- Email: [email protected]
Carcinoembryonic antigen related cellular adhesion molecule 1 alleviates dextran sulfate sodium-induced ulcerative colitis in mice
Life Sciences 149 (2016) 120–128
Contents lists available at ScienceDirect
Life Sciences journal homepage: www.elsevier.com/locate/lifescie
Carcinoembryonic antigen related cellular adhesion molecule 1 alleviates dextran sulfate sodium-induced ulcerative colitis in mice Yu Jin, Yan Lin, Lianjie Lin, Yan Sun, Changqing Zheng ⁎ Department of Gastroenterology, Shengjing Hospital of China Medical University, Shenyang 110022, People's Republic of China
a r t i c l e
i n f o
Article history: Received 10 October 2015 Received in revised form 15 February 2016 Accepted 16 February 2016 Available online 17 February 2016 Keywords: Ulcerative colitis CEACAM1 Inflammation Colonic permeability Tight junction Epithelial cells restitution
a b s t r a c t Aims: To investigate the effects of exogenous carcinoembryonic antigen related cellular adhesion molecule 1 (CEACAM1) on ulcerative colitis (UC) in a dextran sulfate sodium (DSS)-induced mouse model. Main methods: UC mice model was induced by administration of DSS in drinking water for 7 days. Treatment of CEACAM1 was performed by a transrectal injection of CEACAM1 gene packed adenovirus in the mice. The severity of UC was evaluated using disease activity index and colon length. Histological changes were observed after hematoxylin and eosin staining. ELISA was used to measure secretion of pro-inflammatory cytokines in the colon tissue. The expression of mRNA and protein were detected using real-time PCR and western blotting. The effect of CEACAM1 on epithelial cell restitution was evaluated using wound-healing test in Caco-2 cells. Key findings: CEACAM1 overexpression attenuated the symptoms of UC as evidenced by decreased DAI score, increased colon length and histopathologic score. In addition, exogenous CEACAM1 reduced the levels of inflammatory cytokines and downregulated COX-2 and iNOS expression levels. Moreover, CEACAM1 overexpression decreased colonic permeability by upregulating expression of tight junction proteins. In the in vitro study, exogenous CEACAM1 promoted proliferation and migration of Caco-2 cell. Significance: Exogenous CEACAM1 effectively rescues the symptoms of UC in DSS mice through preventing inflammatory responses, improving epithelial barrier and promoting epithelial cells restitution. © 2016 Elsevier Inc. All rights reserved.
1. Introduction Inflammatory bowel disease (IBD) are relapsing systemic inflammatory diseases with unknown pathogenesis, primarily affecting the gastrointestinal tract. There are two main forms of IBD: Ulcerative colitis (UC) and Crohn's disease (CD) [1]. Although the medical technology has been rapidly developed, the incidence and the prevalence of IBD have still been increased around the world [2]. Even worse, long-term IBD is an important risk factor of colorectal cancer [3,4]. Intestinal barrier function plays a critical role in intestinal homeostasis maintaining. In UC, it has been found that intestinal barrier integrity was damaged and tight junction (TJ) formation was destroyed [5,6]. The TJ is comprised by transmembrane proteins, such as occludin and claudins, and cytoplasmatic linker proteins, such as zonula occludens (ZO)-1 [7–9]. Change of TJ protein expression often results in TJ disruption, which in turn causes barrier dysfunction [10].
⁎ Corresponding author at: Department of Gastroenterology, Shengjing Hospital of China Medical University, 39 Huaxiang Road, Shenyang 110022, People's Republic of China. E-mail address: [email protected] (C. Zheng).
http://dx.doi.org/10.1016/j.lfs.2016.02.065 0024-3205/© 2016 Elsevier Inc. All rights reserved.
Carcinoembryonic antigen related cellular adhesion molecule 1 (CEACAM1) is a multi-functional cell adhesion molecule which belongs to the CEACAM superfamily. CEACAM family is a subdivision of glycosylphosphatidylinositol-linked immunoglobulin superfamily [11]. The CEACAM family members are expressed on the surface of numerous types of cells such as endothelial cells, epithelial cells and myeloid cells in various organs. Among these characterized CEACAM members, CEACAM1 is the widest distribution one [12]. CEACAM1 possesses various biological functions, including angiogenesis, insulin action regulation, immune response and tumorigenesis [12–16]. In our previous study, CEACAM1 was showed to rescue the symptoms of TNBSinduced UC in mice by inhibiting inflammation, T cell infiltration, and apoptosis [17]. In order to further investigate the role of CEACAM1 in UC, we used another UC model to confirm the effect of CEACAM1 overexpression in colon. Studies have demonstrated that CEACAM1 was correlated with migration of colorectal cancer cells [18]. Migration of epithelial cells is a key processes involved in wound healing [19], thus we hypothesized that the colonic protective effect of CEACAM1 against UC may be associated with the repair of colonic cells. In the present study, CEACAM1 gene packed adenovirus was injected into the colon of UC mice induced by dextran sulfate sodium (DSS), and its effects against UC were confirmed. In addition, the colonic permeability and
Y. Jin et al. / Life Sciences 149 (2016) 120–128
the expression of tight junction proteins were measured. In the in vitro study, the effect of CEACAM1 overexpression on cell migration was evaluated on intestinal epithelial cell Caco-2 cells. 2. Materials and methods
121
(TNF)-α, interleukin (IL)-1β, interferon-γ (IFN-γ), and IL-6 in the colon tissues. MPO activity was assayed using a Myeloperoxidase Assay Kit (Jiancheng Bioengineering Institute, Nanjing, China). Procedures were conducted in strict accordance with the manufacture's protocols.
2.1. Animal model and gene therapy 2.6. Immunohistochemistry (IHC) assay Six to eight-week-old male C57BL/6 mice were obtained from the Experimental Animal Center of China Medical University (Shenyang, China). The experimental protocols were approved by the Experimental Animal Ethics Committee of China Medical University. All the animals were housed in the pathogen-free room and rested for 1 week with access to food and water ad libitum. The animals were randomly assigned to 6 groups as follows: control, control + vector, control + CEACAM1, DSS, DSS + vector, and DSS + CEACAM1, with six mice in each group. Colitis was induced in mice by administering 5% DSS (MP biomedicals, LLC., Santa Ana, CA, USA) in their drinking water for 1 week. One day after administration of DSS, all the mice in the control + CEACAM1 and DSS + CEACAM1 groups received a transrectal injection of 109 pfu of CEACAM1 adenovirus (Hanbio Biotechnology Co., Ltd., Shanghai, China), and mice in the control + vector and DSS + vector group received a transrectal injection of empty adenovirus vector using the previously established method [17]. Mice in the control and DSS groups received an equal volume of saline. The mice were weighed every day. 2.2. Colitis severity Stool consistency and rectal bleeding for each mouse were recorded before the mice were sacrificed in day 8. The disease activity index (DAI) was calculated following the previous method [20]. The colons from the colocecal junction to the anus were removed and colon lengths were measured. 2.3. Histological examination Colon tissues were fixed in 4% paraformaldehyde at 4 °C for 24 h and embedded in paraffin. The paraffin blocks of colon tissues were then cut into 5-μm-thick sections and stained with hematoxylin and eosin (H&E). Histological changes of the colon tissues were independently evaluated according to the methods reported previously by two pathologists in a blinded fashion [21]. 2.4. Assay of colonic mucosal permeability Colonic mucosal permeability was evaluated using a method described previously with modification [22]. The dissected colon was ligated at the proximal colon and distal rectum, and was perfused with 2 ml of 1.5% (w/v) Evans blue (EB; Sigma-Aldrich, St. Louis, MO, USA) in TrisBuffered saline (PBS). After 120 min of exposure in EB, the colon was opened and rinsed three times in 6 mM acetylcysteine (Sigma) in PBS to remove unabsorbed dye. After being dried on filter paper and weighed, the colon was incubated in formamide (Biosharp, Hefei, China) at 50 °C for 24 h in a shaking waterbath to elute the EB. Colorimetric measurements were performed on a microplate reader (ELX800, Bio-Tek Instruments, Winooski, VT, USA) at peak absorption of 632 nm. The permeability was represented as μg of EB/g of colonic tissue. 2.5. Pro-inflammatory cytokines measurement and myeloperoxidase activity assay The colon segments were homogenized at 4 °C in 0.9% saline solution. Enzyme-linked immunosorbent assay (ELISA) kits (USCN, Wuhan, China) were used to measure levels of tumor necrosis factor
Dewaxed tissue sections were incubated in 3% H2O2 for 15 min and then blocked with goat serum (Solarbio) for 15 min at room temperature. The sections were then incubated at 4 °C with cyclooxygenase 2 (COX2) or inducible nitric oxide synthase (iNOS) primary antibody (1:100; Wanleibio, Shenyang, China) overnight and incubated with biotinylated goat anti-rabbit secondary antibody (1:200, Beyotime) at 37 °C for 30 min. Subsequently, the sections were incubated with horseradish peroxidase (HRP) labelled streptavidin (Beyotime) for 30 min at 37 °C. The staining was visualized by reaction with diaminobenzidine tetrahydrochloride and counterstaining with hematoxylin. Finally, the stained sections were observed under an optic microscope (DP73; Olympus, Tokyo, Japan).
2.7. Cell culture Intestinal epithelial cells (Caco-2) were obtained from ATCC (Manassas, VA, USA) and grown in standard Dulbecco's modified Eagle medium (GIBCO, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (Hyclone, Logan, UT, USA) and 50 U/ml penicillin, and 50 μg/ml streptomycin in 5% CO2 and 37 °C.
