- Email: [email protected]
Caveolin-1 knockdown is associated with the metastasis and proliferation of human lung cancer cell line NCI-H460
Biomedicine & Pharmacotherapy 66 (2012) 439–447
Available online at
www.sciencedirect.com
Original article
Caveolin-1 knockdown is associated with the metastasis and proliferation of human lung cancer cell line NCI-H460 Yang Song a,1, Liyan Xue b,1, Sha Du a, Mingzhong Sun c, Jun Hu a, Lihong Hao a, Linlin Gong a, Dongmei Yeh d, Hai Xiong e,**, Shujuan Shao a,* a
Department of Histology and Embryology, Dalian Medical University, No. 9 Lvshun South Road, 116044 Dalian, China Department of Pathology, Cancer Institute & Hospital Chinese Academy Of Medical Sciences, China Department of Biotechnology, Dalian Medical University, Dalian, China d Department of Anatomy, Medical College, Dalian University, Dalian, China e Department of Chest Surgery, The First Affiliated Hospital of Dalian Medical University, 222, Zhongshan Road, 116011 Dalian, China b c
A R T I C L E I N F O
A B S T R A C T
Article history: Received 6 February 2012 Accepted 1 March 2012
Caveolin-1 (CAV-1), one component of caveolae, involves in multiple cellular processes and signal transductions. We previously showed that the expression of CAV-1 gene in NCI-H446 cells inhibited cell proliferation and promoted cell metastasis. Here we explore the function of CAV-1 on tumor growth and metastasis by using NCI-H460 in vitro. First, we established NCI-H460 cell line, which CAV-1 was stably knockdown. Then we investigated the effects of CAV-1 on the morphology, proliferation, cell cycle and metastasis potential for NCI-H460 cell by crystal violet stains, CCK-8, colony formation, flow cytometry, scratch-wound assay and transwell assay. Western blot was used to examine the expression changes of cyclin D1, PCNA, E-cadherin and b-catenin. Our results showed stable knockdown of CAV-1 inhibited the proliferation of NCI-H460 cells. Cell cycle of the transfected cells was arrested in G1/S phase and the expressions of cyclin D1 and PCNA protein were downregulated. Downregulation of CAV-1 promoted the migration and invasion abilities of NCI-H460 cells in vitro. The expression of b-catenin increased and the level of E-cadherin decreased. In summary, our findings provide experimental evidence that CAV-1 may function as a proproliferative and antimetastatic gene in NCI-H460 cell line. ß 2012 Published by Elsevier Masson SAS.
Keywords: Caveolin-1 RNAi Lung cancer Proliferation Metastasis
1. Introduction Lung cancer is the leading cause of cancer-related death in the world [1]. Lung cancer is mainly classified into small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC). NSCLC comprises approximately 80% of all lung cancers, and early-stage NSCLC is potentially curative by complete surgical resection. However, even with surgical resection, the overall 5-year survival rate for these patients is about 45% to 70%, with most deaths being due to metastatic recurrence [2]. Caveolin-1 (CAV-1) is a 21–24 kDa integral membrane protein and a principal structural component of caveolae, which are involved in multiple cellular processes such as molecular transport, cell proliferation, adhesion, migration and signal transductions [3,4]. In the last decade, it has been suggested that
* Corresponding author. Tel.: +86 0411 86110218. ** Corresponding author. Tel.: +86 0411 83635963 7112. E-mail addresses: [email protected] (H. Xiong), [email protected] (S. Shao). 1 Contributed equally. 0753-3322/$ – see front matter ß 2012 Published by Elsevier Masson SAS. doi:10.1016/j.biopha.2012.03.001
CAV-1 acts as a suppressor gene under some conditions [5]. In contrast, CAV-1 is associated with and contributes to malignant progression. A high-level of expression of intracellular CAV-1 is associated with tumor progression and metastasis of human prostate [6], renal cell carcinoma [7] and esophageal squamous cell carcinoma [8]. Abundant evidence indicates that the overexpression of CAV-1 in NSCLC is closely associated with the early metastasis and poor prognosis of lung adenocarcinoma and squamous carcinoma [9– 12]. It has been reported CAV-1 is overexpressed in lung epithelial cell lines and most of NSCLC cell lines while it is downregulated in SCLC cell lines [13]. We previously researched the role of reexpression of CAV-1 gene in NCI-H446 cells. Our results showed that CAV-1 inhibited proliferation and promoted metastasis of NCI-H446 cells [14]. NCI-H460 is a human large cell carcinoma cell line. Our result showed that CAV-1 was overexpressed in NCI-H460 cell lines [14]. What is the function of CAV-1 in NCI-H460 cell lines? Have the same roles of CAV-1 in NCI-H446 and NCI-H460? The study described the role of CAV-1 on NCI-H460 about proliferation, morphology, cell cycle, metastasis and corresponding mechanisms by RNAi technology.
440
Y. Song et al. / Biomedicine & Pharmacotherapy 66 (2012) 439–447
2. Materials and methods 2.1. Cell culture NCI-H460 cell was routinely cultured in RPMI1640 media (Gibco, USA) containing 10% fetus bovine serum (Hyclone, USA) at 37 oC with 5% CO2. Cells were passaged with 0.25% trypsin. 2.2. shRNA interference and caveolin-1 (CAV-1) transfection and screening The pGPU6/GFP/Neo vectors containing siRNA primers against CAV-1 (NM_001753), negative control and GAPDH were constructed by Gene Pharma Co., Ltd (Shanghai, China). Four possible target sites to this sequence were designed. The target sequences were as follows: 50 - GCAATGT CCGCATCAACTTGC-30 (mRNA 781801), 50 - GCAGTTGTACCATGCATTAAG -30 (mRNA 663-683), 50 GCCGTGTCTATTCCATCTACG-30 (mRNA 712-732) and 50 - GCTGAGC GAGAAGCAAGTGTA -30 (mRNA 383-403). The sequence of negative control was 50 - GTTCTCCGAACGTGTCACGT-30 . The recombinant plasmid was verified by screening analysis. The NCI-H460 cells were transfected with four types of CAV-1-shRNA, negative control (shNC) by using Lipofactamine 2000 (Invitrogen, USA) following the kit instructions. GAPDH was used as the reference to detect the transfection efficiency. The transfected cells were screened with 400 mg/mL G418 (Gibco, USA). After about 8 weeks of selection, the cells were harvested for use and cryopreserved. The levels of CAV-1 mRNA and protein expressions were determined by quantitative real-time PCR (qRT-PCR) and Western blot analysis. 2.3. RNA extraction and quantitative real-time reversed transcription-PCR Total RNA was exacted by using the Aqua Pure RNA Isolation reagent (Invitrogen, USA) according to the manufacturer’s instructions. The total RNA from each sample was reverse transcribed to cDNA using transcript cDNA synthesis Kit (Agilent, USA), and cDNA (500 ng), mixed with SYBR green PCR master mix (Agilent, USA), was used for real-time quantitative-PCR with stratagene Mx3000P
