The cell proliferation assays were performed with a CCK-8 assay. Forty-eight hours after transfection, cells were trypsinized and reseeded into 96-well plates (3000 cells/well). Ten microliters of CCK-8 (Dojindo,
Table 1 Correlation between CPA4 expression and the clinicopathological parameters of 120 CRC patients. Clinicopathological parameters
Sex Female Male Age (years) ≥65 b65 Histologic differentiation Well or moderate Poor TNM stage I-II III-IV Serum CEA level N5 ng/mL ≤5 ng/mL Lymphovascular invasion Negative Positive Perineural invasion Negative Positive
Number of cases
CPA4 expression level High
Low
39 81
13 29
26 52
65 55
26 16
39 39
76 44
20 22
56 22
67 53
17 25
50 28
45 75
18 24
27 51
100 20
34 8
66 12
109 11
39 3
70 8
P value
0.791
0.212
0.009⁎
0.013⁎
0.374
0.608
0.816
CEA carcinoembryonic antigen, TNM Tumor-Node-Metastasis stage. ⁎ pb0.05.
128
H. Pan et al. / International Journal of Biological Macromolecules 138 (2019) 125–134
Kumamoto, Japan) solution was then added to each well and absorbance at 450 nm was measured after 2 h of incubation. Anchorageindependent growth was assessed using a colony formation assay. Briefly, 500 cells were loaded per well in 6-well plates. The cells were cultured for approximately 14 days, fixed with 4% paraformaldehyde, and stained with 0.1% crystal violet (Sigma, St. Louis, MO). The total number of colonies (defined as containing over 50 cells) was counted. Cell migratory and invasive abilities were measured by Boyden chambers (Corning, Corning, NY) using membranes with 8-μm pores coated with or without Matrigel for invasion and migration assays, respectively. The experiments were performed in triplicate.
2.9. In vivo tumorigenic assays Nude nu/nu mice, 4–6 weeks old, were purchased from the Shanghai Laboratory Animal Center of the Chinese Academy of Sciences (Shanghai, China). All animals were housed and maintained under specific pathogen-free conditions, and all experiments were approved by the Use Committee for Animal Care and performed in accordance with institutional guidelines. Transfected CRC cells (1 × 106 cells in 100 μL PBS) were injected subcutaneously into the dorsal region of anaesthetized nude mice. Tumor volume (cm3) was measured every five days, and tumor weight (mg) was measured at the end of the experiment.
Fig. 2. Knockdown of CPA4 suppressed the proliferation and tumorigenesis of human colorectal cancer (CRC) cells in vivo and in vitro. (A) and (B) The efficiency of CPA4 knockdown in HCT116 and LS123 cells was determined by western blot, with GAPDH used as a loading control. (C–F) Knockdown of CPA4 repressed cell proliferation as determined by CCK-8 assays and colony formation assays. (G–H) Knockdown of CPA4 inhibited the migratory and invasive abilities of HCT116 and LS123 cells. (I) Tumorigenesis assay by subcutaneous injection of HCT116/shNC and HCT116/shCPA4 cells in nude mice (n = 6/group). (J) Tumor volumes were measured every 5 days and resulting measurements presented as a growth curve. Tumor weights were measured on the terminal days. (K) The sections of tumor were under IHC staining using antibodies against CPA4, STAT3 and ERK. The results are presented as the mean ± SD. (⁎p b 0.05, ⁎⁎p b 0.01, ⁎⁎⁎p b 0.001).
H. Pan et al. / International Journal of Biological Macromolecules 138 (2019) 125–134
Tumor sections were further under IHC staining using antibody against CPA4 and the proteins associated with downstream pathways. 2.10. Flow cytometric analysis of cell apoptosis and cell cycle The extent of apoptosis was measured with an Annexin V-APC Apoptosis Detection kit (BD Biosciences) according to the manufacturer's instructions. Cells were collected, washed with ice-cold PBS twice,
129
gently resuspended in 100 μL of 1× binding buffer containing 2.5 μL APC-conjugated annexin-V, then incubated at room temperature in the dark for 15 min. For cell cycle analysis, the cells were fixed using 75% pre-cooled ethanol at 4 °C overnight. Cells were then stained with 50 μg/mL propidium iodide (PI; Kaiji, China) containing RNaseI (Kaiji, China). The stained cells were analyzed by flow cytometry (Guava easyCyte). Three independent replicates of this experiment were performed.
Fig. 3. Overexpression of CPA4 promoted the proliferation and tumorigenesis of human CRC cells in vivo and in vitro. (A) and (B) The efficiency of CPA4 overexpression in SW620 and RKO cells was determined by western blot, with GAPDH as a loading control. (C–F) Overexpression of CPA4 promoted cell proliferation as determined by CCK-8 assays and colony formation assays. (G–H) Overexpression of CPA4 promoted the migratory abilities and invasiveness of SW620 and RKO cells. (I) Tumorigenesis assay by subcutaneous injection of RKO/Vector and RKO/CPA4 cells in nude mice (n = 6/group). (J) Tumor volumes were measured every 5 days, and tumor weights were measured at the end of the experiment. (K) The sections of tumor processed by IHC staining using antibodies against CPA4, STAT3, and ERK. The results are presented as the mean ± SD. (⁎p b 0.05, ⁎⁎p b 0.01, ⁎⁎⁎p b 0.001).
130
H. Pan et al. / International Journal of Biological Macromolecules 138 (2019) 125–134
2.11. Statistical analysis Experiments were conducted in triplicate, and the data are presented as mean values ± standard deviation (SD). The expression level of CPA4 in paired non-tumor and tumor tissues was compared using a paired Student's t-test. An independent Student's t-test was used to compare the mean values of any two preselected groups. Survival data were analyzed with the Kaplan-Meier method and were compared using the log-rank test. The correlations between IHC results and clinicopathologic parameters were determined using the chi-square test. p b 0.05 was considered statistically significant. All data were analyzed using SPSS version 21.0 for Windows (IBM, Armonk, NY, USA). Designations for levels of statistical significance are as follows: * represents p b 0.05, ** represents p b 0.01, and *** represents p b 0.001. 3. Results 3.1. CPA4 expression in CRC cell lines and tumor tissues CPA4 mRNA expression levels were investigated in 42 paired CRC and adjacent non-tumor tissue samples by qRT-PCR (Fig. 1A). CPA4 expression was significantly upregulated in 76.2% (32/42) of CRC tissues compared with that in adjacent normal tissues (Fig. 1B). We also measured CPA4 mRNA and protein expression levels in CRC cell lines and colon cell lines by qRT-PCR and western blot. Among five CRC cell lines, CPA4 mRNA expression was significantly increased in the HCT116 and LS123 lines and decreased in SW620 and RKO lines. CPA4 protein expression levels were determined using western blot and were consistent with relative levels of CPA4 mRNA (Fig. 1C, D). 3.2. Prognostic and clinicopathological significance of CPA4 in CRC To explore whether CPA4 expression was associated with overall survival and clinicopathological features of CRC cases, IHC staining was performed in 120 human CRC samples, and high CPA4 protein expression was detected in 35.0% (42/120) of those CRC samples (Fig. 1E). Kaplan-Meier analysis revealed that patients with low CPA4 expression levels had better overall survival rates than patients with high CPA4 expression (Fig. 1F). Furthermore, high CPA4 expression positively correlated with TNM stage (p = 0.013) and histologic
differentiation (p = 0.009) (Table 1). In order to verify our findings, the expression level of CPA4 was analyzed using The Cancer Genome Atlas (TCGA). CPA4 was significantly up-regulated in both Colon Adenocarcinoma (COAD) and Rectal Adenocarcinoma (READ) tissues compared with normal tissues (Fig. 1G).