2.8. Plasmid construction and transfection The plasmid expressing CEACAM1 was obtained by cloning the full coding sequences for wild-type into the vector pcDNA3.1 (Invitrogen, Carlsbad, CA, USA). The open-reading frame of CEACAM1 gene was amplified by PCR. The primers were listed as following: forward 5′- TTCA AGCTTATGGGGCACCTCTCAG -3′ and reverse 5′- TGGCTCGAGTTACTGC TTTTTTACTTCTGA -3′. PCR products were separated using 1.0% polyacrylamide gels, and the target fragment was cut off and isolated using an Agarose gel DNA Recovery kit (BioTeke Corporation, Beijing, China). The purified PCR fragment was ligated into HindIII/XhoI (Fermetas, Vilnius, Lithuania) digested pcDNA3.1 vector to yield the pcDNA3.1-CEACAM1 construct. The code sequence of the plasmid was then confirmed by sequencing. Caco-2 cells were planted on a 6-well plate at a density of 3 × 105 cells per well and cultured for 24 h. Then, the medium was changed to serum-free medium. Cells were transfected with pcDNA3.1-CEACAM1 plasmid using Lipofectamine 2000 (Invitrogen) for 4 h, and the medium was changed with normal medium. The expression of CEACAM1 was confirmed by real-time PCR and Western blot analysis.
2.9. MTT assay Cell viability of Caco-2 cells was assessed by MTT assay. Cells were seeded into 96-well plates at a concentration of approximately 3000 cells per well and cultured for 24 h. Cells were then transfected with the vector as described above. After being cultured for 12, 24, and 48 h, 5 mg/ml MTT (Sigma-Aldrich, St Louis, MO, USA) was added to each well, followed by 4 h of additional incubation. The supernatant was carefully withdrawn, and 200 μl of DMSO was added to each well to dissolve the insoluble formazan. The optical density was measured at 490 nm on a microplate reader (ELX-800, Bio-Tek Instruments).
122
Y. Jin et al. / Life Sciences 149 (2016) 120–128
2.10. Lactate dehydrogenase (LDH) release assay
3. Results
Caco-2 cells were exposed to 5% DSS for 48 h and the supernatant was collected for LDH release assay. LDH activity was measured using a standard LDH kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacture's instruction.
3.1. CEACAM1 expression in DSS-induced UC mice
2.11. RNA isolation and real-time PCR
The expression of CEACAM1 in mice was measured using realtime PCR and western blot. The results showed that the expression of CEACAM1 in the colon tissue was significantly enhanced after transrectal injection of CEACAM1 gene containing virus (Fig. 1, P b 0.01 compared with control group). However, after DSS exposure,
Total RNA was extracted from the colon tissue using a RNAsimple Total RNA Kit (TIANGEN Biotech, Beijing, China) in accordance with the manufacturer's protocol. The mRNA was reverse transcribed into complementary DNA using Super Moloney Murine Leukemia Virus Reverse Transcriptase (BioTeke, Beijing, China) and subjected to realtime polymerase chain reaction on an Exicycler 96 fluorescence quantitative detector (Bioneer, Daejeon, Korea). Levels of the mRNA were determined using SYBR Green (Solarbio) and β-actin was used as an internal reference. The primers sequences are listed in Table 1. 2.12. Western blot Total protein from the colon tissue was extracted using RIPA lysis buffer (Beyotime Institute of Biotechnology, Haimen, China) and the concentration was determined using a Bicinchoninic Acid Protein Assay Kit (Beyotime). A total of 40 μg of total protein from each sample was separated in sodium dodecyl sulfate polyacrylamide gel electrophoresis and the target proteins were transfer to a polyvinylidene fluoride membrane (Millipore, Bedford, MA, USA). The membrane was then incubated with primary antibodies overnight at 4 °C, followed by incubation with goat anti-rabbit IgG-HRP (1:5000; Beyotime) at room temperature for 45 min. Finally, the protein blots were visualized using the enhanced chemiluminecent (7 Sea Pharmtech, Shanghai, China) and exposed on films (Fuji Photo Film, Tokyo, Japan). The films were scanned and analyzed by Gel-Pro-Analyzer software (Media Cybernetics, Rockville, MD, USA) to determine the gray value of the blots, using β-actin as the internal control. 2.13. Statistical analysis All data were represented as means ± standard deviation (SD). Comparisons between groups were performed using one-way analysis of variance (ANOVA), followed by Fisher's least significant difference (LSD) post hoc test for multiple comparisons. P b 0.05 indicates statistically significant difference.
Table 1 Oligonucleotide primer sets for real-time PCR. Genes
Sequence(5′-3′)
Size (bp)
Mus CEACAM1-F Mus CEACAM1-R Homo CEACAM1-F Homo CEACAM1 R Mus iNOS-F Mus iNOS-R Mus COX-2-F Mus COX-2-R Mus Claudin-1-F Mus Claudin-1-R Mus ZO-1-F Mus ZO-1-R Mus Occludin-F Mus Occludin-R Mus β-actin-F Mus β-actin-R Homo β-actin-F Homo β-actin-R
AACCCTCAGCCTCCAACCA CAGACGGACAGATTATGCTCACT CCTGGCTTATCAATGGAACA ACTGAGTTATTGGCGTGGC GCAGGGAATCTTGGAGCGAGTTG GTAGGTGAGGGCTTGGCTGAGTG GATGACTGCCCAACTCCCA TGAACCCAGGTCCTCGCTTA GTCCTACTTTCCTGCTCCTGTCC ATGTCCATTTTGTATTTGCTCC CTGGTGGAAATGATGTCGGAAT CTTTAGGGAGGTCAAGGAGG TCTGCTTCATCGCTTCCTTAG GTCGGGTTCACTCCCATTA GGAGATTACTGCCCTGGCTCCTAGC GGCCGGACTCATCGTACTCCTGCTT CTTAGTTGCGTTACACCCTTTCTTG CTGTCACCTTCACCGTTCCAGTTT
191 106 139 193 146 165 160 155 156
Fig. 1. CEACAM1 expression levels in the colon tissues of DSS mice. Messenger RNA expression of CEACAM1 was detected using realtime PCR (A). Protein expression of CEACAM1 was detected using western blot (B). The relative mRNA and protein expression levels in the control group were represented as 1, and the relative expression levels in other groups were normalized to the control group. Data are expressed as mean ± standard deviation (n = 6). ##P b 0.01 compared with the control group, **P b 0.01 compared with the DSS group.
Y. Jin et al. / Life Sciences 149 (2016) 120–128
123
Fig. 2. Protective effects of CEACAM1 against DSS-induced UC in mice. Exogenous CEACAM1 decreased disease activity index (DAI) (A) and reduced colon length shortening (B) in DSSinduced colitis. Data are expressed as mean ± standard deviation (n = 6). ##P b 0.01 compared with the control group, **P b 0.01 compared with the DSS group.
the expression of CEACAM1 was markedly reduced compared with the control group (P b 0.01). The CEACAM1 overexpression completely reversed this reduction (P b 0.01 compared with the DSS group).
3.2. CEACAM1 overexpression attenuates DSS-induced UC in mice DAI score was used to evaluate the severity of UC in mice. On day 7, mice in the control group showed no sign of UC as evidenced by the 0
Fig. 3. Representative hematoxylin–eosin staining of colons of DSS mice in control (A), control + vector (B), control + CEACAM1 (C), DSS (D), DSS + vector (E), and DSS + CEACAM1 (F) groups. CEACAM1 gene overexpression attenuated DSS-induced inflammatory cells infiltration and necrosis in the colon. The morphologic changes and inflammatory responses score were shown in G. The number of goblet cells was shown in H. Scale bar: 100 μm. Data are expressed as mean ± standard deviation (n = 6). ##P b 0.01 compared with the control group, **P b 0.01 compared with the DSS group.
124
Y. Jin et al. / Life Sciences 149 (2016) 120–128
Fig. 4. Effects of exogenous CEACAM1 on inflammatory response in the colon of DSS mice. The levels of TNF-α (A), IL-1β (B), IL-6 (C) and IFN-γ (D) and myeloperoxidase (MPO) activity (E) in the colon tissue were decreased after re-introducing of exogenous CEACAM1. Data are expressed as mean ± standard deviation (n = 6). ##P b 0.01 compared with the control group, **P b 0.01 compared with the DSS group.
score of DAI (Fig. 2A). While in the DSS group, mice got an average score of higher than 2.5 (2.83 ± 0.86), indicating the occurrence of UC. Exogenous CEACAM1 overexpression resulted in a significantly lowered DAI score (1.39 ± 0.57, P b 0.01 compared with DSS group). In addition, colon length in the DSS group was obviously shorter than that in the control group (5.07 ± 0.69 vs. 9.70 ± 1.39 cm, P b 0.01), and were
largely restored by CEACAM1 overexpression (8.65 ± 1.28 cm, P b 0.01 compared with DSS group). Histological changes were observed by H&E staining. Greater infiltration of inflammatory cells, marked necrosis of colonic mucosa, and obvious reduction of goblet cells were found in mice of the DSS group (Fig. 3D, G and H). Exogenous CEACAM1 overexpression markedly
Fig. 5. Exogenous CEACAM1 downregulated expression of inflammatory enzymes in the colon of DSS mice. (A) immunohistochemistry analysis of expression of cyclooxygenase-2 (COX-2) and inducible nitric oxide synthase (iNOS). COX-2 (B) and (iNOS) expressions were also detected by realtime PCR and Western blot. The relative mRNA and protein expression levels in the control group were represented as 1, and the relative expression levels in other groups were normalized to the control group. Scale bar: 50 μm. Data are expressed as mean ± standard deviation (n = 6). ##P b 0.01 compared with the control group, **P b 0.01 compared with the DSS group.