(Agilent, USA). CAV-1 mRNA was normalized to b-actin mRNA. Primer sequences were: CAV-1, forward 50 -GAGCTGAGCGAGAAGCAAGT-30 , and reverse 50 -TCCCTTC TGGTTCTGCAATC-30 ; b-actin, forward 50 -CCTCTCCCAAGTCCACACAG-30 and reverse 50 -GGGCACGAAGGCTCATCATT-30 . 2.4. SDS-PAGE and Western blot analysis Cell proteins were separated by 12% for Cyclin D1, PCNA and CAV-1 or 8% for b-catenin and E-cadherin and transferred to nitrocellulose membranes. b-actin was used as the internal standard. The membranes were probed with antibodies to CAV-1 (Santa Cruz Biotechnology, USA); Cyclin D1, PCNA, b-catenin, E-cadherin (Protein Tech Group, China). 2.5. Cell morphology analysis by crystal violet stains Five hundred cells were cultured in each six well plate. After fixation in ice-cold 70% methanol for 10 min, 0.1% crystal violet was added into the culture for 5 min. Washing three times with PBS, the cell morphology was examined under the microscope. 2.6. Cell proliferation assay Cell proliferation was performed by using a colorimetric assay kit (CCK-8 assay kit; Dojindo Laboratories, Tokyo, Japan) according to the manufacturer’s instructions. Briefly, 5 103 cells/well were seeded in 96-well plates in RMIP-1640 medium. The culture medium was removed and 100 mL of fresh culture medium containing 10 mL of CCK-8 was added to each well. Then the cells were incubated at 37 oC for 1 h. At the time points of 0, 24, 48, 72 and 96 h, the optical density value was measured at least in triplicate against a reagent blank at a test wavelength of 450 nm. Experiments were done in triplicate. 2.7. Colony formation assay A total of 4 102 cells were plated in 100 mm culture dishes. After incubation for an additional 14 days, the cells were fixed with
Fig. 1. Cells transfected with caveolin-1 (CAV-1) shRNA and negative control (shNC) were observed under bright microscopy (left) and fluorescence microscopy (right) after transfected for 48 h. More than 70% of NCI-H460 cells expressed GFP (100).
Y. Song et al. / Biomedicine & Pharmacotherapy 66 (2012) 439–447
441
Fig. 2. Real-time PCR and Western blot validations of the stable knock down of caveolin-1 (CAV-1). A. Real-time PCR of CAV-1. The CAV-1 mRNA level decreased significantly in shRNA-CAV-1-NCI-H460 (*P < 0.01): 1: NCI-H460; 2: shNC-NCI-H460; 3: shRNA-CAV-1-NCI-H460 (mRNA 663–683). B. Western blot of CAV-1. shRNA-CAV-1-NCI-H460 had the lower CAV-1 expression than NCI-H460 and shNC-NCI-H460 cells (*P < 0.01).
70% methanol and stained with 0.1% crystal violet, and colonies of more than 50 cells were manually counted. All experiments were performed in independent triplicates. 2.8. Cell cycle analysis by flow cytometry 2 105 cells were cultured in six well plates as described above and harvested after 24 h. Cells were trypsinized, washed with PBS twice and then fixed with cold 70% ethanol at 4 oC overnight. For flow cytometric analysis, the cells were treated with RNase A for 30 min at 37 oC, stained with propidium iodide (PI) solution for 30 min at 4 oC and then measured by flow cytometry (BD FACS Caton, USA). ModFit LT software was used for data acquisition and analysis.
2.9. Invasion and migration assays Cell invasion and migration were assessed using transwell chambers (Costar, USA) coated with or without 50 mL sera-free RPMI1640 medium containing 3 mg/mL Matrigel (Sigma, USA) in the upper chamber. 5 105 cells were suspended with 100 mL RPMI1640 medium without fetal bovine serum and placed onto the upper compartment. The lower chamber was filled with 200 mL RPMI1640 containing 0.1 mg/mL fetal bovine serum. The plates were incubated at 37 oC for 24 h for invasion and 18 h for migration. The number of cells stained with 0.1% crystal violet on the undersurface of the polycarbonate membranes (8 mm pore size) was counted in multiple random fields using a light microscope.
Fig. 3. Cell morphology of crystal violet stains. The shRNA-caveolin-1 (CAV-1)-NCI-H460 cells had smaller cell shape with few elongated filopodia than NCl-H460 and shNCNCl-H460 cells. The cells grew with colony formation (200).
442
Y. Song et al. / Biomedicine & Pharmacotherapy 66 (2012) 439–447
2.10. Wound healing assay Cells were seeded in six well plates using 10% fetal bovine serum until confluence. A wound area was generated by scraping with a 200 mL pipette tip. The medium was then changed to serum-free
medium. After 8 and 24 h, the cells in the wounded monolayer were counted randomly at multiple fields. The fields were photographed using a phase contrast microscope with a digital camera (Digital Sight, Nikon, Japan). The relative motility capacities of the cells were processed according to our method [14].
Fig. 4. The effect of the down- regulation of caveolin-1 (CAV-1) on cell proliferation. A. CCK-8 assay. The result indicated that knockdown of CAV-1 expression significantly inhibits the growth of shRNA-CAV-1-NCI-H460 cells (*P < 0.01). No difference was observed between NCl-H460 and shNC-NCl-H460 (P > 0.05). B. Colony formation assay. The number and size of colonies of shRNA-CAV-1-NCI-H460 was much less and smaller than NCl-H460 and shNC-NCl-H460 cells (*P < 0.01). The ratio of colony formation of shRNA-CAV-1-NCI-H460 was lower than NCl-H460 and shNC-NCl-H460 cells (*P < 0.01). No distinction was observed between NCl-H460 and shNC-NCl-H460 cells (40).