3.3. Knockdown of CPA4 suppressed the proliferation and tumorigenesis of CRC cells CPA4 expression was knocked down in HCT116 and LS123 lines by two different shRNAs (#1 and #2). The knockdown efficiency of each shRNA was confirmed by western blot (Fig. 2A, B). CCK-8 and colony formation assays indicated that knocking down CPA4 greatly inhibited the cell growth of HCT116 and LS123 cells compared to growth of control cells (Fig. 2C–F). Transwell assays showed that knocking down CPA4 significantly attenuated the migratory and invasive abilities of HCT116 and LS123 cells (Fig. 2G, H). Tumorigenesis assays by subcutaneous injection with shCPA4-stably transfected HCT116 cells were performed in nude mice, and tumor growth was monitored. Tumor volume and weight were significantly lower in the CPA4 knockdown group than in the negative control group (Fig. 2I, J). Moreover, much lower expression of CPA4, STAT3 and ERK was found in CPA4 knockdown group than that in the control group, as detected by IHC analysis (Fig. 2K).
3.4. Overexpression of CPA4 promoted the proliferation and tumorigenesis of CRC cells CRC cell lines SW620 and RKO stably overexpressing CPA4 were established and the overexpression of CPA4 in these cells was confirmed by western blot (Fig. 3A, B). In comparison with control cells, the growth of SW620 and RKO cells was promoted by CPA4 overexpression, as determined by CCK-8 and colony formation assays (Fig. 3C–F). CPA4 overexpression also enhanced the migration and invasion of SW620 and RKO cells (Fig. 3G, H). Furthermore, to confirm the growth-promoting effects in vivo, tumorigenesis assays by subcutaneous injection were performed in nude mice. Overexpression of CPA4 in the RKO cells markedly promoted tumor growth in vivo (Fig. 3I, J). In addition, the IHC analysis revealed that expression of CPA4, STAT3 and ERK was increased in CPA4 overexpression group compared with control group (Fig. 3K).
Fig. 4. CPA4 Knockdown inhibits G1/S transition and apoptosis of colorectal cancer (CRC) cells. (A) and (B) Representative images of the cell cycle assays in HCT116 and LS123 cells after transfection with shNC or shCPA4. Cells were stained with propidium iodide and analyzed by flow cytometry. (C) and (D) Apoptosis of HCT116 and LS123 cells was determined by flow cytometry. Cells stained with annexin-V-APC were considered apoptotic.
H. Pan et al. / International Journal of Biological Macromolecules 138 (2019) 125–134
131
Changes in the cell cycle profile following CPA4 knockdown were analyzed by flow cytometry. The percentage of cells in the G1 phase was significantly increased for shCPA4-transfected HCT116 and LS123 cells compared with that of shNC-transfected cells (P b 0.05) (Fig. 4A, B). However, no significant difference was found in the percentage of cells in the S or G2/M phases after CPA4 knockdown. Together, the data show that CPA4 knockdown attenuates CRC cell proliferation by inhibiting the G1/S transition.
and LS123 cell lines. For HCT116 cells, the percentages of cells that underwent apoptosis were 4.29% and 23.07% (p b 0.01) for shNC and shCPA4 cells, respectively. For LS123 cells, the percentages of cells that underwent apoptosis were 4.57% and 13.23% (p b 0.01) for shNC and shCPA4 cells, respectively (Fig. 4C, D). The levels of caspases, a family of central regulators of apoptosis, were assessed by western blot. Cleavage of caspase-9 and caspase-3 was increased in CPA4 knockdown cells, while levels of cleaved caspases decreased in CPA4-overexpressing cells compared with those in control cells (Fig. 5A).
3.6. CPA4 inhibits apoptosis in CRC cells
3.7. CPA4 activates STAT3 and ERK pathways in CRC cells
The percentages of CRC cells that underwent apoptosis upon shCPA4-mediated knockdown were determined for both HCT116
To explore the regulatory mechanism of CPA4 in CRC, we examined changes in intracellular signaling molecules upon CPA4 knockdown in
3.5. CPA4 knockdown results in G1 arrest in CRC
Fig. 5. CPA4 activated STAT3 and ERK signaling pathways in colorectal cancer (CRC) cells. (A–B) The phosphorylation of intracellular signaling in HCT-116 and LS-123 with CPA4 knockdown was examined by intracellular protein assays. (C) The levels of phosphorylated ERK, total ERK, phosphorylated STAT3, total STAT3, and cleavage of caspase-9 and caspase3 were detected in CPA4-knockdown and -overexpressing cells by western blot analysis. GAPDH was used as the loading control. (D–G) The relative grey value of phosphorylated STAT3 and phosphorylated ERK were measured by Image J software.
132
H. Pan et al. / International Journal of Biological Macromolecules 138 (2019) 125–134
HCT116 and LS123 cells. A significant decrease in phosphorylation of STAT3-Tyr705 and ERK1/2-Tyr202/Tyr204 was detected (Fig. 5A, B). To further validate these findings, we measured the phosphorylation and total protein levels of STAT3 and ERK in CPA4 knockdown and overexpression cell lines using western blot. Relative to levels in control cells, levels of phosphorylated STAT3 and ERK were decreased in HCT116 and LS123 CPA4 knockdown cells, whereas phosphorylation of STAT3 and ERK was increased in SW620 and RKO cells
overexpressing CPA4 (Fig. 5C). However, the total protein levels of STAT3 and ERK did not change in any cell line. Then the CPA4 overexpressing RKO cells were treated with an STAT3 inhibitor (cryptotanshinone) or ERK inhibitor (U0126). The result of Western blots showed that STAT3 and ERK phosphorylation was subsequently inhibited in the CPA4 overexpressing RKO cells (Fig. 6A). In addition, CCK-8, colony formation assays and transwell assays revealed that the cell proliferation and growth, as well as migration and invasion
Fig. 6. The RKO cells with CPA4 overexpression were treated with the STAT3 inhibitor cryptotanshinone, the ERK inhibitor U01226. (A) The expression levels of the indicated proteins were measured by western blot. (B–D) The abilities of cell proliferation, growth, migration and invasion of RKO cells with CPA4 overexpression was determined by CCK-8 (B), colony formation assay (C), and transwell assays (D) after treatment with cryptotanshinone, U0126 or DMSO. (⁎⁎⁎p b 0.001).
H. Pan et al. / International Journal of Biological Macromolecules 138 (2019) 125–134
of these CRC cells promoted by CPA4 was reversed after treatment with cryptotanshinone or U0126 (Fig. 6B–F). The above results may show that CPA4 plays a role in promoting proliferation and inhibiting apoptosis of CRC by activating the STAT3 and ERK pathways.
133
that CPA4 plays an important role in tumor progression in CRC through activating the STAT3 and ERK signaling pathways. However, the direct downstream targets of CPA4 have not been identified, warranting further studies to discover the underlying molecular regulatory mechanisms.