Y. Jin et al. / Life Sciences 149 (2016) 120–128
attenuated DSS-induced UC symptoms (Fig. 3E and F). Vector injection did not alter the states of colons in either control or DSS mice. 3.3. CEACAM1 overexpression inhibits secretion of inflammatory cytokines in colon tissue of DSS-induced UC mice The production of inflammatory cytokines was detected using ELISA kits. The results revealed that productions of TNF-α, IL-6, IFN-γ and IL1β were increased markedly in the colon tissue of mice treated with DSS (Fig. 4A–D). CEACAM1 overexpression effectively inhibited the secretion of these cytokines. MPO, a biomarker of neutrophils activation and infiltration, was also found to be increased in the colon tissue of DSS mice (Fig. 4E), and CEACAM1 overexpression restored this change. Expression of COX-2 and iNOS, two enzymes related to inflammatory response, was measured using IHC and Western blot. As illustrated in Fig. 5, in the DSS group, expression levels of COX-2 and iNOS were both elevated in mRNA level and protein level. In contrast, exogenous CEACAM1 overexpression effectively downregulated the expression of these two enzymes. These data suggest that exogenous CEACAM1 suppresses inflammatory response in the colon tissue of DSS induced UC mice. 3.4. CEACAM1 overexpression improves intestinal permeability in DSSinduced colitis The results of permeability assay showed that the EB content of the colon tissue in the DSS group was dramatically increased compared with the control group (Fig. 6A). CEACAM1 overexpression markedly reduced the EB content, indicating the reduction of intestinal permeability. To further investigate the effect of CEACAM1 overexpression on intestinal permeability, the expression of TJ protein in the colon tissue was detected. As shown in Fig. 6B–H, expression levels of claudin-1, occludin and ZO-1 were dramatically decreased in both mRNA and protein in the UC mice. However, all the changes were restored in the CEACAM1 overexpression group. CEACAM1 overexpression has not affected TJ proteins expression in the normal control rats.
125
3.5. CEACAM1 overexpression improves repairing capability of intestinal epithelial cells CEACAM1 gene transit transfection successfully induced dramatically increased expression of mRNA and protein of CEACAM1 in Caco-2 cells (Fig. 7A). The result of MTT assay revealed that CEACAM1 not only increased cell proliferation of control cells, but also increased cell proliferation of DSS-exposed cells (Fig. 7B). Accordingly, CEACAM1 overexpression accelerated wound closure (Fig. 7D) in both control and DSS-exposed cells. In addition, CEACAM1 overexpression reduced LDH release induced by DSS (Fig. 7E) in Caco-2 monolayers. These data indicated that CEACAM1 promotes the repairing ability and decreases the permeability of intestinal epithelial cells.
4. Discussion Both DSS and TNBS are widely used in establishment of experimental IBD models [23]. However, the pathological mechanisms are different between models induced by these two reagents. In TNBS induced colitis, ethanol is needed to break the mucosal barrier, and TNBS is believed to induce a T-cell-mediated response against hapten modified autologous proteins, which is similar to the inflammatory processes in CD patients [23,24]. In contrast, DSS induces epithelial cells damage in the basal crypts, which is similar to the inflammatory processes in UC patients [24,25]. Therefore, in order to confirm the effect of CEACAM1 on other types of UC model, and investigate its effect on epithelial cells repair in UC, DSS-induced mice was used in this study. After DSS exposure for 1 week, the rats exhibited loss of body weight, loose stools, bloody feces and colonic shortening, which were consistent with the previous studies [26,27], suggesting the successful of the model establishment. CEACAM1 gene overexpression in the colon attenuated UC symptoms in DSS mice, as evident by the improved stool consistency, rectal bleeding and the shortening of colon. In histological examination, similar as the observation in our previous study on TNBS-treated mice, DSS induced mucosal destruction and CEACAM1 overexpression attenuated histological changes. These data indicate that CEACAM1 alleviates DSS-induced UC in mice.
Fig. 6. Effect of exogenous CEACAM1 on the intestinal permeability of DSS mice. CEACAM1 decreased evans blue content (A) and downregulated TJ proteins expression in DSS-treated mice (B–H). The relative mRNA and protein expression levels in the control group were represented as 1, and the relative expression levels in other groups were normalized to the control group. Data are expressed as mean ± standard deviation (n = 6). ##P b 0.01 compared with the control group, **P b 0.01 compared with the DSS group.
126
Y. Jin et al. / Life Sciences 149 (2016) 120–128
Several studies have shown the abnormality in the TJ complex in UC [28–31], which corresponds to the increase in intestinal permeability. IBD patients with continuous increase in intestinal permeability may have a poor prognosis [32,33]. Therefore, it is important to protect
intestinal permeability in IBD treatment. Intestinal epithelial TJ is a key component of intestinal barrier. Intestinal epithelial TJ barrier damage leads to an increase of intestinal permeability and results in the access of intraluminal antigens into the mucosa. Thus, pharmacological
Fig. 7. Effect of exogenous CEACAM1 on the intestinal epithelial cell restitution. (A) Significant increased CEACAM1 expression after transit transfection in Caco-2 cells. Exogenous CEACAM1 markedly enhanced the capability of proliferation (B) and migration (C) and reduced the LDH release (D) of Caco-2. The relative mRNA and protein expression levels in the control group were represented as 1, and the relative expression levels in other groups were normalized to the control group. Data are expressed as mean ± standard deviation (n = 3). *P b 0.05 compared with the control group, **P b 0.01 compared with the control group.
Y. Jin et al. / Life Sciences 149 (2016) 120–128
regulation of the intestinal TJ protein expression would be beneficial for the remission from IBD. In this study, we measured the expression of three key TJ proteins: claudin-1, occludin and ZO-1. Claudin-1 belongs to the claudins family. This family and occludin make up the transmembrane proteins. Claudins form the TJ pore for small solutes and ions [9, 34], whereas occludin regulates macromolecule flux across the intestinal epithelial tight junction barrier [35]. ZO-1 is a member of the membrane-associated guanylate kinase homologs family. These membrane-associated signaling molecules bind to the transmembrane and cytosolic tight junction proteins to regulate the TJ complex [36]. Of these three TJ proteins, downregulation of occludin and ZO-1 in UC was confirmed by a number of studies. In line with their functions, occludin depletion in intestinal epithelial cells leads to an increase in macromolecule flux. Loss of ZO-1 results in the destruction of link between transmembrane tight junction proteins and actin. However, the observation of claudin-1 expression in UC varies with studies [28,37, 38], and the reason remains to be clarified. In the present study, DSS exposure induced a dramatic downregulation of claudin-1, occludin and ZO-1 both in mRNA and protein level. Whereas re-introducing exogenous CEACAM-1 gene to colon restored these changes and significantly decreased intestinal permeability. These data suggest that CEACAM-1 plays a protective role in the colon of UC mice by modulating TJ proteins and therefore decreasing intestinal permeability. The cause of UC is not fully clear. However, the uncontrolled inflammatory response in the intestinal tract is considered to be closely related to the pathogenesis of UC. We have demonstrated previously that CEACAM1 overexpression decreased secretion of inflammatory cytokines such as TNF-α, INF-γ and IL-6 in the colon tissue of TNBS mice. Here, we repeated the examination of inflammatory responses in DSS mice because the different pathological mechanisms in these two IBD model. We not only observed the similar results in DSS-induced UC model, but also found that the pro-inflammatory enzymes, such as COX-2 and iNOS were downregulated after the re-introducing of exogenous CEACAM1 into the colon tissue. These data indicate that CEACAM1 plays an important role in pro-inflammatory cytokines regulation in DSS-induced UC. The relationship between colonic permeability and intestinal inflammation in UC has been discussed in previous study [28]. The damage of TJ barrier and the increased colonic permeability were considered to precede the inflammatory responses in colon of DSS-induced UC mice. An earlier study also reported the late onset of the intestinal inflammation in DSS-induced UC [39]. However, some studies also demonstrated that pro-inflammatory cytokines induced intestinal epithelial barrier dysfunction [40–42]. Together these observations, we consider that there is a vicious cycle between intestinal permeability increase and inflammatory response in the UC colon. Permeability is increased by antigens and consequently inflammatory cytokines released, which in turn increased intestinal permeability. In this study, we obtained data in late stage of UC, thus we observed both increased colonic permeability and inflammatory response in the colon. This limited us to find out the exact mechanism of the permeability protective effect of CEACAM1. Whether it regulates TJ proteins directly thereby inhibiting inflammation or it upregulates TJ proteins through preventing the production of inflammatory cytokines is unclear. This will be further studied in the future. Integrity of intestinal epithelium is also important to maintain barrier function of the gastrointestinal tract. The epithelial cells surrounding the wound play a crucial role in the wound-healing process [43,44]. Intestinal wound healing is dependent on the ability of migration, proliferation and differentiation of the intestinal epithelial cells. In the present study, we found that CEACAM1 overexpression significantly increased proliferation and migration abilities in Caco-2 cells, which indicated that CEACAM1 promote colonic epithelial restitution in UC. 5. Conclusion In conclusion, exogenous expression of CEACAM1 alleviates DSSinduced UC in mice through preventing inflammatory response,
127
regulating expression of TJ proteins and promoting colonic epithelial restitution. CEACAM1 may become a potential target of UC therapy. Conflict of interest statement The authors declare that they have no conflicts of interest concerning this article.
