Catalysis by mutants of human carbonic anhydrase II: effects of replacing hydrophobic residues 198 and 204

274

Biochimica et Biophysica Acta, 1159 (1992) 274-278 © 1992 Elsevier Science Publishers B.V. All rights reserved 0167-4838/92/$05.00

BBAPRO 34310

Catalysis by mutants of human carbonic anhydrase II: effects of replacing hydrophobic residues 198 and 204 Shinichi Taoka

Xian Chen a Roy W. Tarnuzzer c, Gino Van Heeke b,c, Chingkuang Tu a and David N. Silverman a a,

u Department of Pharmacology, Unicersity of Florida, Gainest'ille, FL (USA), b Protein Expression Laboratory, Interdisciplinary Center for Biotechnology Research, University of Florida, Gainesville, FL (USA) and c BioNebraska Incorporated, Lincoln, NE (USA) (Received 3 April 1992)

Key words: Carbonic anhydrase; Carbon dioxide; Proton transfer; Oxygen-18

Previous studies shows that the replacement of Phe-198 in carbonic anhydrase III to the corresponding Leu residue found in carbonic anhydrase II caused the appearance of isozyme II-like activity (LoGrasso et al. (1991) Biochemistry 30, 8463-8470). Carbonic anhydrase II is more efficient in the catalysis of CO 2 hydration by 500-fold and has an apparent pK a for this catalysis about two pKa units above that of carbonic anhydrase III. Moreover, isozyme II catalyzes the hydrolysis of 4-nitrophenyl acetate, whereas isozyme III shows no appreciable catalysis. The purpose of this work was to test the hypothesis that making the converse replacement Leu-198 ~ Phe as well as Leu-204 ~ Glu and the double replacement in carbonic anhydrase II would give the resulting mutants of isozyme II properties of isozyme III. The catalytic activities of these mutants in CO 2 hydration and 4-nitrophenyl acetate hydrolysis were smaller by at most 5-fold and the pK a values for these catalyses were identical compared with wild-type isozyme II. The different effects of converse mutants of HCA II and III indicate complexity in structure not evident from their similar backbone conformations.

Introduction The carbonic anhydrases (EC 4.2.1.1) are a group of zinc-containing isozymes that catalyze the hydration of CO 2 (Eqn. 1) as well as the hydrolysis of 4-nitrophenyl acetate. Among the most efficient of these is human carbonic anhydrase II (HCA II) which is found in red blood cells and secretory tissues; the least efficient is H C A III which is found predominantly in muscle tissue [1]. C02 + H 2 0 ~ HCO 3 + H +

(1)

For these isozymes, the major catalytic group is the zinc-bound water, and catalysis of both CO 2 hydration and 4-nitrophenyl acetate hydrolysis can be approximately described as a simple titration curve with a maximum at high pH reflecting the p K a of the zincbound water, which is near 7 for H C A II and below 5.5 for H C A III [2]. The crystal structures of bovine CA III

Correspondence to: D.N. Silverman, Department of Pharmacology, Box J-267 Health Center, University of Florida, Gainsville, FL 32610-0267, USA. Abbreviation: HCA, human carbonic anhydrase.

and H C A II have been reported [3,4]. These two enzymes have a 60% amino-acid identity [1] and a very similar backbone structure [3]. Using site-directed mutagenesis, LoGrasso et al. [5] were able to identify Phe-198 in H C A III as a key residue responsible for the low catalytic activity and the low p K a of the zinc-bound water. The replacement Phe-198---, Leu at this position caused up to 25-fold enhancement of catalytic activity and increased the apparent p K a of catalysis by this mutant from below 5.5 to 6.4. Leu was chosen because it is the residue at position 198 in the more efficient H C A II. We have now made the converse replacements Leu-198 ~ Phe and Leu-204 ~ Glu in H C A II, in each case replacing with the amino-acid found at these positions in H C A III. The side chain of Leu-198 in H C A II is near the zinc and forms part of the hydrophobic side of the active site cavity. The side chain of Leu-204 is adjacent to the isobutyl group of residue 198 in t t C A II, as shown in Fig. 1. We tested the hypothesis that changing the residues at positions 198 and 204 to the corresponding amino acids at these positions in H C A III would make mutants with catalytic properties more similar to H C A III. This hypothesis was not supported