4. Discussion 5. Conclusions In the present study, we showed for the first time that CPA4 expression is upregulated in CRC cell lines and tissue samples at both the mRNA and protein levels. Overexpression of CPA4 promoted CRC cell proliferation and colony-forming abilities, and inhibited cell apoptosis. Moreover, CPA4 also enhanced tumor growth in nude mice. In addition, knocking down CPA4 significantly inhibited CRC cell proliferation and tumor growth both in vitro and in vivo. Clinically, overexpression of CPA4, as observed by IHC staining, was associated with histological differentiation, tumor stage, and a shorter overall survival time of CRC patients. These results indicated that CPA4 plays a critical role in CRC cell growth and might be a reliable biomarker for CRC. CPA4, also known as CPA3, is a member of the carboxypeptidase A/B subfamily. CPA4 serves as a zinc-containing exopeptidase that catalyzes the release of carboxy-terminal amino acids, and is synthesized as a zymogen that is activated by proteolytic cleavage [13]. Moreover, CPA4 can participate in the histone hyperacetylation pathway and may modulate the function of peptides that affect the growth and regulation of prostate epithelial cells [14]. Coding variations in CPA4 may confer an increased risk of intermediate-to-high risk prostate cancer among younger patients [14]. Tanco et al. demonstrated that some of the peptides identified as CPA4 substrates have been previously shown to function in cell differentiation and proliferation, potentially explaining the correlation between CPA4 and cancer progression [3]. Kayashima et al. reported that CPA4 is imprinted and may be a strong candidate gene for predicting prostate cancer aggressiveness [4]. Upregulation of CPA4 was also detected in the MCF-7 breast cancer cell line, and may serve as a biomarker for the prognosis of breast cancer [5]. Hsu et al. observed aberrant expression of CPA4 in head and neck squamous cell carcinoma, and that this abnormality is associated with poor survival [6]. In addition, Sun et al. showed that CPA4 is overexpressed in a number of malignant tumors, and that CPA4 can exert a prognostic role in these cancers [7–12]. However, these studies did not provide insight into the functional role or underlying mechanism by which CPA4 influences cancer progression. To our knowledge, our study is the first to report the oncogenic function and mechanism of CPA4 in CRC using in vivo and in vitro experiments. Our study revealed that CPA4-mediated promotion of tumor cell growth may be attributable to activation of STAT3 and ERK signaling pathways. The JAK/STAT3 signaling pathway is associated with regulating cell growth and proliferation, as well as reducing apoptosis, and has been reported to be activated in several types of cancer [15,16]. STAT3 activity plays an important role in various carcinogenic processes, including cell cycle regulation, prevention of apoptosis, induction of survival factors, and establishment of uncontrolled growth [17,18]. The MAPK/ERK pathway is a classic intracellular signaling pathway, and is known to be closely associated with the progression of malignant tumors [19,20]. Accumulating evidence demonstrates that the MAPK/ ERK pathway is associated with proper performance of the cellular DNA damage response (DDR), the main pathway of tumor suppression [21]. In addition, the MAPK/ERK pathway is crucial for regulating tumor metabolism [22]. Finally, caspases are a family of protease enzymes that play essential roles in apoptosis [23,24]. We provide evidence in our study that the knockdown of CPA4 inhibits phosphorylation of the STAT3 and MAPK/ERK pathways, increasing caspase cleavage. Flow cytometry experiments also showed that the apoptosis index was increased in CPA4 knockdown cells. Moreover, after treatment with the STAT3 inhibitor cryptotanshinone or ERK inhibitor U0126 in CPA4overexpressing cells, cell growth was suppressed and phosphorylation of STAT3 and ERK was significantly decreased. Therefore, we propose
Collectively, our results revealed that CPA4 was upregulated in CRC tumor samples and cell lines. Overexpression of CPA4 was positively correlated with TNM stage and poor oncological outcomes. CPA4 promoted CRC cell growth in vivo and in vitro through activating the STAT3 and ERK signaling pathways. Our findings highlight the oncogenic role and potential mechanism of CPA4 in promoting CRC tumorigenesis. Funding This study was supported by Beijing Natural Science Foundation (7184240). Declaration of Competing Interest None. Acknowledgement The authors are grateful to Mrs. Xuan Zhang and Prof. Zhiyi Pan for providing help in data analysis. References [1] F. Bray, J. Ferlay, I. Soerjomataram, R.L. Siegel, L.A. Torre, A. Jemal, Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries, CA Cancer J. Clin. 68 (6) (2018) 394–424. [2] W. Chen, R. Zheng, P.D. Baade, S. Zhang, H. Zeng, F. Bray, A. Jemal, X.Q. Yu, J. He, Cancer statistics in China, 2015, CA Cancer J. Clin. 66 (2) (2016) 115–132. [3] S. Tanco, X. Zhang, C. Morano, F.X. Aviles, J. Lorenzo, L.D. Fricker, Characterization of the substrate specificity of human carboxypeptidase A4 and implications for a role in extracellular peptide processing, J. Biol. Chem. 285 (24) (2010) 18385–18396. [4] T. Kayashima, K. Yamasaki, T. Yamada, H. Sakai, N. Miwa, T. Ohta, K. Yoshiura, N. Matsumoto, Y. Nakane, H. Kanetake, F. Ishino, N. Niikawa, T. Kishino, The novel imprinted carboxypeptidase A4 gene (CPA4) in the 7q32 imprinting domain, Hum. Genet. 112 (3) (2003) 220–226. [5] A.A. Tan, W.M. Phang, S.C. Gopinath, O.H. Hashim, L.V. Kiew, Y. Chen, Revealing glycoproteins in the secretome of MCF-7 human breast cancer cells, Biomed. Res. Int. 2015 (2015), 453289. [6] C.M. Hsu, P.M. Lin, H.C. Lin, C.C. Lai, C.H. Yang, S.F. Lin, M.Y. Yang, Altered expression of imprinted genes in squamous cell carcinoma of the head and neck, Anticancer Res. 36 (5) (2016) 2251–2258. [7] L. Sun, J. Burnett, C. Guo, Y. Xie, J. Pan, Z. Yang, Y. Ran, D. Sun, CPA4 is a promising diagnostic serum biomarker for pancreatic cancer, Am. J. Cancer Res. 6 (1) (2016) 91–96. [8] L. Sun, C. Guo, J. Burnett, Z. Yang, Y. Ran, D. Sun, Serum carboxypeptidaseA4 levels predict liver metastasis in colorectal carcinoma, Oncotarget 7 (48) (2016) 78688–78697. [9] L. Sun, C. Guo, H. Yuan, J. Burnett, J. Pan, Z. Yang, Y. Ran, I. Myers, D. Sun, Overexpression of carboxypeptidase A4 (CPA4) is associated with poor prognosis in patients with gastric cancer, Am. J. Transl. Res. 8 (11) (2016) 5071–5075. [10] L. Sun, Y. Wang, H. Yuan, J. Burnett, J. Pan, Z. Yang, Y. Ran, I. Myers, D. Sun, CPA4 is a novel diagnostic and prognostic marker for human non-small-cell lung cancer, J. Cancer 7 (10) (2016) 1197–1204. [11] L. Sun, J. Cao, C. Guo, J. Burnett, Z. Yang, Y. Ran, D. Sun, Associations of carboxypeptidase 4 with ALDH1A1 expression and their prognostic value in esophageal squamous cell carcinoma, Dis. Esophagus 30 (6) (2017) 1–5. [12] L. Sun, C. Guo, J. Burnett, J. Pan, Z. Yang, Y. Ran, D. Sun, Association between expression of carboxypeptidase 4 and stem cell markers and their clinical significance in liver cancer development, J. Cancer 8 (1) (2017) 111–116. [13] I. Pallares, R. Bonet, R. Garcia-Castellanos, S. Ventura, F.X. Aviles, J. Vendrell, F.X. Gomis-Ruth, Structure of human carboxypeptidase A4 with its endogenous protein inhibitor, latexin, Proc. Natl. Acad. Sci. U. S. A. 102 (11) (2005) 3978–3983. [14] P.L. Ross, I. Cheng, X. Liu, M.S. Cicek, P.R. Carroll, G. Casey, J.S. Witte, Carboxypeptidase 4 gene variants and early-onset intermediate-to-high risk prostate cancer, BMC Cancer 9 (2009) 69. [15] R. Chang, L. Song, Y. Xu, Y. Wu, C. Dai, X. Wang, X. Sun, Y. Hou, W. Li, X. Zhan, L. Zhan, Loss of Wwox drives metastasis in triple-negative breast cancer by JAK2/STAT3 axis, Nat. Commun. 9 (1) (2018) 3486.