Acknowledgments This study was supported by a grant from the Science and Technology Program of Department of Science and Technology, Liaoning Province (No.: 2013225303). References [1] A. Kaser, S. Zeissig, R.S. Blumberg, Inflammatory bowel disease, Annu. Rev. Immunol. 28 (2010) 573–621. [2] N.A. Molodecky, I.S. Soon, D.M. Rabi, W.A. Ghali, M. Ferris, G. Chernoff, et al., Increasing incidence and prevalence of the inflammatory bowel diseases with time, based on systematic review, Gastroenterology 142 (2012) 46–54. [3] M. Yashiro, Molecular alterations of colorectal cancer with inflammatory bowel disease, Dig. Dis. Sci. 60 (2015) 2251–2263. [4] S.I. Grivennikov, Inflammation and colorectal cancer: colitis-associated neoplasia, Semin. Immunopathol. 35 (2013) 229–244. [5] A.H. Gitter, F. Wullstein, M. Fromm, J.D. Schulzke, Epithelial barrier defects in ulcerative colitis: characterization and quantification by electrophysiological imaging, Gastroenterology 121 (2001) 1320–1328. [6] S. Tsukita, M. Furuse, M. Itoh, Multifunctional strands in tight junctions, Nat. Rev. Mol. Cell. Biol. 2 (2001) 285–293. [7] A.S. Fanning, B.J. Jameson, L.A. Jesaitis, J.M. Anderson, The tight junction protein ZO-1 establishes a link between the transmembrane protein occludin and the actin cytoskeleton, J. Biol. Chem. 273 (1998) 29745–29753. [8] K. Matter, M.S. Balda, Occludin and the functions of tight junctions, Int. Rev. Cytol. 186 (1999) 117–146. [9] C.M. Van Itallie, J.M. Anderson, Claudins and epithelial paracellular transport, Annu. Rev. Physiol. 68 (2006) 403–429. [10] N. Sonoda, M. Furuse, H. Sasaki, S. Yonemura, J. Katahira, Y. Horiguchi, et al., Clostridium perfringens Enterotoxin fragment removes specific claudins from tight junction strands: evidence for direct involvement of claudins in tight junction barrier, J. Cell. Biol. 147 (1999) 195–204. [11] J.A. Thompson, A.M. Eades-Perner, M. Ditter, W.J. Muller, W. Zimmermann, Expression of transgenic carcinoembryonic antigen (CEA) in tumor-prone mice: an animal model for CEA-directed tumor immunotherapy, Int. J. Cancer 72 (1997) 197–202. [12] K. Kuespert, S. Pils, C.R. Hauck, CEACAMs: their role in physiology and pathophysiology, Curr. Opin. Cell Biol. 18 (2006) 565–571. [13] Q.Y. Al-Share, A.M. DeAngelis, S.G. Lester, T.A. Bowman, S.K. Ramakrishnan, S.L. Abdallah, et al., Forced hepatic overexpression of CEACAM1 curtails diet-induced insulin resistance, Diabetes 64 (2015) 2780–2790. [14] V. Khairnar, V. Duhan, S.K. Maney, N. Honke, N. Shaabani, A.A. Pandyra, et al., CEACAM1 induces B-cell survival and is essential for protective antiviral antibody production, Nat. Commun. 6 (2015) 6217. [15] S.M. Najjar, K.J. Ledford, S.L. Abdallah, A. Paus, L. Russo, M.K. Kaw, et al., Ceacam1 deletion causes vascular alterations in large vessels, Am. J. Physiol. Endocrinol. Metab. 305 (2013) E519–E529. [16] R. Lu, M. Kujawski, H. Pan, J.E. Shively, Tumor angiogenesis mediated by myeloid cells is negatively regulated by CEACAM1, Cancer Res. 72 (2012) 2239–2250. [17] Y. Jin, L. Lin, Y. Lin, C. Zheng, Exogenous carcinoembryonic antigen-related cell adhesion molecule 1 suppresses 2,4,6-trinitrobenzene sulfonic acid-induced ulcerative colitis in mice, J. Surg. Res. 195 (2015) 113–120. [18] J. Ieda, S. Yokoyama, K. Tamura, K. Takifuji, T. Hotta, K. Matsuda, et al., Re-expression of CEACAM1 long cytoplasmic domain isoform is associated with invasion and migration of colorectal cancer, Int. J. Cancer 129 (2011) 1351–1361. [19] B.J. Goggins, C. Chaney, G.L. Radford-Smith, J.C. Horvat, S. Keely, Hypoxia and integrin-mediated epithelial restitution during mucosal inflammation, Front. Immunol. 4 (2013) 272. [20] W.M. Raup-Konsavage, T.K. Cooper, G.S. Yochum, A role for MYC in lithium-stimulated repair of the colonic epithelium after DSS-induced damage in mice, Dig. Dis. Sci. (2015). [21] A.A. Abdin, Targeting sphingosine kinase 1 (SphK1) and apoptosis by colon-specific delivery formula of resveratrol in treatment of experimental ulcerative colitis in rats, Eur. J. Pharmacol. 718 (2013) 145–153. [22] S. Lange, D.S. Delbro, E. Jennische, Evans blue permeation of intestinal mucosa in the rat, Scand. J. Gastroenterol. 29 (1994) 38–46. [23] S. Wirtz, C. Neufert, B. Weigmann, M.F. Neurath, Chemically induced mouse models of intestinal inflammation, Nat. Protoc. 2 (2007) 541–546. [24] B. Foligne, S. Nutten, L. Steidler, V. Dennin, D. Goudercourt, A. Mercenier, et al., Recommendations for improved use of the murine TNBS-induced colitis model in evaluating anti-inflammatory properties of lactic acid bacteria: technical and microbiological aspects, Dig. Dis. Sci. 51 (2006) 390–400. [25] L.A. Dieleman, B.U. Ridwan, G.S. Tennyson, K.W. Beagley, R.P. Bucy, C.O. Elson, Dextran sulfate sodium-induced colitis occurs in severe combined immunodeficient mice, Gastroenterology 107 (1994) 1643–1652.
128
Y. Jin et al. / Life Sciences 149 (2016) 120–128
[26] R.B. Patel, K.D. Prajapati, B.M. Sonara, M.M. Sharma, H.M. Patel, V.D. Pawar, et al., Ameliorative potential of aliskiren in experimental colitis in mice, Eur. J. Pharmacol. 737 (2014) 70–76. [27] Y. Lin, L. Lin, Q. Wang, Y. Jin, Y. Zhang, Y. Cao, et al., Transplantation of human umbilical mesenchymal stem cells attenuates dextran sulfate sodium-induced colitis in mice, Clin. Exp. Pharmacol. Physiol. 42 (2015) 76–86. [28] L.S. Poritz, K.I. Garver, C. Green, L. Fitzpatrick, F. Ruggiero, W.A. Koltun, Loss of the tight junction protein ZO-1 in dextran sulfate sodium induced colitis, J. Surg. Res. 140 (2007) 12–19. [29] S. Resta-Lenert, J. Smitham, K.E. Barrett, Epithelial dysfunction associated with the development of colitis in conventionally housed mdr1a−/− mice, Am. J. Physiol. Gastrointest. Liver Physiol. 289 (2005) G153–G162. [30] T. Kucharzik, S.V. Walsh, J. Chen, C.A. Parkos, A. Nusrat, Neutrophil transmigration in inflammatory bowel disease is associated with differential expression of epithelial intercellular junction proteins, Am. J. Pathol. 159 (2001) 2001–2009. [31] T. Oshima, H. Miwa, T. Joh, Changes in the expression of claudins in active ulcerative colitis, J. Gastroenterol. Hepatol. 23 (Suppl. 2) (2008) S146–S150. [32] T.Y. Ma, Intestinal epithelial barrier dysfunction in Crohn's disease, Proc. Soc. Exp. Biol. Med. 214 (1997) 318–327. [33] A. Bitton, P.L. Dobkin, M.D. Edwardes, M.J. Sewitch, J.B. Meddings, S. Rawal, et al., Predicting relapse in Crohn's disease: a biopsychosocial model, Gut 57 (2008) 1386–1392. [34] C.M. Van Itallie, L.L. Mitic, J.M. Anderson, Claudin-2 forms homodimers and is a component of a high molecular weight protein complex, J. Biol. Chem. 286 (2011) 3442–3450. [35] R. Al-Sadi, K. Khatib, S. Guo, D. Ye, M. Youssef, T. Ma, Occludin regulates macromolecule flux across the intestinal epithelial tight junction barrier, Am. J. Physiol. Gastrointest. Liver Physiol. 300 (2011) G1054–G1064.
[36] A.S. Fanning, T.Y. Ma, J.M. Anderson, Isolation and functional characterization of the actin binding region in the tight junction protein ZO-1, FASEB J. 16 (2002) 1835–1837. [37] L.S. Poritz, L.R. Harris 3rd, A.A. Kelly, W.A. Koltun, Increase in the tight junction protein claudin-1 in intestinal inflammation, Dig. Dis. Sci. 56 (2011) 2802–2809. [38] T. Kinugasa, Y. Akagi, T. Yoshida, Y. Ryu, I. Shiratuchi, N. Ishibashi, et al., Increased claudin-1 protein expression contributes to tumorigenesis in ulcerative colitisassociated colorectal cancer, Anticancer Res. 30 (2010) 3181–3186. [39] S. Kitajima, S. Takuma, M. Morimoto, Changes in colonic mucosal permeability in mouse colitis induced with dextran sulfate sodium, Exp. Anim. 48 (1999) 137–143. [40] J. Mankertz, S. Tavalali, H. Schmitz, A. Mankertz, E.O. Riecken, M. Fromm, et al., Expression from the human occludin promoter is affected by tumor necrosis factor alpha and interferon gamma, J. Cell. Sci. 113 (Pt 11) (2000) 2085–2090. [41] F. Wang, W.V. Graham, Y. Wang, E.D. Witkowski, B.T. Schwarz, J.R. Turner, Interferon-gamma and tumor necrosis factor-alpha synergize to induce intestinal epithelial barrier dysfunction by up-regulating myosin light chain kinase expression, Am. J. Pathol. 166 (2005) 409–419. [42] A. Youakim, M. Ahdieh, Interferon-gamma decreases barrier function in T84 cells by reducing ZO-1 levels and disrupting apical actin, Am. J. Physiol. 276 (1999) G1279–G1288. [43] M. Iizuka, S. Konno, Wound healing of intestinal epithelial cells, World J. Gastroenterol. 17 (2011) 2161–2171. [44] J.A. Efstathiou, M. Pignatelli, Modulation of epithelial cell adhesion in gastrointestinal homeostasis, Am. J. Pathol. 153 (1998) 341–347.