275

Fig. 1. Selected residues near the active site of human carbonic anhydrase II. This diagram was taken from the coordinates as described by Eriksson et al. [41. by the data, a result that indicates complexities between the conformations of these two isozymes not apparent from their similar crystal structures. Materials and Methods

Mutagenesis and expression. Mutants of HCA II at amino-acid positions 198 and 204 (in bold below) were constructed in the plasmid p E T 3 1 F l m H C A 2 [6] using the Oligonucleotide-directed in vitro Mutagenesis System (Amersham). The mutant oligonucleotides, L204E: ACCACCCCTCCTCTCGAGGAATGTGTGACCT and L198F ~: T A C T G G A C C T A C C C C G G G T C A T F T A C C A C C C C T C C T C T T were prepared by the DNA Synthesis Core Facility, Interdisciplinary Center for Biotechnology Research, University of Florida. Putative clones were screened for the presence of a XhoI or Sinai site (underlined in the sequence) which indicates the presence of the L204E or L198F mutation, respectively. Mutations were confirmed by dideoxy DNA sequencing (Sequenase v2.0,USB). The SspI/ BspEI fragment of these mutant p E T 3 1 F l m H C A 2 constructs were then subcloned into the ScaI site of pBR322. The expression host Escherichia coli strain BL21(DE3) was transformed with plasmids representing each single mutant, double mutant, and wild-type HCA II and grown as l-liter cultures in L-broth sup-

t Single letter abbreviations are made for the amino acids in which L198F designates the mutant containing the replacement Leu-198 Phe.

plemented with tetracycline (12.5 /zg/ml). When the cell cultures reached an optical density of 0.6 (at 550 nm), expression of the wild-type or mutant H C A II was induced with I P T G (isopropylthiogalactoside) and incubation was continued for 2 h at 37°C. Cells were harvested by centrifugation at 5000 × g and frozen at - 2 0 ° C prior to purification of the recombinant native or mutant HCA II. Purification. Purification of HCA II and mutants was by affinity chromatography [7]. The concentration of enzyme was determined by titration with the tightbinding inhibitor ethoxzolamide in a Henderson plot [8]. This value was consistent within experimental error ( + 10%) with the concentration determined using the molar absorptivity of 5.34.104 M - I c m - i [9]. Kinetic measurements. The rate of hydration of CO 2 was determined by stopped-flow spectrophotometry (Applied Photophysics Model SF.17MV) measuring the rate of change of absorbance of a pH indicator [10]. The buffer-indicator pairs (with the wavelengths observed) were: Mes (pK a 6.1) and chlorophenol red (pKa 6.3, 574 nm); Mops (pK a 7.2) and p-nitrophenol (pKa 7.1, 400 nm); Taps (pK a 8.4) and m-Cresol purple (pK~ 8.3, 578 nm); Ches (pK~ 9.3) and thymol blue (pK~ 8.9, 590 nm). Experiments were carried out at 25°C with 25 mM buffer and total ionic strength of solution was maintained at a minimum of 0.1 M using Na2SO 4. Initial velocities of the hydrolysis of 4nitrophenyl acetate were measured (Beckman DU7 spectrophotometer) by the method of Verpoorte et al. [11], in which the increase in absorbance was followed at 348 nm, the isosbestic point of nitrophenol and the conjugate nitrophenolate ion. Measurements were made at 25°C and ionic strength was maintained at 0.1 M with Na2SO 4. Solutions contained 50 mM of one of the buffers used in the CO 2 measurements. Kinetic constants were estimated from initial velocities using a weighted, linear least squares method with U 4 weights. Oxygen-18 exchange. We measured the rate of exchange of ~80 between CO 2 and water and of 180 between ~2C- and 13C-containing species of CO 2 with mass spectrometry [12]. The 180 method is useful because two independent rates can be obtained, R~ and RH2o [12]. R 1 is the rate of interconversion of CO2 and H C O 3 at chemical equilibrium (Eqn. 2). This step during dehydration provides a transitory labeling of the active site with 180: HCOOtSO + EZnH20 ~ EZntSOH- + COz + H20