Y. Song et al. / Biomedicine & Pharmacotherapy 66 (2012) 439–447
2.11. Statistical analysis Results are represented as means SD. Statistical analyses were performed using the SPSS13.0 software. Tests that produced P 0.05 were considered to be significant. 3. Results
443
Table 1 Cell numbers of NCl-H460, shNC-NCI-H460 and shRNA-caveolin-1 (CAV-1)-NCIH460 cells by cell colony formation. Cell lines
Cell numbers of colony formation
Ratio of colony formation (%)
NCl-H460 shNC-NCI-H460 shRNA-CAV-1-NCI-H460
214 16.5 195.3 13.6 120.7 7.8
42.8 2.92 39.6 2.20 24.2 0.96
3.1. Caveolin-1 (CAV-1) was stable knockdown in NCI-H460 cell line GFP was highly expressed in the reference group, indicating that a high efficiency of transfection can be achieved (Fig. 1). Among the four recombinant vectors, pGPU6/GFP/Neo-shRNACAV-1 (mRNA 663–683) showed the strongest gene silencing effect and downregulated the mRNA and protein expression of CAV-1 in the transfected cells comparing with NCI-H460 and shNC-NCI-H460 cells. The level of mRNA and protein of CAV-1 in NCI-H460 were about a 80% decrease of that of shRNA-CAV-1-NCIH460 (Fig. 2). There was no difference between NCI-H460 and shNC-NCI-H460 cell. It indicated that 50 -GCAGTTGTACCATGCATTAAG-30 was an efficient silencing target for CAV-1. The results indicate that the successful establishment of the CAV-1 stable knockdown cell line shRNA-CAV-1- NCI-H460. 3.2. The stable knockdown of caveolin-1 (CAV-1) changed NCI-H460 cell morphology Comparing with NCl-H460 cells and shNC-NCl-H460, shRNACAV-1-NCI-H460 cells showed smaller cell shape with few filopodia and grew with colonies formation, as the results showed in Fig. 3. 3.3. The stable knockdown of caveolin-1 (CAV-1) inhibited NCI-H460 cell proliferation The result of CCK-8 assay was showed in Fig. 4A. shRNA interfering significantly inhibited the cell growth of NCI-H460
cells. The result of colony formation assay was consistent with CCK-8 assay. The number of colonies of NCI-H460, shNC-NCI-H460 and shRNA-CAV-1-NCI-H460 cells were 214 16.5, 195.3 13.6 and 120.7 7.8 respectively. The ratio of colony formation were 42.8 2.92%, 39.6 2.20% and 24.2 0.96%. The number of colony and the ratio of colony formation of shRNA-CAV-1-NCI-H460 were significant lower than that of the shNC-NCI-H460 cells (P = 0.0008 and 0.006, respectively), but no difference was observed between shNC-NCI-H460 cells and NCI-H460 cells (Fig. 4B and Table 1). 3.4. The stable knockdown of caveolin-1 (CAV-1) arrested NCI-H460 cells to G1/S phases Flow cytometry assay was used to detect whether the cell cycle was affected by stable knockdown of CAV-1. The percentage of G1 stage cells in the group of shNC-NCI-H460 and shRNA-CAV-1-NCIH460 were (36.50 1.43)% and (49.66 1.13)%, respectively. The percentage of S stage cells in the group of shNC-NCI-H460 and shRNACAV-1- NCI-H460 were (39.23 1.48%) and (21.61 1.18)%, respectively. We found that the percentage of G1 stage in shRNA-CAV-1NCI-H460 cells was increased significantly (P = 0.00003), while the percentage of S stage was decreased (P = 0.00004). The differences of the G2/M stage cells were of no statistical significance among the cells. These data were shown in Fig. 5 and Table 2. Then we detected the levels of cyclin D1 and PCNA expression by Western blot. The levels of cyclin D1 and PCNA expression were downregulated in shRNA-CAV-1- NCI-H460 cells (P = 0.02 and 0.0002, respectively).
Fig. 5. The effect of the downregulation of caveolin-1 (CAV-1) on cell proliferation. FACS analysis demonstrating an increased percentage in the G0/G1 phase and a decreased percentage in the S phase of the shRNA-CAV-1-NCI-H460 cells (*P < 0.01). The majority of NCI-H460-CAV-1-shRNA cells were arrested in G1/S phase. No difference was observed among the cells in the G2 phase.
444
Y. Song et al. / Biomedicine & Pharmacotherapy 66 (2012) 439–447
There was no difference between NCl-H460 and shNC-NCl-H460 cells (Fig. 8A). The results were consistent with the poor proliferation ability on shRNA-CAV-1- NCI-H460. Taken together these findings show a proproliferative role for CAV-1 in the NCI-H460 cell line. 3.5. The downregulation of caveolin-1 (CAV-1) increased the migration and invasion of NCI-H460 Migration and invasion through a basement membrane are hallmarks of malignancy. We performed a transwell chamber assay to determine the cell abilities of passing through a biological basement membrane in vitro. The results indicated that the migration capacity through the polycarbonate membrane of transwell chambers in the shRNA-CAV-1-NCI-H460 cells was a roughly 3-fold increase comparing with shNC-NCl-H460 (P = 0.00008), whereas there was no difference between NCl-H460
Table 2 Cell cycle analysis of NCl-H460, shNC-NCI-H460 and shRNA-caveolin-1 (CAV-1)NCI-H460 cells. Cell lines
G0/G1 (%)
S (%)
G2/M (%)
NCl-H460 shNC-NCI-H460 shRNA-CAV-1-NCI-H460
35.93 0.95 36.50 1.43 49.66 1.13
38.71 2.79 39.23 1.48 21.61 1.18
25.35 2.83 24.27 0.52 28.73 0.60
and shNC-NCl-H460 cells (Fig. 6A). Moreover, when the cells were subjected to invasion assays, we observed an almost 4-fold increase in the capacity of shRNA-CAV-1-NCI-H460 cells to invade through Matrigel-coated transwell chambers comparing to shNCNCl-H460 cells (P = 0.0001). No distinction was observed between NCl-H460 and shNC-NCl-H460 cells (Fig. 6B). These results
Fig. 6. The effect of the stable knockdown caveolin-1 (CAV-1) on migration and invasion of transwell chamber. A. Transwell migration (crystal violet staining, original magnification 200). shRNA-CAV-1-NCI-H460 cells had much more cells migrated through the basement membrane than those of shNC-NCI-H460 and NCI-H460 cells (*P < 0.01). No significant difference was observed between shNC-NCI-H460 and NCI-H460 cells (P > 0.05). B. Transwell invasion (crystal violet staining, original magnification 200). shRNA-CAV-1-NCI-H460 cells had much more cells invaded through the basement membrane than those of shNC-NCI-H460 and NCI-H460 cells (*P < 0.01). There was no distinction between shNC-NCI-H460 and NCI-H460 cells (P > 0.05).
Y. Song et al. / Biomedicine & Pharmacotherapy 66 (2012) 439–447
445
Fig. 7. Cell scratch-wound assay. At 8 h after scratch time point, few cells migrated in the NCl-H460 and shNC-NCI-H460 cell groups while quite a lot of shRNA-caveolin-1 (CAV-1)-NCI-H460 cells migrated across the wound. At 24 h, the shRNA-CAV-1-NCI-H460 cells reached the midline of the wound. shRNA-CAV-1-NCI-H460 had higher migrated cells than that of NCI-H460 and shNC-NCI-H460 at 8 and 24 h after scratching (*P < 0.01) (100).
suggest that CAV-1 suppresses the metastasis potential of the transfected NCl-H460 cell. 3.6. The downregulation of caveolin-1 (CAV-1) increased the mobilities of NCI-H460 Cell scratch-wound assay was performed to investigate the effect of CAV-1 on the horizontal migration of NCI-H460 cell by observing the scratch-wounding confluent monolayers of each group cells. The stable knockdown of CAV-1 markedly promoted the spreading of the shRNA-CAV-1-NCI-H460 cell line along the edges of the wound comparing to the NCl-H460 and shNC-NClH460 cells (Fig. 7). No difference was observed between NCl-H460 and shNC-NCl-H460 cells. 3.7. The stable knockdown of caveolin-1 (CAV-1) decreased the expression of E-cadherin and increased the expression of b-catenin The result of Western blot revealed that NCl-H460 cells had a lower E-cadherin expression and a higher b-catenin expression after stable knockdown of CAV-1. The stable knockdown of CAV-1 induced a 1.8-fold decrease of E-cadherin protein expression and a 2-fold increase of expression of b-catenin protein as compared with the shNC-NCl-H460 cells (Fig. 8B).