Contents lists available at ScienceDirect
Life Sciences journal homepage: www.elsevier.com/locate/lifescie
Carcinoembryonic antigen related cellular adhesion molecule 1 alleviates dextran sulfate sodium-induced ulcerative colitis in mice Yu Jin, Yan Lin, Lianjie Lin, Yan Sun, Changqing Zheng ⁎ Department of Gastroenterology, Shengjing Hospital of China Medical University, Shenyang 110022, People's Republic of China
a r t i c l e
i n f o
Article history: Received 10 October 2015 Received in revised form 15 February 2016 Accepted 16 February 2016 Available online 17 February 2016 Keywords: Ulcerative colitis CEACAM1 Inflammation Colonic permeability Tight junction Epithelial cells restitution
a b s t r a c t Aims: To investigate the effects of exogenous carcinoembryonic antigen related cellular adhesion molecule 1 (CEACAM1) on ulcerative colitis (UC) in a dextran sulfate sodium (DSS)-induced mouse model. Main methods: UC mice model was induced by administration of DSS in drinking water for 7 days. Treatment of CEACAM1 was performed by a transrectal injection of CEACAM1 gene packed adenovirus in the mice. The severity of UC was evaluated using disease activity index and colon length. Histological changes were observed after hematoxylin and eosin staining. ELISA was used to measure secretion of pro-inflammatory cytokines in the colon tissue. The expression of mRNA and protein were detected using real-time PCR and western blotting. The effect of CEACAM1 on epithelial cell restitution was evaluated using wound-healing test in Caco-2 cells. Key findings: CEACAM1 overexpression attenuated the symptoms of UC as evidenced by decreased DAI score, increased colon length and histopathologic score. In addition, exogenous CEACAM1 reduced the levels of inflammatory cytokines and downregulated COX-2 and iNOS expression levels. Moreover, CEACAM1 overexpression decreased colonic permeability by upregulating expression of tight junction proteins. In the in vitro study, exogenous CEACAM1 promoted proliferation and migration of Caco-2 cell. Significance: Exogenous CEACAM1 effectively rescues the symptoms of UC in DSS mice through preventing inflammatory responses, improving epithelial barrier and promoting epithelial cells restitution. © 2016 Elsevier Inc. All rights reserved.
1. Introduction Inflammatory bowel disease (IBD) are relapsing systemic inflammatory diseases with unknown pathogenesis, primarily affecting the gastrointestinal tract. There are two main forms of IBD: Ulcerative colitis (UC) and Crohn's disease (CD) [1]. Although the medical technology has been rapidly developed, the incidence and the prevalence of IBD have still been increased around the world [2]. Even worse, long-term IBD is an important risk factor of colorectal cancer [3,4]. Intestinal barrier function plays a critical role in intestinal homeostasis maintaining. In UC, it has been found that intestinal barrier integrity was damaged and tight junction (TJ) formation was destroyed [5,6]. The TJ is comprised by transmembrane proteins, such as occludin and claudins, and cytoplasmatic linker proteins, such as zonula occludens (ZO)-1 [7–9]. Change of TJ protein expression often results in TJ disruption, which in turn causes barrier dysfunction [10].
⁎ Corresponding author at: Department of Gastroenterology, Shengjing Hospital of China Medical University, 39 Huaxiang Road, Shenyang 110022, People's Republic of China. E-mail address: [email protected] (C. Zheng).
http://dx.doi.org/10.1016/j.lfs.2016.02.065 0024-3205/© 2016 Elsevier Inc. All rights reserved.
Carcinoembryonic antigen related cellular adhesion molecule 1 (CEACAM1) is a multi-functional cell adhesion molecule which belongs to the CEACAM superfamily. CEACAM family is a subdivision of glycosylphosphatidylinositol-linked immunoglobulin superfamily [11]. The CEACAM family members are expressed on the surface of numerous types of cells such as endothelial cells, epithelial cells and myeloid cells in various organs. Among these characterized CEACAM members, CEACAM1 is the widest distribution one [12]. CEACAM1 possesses various biological functions, including angiogenesis, insulin action regulation, immune response and tumorigenesis [12–16]. In our previous study, CEACAM1 was showed to rescue the symptoms of TNBSinduced UC in mice by inhibiting inflammation, T cell infiltration, and apoptosis [17]. In order to further investigate the role of CEACAM1 in UC, we used another UC model to confirm the effect of CEACAM1 overexpression in colon. Studies have demonstrated that CEACAM1 was correlated with migration of colorectal cancer cells [18]. Migration of epithelial cells is a key processes involved in wound healing [19], thus we hypothesized that the colonic protective effect of CEACAM1 against UC may be associated with the repair of colonic cells. In the present study, CEACAM1 gene packed adenovirus was injected into the colon of UC mice induced by dextran sulfate sodium (DSS), and its effects against UC were confirmed. In addition, the colonic permeability and
Y. Jin et al. / Life Sciences 149 (2016) 120–128
the expression of tight junction proteins were measured. In the in vitro study, the effect of CEACAM1 overexpression on cell migration was evaluated on intestinal epithelial cell Caco-2 cells. 2. Materials and methods
121
(TNF)-α, interleukin (IL)-1β, interferon-γ (IFN-γ), and IL-6 in the colon tissues. MPO activity was assayed using a Myeloperoxidase Assay Kit (Jiancheng Bioengineering Institute, Nanjing, China). Procedures were conducted in strict accordance with the manufacture's protocols.
2.1. Animal model and gene therapy 2.6. Immunohistochemistry (IHC) assay Six to eight-week-old male C57BL/6 mice were obtained from the Experimental Animal Center of China Medical University (Shenyang, China). The experimental protocols were approved by the Experimental Animal Ethics Committee of China Medical University. All the animals were housed in the pathogen-free room and rested for 1 week with access to food and water ad libitum. The animals were randomly assigned to 6 groups as follows: control, control + vector, control + CEACAM1, DSS, DSS + vector, and DSS + CEACAM1, with six mice in each group. Colitis was induced in mice by administering 5% DSS (MP biomedicals, LLC., Santa Ana, CA, USA) in their drinking water for 1 week. One day after administration of DSS, all the mice in the control + CEACAM1 and DSS + CEACAM1 groups received a transrectal injection of 109 pfu of CEACAM1 adenovirus (Hanbio Biotechnology Co., Ltd., Shanghai, China), and mice in the control + vector and DSS + vector group received a transrectal injection of empty adenovirus vector using the previously established method [17]. Mice in the control and DSS groups received an equal volume of saline. The mice were weighed every day. 2.2. Colitis severity Stool consistency and rectal bleeding for each mouse were recorded before the mice were sacrificed in day 8. The disease activity index (DAI) was calculated following the previous method [20]. The colons from the colocecal junction to the anus were removed and colon lengths were measured. 2.3. Histological examination Colon tissues were fixed in 4% paraformaldehyde at 4 °C for 24 h and embedded in paraffin. The paraffin blocks of colon tissues were then cut into 5-μm-thick sections and stained with hematoxylin and eosin (H&E). Histological changes of the colon tissues were independently evaluated according to the methods reported previously by two pathologists in a blinded fashion [21]. 2.4. Assay of colonic mucosal permeability Colonic mucosal permeability was evaluated using a method described previously with modification [22]. The dissected colon was ligated at the proximal colon and distal rectum, and was perfused with 2 ml of 1.5% (w/v) Evans blue (EB; Sigma-Aldrich, St. Louis, MO, USA) in TrisBuffered saline (PBS). After 120 min of exposure in EB, the colon was opened and rinsed three times in 6 mM acetylcysteine (Sigma) in PBS to remove unabsorbed dye. After being dried on filter paper and weighed, the colon was incubated in formamide (Biosharp, Hefei, China) at 50 °C for 24 h in a shaking waterbath to elute the EB. Colorimetric measurements were performed on a microplate reader (ELX800, Bio-Tek Instruments, Winooski, VT, USA) at peak absorption of 632 nm. The permeability was represented as μg of EB/g of colonic tissue. 2.5. Pro-inflammatory cytokines measurement and myeloperoxidase activity assay The colon segments were homogenized at 4 °C in 0.9% saline solution. Enzyme-linked immunosorbent assay (ELISA) kits (USCN, Wuhan, China) were used to measure levels of tumor necrosis factor
Dewaxed tissue sections were incubated in 3% H2O2 for 15 min and then blocked with goat serum (Solarbio) for 15 min at room temperature. The sections were then incubated at 4 °C with cyclooxygenase 2 (COX2) or inducible nitric oxide synthase (iNOS) primary antibody (1:100; Wanleibio, Shenyang, China) overnight and incubated with biotinylated goat anti-rabbit secondary antibody (1:200, Beyotime) at 37 °C for 30 min. Subsequently, the sections were incubated with horseradish peroxidase (HRP) labelled streptavidin (Beyotime) for 30 min at 37 °C. The staining was visualized by reaction with diaminobenzidine tetrahydrochloride and counterstaining with hematoxylin. Finally, the stained sections were observed under an optic microscope (DP73; Olympus, Tokyo, Japan).
2.7. Cell culture Intestinal epithelial cells (Caco-2) were obtained from ATCC (Manassas, VA, USA) and grown in standard Dulbecco's modified Eagle medium (GIBCO, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (Hyclone, Logan, UT, USA) and 50 U/ml penicillin, and 50 μg/ml streptomycin in 5% CO2 and 37 °C.