(2)

RH20 is the rate of release of 180-labeled water from the active site (Eqn. 3). RH20 involves a proton transfer to the zinc-bound hydroxide forming a zinc-bound water which is readily exchangeable with solvent water. Water containing 180 is greatly diluted by H2160, resulting in net depletion of 180 from species of CO z.

276 TABLE 1

Maximal (pH independent) steady-state constants and values of the apparent pK~ for the hydration of CO 2 and for the hydrolysis of 4-nitrophenyl acetate catalyzed by carbonic anhydrase and mutants Values of apparent p K a were determined from kca t / K m with standard errors in p K a of 0.1. Enzyme

CO 2 hydration

wild-type H C A II L204E H C A II L198F H C A 1I L198F-L204E H C A 1I FI98L H C A III a wild-type H C A III a

4-nitrophenyl acetate hydrolysis

k cat (.10-Ss-J)

k cat / Km (.10-TM

6.9 ± 0.6 3.8 ± 0.3 3.4 _+0.4 2.5 +0.2 0.22-+ 0.03 0.02

9.6 ±0.6 6.1 ±0.4 5.2 ±0.3 2.2 ±0.2 0.74±0.03 0.03

p K,

k cat / Km (.10-3M-Is-I)

p K,

7.1 7.3 7.0 6.9 6.9 <6

2.2 ±0.1 1.! ±0.06 1.3 ±0.1 0.48±0.03 1.0 ±0.1 0.01

6.8 7.1 7.2 6.9 6.4 -

I s I)

From Ref. 5.

In Eqn. 3, BH can be buffer in solution, water or a side chain of the enzyme such as His-64. ka

EZnlsoH

+BH ,

' EZnlsoH2+B k- B H20

,

' EZnH20+H21so+

B-

(3)

The release of ~80-labeled water from the active site, RH2 o, is limited in rate by transfer of a proton to the (labeled) zinc-hydroxide in both CA II and CA III. This has been confirmed by solvent hydrogen isotope effects, buffer enhancement of RH2o, simulations of catalysis and by the agreement of RH2o with rates of proton transfer obtained using the steady-state turnover number (see Ref. 2 and references therein). Oxygen-18 exchange measurements were carried out at 25°C using a membrane-inlet mass spectrometer [12]. Total concentration of all species of CO 2 was 25 mM and ionic strength was maintained at a minimum of 0.2 M by addition of Na2SO 4. No buffers were used.

measured by stopped-flow spectrophotometry and confirmed by ~80 exchange between CO 2 and water 2. The replacements Leu-198 --} Phe and Leu-204 -~ Glu had no effect on the apparent p K , near 7.0 for these catalyses (Table I). Compared with wild-type HCA II, the steady-state constants for CO 2 hydration and ester hydrolysis were decreased by 35 to 50% by the single replacements at residues 198 and 204. The decreases in activity for the double mutant L198F-L204E HCA II were as great as 75% (Table I). In none of these cases was activity of the mutant decreased to the level of H C A III (Table I). It is interesting, however, that the catalysis of the hydrolysis of 4-nitrophenyl acetate was equivalent for the two mutants L198f HCA II and F198L H C A III (Table I). This is much more of an activation of the mutant F198L HCA III compared

106

Results

The ratio kcat/K m for catalyzed hydration of CO 2 and hydrolysis of 4-nitrophenyl acetate could be described by a simple titration curve for wild-type H C A II and all the mutants described here. This ratio was

RH20 ($ 1) [E]