4. Discussion We previously reported that the re-expression of CAV-1 gene inhibited cell proliferation and promoted cell metastasis in NCIH446 cells [14]. In the present study, we investigated the effect of stable knockdown of CAV-1 in NCI-H460 cells on cell morphology, growth, cell cycle, mobility and metastasis. The result of yeast two-hybrid screen identified that the actinbinding filamin was a ligand for CAV-1 [15]. Possibly, the interaction between CAV-1 and actin or filamin participated in filopodia formation. Our results of morphological studies showed the cells became smaller cell shape with few filopodia and grew with colonies formation after stable knockdown of CAV-1. CCK-8 and colony formation assay were used to detect the effect of CAV-1 knockdown on the proliferation of NCI-H460. The results indicated that downregulation of CAV-1 results in an inhibition of cell proliferation comparing to NCI-H460 and shNC-NCI-H460 cells in vitro, however there was no different between NCI-H460 and shNC-NCI-H460 cells. This finding is consistent with the results of Casey Trimmer [13]. He studied the effect of CAV-1 on the growth of several NSCLC cell lines by using RNAi technology. The results showed that siRNA-mediated downregulation of CAV-1 expression significantly inhibited colony formation in soft agar and liquid culture of cells. Although CAV-1 has been implicated as a candidate
446
Y. Song et al. / Biomedicine & Pharmacotherapy 66 (2012) 439–447
Fig. 8. Western blot of cyclin D1, PCNA, E-cadherin and b-catenin. A. The expression of cyclin D1 and PCNA by Western blot. The levels of cyclin D1 and PCNA were downregulated in shRNA-caveolin-1 (CAV-1)-NCI-H460. (*P < 0.01). B. E-cadherin and b-catenin detected by Western blot. shRNA-CAV-1-NCI-H460 cells had much lower Ecadherin expression than that from NCl-H460 and shNC-NCI-H460 cells (*P < 0.01). The expression of b-catenin was significantly increased in shRNA-CAV-1-NCI-H460 cells (*P < 0.01).
tumor suppressor gene in many human tumors including lung cancer, it seems that CAV-1 expression is required for in vitro tumor growth of NSCLC cell lines that express CAV-1. Flow cytometry assay was used to detect the ratio of cells in cell cycle. Stable knockdown of CAV-1 in NCI-H460 cells resulted in an increase in the G0/G1 phase population the cell cycle and a significant reduction in the S phase population as well. It indicated the cells were arrested at G1/S phase. CAV-1 maybe inhibits the cell growth by suppressing the cell cycle. The expressions of PCNA and cyclin D1 of Western blot validate the results of cell cycle. The proliferating cell nuclear antigen (PCNA), a protein which is synthesized mainly during the G1/S phase of the cell cycle and plays an important role for both DNA synthesis and DNA repair by binding with DNA polymerase d in eukaryotic [16,17]. Many studies support the role of PCNA as a potential marker of cellular proliferation and oncogenesis [18,19]. Cyclin D1, a member of G1 cyclins, controls the cell cycle transition from the G1 to S phase. It acts by forming a complex with either CDK4 or CDK6. Thus cyclin D1 is an essential molecule for the dividing cell to enter the DNA synthesis phase [20]. Our data showed that stable knockdown of CAV-1 could downregulate the expression of cyclin D1 and PCNA on NCI-H460 cells. It maybe the one of the reasons that the transfected cell shows a poor proliferation. Metastasis is a very complex biological process in carcinomas, which mainly relies on the invasion and migration abilities of the malignant tumor cells [14]. Activation of ‘epithelial-mesenchymal transition’ (EMT) is crucial for the dissemination and invasion of certain cancer cells [21]. The first important event of EMT is loss of E-cadherin, which is an important cell-cell adhesion protein,
forming junction complex by binding of b-catenin to a-catenin and mediating adhesion stability [22,23]. Impairment of Ecadherin/b-catenin junction complex has been demonstrated to play an important role in induction of EMT in development and tumorigenesis [24,25]. It is reported that downregulation of CAV-1 in human tumor cells causes the downregulation of E-cadherin, increases b-catenin-TCF/LEF-1 transcriptional activity and promotes invasion [26–28]. A controversial role for CAV-1 in metastasis has emerged from various types of cancers. Fiucci et al. [29] reported that overexpression of CAV-1 in human breast cancer MCF-7 cells inhibited soft agar growth and matrix invasion. The result of transwell migration assay and scratch-wound assay demonstrated that the shRNA-CAV-1-NCI-H460 cell line migrated faster than the NCl-H460 and shNC-NCI-H460 cells, which suggested that stable knockdown of CAV-1 could promote the migration for the NCl-H460 cell line. In the transwell invasion assay, the shRNA-CAV-1-NCI-H460 cells showed a significant higher invasion capability relative to the NCI-H460 cells and shNCNCl-H460 cells. It indicated that the stable knockdown of CAV-1 could strongly enhance the capability of cells invasion. The following results of Western blot, showing a significant reduction in the E-cadherin expression and increasing in the b-catenin expression in shRNA-CAV-1-NCI-H460 cells, which were consistent with their elevated motility and metastatic potential in vitro. It demonstrated that CAV-1 maybe effect the E-cadherin/b-catenin pathway in shRNA-CAV-1- NCI-H460 cells. Taken together the above results implicate that stable knockdown of CAV-1 enhance the capabilities of metastasis in the transfected NCI-H460 cell in vitro.
Y. Song et al. / Biomedicine & Pharmacotherapy 66 (2012) 439–447
Overall, our data show that downregulation of CAV-1 suppresses the proliferation of NCI-H460 cells whereas dramatically promotes their abilities to metastasize in vitro. Mechanistically, this phenotype was associated with inhibition of E-cadherin/bcatenin pathway and downregulations of cyclinD1 and PCNA. CAV1 plays different roles between SCLC and NSCLC. The mechanisms of the differences in the roles of CAV-1 will be our further studies.