134
H. Pan et al. / International Journal of Biological Macromolecules 138 (2019) 125–134
[16] D.E. Johnson, R.A. O'Keefe, J.R. Grandis, Targeting the IL-6/JAK/STAT3 signalling axis in cancer, Nat. Rev. Clin. Oncol. 15 (4) (2018) 234–248. [17] N. Fathi, G. Rashidi, A. Khodadadi, S. Shahi, S. Sharifi, STAT3 and apoptosis challenges in cancer, Int. J. Biol. Macromol. 117 (2018) 993–1001. [18] C.Y. Loh, A. Arya, A.F. Naema, W.F. Wong, G. Sethi, C.Y. Looi, Signal transducer and activator of transcription (STATs) proteins in cancer and inflammation: functions and therapeutic implication, Front. Oncol. 9 (2019) 48. [19] M. Laplante, D.M. Sabatini, mTOR signaling in growth control and disease, Cell 149 (2) (2012) 274–293. [20] L.J. Bugaj, A.J. Sabnis, A. Mitchell, J.E. Garbarino, J.E. Toettcher, T.G. Bivona, W.A. Lim, Cancer mutations and targeted drugs can disrupt dynamic signal encoding by the Ras-Erk pathway, Science (New York, N.Y.) 361 (6405) (2018).
[21] S. Rezatabar, A. Karimian, V. Rameshknia, H. Parsian, M. Majidinia, T.A. Kopi, A. Bishayee, A. Sadeghinia, M. Yousefi, M. Monirialamdari, B. Yousefi, RAS/MAPK signaling functions in oxidative stress, DNA damage response and cancer progression, J. Cell. Physiol. (2019)https://doi.org/10.1002/jcp.28334 [Epub ahead of print]. [22] S. Papa, P.M. Choy, C. Bubici, The ERK and JNK pathways in the regulation of metabolic reprogramming, Oncogene 38 (13) (2019) 2223–2240. [23] S. Shalini, L. Dorstyn, S. Dawar, S. Kumar, Old, new and emerging functions of caspases, Cell Death Differ. 22 (4) (2015) 526–539. [24] P. Li, D. Nijhawan, I. Budihardjo, S.M. Srinivasula, M. Ahmad, E.S. Alnemri, X. Wang, Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade, Cell 91 (4) (1997) 479–489.
Contents lists available at ScienceDirect
International Journal of Biological Macromolecules journal homepage: http://www.elsevier.com/locate/ijbiomac
Carboxypeptidase A4 promotes cell growth via activating STAT3 and ERK signaling pathways and predicts a poor prognosis in colorectal cancer Hongda Pan a,b,c,d,⁎,1, Jingxin Pan b,1, Lei Ji c, Shibo Song d, Hong Lv c, Zhangru Yang c, Yibin Guo e,⁎ a
Department of Gastric Surgery, Fudan University Shanghai Cancer Center, 200032 Shanghai, China The Second Affiliated Hospital of Fujian Medical University, 362000 Quanzhou, China Department of Oncology, Shanghai Medical College, Fudan University, 200032 Shanghai, China d Department of Gastrointestinal Surgery, Beijing Hospital, 100730 Beijing, China e Department of Medical Genetics, Zhongshan School of Medicine, Sun Yat-sen University, 510080 Guangzhou, China b c
a r t i c l e
i n f o
Article history: Received 16 March 2019 Received in revised form 24 May 2019 Accepted 3 July 2019 Available online 04 July 2019 Keywords: Carboxypeptidase A4 Colorectal cancer STAT3 signaling pathway
a b s t r a c t Carboxypeptidase A4 (CPA4) is a novel cancer-related gene that is aberrantly expressed in various malignant tumors. However, the roles and mechanisms of CPA4 have not been explored in colorectal cancer (CRC). In this study, we investigated the functions and mechanisms by which CPA4 promotes CRC progression. Quantitative real-time PCR (qRT-PCR) and western blot showed that CPA4 mRNA and CPA4 protein levels were up-regulated in CRC compared to levels in adjacent normal tissue. Immunohistochemistry (IHC) results indicating high CPA4 levels were positively associated with poor prognoses. In addition, Cell Counting Kit-8 (CCK-8), colony formation, flow cytometry, and transwell assays demonstrated that CPA4 overexpression facilitated the growth of CRC cells, whereas CPA4 knockdown resulted in decreased proliferation, G1/S phase transition arrest, and apoptosis. Subcutaneous tumorigenesis was performed in nude mice to confirm the tumor-promoting effects of CPA4 in vivo. Western blot revealed that activation of the STAT3 and ERK pathways is one of the oncogenic functions of CPA4 in CRC. Accordingly, CPA4 promotes CRC cell growth via activating the STAT3 and ERK pathways and may be a prognostic factor or therapeutic target for CRC. © 2019 Elsevier B.V. All rights reserved.
1. Introduction Colorectal cancer (CRC) is the third most common malignant tumor and the third leading cause of death globally, with around 1,800,000 new cases and 861,000 deaths in 2018 [1]. According to data from the Chinese National Cancer Center, CRC is the fourth most common cancer in women and the fifth most common cancer in men [2]. CRC is a heterogeneous disease with complex mechanisms of pathogenesis. Although clinicians have made great efforts to improve the comprehensive treatments available, the survival outcomes of CRC
⁎ Correspondence to: H. Pan, Department of Gastric Surgery, Fudan University Shanghai Cancer Center, Department of Oncology, Shanghai Medical College, Fudan University, 270 Dong An Road, Shanghai 200032, China. ⁎⁎ Correspondence to: Y. Guo, Department of Medical Genetics, Zhongshan School of Medicine, Sun Yat-sen University, No.74, Zhongshan Road 2, Guangzhou 510080, China. E-mail addresses: [email protected] (H. Pan), [email protected] (Y. Guo). 1 Hongda Pan and Jingxin Pan contributed equally to this article.
https://doi.org/10.1016/j.ijbiomac.2019.07.028 0141-8130/© 2019 Elsevier B.V. All rights reserved.
patients are far from ideal. Therefore, it is critical to explore the regulatory mechanisms of CRC to promote the development of promising diagnostic biomarkers as well as optimal therapeutic targets. Carboxypeptidase A4 (CPA4) is a member of the metallocarboxypeptidase family. CPA4 functions in neuropeptide processing and regulation in the extracellular environment, which are closely related to cancer progression [3]. Previous studies have suggested that CPA4 is an imprinted gene and it may become a strong candidate gene for predicting the aggressiveness of prostate cancer [4]. CPA4 is secreted as an N-glycan and elevated levels of CPA4 can be detected in the media of breast cancer cell lines, and may be useful as a glycan-based biomarker for the prognosis of breast cancer [5]. Altered expression of CPA4 has also been detected in head and neck squamous cell carcinoma tissues, and higher expression of CPA4 is related to poor survival [6]. Several studies have demonstrated that CPA4 is aberrantly expressed in a wide variety of cancers, and elevated CPA4 expression levels are associated with advanced tumor stage, metastasis, and poor prognosis [7–12]. However, the function and mechanism by which CPA4 contributes to cancer development and progression are unclear.
126
H. Pan et al. / International Journal of Biological Macromolecules 138 (2019) 125–134
In our study, we demonstrated a significant correlation between high CPA4 expression and poor prognosis in CRC patients. The oncogenic function of CPA4 was examined by in vitro and in vivo
experiments. Moreover, we found that CPA4 promoted CRC progression via STAT3 and ERK signaling pathways. This study thus reports the oncogenic and prognostic roles of CPA4 in CRC.
Fig. 1. CPA4 was overexpressed in colorectal cancer (CRC) tissues and cells, and correlated with survival in HCC patients. (A) and (B) CPA4 mRNA levels in 42 pairs of tumor samples and matched normal tissues were determined by qRT-PCR. Compared to matched normal tissues, CPA4 expression was upregulated in 76.2% (32/42) of CRC samples. (C) and (D) mRNA and protein levels of CPA4 in a human colon cell line and five CRC cell lines as measured by qRT-PCR and western blot, respectively. (E) Representative IHC staining for CPA4 in CRC and normal tissues (scale bar: 200 μm and 50 μm). (F) High CPA4 expression correlated with poorer overall survival in CRC patients. (G) and (H) CPA4 expression was increased in tumor tissues compared with normal colorectal tissues in TCGA-COAD and TCGA-READ datasets.