10 s

1 04

10 a

5.5

2 The substrate dependence of R 1 is given by R I / [ E ] = k~t[S] / (Kef r +[S]) in which kceaXt is a rate constant for maximal interconversion of CO 2 and H C O 3 and Kcff is an apparent substrate binding constant and IS] is the concentration of all specie s of CO 2. Values of keaXt/geff for the enzymes in Table I were determined by nonlinear least-squares fit of the above expression for R t to the data or by m e a s u r e m e n t of R 1 at values of [S] much smaller than g e f f. In theory and in practice, keXcat/"eft/l?" for CO 2 hydration is equal to kca t / K m obtained by steady-state methods (Simonsson, I., Jonsson, B.-H. and Lindskog, S. (1979) Eur. J. Biochem. 93, 409-417; Koenig, S.H. et al. (1974) Pure Appl. Chem. 40, 103-113). The standard deviations for R l were in the range of 3-10%.

615

-7

7'.5 pH

8

815

9

Fig. 2. The pH profile of RH2o/[E], the rate constant for the release from enzyme of water bearing substrate oxygen. ( • ) , L204E H C A II; (m), L198F-L204E H C A II. Data were obtained at 25°C with solutions containing 25 m M of all species of CO2, 25 /zM E D T A and with total ionic strength of solution maintained at 0.2 M with Na2SO 4. No buffers were added to solution. Solid lines were obtained from a nonlinear least-squares fit of Eqn. 4 to the data and resulted in the entries given in Table II. These are best fits utilizing a model with two p K a values; improved fits (data not given) were obtained assuming interaction between donor and acceptor groups or a second proton donor.

277 TABLE II

Interconversion o f C O 2 and H C O 3

Rate constants kn of Eqn. 4 for intramolecular proton transfer in carbonic anhydrase and mutants and the apparent pK, values for donor and acceptor groups

The ratio kcat//Km for hydration of CO 2 contains the rate constants for the steps of Eqn. 2, from the binding of CO2 to the first irreversible step, which is the departure of H C O 3 from the active site. The p H dependence of kcat//gm could be described by a simple titration curve for wild-type H C A II and all the mutants described here. The resulting apparent p K a reflects the ionization of the zinc-bound water [2]. These p K a values were further confirmed by the p H dependence of the catalytic hydrolysis of 4-nitrophenyl acetate, the p K a of which is an accurate representation of the ionization of the zinc-bound water [15]. The similarity of the values of p K a in Table I for CO 2 hydration and ester hydrolysis confirms that we are observing not a kinetic p K a but a value close to that of the zinc-bound water. The results indicate that neither of the mutants L198F nor L204E nor the double mutant caused a significant change in the p K a of the zinc-bound water. In analogy with the structure of H C A III, the side chain of Glu-204 is expected to be positioned behind the phenyl ring of Phe-198 and its charge shielded from the zinc-water. Thus, the introduction near the zinc in H C A II of a charged carboxylate, Glu-204, does not destabilize appreciably the zinc-bound hydroxide. The magnitude of kcat//gm for hydration of CO 2 was decreased for the replacements Leu-204 ~ Glu and Leu-198 ~ Phe (Table I) which is not a result of altering the p K a of the zinc-bound water. It is a reasonable suggestion that the decrease caused by the replacement Leu-198 ~ Phe is due to a steric effect of the phenyl-ring-limiting access of CO2 to the active-site cavity, as has been suggested by Eriksson [3]. C o m p a r e d with wild-type H C A II, the free energy of the transition state for the rate controlling step of kcat//Km is enhanced 37 and 27 c a l / m o l by the replacement Leu-198 ~ Phe and Leu-204 ~ Glu, respectively. The increase in this barrier for the double mutant is 88 c a l / m o l . Similar conclusions are drawn from the catalysis of ester hydrolysis which also exhibits a non-additive interaction of the replacements at 198 and 204 on kcat//Km . Since the side chains of 198 and 204 are adjacent in the structure, it is not surprising that the changes in k c a t / K m for hydration are more than additive; that is, these side-chains interact in