[12]
[13]
[14]
Disclosure of interest [15]
The authors have not supplied their declaration of conflict of interest. Funding: Financially supported by Mega-Projects of National Science Research of China (973 Program, 2012CB967003), National Natural Science Foundation of China (20935004), National Natural Science Foundation of China (30971539) and Education Department Foundation of Liaoning Province of China (L2010112) References [1] Poulsen TT, Pedersen N, Poulsen HS. Replacement and suicide gene therapy for targeted treatment of lung cancer. Clin Lung Cancer 2005;6:227–36 [PubMed: 15694015]. [2] NavabR, Liu J, Seiden-Long I, Shih W, Li M, Bandarchi B, et al. Co-overexpression of met and hepatocyte growth factor promotes systemic metastasis in NCIH460 non-small cell lung carcinoma cells. Neoplasia 2009;11:1292–300 [PubMed: 20019837]. [3] Shaul PW, Anderson RG. Role of plasmalemmal caveolae in signal transduction. Am J Physiol 1998;275:L843–51 [PubMed: 9815100]. [4] Sternberg PW, Schmid SL. Caveolin-1, cholesterol and Ras signalling. Nat Cell Biol 1999;1:98–105 [PubMed: 10559891]. [5] Williams TM, Lisanti MP. Caveolin-1 in oncogenic transformation, cancer, and metastasis. Am J Physiol 2005;288:C494–6 [PubMed: 15692148]. [6] Yang G, Truong LD, Wheeler TM, Thompson TC. Caveolin-1 expression in clinically confined human prostate cancer: a novel prognostic marker. Cancer Res 1999;59:5719–23 [PubMed: 10582690]. [7] Joo HJ, Oh DK, Kim YS, Lee KB, Kim SJ. Increased expression of caveolin-1 and microvessel density correlates with metastasis and poor prognosis in clear cell renal cell carcinoma. BJU Int 2004;93:291–6 [PubMed: 14764125]. [8] Kato K, Hida Y, Miyamoto M, Hashida H, Shinohara T, Itoh T, et al. Overexpression of caveolin-1 in esophageal squamous cell carcinoma correlates with lymph node metastasis and pathologic stage. Cancer 2002;94:929–33 [PubMed: 11920460]. [9] Yoo SH, Park YS, Kim HR, Sung SW, Kim JH, Shim YS, et al. Expression of caveolin-1 is associated with poor prognosis of patients with squamous cell carcinoma of the lung. Lung Cancer 2003;42:195–202 [PubMed: 14568687]. [10] Kato T, Miyamoto M, Kato K, Cho Y, Itoh T, Morikawa T, et al. Difference of caveolin-1 expression pattern in human lung neoplastic tissue. Atypical adenomatous hyperplasia, adenocarcinoma and squamous cell carcinoma. Cancer Lett 2004;214:121–8 [PubMed: 15331180]. [11] Ho CC, Huang PH, Huang HY, Chen YH, Yang PC, Hsu SM. Up-regulated caveolin-1 accentuates the metastasis capability of lung adenocarcinoma
[16] [17]
[18]
[19]
[20]
[21] [22] [23] [24] [25]
[26]
[27]
[28]
[29]
447
by inducing filopodia formation. Am J Pathol 2002;161:1647–56 [PubMed: 12414512]. Moon KC, Lee GK, Yoo SH, Jeon YK, Chung JH, Han J, et al. Expression of caveolin-1 in pleomorphic carcinoma of the lung is correlated with a poor prognosis. Anticancer Res 2005;25:4631–7 [PubMed: 16334154]. Sunaga N, Miyajima K, Suzuki M, Sato M, White MA, Ramirez RD, et al. Different roles for caveolin-1 in the development of non-small cell lung cancer versus small cell lung cancer. Cancer Res 2004;64:4277–85 [PubMed: 15205342]. Yeh D, Chen C, Sun MZ, Shao S, Hao L, Song Y, et al. Caveolin-1 is an important factor for the metastasis and proliferation of human small cell lung cancer NCIH446 cell. Anat Rec (Hoboken) 2009;292:1584–92 [PubMed: 19718715]. Stahlhut M, van Deurs B. Identification of filamin as a novel ligand for caveolin-1: evidence for the organization of caveolin-1-associated membrane domains by the actin cytoskeleton. Mol Biol Cell 2000;11:325–37 [PubMed: 10637311]. Shivji KK, Kenny MK, Wood RD. Proliferating cell nuclear antigen is required for DNA excision repair. Cell 1992;69:367–74 [PubMed: 1348971]. Essers J, Theil AF, Baldeyron C, van Cappellen WA, Houtsmuller AB, Kanaar R, et al. Nuclear dynamics of PCNA in DNA replication and repair. Mol Cell Biol 2005;25:9350–9 [PubMed: 16227586]. Fujita S, Seki S, Fujiwara M, Ikeda T. Midkine expression correlating with growth activity and tooth morphogenesis in odontogenic tumors. Hum Pathol 2008;39:694–700 [PubMed: 18329695]. Barboza CA, Pereira Pinto L, Freitas Rde A, Costa Ade L, Souza LB. Proliferating cell nuclear antigen (PCNA) and p53 protein expression in ameloblastoma and adenomatoid odontogenic tumor. Braz Dent J 2005;16:56–61 [PubMed: 16113935]. Todd R, Hinds PW, Munger K, Rustgi AK, Opitz OG, Suliman Y, et al. Cell cycle dysregulation in oral cancer. Crit Rev Oral Biol Med 2002;13:51–61 [PubMed: 12097237]. Yilmaz M, Christofori G, Lehembre F. Distinct mechanisms of tumor invasion and metastasis. Trends Mol Med 2007;13:535–41 [PubMed: 17981506]. Perez-Moreno M, Jamora C, Fuchs E. Sticky business: orchestrating cellular signals at adherens junctions. Cell 2003;112:535–48 [PubMed: 12600316]. Perez-Moreno M, Fuchs E. Catenins: keeping cells from getting their signals crossed. Dev Cell 2006;11:601–12 [PubMed: 17084354]. Wheelock MJ, Johnson KR. Cadherins as modulators of cellular phenotype. Ann Rev Cell Dev Biol 2003;19:207–35 [PubMed: 14570569]. Brabletz T, Hlubek F, Spaderna S, Schmalhofer O, Hiendlmeyer E, Jung A, et al. Invasion and metastasis in colorectal cancer: epithelial-mesenchymal transition, mesenchymal-epithelial transition, stem cells and beta-catenin. Cells Tissues Organs 2005;179:56–65 [PubMed: 15942193]. Lu Z, Ghosh S, Wang Z, Hunter T. Downregulation of caveolin-1 function by EGF leads to the loss of E-cadherin, increased transcriptional activity of beta-catenin, and enhanced tumor cell invasion. Cancer Cell 2003;4:499–515 [PubMed: 14706341]. Fiucci G, Ravid D, Reich R, Liscovitch M. Caveolin-1 inhibits anchorageindependent growth, anoikis and invasiveness in MCF-7 human breast cancer cells. Oncogene 2002;21:2365–75 [PubMed: 11948420]. Miotti S, Tomassetti A, Facetti I, Sanna E, Berno V, Canevari S. Simultaneous expression of caveolin-1 and E-cadherin in ovarian carcinoma cells stabilizes adherens junctions through inhibition of src-related kinases. Am J Pathol 2005;167:1411–27 [PubMed: 16251425]. Torres VA, Tapia JC, Rodriguez DA, Lladser A, Arredondo C, Leyton L, et al. Ecadherin is required for caveolin-1-mediated downregulation of the inhibitor of apoptosis protein survivin via reduced beta-catenin-Tcf/Lef- dependent transcription. Mol Cell Biol 2007;27:7703–17 [PubMed: 17785436].