H. Pan et al. / International Journal of Biological Macromolecules 138 (2019) 125–134
2. Methods 2.1. Patients and specimens In total, 42 pairs of matched CRC and adjacent normal tissues were collected from the Department of Gastrointestinal Surgery, Beijing Hospital (BJH). All tissues were frozen immediately in liquid nitrogen after surgical excision and stored at −80 °C. Archived formalin fixed, paraffin-embedded specimens of 120 CRC patients who underwent surgical resection from July 2011 to May 2013 at BJH were retrieved from the Department of Pathology. Clinicopathological information was retrieved from the hospital database, which was updated until May 2018. Written informed consent was obtained from all patients and the study was approved by the ethics committees of BJH. 2.2. Cell lines and culture The human colon cell line NCM460 and CRC cell lines HCT116, LS123, SW480, SW620, and RKO were purchased from the American Type Culture Collection (Manassas, VA, USA). Cell lines were cultured in Dulbecco's modified Eagle's medium (DMEM) (Gibco) containing 10% fetal bovine serum (FBS). The STAT3 inhibitor cryptotanshinone and ERK inhibitor U0126 (Selleck Chemicals, USA) were dissolved in DMSO prior to use. All cells were grown at 37 °C in a 5% CO2, humidified atmosphere. 2.3. Lentivirus constructs and transfection CPA4 short hairpin RNAs (shCPA4), the CPA4 overexpression plasmid, and the scramble shRNA control were purchased from GeneChem Company (Shanghai, China). The target sequences of the shRNAs were as follows: shCPA4#1: 5′-GTATGACAACGGCATCAAA-3′ and shCPA4#2: 5′-GGAAATCTCCCTCCTCCTTCA-3′. HCT116 and LS123 cells were transfected with the shCPA4 plasmid, and SW620 and RKO cells were transfected with the CPA4 overexpression plasmid. Cells transfected with scramble vector were used as controls. The shRNAs and plasmids were transfected into cells using Lipofectamine 2000 (Invitrogen) following the manufacturer's protocol. Levels of CPA4 were measured by western blot. 2.4. RNA extraction and qRT-PCR analysis Total RNA from human tissue samples and cultured cells was purified using TRIzol (Invitrogen, Carlsbad, CA, USA). Complementary DNA (cDNA) was synthesized using the PrimeScript RT Reagent Kit (Takara, Shiga, Japan). qRT-PCR was performed using SYBR Green Premix Ex Taq (Takara, Shiga, Japan) with an ABI 7500 PCR system (Applied Biosystems). The primer sequences used were: CPA4 forward: 5′-ATTG GACATTCGTTTGAAAACCG-3′; CPA4 reverse: 5′- GGGAGATCCACTCTCG GGA-3′; GAPDH forward: 5′- TGACTTCAACAGCGACACCCA -3′; GAPDH reverse: 5′- CACCCTGTTGCTGTAGCCAAA -3′. GAPDH was measured as an endogenous control. The relative expression levels of the target genes were calculated by the 2-ΔCT method and normalized to the relative expression level detected in the corresponding control cells, which was defined as 1. For the correlation study, the expression level (defined as the fold change) of CPA4 was calculated by 2-ΔΔCT. 2.5. Protein extraction and western blot analysis Total protein was extracted from each sample for 60 min on ice in RIPA buffer (Thermo Scientific, USA) containing protease and phosphatase inhibitors (Cell Signaling Technology, USA). Cell lysates were centrifuged at 12,000 ×g, 4 °C, for 15 min, and the protein concentrations of the resulting supernatants were determined using a BCA Protein Assay Kit (Thermo Scientific, USA). Protein samples (30 μg) were then separated on a 10% SDS-PAGE gel (Life Technology, USA) and
127
transferred to a 0.45-μm PVDF membrane (Millipore, USA). The membrane was then incubated with the appropriate monoclonal antibody at 4 °C for 24 h. CPA4 was detected with a mouse polyclonal antiCPA4 antibody (Abcam, USA). GAPDH (CST, USA) expression was used as an equal loading control. The secondary antibody used was goat anti-mouse IgG-HRP (Abcam, USA). The signal detection from each blot was performed using a visual imaging system (Bio-Rad, USA). The grey values of western blot bands were measured using Image J software (National Institutes of Health, USA) to quantify relative expression levels. 2.6. Intracellular signaling arrays To explore downstream intracellular signaling, a PathScan intracellular signaling array was utilized. Briefly, 2 days after transfection, HCT116 and LS123 cells were lysed on ice for 5 min using 0.1 mL of cell lysis buffer. Lysates were then centrifuged at 4 °C, 10,000 rpm for 15 min. Phosphorylation or cleavage of intracellular signaling intermediates was examined using the PathScan array kit (Cell Signaling Technology, Danvers, MA, USA, #7323). 2.7. Immunohistochemistry (IHC) Paraffin-embedded tissues were cut into 5-μm sections. IHC analysis was performed using a standard immunoperoxidase staining procedure. Primary antibodies against CPA4 (Abcam, UK) were used at a concentration of 1:200. IHC signal intensities were scored as follows: 0 (no staining), 1 (staining in b1% of cells), 2 (staining in 1–10% of cells), or 3 (staining in N10% of cells). The samples classified as 0 and 1 were considered low CPA4 expression samples, while those classified as 2 and 3 were considered high CPA4 expression samples. 2.8. Cell proliferation, colony-formation, cell migration, and invasion assays The cell proliferation assays were performed with a CCK-8 assay. Forty-eight hours after transfection, cells were trypsinized and reseeded into 96-well plates (3000 cells/well). Ten microliters of CCK-8 (Dojindo,
Table 1 Correlation between CPA4 expression and the clinicopathological parameters of 120 CRC patients. Clinicopathological parameters
Sex Female Male Age (years) ≥65 b65 Histologic differentiation Well or moderate Poor TNM stage I-II III-IV Serum CEA level N5 ng/mL ≤5 ng/mL Lymphovascular invasion Negative Positive Perineural invasion Negative Positive
Number of cases
CPA4 expression level High
Low
39 81
13 29
26 52
65 55
26 16
39 39
76 44
20 22
56 22
67 53
17 25
50 28
45 75
18 24
27 51
100 20
34 8
66 12
109 11
39 3
70 8
P value
0.791
0.212
0.009⁎
0.013⁎
0.374
0.608
0.816
CEA carcinoembryonic antigen, TNM Tumor-Node-Metastasis stage. ⁎ pb0.05.
128
H. Pan et al. / International Journal of Biological Macromolecules 138 (2019) 125–134
Kumamoto, Japan) solution was then added to each well and absorbance at 450 nm was measured after 2 h of incubation. Anchorageindependent growth was assessed using a colony formation assay. Briefly, 500 cells were loaded per well in 6-well plates. The cells were cultured for approximately 14 days, fixed with 4% paraformaldehyde, and stained with 0.1% crystal violet (Sigma, St. Louis, MO). The total number of colonies (defined as containing over 50 cells) was counted. Cell migratory and invasive abilities were measured by Boyden chambers (Corning, Corning, NY) using membranes with 8-μm pores coated with or without Matrigel for invasion and migration assays, respectively. The experiments were performed in triplicate.