Experimental conditions as in the legend to Fig. 2. Enzyme

wild-type HCA II a L204E HCA II L198F HCA II L198F-L204E HCA II F198L HCA III b wild-type HCA III b

Donor pKa (zinc-water) 6.9 7.3 7.0 6.9 6.4 5.0

Acceptor pK a (His-64) 6.9 6.7 6.9 6.9 9.0 c 9.0 c

kB (.10 5s-l) 35 + 4 18 + 3 15 + 3 5.3 + 0.6 0.14:t:0.02 0.02 + 0.01

From Silverman, D.N., Tu, C.K., Lindskog, S. and Wynns, G.C. (1979) J. Am. Chem, Soc. 101, 6734-6740. b From Ref. 5. c The proton acceptors for HCA III include Lys-64. a

with wild-type H C A III than an inactivation of L198F H C A II compared with H C A II. The rate constant k B for the proton transfer from the donor group on the enzyme to the zinc-bound hydroxide in the dehydration direction (Eqn. 3) was obtained from lSO-exchange data based on Eqn. 4. There is strong evidence that the donor group in H C A II is His-64 [13]. Position 64 is in the active-site cavity with the C-a located about 9.7 ,~ from the zinc in both H C A II and H C A III [3,4]. RH2o/[E] = k n/{(1 + K n/[H + ])(1 + [H + I / K E ) )

(4)

K E is the ionization constant of the zinc-bound water and K B is that of the proton shuttle group; [E] is total enzyme concentration. Fig. 2 shows the application of this expression to RH2 o catalyzed by two mutants of H C A II. Values of k B were largest for H C A II with each mutant at position 198 and 204 decreased approx. 50% and k B for the double mutant decreased 85% (Table II). These decreases were very similar in magnitude with those for kcat (Table I), a rate constant that is also dominated by the intramolecular proton transfer

[2]. Discussion

altering kcat//gm .

The catalytic pathway for both carbonic anhydrase II and III consists of two stages (reviewed in Ref. 2). The first is the interconversion of CO 2 to H C O 3, probably by direct nucleophilic attack of zinc-bound hydroxide on CO 2. The second stage is the transfer of a proton from zinc-bound water to solution, a series of steps that involves the proton shuttle residue His-64 in H C A II.

Proton transfer

Proton transfer from zinc-bound water to solution in catalysis by H C A II (Eqn. 3) proceeds predominantly through a proton shuttle residue His-64 which transfers the proton to buffers in solution [2,13]. Consequently, the lower values of keat for hydration of CO 2 observed with the mutants L198F and L204E H C A II represent lower values of this intramolecular proton transfer.

278 Although it is a minor pathway for H C A II, there is some proton transfer directly from zinc-bound water to buffers in solution [13]. Consequently, it is useful to measure the intramolecular proton transfer with an equilibrium method in which buffers can be omitted, such as the 180-exchange method. To release 180 from the enzyme, proton transfer occurs from the (protonated) imidazole side chain of His-64 to the zinc-bound (labeled) hydroxide (Eqn. 3) and both the p K a of the acceptor and donor groups are manifested in this experiment (Fig. 2). This situation is described by Eqn. 4. The 1SO-exchange data show that neither p K a of the acceptor His-64 nor p K a for the zinc-bound water are altered by the presence of Phe-198 and Glu-204 (Table II). Similar to the case with k c . a t / K m and k ~ , approximately equal decreases in k a occurred with both replacements Leu-198 ~ Phe and Leu-204 ~ Glu (Table II). The changes caused by these two mutations o n kca t for hydration and k B are again more than additive, indicating interaction of the side chains of 198 and 204 in the active site. It is known that this intramolecular proton transfer in wild-type H C A II proceeds through hydrogen-bonded water molecules located between the donor and acceptor groups [16]. Moreover, Hillenbrand and Scheiner [17] have shown that the rate constant for proton transfer is very sensitive to the distance and orientation of proton donor and acceptor. It is possible that the replacements at 198 and 204 have altered the position of the side chain of His-64 and affected the proton transfer without changing p K a values. Krebs et al. [18] noted a change in side-chain conformation of His-64 in the T200S mutant of H C A II compared with wild-type. Ren et al. [19] have measured catalysis by a number of mutants of H C A II at positions 64, 67, 198 and 207. Included in their mutants was L198F H C A II for which their results and ours are in general agreement that changes in activity with this mutant are relatively small, no greater than 2-fold. Finer differences between our results are possibly due to different conditions of the experiments, Moreover, their study contains a number of other mutants of H C A II containing residues found in H C A III, such as H64K and N67R H C A II. The relatively small changes in catalysis seen with all these mutants of H C A II, compared with the low efficiency of H C A III, suggest more complexity in the structures of these isozymes than has been apparent from their similar backbone conformations. The ability of these