Available online at
www.sciencedirect.com
Original article
Caveolin-1 knockdown is associated with the metastasis and proliferation of human lung cancer cell line NCI-H460 Yang Song a,1, Liyan Xue b,1, Sha Du a, Mingzhong Sun c, Jun Hu a, Lihong Hao a, Linlin Gong a, Dongmei Yeh d, Hai Xiong e,**, Shujuan Shao a,* a
Department of Histology and Embryology, Dalian Medical University, No. 9 Lvshun South Road, 116044 Dalian, China Department of Pathology, Cancer Institute & Hospital Chinese Academy Of Medical Sciences, China Department of Biotechnology, Dalian Medical University, Dalian, China d Department of Anatomy, Medical College, Dalian University, Dalian, China e Department of Chest Surgery, The First Affiliated Hospital of Dalian Medical University, 222, Zhongshan Road, 116011 Dalian, China b c
A R T I C L E I N F O
A B S T R A C T
Article history: Received 6 February 2012 Accepted 1 March 2012
Caveolin-1 (CAV-1), one component of caveolae, involves in multiple cellular processes and signal transductions. We previously showed that the expression of CAV-1 gene in NCI-H446 cells inhibited cell proliferation and promoted cell metastasis. Here we explore the function of CAV-1 on tumor growth and metastasis by using NCI-H460 in vitro. First, we established NCI-H460 cell line, which CAV-1 was stably knockdown. Then we investigated the effects of CAV-1 on the morphology, proliferation, cell cycle and metastasis potential for NCI-H460 cell by crystal violet stains, CCK-8, colony formation, flow cytometry, scratch-wound assay and transwell assay. Western blot was used to examine the expression changes of cyclin D1, PCNA, E-cadherin and b-catenin. Our results showed stable knockdown of CAV-1 inhibited the proliferation of NCI-H460 cells. Cell cycle of the transfected cells was arrested in G1/S phase and the expressions of cyclin D1 and PCNA protein were downregulated. Downregulation of CAV-1 promoted the migration and invasion abilities of NCI-H460 cells in vitro. The expression of b-catenin increased and the level of E-cadherin decreased. In summary, our findings provide experimental evidence that CAV-1 may function as a proproliferative and antimetastatic gene in NCI-H460 cell line. ß 2012 Published by Elsevier Masson SAS.
Keywords: Caveolin-1 RNAi Lung cancer Proliferation Metastasis
1. Introduction Lung cancer is the leading cause of cancer-related death in the world [1]. Lung cancer is mainly classified into small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC). NSCLC comprises approximately 80% of all lung cancers, and early-stage NSCLC is potentially curative by complete surgical resection. However, even with surgical resection, the overall 5-year survival rate for these patients is about 45% to 70%, with most deaths being due to metastatic recurrence [2]. Caveolin-1 (CAV-1) is a 21–24 kDa integral membrane protein and a principal structural component of caveolae, which are involved in multiple cellular processes such as molecular transport, cell proliferation, adhesion, migration and signal transductions [3,4]. In the last decade, it has been suggested that
* Corresponding author. Tel.: +86 0411 86110218. ** Corresponding author. Tel.: +86 0411 83635963 7112. E-mail addresses: [email protected] (H. Xiong), [email protected] (S. Shao). 1 Contributed equally. 0753-3322/$ – see front matter ß 2012 Published by Elsevier Masson SAS. doi:10.1016/j.biopha.2012.03.001
CAV-1 acts as a suppressor gene under some conditions [5]. In contrast, CAV-1 is associated with and contributes to malignant progression. A high-level of expression of intracellular CAV-1 is associated with tumor progression and metastasis of human prostate [6], renal cell carcinoma [7] and esophageal squamous cell carcinoma [8]. Abundant evidence indicates that the overexpression of CAV-1 in NSCLC is closely associated with the early metastasis and poor prognosis of lung adenocarcinoma and squamous carcinoma [9– 12]. It has been reported CAV-1 is overexpressed in lung epithelial cell lines and most of NSCLC cell lines while it is downregulated in SCLC cell lines [13]. We previously researched the role of reexpression of CAV-1 gene in NCI-H446 cells. Our results showed that CAV-1 inhibited proliferation and promoted metastasis of NCI-H446 cells [14]. NCI-H460 is a human large cell carcinoma cell line. Our result showed that CAV-1 was overexpressed in NCI-H460 cell lines [14]. What is the function of CAV-1 in NCI-H460 cell lines? Have the same roles of CAV-1 in NCI-H446 and NCI-H460? The study described the role of CAV-1 on NCI-H460 about proliferation, morphology, cell cycle, metastasis and corresponding mechanisms by RNAi technology.