2.9. In vivo tumorigenic assays Nude nu/nu mice, 4–6 weeks old, were purchased from the Shanghai Laboratory Animal Center of the Chinese Academy of Sciences (Shanghai, China). All animals were housed and maintained under specific pathogen-free conditions, and all experiments were approved by the Use Committee for Animal Care and performed in accordance with institutional guidelines. Transfected CRC cells (1 × 106 cells in 100 μL PBS) were injected subcutaneously into the dorsal region of anaesthetized nude mice. Tumor volume (cm3) was measured every five days, and tumor weight (mg) was measured at the end of the experiment.
Fig. 2. Knockdown of CPA4 suppressed the proliferation and tumorigenesis of human colorectal cancer (CRC) cells in vivo and in vitro. (A) and (B) The efficiency of CPA4 knockdown in HCT116 and LS123 cells was determined by western blot, with GAPDH used as a loading control. (C–F) Knockdown of CPA4 repressed cell proliferation as determined by CCK-8 assays and colony formation assays. (G–H) Knockdown of CPA4 inhibited the migratory and invasive abilities of HCT116 and LS123 cells. (I) Tumorigenesis assay by subcutaneous injection of HCT116/shNC and HCT116/shCPA4 cells in nude mice (n = 6/group). (J) Tumor volumes were measured every 5 days and resulting measurements presented as a growth curve. Tumor weights were measured on the terminal days. (K) The sections of tumor were under IHC staining using antibodies against CPA4, STAT3 and ERK. The results are presented as the mean ± SD. (⁎p b 0.05, ⁎⁎p b 0.01, ⁎⁎⁎p b 0.001).
H. Pan et al. / International Journal of Biological Macromolecules 138 (2019) 125–134
Tumor sections were further under IHC staining using antibody against CPA4 and the proteins associated with downstream pathways. 2.10. Flow cytometric analysis of cell apoptosis and cell cycle The extent of apoptosis was measured with an Annexin V-APC Apoptosis Detection kit (BD Biosciences) according to the manufacturer's instructions. Cells were collected, washed with ice-cold PBS twice,
129
gently resuspended in 100 μL of 1× binding buffer containing 2.5 μL APC-conjugated annexin-V, then incubated at room temperature in the dark for 15 min. For cell cycle analysis, the cells were fixed using 75% pre-cooled ethanol at 4 °C overnight. Cells were then stained with 50 μg/mL propidium iodide (PI; Kaiji, China) containing RNaseI (Kaiji, China). The stained cells were analyzed by flow cytometry (Guava easyCyte). Three independent replicates of this experiment were performed.
Fig. 3. Overexpression of CPA4 promoted the proliferation and tumorigenesis of human CRC cells in vivo and in vitro. (A) and (B) The efficiency of CPA4 overexpression in SW620 and RKO cells was determined by western blot, with GAPDH as a loading control. (C–F) Overexpression of CPA4 promoted cell proliferation as determined by CCK-8 assays and colony formation assays. (G–H) Overexpression of CPA4 promoted the migratory abilities and invasiveness of SW620 and RKO cells. (I) Tumorigenesis assay by subcutaneous injection of RKO/Vector and RKO/CPA4 cells in nude mice (n = 6/group). (J) Tumor volumes were measured every 5 days, and tumor weights were measured at the end of the experiment. (K) The sections of tumor processed by IHC staining using antibodies against CPA4, STAT3, and ERK. The results are presented as the mean ± SD. (⁎p b 0.05, ⁎⁎p b 0.01, ⁎⁎⁎p b 0.001).
130
H. Pan et al. / International Journal of Biological Macromolecules 138 (2019) 125–134
2.11. Statistical analysis Experiments were conducted in triplicate, and the data are presented as mean values ± standard deviation (SD). The expression level of CPA4 in paired non-tumor and tumor tissues was compared using a paired Student's t-test. An independent Student's t-test was used to compare the mean values of any two preselected groups. Survival data were analyzed with the Kaplan-Meier method and were compared using the log-rank test. The correlations between IHC results and clinicopathologic parameters were determined using the chi-square test. p b 0.05 was considered statistically significant. All data were analyzed using SPSS version 21.0 for Windows (IBM, Armonk, NY, USA). Designations for levels of statistical significance are as follows: * represents p b 0.05, ** represents p b 0.01, and *** represents p b 0.001. 3. Results 3.1. CPA4 expression in CRC cell lines and tumor tissues CPA4 mRNA expression levels were investigated in 42 paired CRC and adjacent non-tumor tissue samples by qRT-PCR (Fig. 1A). CPA4 expression was significantly upregulated in 76.2% (32/42) of CRC tissues compared with that in adjacent normal tissues (Fig. 1B). We also measured CPA4 mRNA and protein expression levels in CRC cell lines and colon cell lines by qRT-PCR and western blot. Among five CRC cell lines, CPA4 mRNA expression was significantly increased in the HCT116 and LS123 lines and decreased in SW620 and RKO lines. CPA4 protein expression levels were determined using western blot and were consistent with relative levels of CPA4 mRNA (Fig. 1C, D). 3.2. Prognostic and clinicopathological significance of CPA4 in CRC To explore whether CPA4 expression was associated with overall survival and clinicopathological features of CRC cases, IHC staining was performed in 120 human CRC samples, and high CPA4 protein expression was detected in 35.0% (42/120) of those CRC samples (Fig. 1E). Kaplan-Meier analysis revealed that patients with low CPA4 expression levels had better overall survival rates than patients with high CPA4 expression (Fig. 1F). Furthermore, high CPA4 expression positively correlated with TNM stage (p = 0.013) and histologic
differentiation (p = 0.009) (Table 1). In order to verify our findings, the expression level of CPA4 was analyzed using The Cancer Genome Atlas (TCGA). CPA4 was significantly up-regulated in both Colon Adenocarcinoma (COAD) and Rectal Adenocarcinoma (READ) tissues compared with normal tissues (Fig. 1G).
3.3. Knockdown of CPA4 suppressed the proliferation and tumorigenesis of CRC cells CPA4 expression was knocked down in HCT116 and LS123 lines by two different shRNAs (#1 and #2). The knockdown efficiency of each shRNA was confirmed by western blot (Fig. 2A, B). CCK-8 and colony formation assays indicated that knocking down CPA4 greatly inhibited the cell growth of HCT116 and LS123 cells compared to growth of control cells (Fig. 2C–F). Transwell assays showed that knocking down CPA4 significantly attenuated the migratory and invasive abilities of HCT116 and LS123 cells (Fig. 2G, H). Tumorigenesis assays by subcutaneous injection with shCPA4-stably transfected HCT116 cells were performed in nude mice, and tumor growth was monitored. Tumor volume and weight were significantly lower in the CPA4 knockdown group than in the negative control group (Fig. 2I, J). Moreover, much lower expression of CPA4, STAT3 and ERK was found in CPA4 knockdown group than that in the control group, as detected by IHC analysis (Fig. 2K).
3.4. Overexpression of CPA4 promoted the proliferation and tumorigenesis of CRC cells CRC cell lines SW620 and RKO stably overexpressing CPA4 were established and the overexpression of CPA4 in these cells was confirmed by western blot (Fig. 3A, B). In comparison with control cells, the growth of SW620 and RKO cells was promoted by CPA4 overexpression, as determined by CCK-8 and colony formation assays (Fig. 3C–F). CPA4 overexpression also enhanced the migration and invasion of SW620 and RKO cells (Fig. 3G, H). Furthermore, to confirm the growth-promoting effects in vivo, tumorigenesis assays by subcutaneous injection were performed in nude mice. Overexpression of CPA4 in the RKO cells markedly promoted tumor growth in vivo (Fig. 3I, J). In addition, the IHC analysis revealed that expression of CPA4, STAT3 and ERK was increased in CPA4 overexpression group compared with control group (Fig. 3K).
Fig. 4. CPA4 Knockdown inhibits G1/S transition and apoptosis of colorectal cancer (CRC) cells. (A) and (B) Representative images of the cell cycle assays in HCT116 and LS123 cells after transfection with shNC or shCPA4. Cells were stained with propidium iodide and analyzed by flow cytometry. (C) and (D) Apoptosis of HCT116 and LS123 cells was determined by flow cytometry. Cells stained with annexin-V-APC were considered apoptotic.