2.8. Plasmid construction and transfection The plasmid expressing CEACAM1 was obtained by cloning the full coding sequences for wild-type into the vector pcDNA3.1 (Invitrogen, Carlsbad, CA, USA). The open-reading frame of CEACAM1 gene was amplified by PCR. The primers were listed as following: forward 5′- TTCA AGCTTATGGGGCACCTCTCAG -3′ and reverse 5′- TGGCTCGAGTTACTGC TTTTTTACTTCTGA -3′. PCR products were separated using 1.0% polyacrylamide gels, and the target fragment was cut off and isolated using an Agarose gel DNA Recovery kit (BioTeke Corporation, Beijing, China). The purified PCR fragment was ligated into HindIII/XhoI (Fermetas, Vilnius, Lithuania) digested pcDNA3.1 vector to yield the pcDNA3.1-CEACAM1 construct. The code sequence of the plasmid was then confirmed by sequencing. Caco-2 cells were planted on a 6-well plate at a density of 3 × 105 cells per well and cultured for 24 h. Then, the medium was changed to serum-free medium. Cells were transfected with pcDNA3.1-CEACAM1 plasmid using Lipofectamine 2000 (Invitrogen) for 4 h, and the medium was changed with normal medium. The expression of CEACAM1 was confirmed by real-time PCR and Western blot analysis.
2.9. MTT assay Cell viability of Caco-2 cells was assessed by MTT assay. Cells were seeded into 96-well plates at a concentration of approximately 3000 cells per well and cultured for 24 h. Cells were then transfected with the vector as described above. After being cultured for 12, 24, and 48 h, 5 mg/ml MTT (Sigma-Aldrich, St Louis, MO, USA) was added to each well, followed by 4 h of additional incubation. The supernatant was carefully withdrawn, and 200 μl of DMSO was added to each well to dissolve the insoluble formazan. The optical density was measured at 490 nm on a microplate reader (ELX-800, Bio-Tek Instruments).
122
Y. Jin et al. / Life Sciences 149 (2016) 120–128
2.10. Lactate dehydrogenase (LDH) release assay
3. Results
Caco-2 cells were exposed to 5% DSS for 48 h and the supernatant was collected for LDH release assay. LDH activity was measured using a standard LDH kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacture's instruction.
3.1. CEACAM1 expression in DSS-induced UC mice
2.11. RNA isolation and real-time PCR
The expression of CEACAM1 in mice was measured using realtime PCR and western blot. The results showed that the expression of CEACAM1 in the colon tissue was significantly enhanced after transrectal injection of CEACAM1 gene containing virus (Fig. 1, P b 0.01 compared with control group). However, after DSS exposure,
Total RNA was extracted from the colon tissue using a RNAsimple Total RNA Kit (TIANGEN Biotech, Beijing, China) in accordance with the manufacturer's protocol. The mRNA was reverse transcribed into complementary DNA using Super Moloney Murine Leukemia Virus Reverse Transcriptase (BioTeke, Beijing, China) and subjected to realtime polymerase chain reaction on an Exicycler 96 fluorescence quantitative detector (Bioneer, Daejeon, Korea). Levels of the mRNA were determined using SYBR Green (Solarbio) and β-actin was used as an internal reference. The primers sequences are listed in Table 1. 2.12. Western blot Total protein from the colon tissue was extracted using RIPA lysis buffer (Beyotime Institute of Biotechnology, Haimen, China) and the concentration was determined using a Bicinchoninic Acid Protein Assay Kit (Beyotime). A total of 40 μg of total protein from each sample was separated in sodium dodecyl sulfate polyacrylamide gel electrophoresis and the target proteins were transfer to a polyvinylidene fluoride membrane (Millipore, Bedford, MA, USA). The membrane was then incubated with primary antibodies overnight at 4 °C, followed by incubation with goat anti-rabbit IgG-HRP (1:5000; Beyotime) at room temperature for 45 min. Finally, the protein blots were visualized using the enhanced chemiluminecent (7 Sea Pharmtech, Shanghai, China) and exposed on films (Fuji Photo Film, Tokyo, Japan). The films were scanned and analyzed by Gel-Pro-Analyzer software (Media Cybernetics, Rockville, MD, USA) to determine the gray value of the blots, using β-actin as the internal control. 2.13. Statistical analysis All data were represented as means ± standard deviation (SD). Comparisons between groups were performed using one-way analysis of variance (ANOVA), followed by Fisher's least significant difference (LSD) post hoc test for multiple comparisons. P b 0.05 indicates statistically significant difference.
Table 1 Oligonucleotide primer sets for real-time PCR. Genes
Sequence(5′-3′)
Size (bp)
Mus CEACAM1-F Mus CEACAM1-R Homo CEACAM1-F Homo CEACAM1 R Mus iNOS-F Mus iNOS-R Mus COX-2-F Mus COX-2-R Mus Claudin-1-F Mus Claudin-1-R Mus ZO-1-F Mus ZO-1-R Mus Occludin-F Mus Occludin-R Mus β-actin-F Mus β-actin-R Homo β-actin-F Homo β-actin-R
AACCCTCAGCCTCCAACCA CAGACGGACAGATTATGCTCACT CCTGGCTTATCAATGGAACA ACTGAGTTATTGGCGTGGC GCAGGGAATCTTGGAGCGAGTTG GTAGGTGAGGGCTTGGCTGAGTG GATGACTGCCCAACTCCCA TGAACCCAGGTCCTCGCTTA GTCCTACTTTCCTGCTCCTGTCC ATGTCCATTTTGTATTTGCTCC CTGGTGGAAATGATGTCGGAAT CTTTAGGGAGGTCAAGGAGG TCTGCTTCATCGCTTCCTTAG GTCGGGTTCACTCCCATTA GGAGATTACTGCCCTGGCTCCTAGC GGCCGGACTCATCGTACTCCTGCTT CTTAGTTGCGTTACACCCTTTCTTG CTGTCACCTTCACCGTTCCAGTTT
191 106 139 193 146 165 160 155 156
Fig. 1. CEACAM1 expression levels in the colon tissues of DSS mice. Messenger RNA expression of CEACAM1 was detected using realtime PCR (A). Protein expression of CEACAM1 was detected using western blot (B). The relative mRNA and protein expression levels in the control group were represented as 1, and the relative expression levels in other groups were normalized to the control group. Data are expressed as mean ± standard deviation (n = 6). ##P b 0.01 compared with the control group, **P b 0.01 compared with the DSS group.
Y. Jin et al. / Life Sciences 149 (2016) 120–128
123
Fig. 2. Protective effects of CEACAM1 against DSS-induced UC in mice. Exogenous CEACAM1 decreased disease activity index (DAI) (A) and reduced colon length shortening (B) in DSSinduced colitis. Data are expressed as mean ± standard deviation (n = 6). ##P b 0.01 compared with the control group, **P b 0.01 compared with the DSS group.
the expression of CEACAM1 was markedly reduced compared with the control group (P b 0.01). The CEACAM1 overexpression completely reversed this reduction (P b 0.01 compared with the DSS group).
3.2. CEACAM1 overexpression attenuates DSS-induced UC in mice DAI score was used to evaluate the severity of UC in mice. On day 7, mice in the control group showed no sign of UC as evidenced by the 0
Fig. 3. Representative hematoxylin–eosin staining of colons of DSS mice in control (A), control + vector (B), control + CEACAM1 (C), DSS (D), DSS + vector (E), and DSS + CEACAM1 (F) groups. CEACAM1 gene overexpression attenuated DSS-induced inflammatory cells infiltration and necrosis in the colon. The morphologic changes and inflammatory responses score were shown in G. The number of goblet cells was shown in H. Scale bar: 100 μm. Data are expressed as mean ± standard deviation (n = 6). ##P b 0.01 compared with the control group, **P b 0.01 compared with the DSS group.
124
Y. Jin et al. / Life Sciences 149 (2016) 120–128
Fig. 4. Effects of exogenous CEACAM1 on inflammatory response in the colon of DSS mice. The levels of TNF-α (A), IL-1β (B), IL-6 (C) and IFN-γ (D) and myeloperoxidase (MPO) activity (E) in the colon tissue were decreased after re-introducing of exogenous CEACAM1. Data are expressed as mean ± standard deviation (n = 6). ##P b 0.01 compared with the control group, **P b 0.01 compared with the DSS group.
score of DAI (Fig. 2A). While in the DSS group, mice got an average score of higher than 2.5 (2.83 ± 0.86), indicating the occurrence of UC. Exogenous CEACAM1 overexpression resulted in a significantly lowered DAI score (1.39 ± 0.57, P b 0.01 compared with DSS group). In addition, colon length in the DSS group was obviously shorter than that in the control group (5.07 ± 0.69 vs. 9.70 ± 1.39 cm, P b 0.01), and were
largely restored by CEACAM1 overexpression (8.65 ± 1.28 cm, P b 0.01 compared with DSS group). Histological changes were observed by H&E staining. Greater infiltration of inflammatory cells, marked necrosis of colonic mucosa, and obvious reduction of goblet cells were found in mice of the DSS group (Fig. 3D, G and H). Exogenous CEACAM1 overexpression markedly
Fig. 5. Exogenous CEACAM1 downregulated expression of inflammatory enzymes in the colon of DSS mice. (A) immunohistochemistry analysis of expression of cyclooxygenase-2 (COX-2) and inducible nitric oxide synthase (iNOS). COX-2 (B) and (iNOS) expressions were also detected by realtime PCR and Western blot. The relative mRNA and protein expression levels in the control group were represented as 1, and the relative expression levels in other groups were normalized to the control group. Scale bar: 50 μm. Data are expressed as mean ± standard deviation (n = 6). ##P b 0.01 compared with the control group, **P b 0.01 compared with the DSS group.