440
Y. Song et al. / Biomedicine & Pharmacotherapy 66 (2012) 439–447
2. Materials and methods 2.1. Cell culture NCI-H460 cell was routinely cultured in RPMI1640 media (Gibco, USA) containing 10% fetus bovine serum (Hyclone, USA) at 37 oC with 5% CO2. Cells were passaged with 0.25% trypsin. 2.2. shRNA interference and caveolin-1 (CAV-1) transfection and screening The pGPU6/GFP/Neo vectors containing siRNA primers against CAV-1 (NM_001753), negative control and GAPDH were constructed by Gene Pharma Co., Ltd (Shanghai, China). Four possible target sites to this sequence were designed. The target sequences were as follows: 50 - GCAATGT CCGCATCAACTTGC-30 (mRNA 781801), 50 - GCAGTTGTACCATGCATTAAG -30 (mRNA 663-683), 50 GCCGTGTCTATTCCATCTACG-30 (mRNA 712-732) and 50 - GCTGAGC GAGAAGCAAGTGTA -30 (mRNA 383-403). The sequence of negative control was 50 - GTTCTCCGAACGTGTCACGT-30 . The recombinant plasmid was verified by screening analysis. The NCI-H460 cells were transfected with four types of CAV-1-shRNA, negative control (shNC) by using Lipofactamine 2000 (Invitrogen, USA) following the kit instructions. GAPDH was used as the reference to detect the transfection efficiency. The transfected cells were screened with 400 mg/mL G418 (Gibco, USA). After about 8 weeks of selection, the cells were harvested for use and cryopreserved. The levels of CAV-1 mRNA and protein expressions were determined by quantitative real-time PCR (qRT-PCR) and Western blot analysis. 2.3. RNA extraction and quantitative real-time reversed transcription-PCR Total RNA was exacted by using the Aqua Pure RNA Isolation reagent (Invitrogen, USA) according to the manufacturer’s instructions. The total RNA from each sample was reverse transcribed to cDNA using transcript cDNA synthesis Kit (Agilent, USA), and cDNA (500 ng), mixed with SYBR green PCR master mix (Agilent, USA), was used for real-time quantitative-PCR with stratagene Mx3000P
(Agilent, USA). CAV-1 mRNA was normalized to b-actin mRNA. Primer sequences were: CAV-1, forward 50 -GAGCTGAGCGAGAAGCAAGT-30 , and reverse 50 -TCCCTTC TGGTTCTGCAATC-30 ; b-actin, forward 50 -CCTCTCCCAAGTCCACACAG-30 and reverse 50 -GGGCACGAAGGCTCATCATT-30 . 2.4. SDS-PAGE and Western blot analysis Cell proteins were separated by 12% for Cyclin D1, PCNA and CAV-1 or 8% for b-catenin and E-cadherin and transferred to nitrocellulose membranes. b-actin was used as the internal standard. The membranes were probed with antibodies to CAV-1 (Santa Cruz Biotechnology, USA); Cyclin D1, PCNA, b-catenin, E-cadherin (Protein Tech Group, China). 2.5. Cell morphology analysis by crystal violet stains Five hundred cells were cultured in each six well plate. After fixation in ice-cold 70% methanol for 10 min, 0.1% crystal violet was added into the culture for 5 min. Washing three times with PBS, the cell morphology was examined under the microscope. 2.6. Cell proliferation assay Cell proliferation was performed by using a colorimetric assay kit (CCK-8 assay kit; Dojindo Laboratories, Tokyo, Japan) according to the manufacturer’s instructions. Briefly, 5 103 cells/well were seeded in 96-well plates in RMIP-1640 medium. The culture medium was removed and 100 mL of fresh culture medium containing 10 mL of CCK-8 was added to each well. Then the cells were incubated at 37 oC for 1 h. At the time points of 0, 24, 48, 72 and 96 h, the optical density value was measured at least in triplicate against a reagent blank at a test wavelength of 450 nm. Experiments were done in triplicate. 2.7. Colony formation assay A total of 4 102 cells were plated in 100 mm culture dishes. After incubation for an additional 14 days, the cells were fixed with
Fig. 1. Cells transfected with caveolin-1 (CAV-1) shRNA and negative control (shNC) were observed under bright microscopy (left) and fluorescence microscopy (right) after transfected for 48 h. More than 70% of NCI-H460 cells expressed GFP (100).
Y. Song et al. / Biomedicine & Pharmacotherapy 66 (2012) 439–447
441
Fig. 2. Real-time PCR and Western blot validations of the stable knock down of caveolin-1 (CAV-1). A. Real-time PCR of CAV-1. The CAV-1 mRNA level decreased significantly in shRNA-CAV-1-NCI-H460 (*P < 0.01): 1: NCI-H460; 2: shNC-NCI-H460; 3: shRNA-CAV-1-NCI-H460 (mRNA 663–683). B. Western blot of CAV-1. shRNA-CAV-1-NCI-H460 had the lower CAV-1 expression than NCI-H460 and shNC-NCI-H460 cells (*P < 0.01).
70% methanol and stained with 0.1% crystal violet, and colonies of more than 50 cells were manually counted. All experiments were performed in independent triplicates. 2.8. Cell cycle analysis by flow cytometry 2 105 cells were cultured in six well plates as described above and harvested after 24 h. Cells were trypsinized, washed with PBS twice and then fixed with cold 70% ethanol at 4 oC overnight. For flow cytometric analysis, the cells were treated with RNase A for 30 min at 37 oC, stained with propidium iodide (PI) solution for 30 min at 4 oC and then measured by flow cytometry (BD FACS Caton, USA). ModFit LT software was used for data acquisition and analysis.
2.9. Invasion and migration assays Cell invasion and migration were assessed using transwell chambers (Costar, USA) coated with or without 50 mL sera-free RPMI1640 medium containing 3 mg/mL Matrigel (Sigma, USA) in the upper chamber. 5 105 cells were suspended with 100 mL RPMI1640 medium without fetal bovine serum and placed onto the upper compartment. The lower chamber was filled with 200 mL RPMI1640 containing 0.1 mg/mL fetal bovine serum. The plates were incubated at 37 oC for 24 h for invasion and 18 h for migration. The number of cells stained with 0.1% crystal violet on the undersurface of the polycarbonate membranes (8 mm pore size) was counted in multiple random fields using a light microscope.
Fig. 3. Cell morphology of crystal violet stains. The shRNA-caveolin-1 (CAV-1)-NCI-H460 cells had smaller cell shape with few elongated filopodia than NCl-H460 and shNCNCl-H460 cells. The cells grew with colony formation (200).
442
Y. Song et al. / Biomedicine & Pharmacotherapy 66 (2012) 439–447
2.10. Wound healing assay Cells were seeded in six well plates using 10% fetal bovine serum until confluence. A wound area was generated by scraping with a 200 mL pipette tip. The medium was then changed to serum-free
medium. After 8 and 24 h, the cells in the wounded monolayer were counted randomly at multiple fields. The fields were photographed using a phase contrast microscope with a digital camera (Digital Sight, Nikon, Japan). The relative motility capacities of the cells were processed according to our method [14].
Fig. 4. The effect of the down- regulation of caveolin-1 (CAV-1) on cell proliferation. A. CCK-8 assay. The result indicated that knockdown of CAV-1 expression significantly inhibits the growth of shRNA-CAV-1-NCI-H460 cells (*P < 0.01). No difference was observed between NCl-H460 and shNC-NCl-H460 (P > 0.05). B. Colony formation assay. The number and size of colonies of shRNA-CAV-1-NCI-H460 was much less and smaller than NCl-H460 and shNC-NCl-H460 cells (*P < 0.01). The ratio of colony formation of shRNA-CAV-1-NCI-H460 was lower than NCl-H460 and shNC-NCl-H460 cells (*P < 0.01). No distinction was observed between NCl-H460 and shNC-NCl-H460 cells (40).