H. Pan et al. / International Journal of Biological Macromolecules 138 (2019) 125–134
131
Changes in the cell cycle profile following CPA4 knockdown were analyzed by flow cytometry. The percentage of cells in the G1 phase was significantly increased for shCPA4-transfected HCT116 and LS123 cells compared with that of shNC-transfected cells (P b 0.05) (Fig. 4A, B). However, no significant difference was found in the percentage of cells in the S or G2/M phases after CPA4 knockdown. Together, the data show that CPA4 knockdown attenuates CRC cell proliferation by inhibiting the G1/S transition.
and LS123 cell lines. For HCT116 cells, the percentages of cells that underwent apoptosis were 4.29% and 23.07% (p b 0.01) for shNC and shCPA4 cells, respectively. For LS123 cells, the percentages of cells that underwent apoptosis were 4.57% and 13.23% (p b 0.01) for shNC and shCPA4 cells, respectively (Fig. 4C, D). The levels of caspases, a family of central regulators of apoptosis, were assessed by western blot. Cleavage of caspase-9 and caspase-3 was increased in CPA4 knockdown cells, while levels of cleaved caspases decreased in CPA4-overexpressing cells compared with those in control cells (Fig. 5A).
3.6. CPA4 inhibits apoptosis in CRC cells
3.7. CPA4 activates STAT3 and ERK pathways in CRC cells
The percentages of CRC cells that underwent apoptosis upon shCPA4-mediated knockdown were determined for both HCT116
To explore the regulatory mechanism of CPA4 in CRC, we examined changes in intracellular signaling molecules upon CPA4 knockdown in
3.5. CPA4 knockdown results in G1 arrest in CRC
Fig. 5. CPA4 activated STAT3 and ERK signaling pathways in colorectal cancer (CRC) cells. (A–B) The phosphorylation of intracellular signaling in HCT-116 and LS-123 with CPA4 knockdown was examined by intracellular protein assays. (C) The levels of phosphorylated ERK, total ERK, phosphorylated STAT3, total STAT3, and cleavage of caspase-9 and caspase3 were detected in CPA4-knockdown and -overexpressing cells by western blot analysis. GAPDH was used as the loading control. (D–G) The relative grey value of phosphorylated STAT3 and phosphorylated ERK were measured by Image J software.
132
H. Pan et al. / International Journal of Biological Macromolecules 138 (2019) 125–134
HCT116 and LS123 cells. A significant decrease in phosphorylation of STAT3-Tyr705 and ERK1/2-Tyr202/Tyr204 was detected (Fig. 5A, B). To further validate these findings, we measured the phosphorylation and total protein levels of STAT3 and ERK in CPA4 knockdown and overexpression cell lines using western blot. Relative to levels in control cells, levels of phosphorylated STAT3 and ERK were decreased in HCT116 and LS123 CPA4 knockdown cells, whereas phosphorylation of STAT3 and ERK was increased in SW620 and RKO cells
overexpressing CPA4 (Fig. 5C). However, the total protein levels of STAT3 and ERK did not change in any cell line. Then the CPA4 overexpressing RKO cells were treated with an STAT3 inhibitor (cryptotanshinone) or ERK inhibitor (U0126). The result of Western blots showed that STAT3 and ERK phosphorylation was subsequently inhibited in the CPA4 overexpressing RKO cells (Fig. 6A). In addition, CCK-8, colony formation assays and transwell assays revealed that the cell proliferation and growth, as well as migration and invasion
Fig. 6. The RKO cells with CPA4 overexpression were treated with the STAT3 inhibitor cryptotanshinone, the ERK inhibitor U01226. (A) The expression levels of the indicated proteins were measured by western blot. (B–D) The abilities of cell proliferation, growth, migration and invasion of RKO cells with CPA4 overexpression was determined by CCK-8 (B), colony formation assay (C), and transwell assays (D) after treatment with cryptotanshinone, U0126 or DMSO. (⁎⁎⁎p b 0.001).
H. Pan et al. / International Journal of Biological Macromolecules 138 (2019) 125–134
of these CRC cells promoted by CPA4 was reversed after treatment with cryptotanshinone or U0126 (Fig. 6B–F). The above results may show that CPA4 plays a role in promoting proliferation and inhibiting apoptosis of CRC by activating the STAT3 and ERK pathways.
133
that CPA4 plays an important role in tumor progression in CRC through activating the STAT3 and ERK signaling pathways. However, the direct downstream targets of CPA4 have not been identified, warranting further studies to discover the underlying molecular regulatory mechanisms.
4. Discussion 5. Conclusions In the present study, we showed for the first time that CPA4 expression is upregulated in CRC cell lines and tissue samples at both the mRNA and protein levels. Overexpression of CPA4 promoted CRC cell proliferation and colony-forming abilities, and inhibited cell apoptosis. Moreover, CPA4 also enhanced tumor growth in nude mice. In addition, knocking down CPA4 significantly inhibited CRC cell proliferation and tumor growth both in vitro and in vivo. Clinically, overexpression of CPA4, as observed by IHC staining, was associated with histological differentiation, tumor stage, and a shorter overall survival time of CRC patients. These results indicated that CPA4 plays a critical role in CRC cell growth and might be a reliable biomarker for CRC. CPA4, also known as CPA3, is a member of the carboxypeptidase A/B subfamily. CPA4 serves as a zinc-containing exopeptidase that catalyzes the release of carboxy-terminal amino acids, and is synthesized as a zymogen that is activated by proteolytic cleavage [13]. Moreover, CPA4 can participate in the histone hyperacetylation pathway and may modulate the function of peptides that affect the growth and regulation of prostate epithelial cells [14]. Coding variations in CPA4 may confer an increased risk of intermediate-to-high risk prostate cancer among younger patients [14]. Tanco et al. demonstrated that some of the peptides identified as CPA4 substrates have been previously shown to function in cell differentiation and proliferation, potentially explaining the correlation between CPA4 and cancer progression [3]. Kayashima et al. reported that CPA4 is imprinted and may be a strong candidate gene for predicting prostate cancer aggressiveness [4]. Upregulation of CPA4 was also detected in the MCF-7 breast cancer cell line, and may serve as a biomarker for the prognosis of breast cancer [5]. Hsu et al. observed aberrant expression of CPA4 in head and neck squamous cell carcinoma, and that this abnormality is associated with poor survival [6]. In addition, Sun et al. showed that CPA4 is overexpressed in a number of malignant tumors, and that CPA4 can exert a prognostic role in these cancers [7–12]. However, these studies did not provide insight into the functional role or underlying mechanism by which CPA4 influences cancer progression. To our knowledge, our study is the first to report the oncogenic function and mechanism of CPA4 in CRC using in vivo and in vitro experiments. Our study revealed that CPA4-mediated promotion of tumor cell growth may be attributable to activation of STAT3 and ERK