Y. Jin et al. / Life Sciences 149 (2016) 120–128
attenuated DSS-induced UC symptoms (Fig. 3E and F). Vector injection did not alter the states of colons in either control or DSS mice. 3.3. CEACAM1 overexpression inhibits secretion of inflammatory cytokines in colon tissue of DSS-induced UC mice The production of inflammatory cytokines was detected using ELISA kits. The results revealed that productions of TNF-α, IL-6, IFN-γ and IL1β were increased markedly in the colon tissue of mice treated with DSS (Fig. 4A–D). CEACAM1 overexpression effectively inhibited the secretion of these cytokines. MPO, a biomarker of neutrophils activation and infiltration, was also found to be increased in the colon tissue of DSS mice (Fig. 4E), and CEACAM1 overexpression restored this change. Expression of COX-2 and iNOS, two enzymes related to inflammatory response, was measured using IHC and Western blot. As illustrated in Fig. 5, in the DSS group, expression levels of COX-2 and iNOS were both elevated in mRNA level and protein level. In contrast, exogenous CEACAM1 overexpression effectively downregulated the expression of these two enzymes. These data suggest that exogenous CEACAM1 suppresses inflammatory response in the colon tissue of DSS induced UC mice. 3.4. CEACAM1 overexpression improves intestinal permeability in DSSinduced colitis The results of permeability assay showed that the EB content of the colon tissue in the DSS group was dramatically increased compared with the control group (Fig. 6A). CEACAM1 overexpression markedly reduced the EB content, indicating the reduction of intestinal permeability. To further investigate the effect of CEACAM1 overexpression on intestinal permeability, the expression of TJ protein in the colon tissue was detected. As shown in Fig. 6B–H, expression levels of claudin-1, occludin and ZO-1 were dramatically decreased in both mRNA and protein in the UC mice. However, all the changes were restored in the CEACAM1 overexpression group. CEACAM1 overexpression has not affected TJ proteins expression in the normal control rats.
125
3.5. CEACAM1 overexpression improves repairing capability of intestinal epithelial cells CEACAM1 gene transit transfection successfully induced dramatically increased expression of mRNA and protein of CEACAM1 in Caco-2 cells (Fig. 7A). The result of MTT assay revealed that CEACAM1 not only increased cell proliferation of control cells, but also increased cell proliferation of DSS-exposed cells (Fig. 7B). Accordingly, CEACAM1 overexpression accelerated wound closure (Fig. 7D) in both control and DSS-exposed cells. In addition, CEACAM1 overexpression reduced LDH release induced by DSS (Fig. 7E) in Caco-2 monolayers. These data indicated that CEACAM1 promotes the repairing ability and decreases the permeability of intestinal epithelial cells.
4. Discussion Both DSS and TNBS are widely used in establishment of experimental IBD models [23]. However, the pathological mechanisms are different between models induced by these two reagents. In TNBS induced colitis, ethanol is needed to break the mucosal barrier, and TNBS is believed to induce a T-cell-mediated response against hapten modified autologous proteins, which is similar to the inflammatory processes in CD patients [23,24]. In contrast, DSS induces epithelial cells damage in the basal crypts, which is similar to the inflammatory processes in UC patients [24,25]. Therefore, in order to confirm the effect of CEACAM1 on other types of UC model, and investigate its effect on epithelial cells repair in UC, DSS-induced mice was used in this study. After DSS exposure for 1 week, the rats exhibited loss of body weight, loose stools, bloody feces and colonic shortening, which were consistent with the previous studies [26,27], suggesting the successful of the model establishment. CEACAM1 gene overexpression in the colon attenuated UC symptoms in DSS mice, as evident by the improved stool consistency, rectal bleeding and the shortening of colon. In histological examination, similar as the observation in our previous study on TNBS-treated mice, DSS induced mucosal destruction and CEACAM1 overexpression attenuated histological changes. These data indicate that CEACAM1 alleviates DSS-induced UC in mice.
Fig. 6. Effect of exogenous CEACAM1 on the intestinal permeability of DSS mice. CEACAM1 decreased evans blue content (A) and downregulated TJ proteins expression in DSS-treated mice (B–H). The relative mRNA and protein expression levels in the control group were represented as 1, and the relative expression levels in other groups were normalized to the control group. Data are expressed as mean ± standard deviation (n = 6). ##P b 0.01 compared with the control group, **P b 0.01 compared with the DSS group.
126
Y. Jin et al. / Life Sciences 149 (2016) 120–128
Several studies have shown the abnormality in the TJ complex in UC [28–31], which corresponds to the increase in intestinal permeability. IBD patients with continuous increase in intestinal permeability may have a poor prognosis [32,33]. Therefore, it is important to protect
intestinal permeability in IBD treatment. Intestinal epithelial TJ is a key component of intestinal barrier. Intestinal epithelial TJ barrier damage leads to an increase of intestinal permeability and results in the access of intraluminal antigens into the mucosa. Thus, pharmacological
Fig. 7. Effect of exogenous CEACAM1 on the intestinal epithelial cell restitution. (A) Significant increased CEACAM1 expression after transit transfection in Caco-2 cells. Exogenous CEACAM1 markedly enhanced the capability of proliferation (B) and migration (C) and reduced the LDH release (D) of Caco-2. The relative mRNA and protein expression levels in the control group were represented as 1, and the relative expression levels in other groups were normalized to the control group. Data are expressed as mean ± standard deviation (n = 3). *P b 0.05 compared with the control group, **P b 0.01 compared with the control group.
Y. Jin et al. / Life Sciences 149 (2016) 120–128
regulation of the intestinal TJ protein expression would be beneficial for the remission from IBD. In this study, we measured the expression of three key TJ proteins: claudin-1, occludin and ZO-1. Claudin-1 belongs to the claudins family. This family and occludin make up the transmembrane proteins. Claudins form the TJ pore for small solutes and ions [9, 34], whereas occludin regulates macromolecule flux across the intestinal epithelial tight junction barrier [35]. ZO-1 is a member of the membrane-associated guanylate kinase homologs family. These membrane-associated signaling molecules bind to the transmembrane and cytosolic tight junction proteins to regulate the TJ complex [36]. Of these three TJ proteins, downregulation of occludin and ZO-1 in UC was confirmed by a number of studies. In line with their functions, occludin depletion in intestinal epithelial cells leads to an increase in macromolecule flux. Loss of ZO-1 results in the destruction of link between transmembrane tight junction proteins and actin. However, the observation of claudin-1 expression in UC varies with studies [28,37, 38], and the reason remains to be clarified. In the present study, DSS exposure induced a dramatic downregulation of claudin-1, occludin and ZO-1 both in mRNA and protein level. Whereas re-introducing exogenous CEACAM-1 gene to colon restored these changes and significantly decreased intestinal permeability. These data suggest that CEACAM-1 plays a protective role in the colon of UC mice by modulating TJ proteins and therefore decreasing intestinal permeability. The cause of UC is not fully clear. However, the uncontrolled inflammatory response in the intestinal tract is considered to be closely related to the pathogenesis of UC. We have demonstrated previously that CEACAM1 overexpression decreased secretion of inflammatory cytokines such as TNF-α, INF-γ and IL-6 in the colon tissue of TNBS mice. Here, we repeated the examination of inflammatory responses in DSS mice because the different pathological mechanisms in these two IBD model. We not only observed the similar results in DSS-induced UC model, but also found that the pro-inflammatory enzymes, such as COX-2 and iNOS were downregulated after the re-introducing of exogenous CEACAM1 into the colon tissue. These data indicate that CEACAM1 plays an important role in pro-inflammatory cytokines regulation in DSS-induced UC. The relationship between colonic permeability and intestinal inflammation in UC has been discussed in previous study [28]. The damage of TJ barrier and the increased colonic permeability were considered to precede the inflammatory responses in colon of DSS-induced UC mice. An earlier study also reported the late onset of the intestinal inflammation in DSS-induced UC [39]. However, some studies also demonstrated that pro-inflammatory cytokines induced intestinal epithelial barrier dysfunction [40–42]. Together these observations, we consider that there is a vicious cycle between intestinal permeability increase and inflammatory response in the UC colon. Permeability is increased by antigens and consequently inflammatory cytokines released, which in turn increased intestinal permeability. In this study, we obtained data in late stage of UC, thus we observed both increased colonic permeability and inflammatory response in the colon. This limited us to find out the exact mechanism of the permeability protective effect of CEACAM1. Whether it regulates TJ proteins directly thereby inhibiting inflammation or it upregulates TJ proteins through preventing the production of inflammatory cytokines is unclear. This will be further studied in the future. Integrity of intestinal epithelium is also important to maintain barrier function of the gastrointestinal tract. The epithelial cells surrounding the wound play a crucial role in the wound-healing process [43,44]. Intestinal wound healing is dependent on the ability of migration, proliferation and differentiation of the intestinal epithelial cells. In the present study, we found that CEACAM1 overexpression significantly increased proliferation and migration abilities in Caco-2 cells, which indicated that CEACAM1 promote colonic epithelial restitution in UC. 5. Conclusion In conclusion, exogenous expression of CEACAM1 alleviates DSSinduced UC in mice through preventing inflammatory response,
127
regulating expression of TJ proteins and promoting colonic epithelial restitution. CEACAM1 may become a potential target of UC therapy. Conflict of interest statement The authors declare that they have no conflicts of interest concerning this article.