mutants of H C A II to maintain high activity when they contain altered residues of larger volume or different charge than in the wild-type probably indicates a significant degree of flexibility in conformation. To prepare mutants of H C A II with catalytic properties similar to H C A III will probably require many mutations, each having a small effect when considered by itself.

Acknowledgements We thank Dr. Nigel Richards for assistance with molecular modeling. This work was supported by a grant from the National Institutes of Health (GM25154).

References 1 Tashian, R.E. (1989) BioEssays 10, 186-192. 2 Silverman, D.N. and Lindskog, S. (1988) Acc. Chem. Res. 21, 30-36. 3 Eriksson, A.E. (1988) Structural Differences Between High and Low Activity Forms of Carbonic Anhydrase, Doctoral Dissertation, Uppsala University. 4 Eriksson, A.E., Kylsten, P.M., Jones, T.A. and Liljas, A. (1988) Proteins: Struc. Func. Genet. 4, 283-293. 5 LoGrasso, P.V., Tu, C.K., Jewell, D.A., Wynns, G.C., Laipis, P.J. and Silverman, D.N. (1991) Biochemistry30, 8463-8470. 6 Tanhauser, S.M., Jewell, D.A., Tu, C.K., Silverman, D.N. and Laipis, P.J. (1992), Gene, in press. 7 Khalifah, R.G., Strader, D.J., Bryant, S.H. and Gibson, S.M. (1977) Biochemistry 16, 2241-2247. 8 Segel, I.H. (1975) Enzyme Kinetics, pp. 158-159, Wiley, New York. 9 Edsall, J.T., Mehta, S., Meyers, D.V. and Armstrong, J.M. (1966) Biochem. Z. 345, 9-36. 10 Khalifah, R.G. (1971) J. Biol. Chem. 246, 2561-2573. 11 Verpoorte, J.A., Mehta, S. and Edsall, J.T. (1967) J. Biol. Chem. 242, 4221-4229. 12 Silverman, D.N. (1982) Methods Enzymol. 87, 732-752. 13 Tu, C.K., Silverman, D.N., Forsman, C., Jonsson, B.H. and Lindskog, S. (1989) Biochemistry28, 7913-7918. 14 Rowlett, R.S., Gargiulo, N.J., Santoli, F.A., Jackson, J.M. and Corbett, A.H. (1991) J. Biol. Chem. 266, 933-941. 15 Simonsson, I. and Lindskog, S. (1982) Eur. J. Biochem. 123, 29-36. 16 Venkatasubban, K.S. and Silverman, D.N. (1980) Biochemistry 19, 4984-4989. 17 Hillenbrand, E.A. and Scheiner, S. (1986) J. Am. Chem. Soc. 108, 7178-7186. 18 Krebs, J.F., Fierke, C.A., Alexander, R.S. and Christianson, D.W. (1991) Biochemistry30, 9153-9160. 19 Ren, X., Jonsson, B.-H. and Lindskog, S. (1991) Eur. J. Biochem. 201,417-420.