signaling pathways. The JAK/STAT3 signaling pathway is associated with regulating cell growth and proliferation, as well as reducing apoptosis, and has been reported to be activated in several types of cancer [15,16]. STAT3 activity plays an important role in various carcinogenic processes, including cell cycle regulation, prevention of apoptosis, induction of survival factors, and establishment of uncontrolled growth [17,18]. The MAPK/ERK pathway is a classic intracellular signaling pathway, and is known to be closely associated with the progression of malignant tumors [19,20]. Accumulating evidence demonstrates that the MAPK/ ERK pathway is associated with proper performance of the cellular DNA damage response (DDR), the main pathway of tumor suppression [21]. In addition, the MAPK/ERK pathway is crucial for regulating tumor metabolism [22]. Finally, caspases are a family of protease enzymes that play essential roles in apoptosis [23,24]. We provide evidence in our study that the knockdown of CPA4 inhibits phosphorylation of the STAT3 and MAPK/ERK pathways, increasing caspase cleavage. Flow cytometry experiments also showed that the apoptosis index was increased in CPA4 knockdown cells. Moreover, after treatment with the STAT3 inhibitor cryptotanshinone or ERK inhibitor U0126 in CPA4overexpressing cells, cell growth was suppressed and phosphorylation of STAT3 and ERK was significantly decreased. Therefore, we propose
Collectively, our results revealed that CPA4 was upregulated in CRC tumor samples and cell lines. Overexpression of CPA4 was positively correlated with TNM stage and poor oncological outcomes. CPA4 promoted CRC cell growth in vivo and in vitro through activating the STAT3 and ERK signaling pathways. Our findings highlight the oncogenic role and potential mechanism of CPA4 in promoting CRC tumorigenesis. Funding This study was supported by Beijing Natural Science Foundation (7184240). Declaration of Competing Interest None. Acknowledgement The authors are grateful to Mrs. Xuan Zhang and Prof. Zhiyi Pan for providing help in data analysis. References [1] F. Bray, J. Ferlay, I. Soerjomataram, R.L. Siegel, L.A. Torre, A. Jemal, Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries, CA Cancer J. Clin. 68 (6) (2018) 394–424. [2] W. Chen, R. Zheng, P.D. Baade, S. Zhang, H. Zeng, F. Bray, A. Jemal, X.Q. Yu, J. He, Cancer statistics in China, 2015, CA Cancer J. Clin. 66 (2) (2016) 115–132. [3] S. Tanco, X. Zhang, C. Morano, F.X. Aviles, J. Lorenzo, L.D. Fricker, Characterization of the substrate specificity of human carboxypeptidase A4 and implications for a role in extracellular peptide processing, J. Biol. Chem. 285 (24) (2010) 18385–18396. [4] T. Kayashima, K. Yamasaki, T. Yamada, H. Sakai, N. Miwa, T. Ohta, K. Yoshiura, N. Matsumoto, Y. Nakane, H. Kanetake, F. Ishino, N. Niikawa, T. Kishino, The novel imprinted carboxypeptidase A4 gene (CPA4) in the 7q32 imprinting domain, Hum. Genet. 112 (3) (2003) 220–226. [5] A.A. Tan, W.M. Phang, S.C. Gopinath, O.H. Hashim, L.V. Kiew, Y. Chen, Revealing glycoproteins in the secretome of MCF-7 human breast cancer cells, Biomed. Res. Int. 2015 (2015), 453289. [6] C.M. Hsu, P.M. Lin, H.C. Lin, C.C. Lai, C.H. Yang, S.F. Lin, M.Y. Yang, Altered expression of imprinted genes in squamous cell carcinoma of the head and neck, Anticancer Res. 36 (5) (2016) 2251–2258. [7] L. Sun, J. Burnett, C. Guo, Y. Xie, J. Pan, Z. Yang, Y. Ran, D. Sun, CPA4 is a promising diagnostic serum biomarker for pancreatic cancer, Am. J. Cancer Res. 6 (1) (2016) 91–96. [8] L. Sun, C. Guo, J. Burnett, Z. Yang, Y. Ran, D. Sun, Serum carboxypeptidaseA4 levels predict liver metastasis in colorectal carcinoma, Oncotarget 7 (48) (2016) 78688–78697. [9] L. Sun, C. Guo, H. Yuan, J. Burnett, J. Pan, Z. Yang, Y. Ran, I. Myers, D. Sun, Overexpression of carboxypeptidase A4 (CPA4) is associated with poor prognosis in patients with gastric cancer, Am. J. Transl. Res. 8 (11) (2016) 5071–5075. [10] L. Sun, Y. Wang, H. Yuan, J. Burnett, J. Pan, Z. Yang, Y. Ran, I. Myers, D. Sun, CPA4 is a novel diagnostic and prognostic marker for human non-small-cell lung cancer, J. Cancer 7 (10) (2016) 1197–1204. [11] L. Sun, J. Cao, C. Guo, J. Burnett, Z. Yang, Y. Ran, D. Sun, Associations of carboxypeptidase 4 with ALDH1A1 expression and their prognostic value in esophageal squamous cell carcinoma, Dis. Esophagus 30 (6) (2017) 1–5. [12] L. Sun, C. Guo, J. Burnett, J. Pan, Z. Yang, Y. Ran, D. Sun, Association between expression of carboxypeptidase 4 and stem cell markers and their clinical significance in liver cancer development, J. Cancer 8 (1) (2017) 111–116. [13] I. Pallares, R. Bonet, R. Garcia-Castellanos, S. Ventura, F.X. Aviles, J. Vendrell, F.X. Gomis-Ruth, Structure of human carboxypeptidase A4 with its endogenous protein inhibitor, latexin, Proc. Natl. Acad. Sci. U. S. A. 102 (11) (2005) 3978–3983. [14] P.L. Ross, I. Cheng, X. Liu, M.S. Cicek, P.R. Carroll, G. Casey, J.S. Witte, Carboxypeptidase 4 gene variants and early-onset intermediate-to-high risk prostate cancer, BMC Cancer 9 (2009) 69. [15] R. Chang, L. Song, Y. Xu, Y. Wu, C. Dai, X. Wang, X. Sun, Y. Hou, W. Li, X. Zhan, L. Zhan, Loss of Wwox drives metastasis in triple-negative breast cancer by JAK2/STAT3 axis, Nat. Commun. 9 (1) (2018) 3486.
134
H. Pan et al. / International Journal of Biological Macromolecules 138 (2019) 125–134
[16] D.E. Johnson, R.A. O'Keefe, J.R. Grandis, Targeting the IL-6/JAK/STAT3 signalling axis in cancer, Nat. Rev. Clin. Oncol. 15 (4) (2018) 234–248. [17] N. Fathi, G. Rashidi, A. Khodadadi, S. Shahi, S. Sharifi, STAT3 and apoptosis challenges in cancer, Int. J. Biol. Macromol. 117 (2018) 993–1001. [18] C.Y. Loh, A. Arya, A.F. Naema, W.F. Wong, G. Sethi, C.Y. Looi, Signal transducer and activator of transcription (STATs) proteins in cancer and inflammation: functions and therapeutic implication, Front. Oncol. 9 (2019) 48. [19] M. Laplante, D.M. Sabatini, mTOR signaling in growth control and disease, Cell 149 (2) (2012) 274–293. [20] L.J. Bugaj, A.J. Sabnis, A. Mitchell, J.E. Garbarino, J.E. Toettcher, T.G. Bivona, W.A. Lim, Cancer mutations and targeted drugs can disrupt dynamic signal encoding by the Ras-Erk pathway, Science (New York, N.Y.) 361 (6405) (2018).
[21] S. Rezatabar, A. Karimian, V. Rameshknia, H. Parsian, M. Majidinia, T.A. Kopi, A. Bishayee, A. Sadeghinia, M. Yousefi, M. Monirialamdari, B. Yousefi, RAS/MAPK signaling functions in oxidative stress, DNA damage response and cancer progression, J. Cell. Physiol. (2019)https://doi.org/10.1002/jcp.28334 [Epub ahead of print]. [22] S. Papa, P.M. Choy, C. Bubici, The ERK and JNK pathways in the regulation of metabolic reprogramming, Oncogene 38 (13) (2019) 2223–2240. [23] S. Shalini, L. Dorstyn, S. Dawar, S. Kumar, Old, new and emerging functions of caspases, Cell Death Differ. 22 (4) (2015) 526–539. [24] P. Li, D. Nijhawan, I. Budihardjo, S.M. Srinivasula, M. Ahmad, E.S. Alnemri, X. Wang, Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade, Cell 91 (4) (1997) 479–489.