Acknowledgments This study was supported by a grant from the Science and Technology Program of Department of Science and Technology, Liaoning Province (No.: 2013225303). References [1] A. Kaser, S. Zeissig, R.S. Blumberg, Inflammatory bowel disease, Annu. Rev. Immunol. 28 (2010) 573–621. [2] N.A. Molodecky, I.S. Soon, D.M. Rabi, W.A. Ghali, M. Ferris, G. Chernoff, et al., Increasing incidence and prevalence of the inflammatory bowel diseases with time, based on systematic review, Gastroenterology 142 (2012) 46–54. [3] M. Yashiro, Molecular alterations of colorectal cancer with inflammatory bowel disease, Dig. Dis. Sci. 60 (2015) 2251–2263. [4] S.I. Grivennikov, Inflammation and colorectal cancer: colitis-associated neoplasia, Semin. Immunopathol. 35 (2013) 229–244. [5] A.H. Gitter, F. Wullstein, M. Fromm, J.D. Schulzke, Epithelial barrier defects in ulcerative colitis: characterization and quantification by electrophysiological imaging, Gastroenterology 121 (2001) 1320–1328. [6] S. Tsukita, M. Furuse, M. Itoh, Multifunctional strands in tight junctions, Nat. Rev. Mol. Cell. Biol. 2 (2001) 285–293. [7] A.S. Fanning, B.J. Jameson, L.A. Jesaitis, J.M. Anderson, The tight junction protein ZO-1 establishes a link between the transmembrane protein occludin and the actin cytoskeleton, J. Biol. Chem. 273 (1998) 29745–29753. [8] K. Matter, M.S. Balda, Occludin and the functions of tight junctions, Int. Rev. Cytol. 186 (1999) 117–146. [9] C.M. Van Itallie, J.M. Anderson, Claudins and epithelial paracellular transport, Annu. Rev. Physiol. 68 (2006) 403–429. [10] N. Sonoda, M. Furuse, H. Sasaki, S. Yonemura, J. Katahira, Y. Horiguchi, et al., Clostridium perfringens Enterotoxin fragment removes specific claudins from tight junction strands: evidence for direct involvement of claudins in tight junction barrier, J. Cell. Biol. 147 (1999) 195–204. [11] J.A. Thompson, A.M. Eades-Perner, M. Ditter, W.J. Muller, W. Zimmermann, Expression of transgenic carcinoembryonic antigen (CEA) in tumor-prone mice: an animal model for CEA-directed tumor immunotherapy, Int. J. Cancer 72 (1997) 197–202. [12] K. Kuespert, S. Pils, C.R. Hauck, CEACAMs: their role in physiology and pathophysiology, Curr. Opin. Cell Biol. 18 (2006) 565–571. [13] Q.Y. Al-Share, A.M. DeAngelis, S.G. Lester, T.A. Bowman, S.K. Ramakrishnan, S.L. Abdallah, et al., Forced hepatic overexpression of CEACAM1 curtails diet-induced insulin resistance, Diabetes 64 (2015) 2780–2790. [14] V. Khairnar, V. Duhan, S.K. Maney, N. Honke, N. Shaabani, A.A. Pandyra, et al., CEACAM1 induces B-cell survival and is essential for protective antiviral antibody production, Nat. Commun. 6 (2015) 6217. [15] S.M. Najjar, K.J. Ledford, S.L. Abdallah, A. Paus, L. Russo, M.K. Kaw, et al., Ceacam1 deletion causes vascular alterations in large vessels, Am. J. Physiol. Endocrinol. Metab. 305 (2013) E519–E529. [16] R. Lu, M. Kujawski, H. Pan, J.E. Shively, Tumor angiogenesis mediated by myeloid cells is negatively regulated by CEACAM1, Cancer Res. 72 (2012) 2239–2250. [17] Y. Jin, L. Lin, Y. Lin, C. Zheng, Exogenous carcinoembryonic antigen-related cell adhesion molecule 1 suppresses 2,4,6-trinitrobenzene sulfonic acid-induced ulcerative colitis in mice, J. Surg. Res. 195 (2015) 113–120. [18] J. Ieda, S. Yokoyama, K. Tamura, K. Takifuji, T. Hotta, K. Matsuda, et al., Re-expression of CEACAM1 long cytoplasmic domain isoform is associated with invasion and migration of colorectal cancer, Int. J. Cancer 129 (2011) 1351–1361. [19] B.J. Goggins, C. Chaney, G.L. Radford-Smith, J.C. Horvat, S. Keely, Hypoxia and integrin-mediated epithelial restitution during mucosal inflammation, Front. Immunol. 4 (2013) 272. [20] W.M. Raup-Konsavage, T.K. Cooper, G.S. Yochum, A role for MYC in lithium-stimulated repair of the colonic epithelium after DSS-induced damage in mice, Dig. Dis. Sci. (2015). [21] A.A. Abdin, Targeting sphingosine kinase 1 (SphK1) and apoptosis by colon-specific delivery formula of resveratrol in treatment of experimental ulcerative colitis in rats, Eur. J. Pharmacol. 718 (2013) 145–153. [22] S. Lange, D.S. Delbro, E. Jennische, Evans blue permeation of intestinal mucosa in the rat, Scand. J. Gastroenterol. 29 (1994) 38–46. [23] S. Wirtz, C. Neufert, B. Weigmann, M.F. Neurath, Chemically induced mouse models of intestinal inflammation, Nat. Protoc. 2 (2007) 541–546. [24] B. Foligne, S. Nutten, L. Steidler, V. Dennin, D. Goudercourt, A. Mercenier, et al., Recommendations for improved use of the murine TNBS-induced colitis model in evaluating anti-inflammatory properties of lactic acid bacteria: technical and microbiological aspects, Dig. Dis. Sci. 51 (2006) 390–400. [25] L.A. Dieleman, B.U. Ridwan, G.S. Tennyson, K.W. Beagley, R.P. Bucy, C.O. Elson, Dextran sulfate sodium-induced colitis occurs in severe combined immunodeficient mice, Gastroenterology 107 (1994) 1643–1652.
128
Y. Jin et al. / Life Sciences 149 (2016) 120–128
[26] R.B. Patel, K.D. Prajapati, B.M. Sonara, M.M. Sharma, H.M. Patel, V.D. Pawar, et al., Ameliorative potential of aliskiren in experimental colitis in mice, Eur. J. Pharmacol. 737 (2014) 70–76. [27] Y. Lin, L. Lin, Q. Wang, Y. Jin, Y. Zhang, Y. Cao, et al., Transplantation of human umbilical mesenchymal stem cells attenuates dextran sulfate sodium-induced colitis in mice, Clin. Exp. Pharmacol. Physiol. 42 (2015) 76–86. [28] L.S. Poritz, K.I. Garver, C. Green, L. Fitzpatrick, F. Ruggiero, W.A. Koltun, Loss of the tight junction protein ZO-1 in dextran sulfate sodium induced colitis, J. Surg. Res. 140 (2007) 12–19. [29] S. Resta-Lenert, J. Smitham, K.E. Barrett, Epithelial dysfunction associated with the development of colitis in conventionally housed mdr1a−/− mice, Am. J. Physiol. Gastrointest. Liver Physiol. 289 (2005) G153–G162. [30] T. Kucharzik, S.V. Walsh, J. Chen, C.A. Parkos, A. Nusrat, Neutrophil transmigration in inflammatory bowel disease is associated with differential expression of epithelial intercellular junction proteins, Am. J. Pathol. 159 (2001) 2001–2009. [31] T. Oshima, H. Miwa, T. Joh, Changes in the expression of claudins in active ulcerative colitis, J. Gastroenterol. Hepatol. 23 (Suppl. 2) (2008) S146–S150. [32] T.Y. Ma, Intestinal epithelial barrier dysfunction in Crohn's disease, Proc. Soc. Exp. Biol. Med. 214 (1997) 318–327. [33] A. Bitton, P.L. Dobkin, M.D. Edwardes, M.J. Sewitch, J.B. Meddings, S. Rawal, et al., Predicting relapse in Crohn's disease: a biopsychosocial model, Gut 57 (2008) 1386–1392. [34] C.M. Van Itallie, L.L. Mitic, J.M. Anderson, Claudin-2 forms homodimers and is a component of a high molecular weight protein complex, J. Biol. Chem. 286 (2011) 3442–3450. [35] R. Al-Sadi, K. Khatib, S. Guo, D. Ye, M. Youssef, T. Ma, Occludin regulates macromolecule flux across the intestinal epithelial tight junction barrier, Am. J. Physiol. Gastrointest. Liver Physiol. 300 (2011) G1054–G1064.
[36] A.S. Fanning, T.Y. Ma, J.M. Anderson, Isolation and functional characterization of the actin binding region in the tight junction protein ZO-1, FASEB J. 16 (2002) 1835–1837. [37] L.S. Poritz, L.R. Harris 3rd, A.A. Kelly, W.A. Koltun, Increase in the tight junction protein claudin-1 in intestinal inflammation, Dig. Dis. Sci. 56 (2011) 2802–2809. [38] T. Kinugasa, Y. Akagi, T. Yoshida, Y. Ryu, I. Shiratuchi, N. Ishibashi, et al., Increased claudin-1 protein expression contributes to tumorigenesis in ulcerative colitisassociated colorectal cancer, Anticancer Res. 30 (2010) 3181–3186. [39] S. Kitajima, S. Takuma, M. Morimoto, Changes in colonic mucosal permeability in mouse colitis induced with dextran sulfate sodium, Exp. Anim. 48 (1999) 137–143. [40] J. Mankertz, S. Tavalali, H. Schmitz, A. Mankertz, E.O. Riecken, M. Fromm, et al., Expression from the human occludin promoter is affected by tumor necrosis factor alpha and interferon gamma, J. Cell. Sci. 113 (Pt 11) (2000) 2085–2090. [41] F. Wang, W.V. Graham, Y. Wang, E.D. Witkowski, B.T. Schwarz, J.R. Turner, Interferon-gamma and tumor necrosis factor-alpha synergize to induce intestinal epithelial barrier dysfunction by up-regulating myosin light chain kinase expression, Am. J. Pathol. 166 (2005) 409–419. [42] A. Youakim, M. Ahdieh, Interferon-gamma decreases barrier function in T84 cells by reducing ZO-1 levels and disrupting apical actin, Am. J. Physiol. 276 (1999) G1279–G1288. [43] M. Iizuka, S. Konno, Wound healing of intestinal epithelial cells, World J. Gastroenterol. 17 (2011) 2161–2171. [44] J.A. Efstathiou, M. Pignatelli, Modulation of epithelial cell adhesion in gastrointestinal homeostasis, Am. J. Pathol. 153 (1998) 341–347.