Y. Song et al. / Biomedicine & Pharmacotherapy 66 (2012) 439–447
2.11. Statistical analysis Results are represented as means SD. Statistical analyses were performed using the SPSS13.0 software. Tests that produced P 0.05 were considered to be significant. 3. Results
443
Table 1 Cell numbers of NCl-H460, shNC-NCI-H460 and shRNA-caveolin-1 (CAV-1)-NCIH460 cells by cell colony formation. Cell lines
Cell numbers of colony formation
Ratio of colony formation (%)
NCl-H460 shNC-NCI-H460 shRNA-CAV-1-NCI-H460
214 16.5 195.3 13.6 120.7 7.8
42.8 2.92 39.6 2.20 24.2 0.96
3.1. Caveolin-1 (CAV-1) was stable knockdown in NCI-H460 cell line GFP was highly expressed in the reference group, indicating that a high efficiency of transfection can be achieved (Fig. 1). Among the four recombinant vectors, pGPU6/GFP/Neo-shRNACAV-1 (mRNA 663–683) showed the strongest gene silencing effect and downregulated the mRNA and protein expression of CAV-1 in the transfected cells comparing with NCI-H460 and shNC-NCI-H460 cells. The level of mRNA and protein of CAV-1 in NCI-H460 were about a 80% decrease of that of shRNA-CAV-1-NCIH460 (Fig. 2). There was no difference between NCI-H460 and shNC-NCI-H460 cell. It indicated that 50 -GCAGTTGTACCATGCATTAAG-30 was an efficient silencing target for CAV-1. The results indicate that the successful establishment of the CAV-1 stable knockdown cell line shRNA-CAV-1- NCI-H460. 3.2. The stable knockdown of caveolin-1 (CAV-1) changed NCI-H460 cell morphology Comparing with NCl-H460 cells and shNC-NCl-H460, shRNACAV-1-NCI-H460 cells showed smaller cell shape with few filopodia and grew with colonies formation, as the results showed in Fig. 3. 3.3. The stable knockdown of caveolin-1 (CAV-1) inhibited NCI-H460 cell proliferation The result of CCK-8 assay was showed in Fig. 4A. shRNA interfering significantly inhibited the cell growth of NCI-H460
cells. The result of colony formation assay was consistent with CCK-8 assay. The number of colonies of NCI-H460, shNC-NCI-H460 and shRNA-CAV-1-NCI-H460 cells were 214 16.5, 195.3 13.6 and 120.7 7.8 respectively. The ratio of colony formation were 42.8 2.92%, 39.6 2.20% and 24.2 0.96%. The number of colony and the ratio of colony formation of shRNA-CAV-1-NCI-H460 were significant lower than that of the shNC-NCI-H460 cells (P = 0.0008 and 0.006, respectively), but no difference was observed between shNC-NCI-H460 cells and NCI-H460 cells (Fig. 4B and Table 1). 3.4. The stable knockdown of caveolin-1 (CAV-1) arrested NCI-H460 cells to G1/S phases Flow cytometry assay was used to detect whether the cell cycle was affected by stable knockdown of CAV-1. The percentage of G1 stage cells in the group of shNC-NCI-H460 and shRNA-CAV-1-NCIH460 were (36.50 1.43)% and (49.66 1.13)%, respectively. The percentage of S stage cells in the group of shNC-NCI-H460 and shRNACAV-1- NCI-H460 were (39.23 1.48%) and (21.61 1.18)%, respectively. We found that the percentage of G1 stage in shRNA-CAV-1NCI-H460 cells was increased significantly (P = 0.00003), while the percentage of S stage was decreased (P = 0.00004). The differences of the G2/M stage cells were of no statistical significance among the cells. These data were shown in Fig. 5 and Table 2. Then we detected the levels of cyclin D1 and PCNA expression by Western blot. The levels of cyclin D1 and PCNA expression were downregulated in shRNA-CAV-1- NCI-H460 cells (P = 0.02 and 0.0002, respectively).
Fig. 5. The effect of the downregulation of caveolin-1 (CAV-1) on cell proliferation. FACS analysis demonstrating an increased percentage in the G0/G1 phase and a decreased percentage in the S phase of the shRNA-CAV-1-NCI-H460 cells (*P < 0.01). The majority of NCI-H460-CAV-1-shRNA cells were arrested in G1/S phase. No difference was observed among the cells in the G2 phase.
444
Y. Song et al. / Biomedicine & Pharmacotherapy 66 (2012) 439–447
There was no difference between NCl-H460 and shNC-NCl-H460 cells (Fig. 8A). The results were consistent with the poor proliferation ability on shRNA-CAV-1- NCI-H460. Taken together these findings show a proproliferative role for CAV-1 in the NCI-H460 cell line. 3.5. The downregulation of caveolin-1 (CAV-1) increased the migration and invasion of NCI-H460 Migration and invasion through a basement membrane are hallmarks of malignancy. We performed a transwell chamber assay to determine the cell abilities of passing through a biological basement membrane in vitro. The results indicated that the migration capacity through the polycarbonate membrane of transwell chambers in the shRNA-CAV-1-NCI-H460 cells was a roughly 3-fold increase comparing with shNC-NCl-H460 (P = 0.00008), whereas there was no difference between NCl-H460
Table 2 Cell cycle analysis of NCl-H460, shNC-NCI-H460 and shRNA-caveolin-1 (CAV-1)NCI-H460 cells. Cell lines
G0/G1 (%)
S (%)
G2/M (%)
NCl-H460 shNC-NCI-H460 shRNA-CAV-1-NCI-H460
35.93 0.95 36.50 1.43 49.66 1.13
38.71 2.79 39.23 1.48 21.61 1.18
25.35 2.83 24.27 0.52 28.73 0.60
and shNC-NCl-H460 cells (Fig. 6A). Moreover, when the cells were subjected to invasion assays, we observed an almost 4-fold increase in the capacity of shRNA-CAV-1-NCI-H460 cells to invade through Matrigel-coated transwell chambers comparing to shNCNCl-H460 cells (P = 0.0001). No distinction was observed between NCl-H460 and shNC-NCl-H460 cells (Fig. 6B). These results
Fig. 6. The effect of the stable knockdown caveolin-1 (CAV-1) on migration and invasion of transwell chamber. A. Transwell migration (crystal violet staining, original magnification 200). shRNA-CAV-1-NCI-H460 cells had much more cells migrated through the basement membrane than those of shNC-NCI-H460 and NCI-H460 cells (*P < 0.01). No significant difference was observed between shNC-NCI-H460 and NCI-H460 cells (P > 0.05). B. Transwell invasion (crystal violet staining, original magnification 200). shRNA-CAV-1-NCI-H460 cells had much more cells invaded through the basement membrane than those of shNC-NCI-H460 and NCI-H460 cells (*P < 0.01). There was no distinction between shNC-NCI-H460 and NCI-H460 cells (P > 0.05).
Y. Song et al. / Biomedicine & Pharmacotherapy 66 (2012) 439–447
445
Fig. 7. Cell scratch-wound assay. At 8 h after scratch time point, few cells migrated in the NCl-H460 and shNC-NCI-H460 cell groups while quite a lot of shRNA-caveolin-1 (CAV-1)-NCI-H460 cells migrated across the wound. At 24 h, the shRNA-CAV-1-NCI-H460 cells reached the midline of the wound. shRNA-CAV-1-NCI-H460 had higher migrated cells than that of NCI-H460 and shNC-NCI-H460 at 8 and 24 h after scratching (*P < 0.01) (100).
suggest that CAV-1 suppresses the metastasis potential of the transfected NCl-H460 cell. 3.6. The downregulation of caveolin-1 (CAV-1) increased the mobilities of NCI-H460 Cell scratch-wound assay was performed to investigate the effect of CAV-1 on the horizontal migration of NCI-H460 cell by observing the scratch-wounding confluent monolayers of each group cells. The stable knockdown of CAV-1 markedly promoted the spreading of the shRNA-CAV-1-NCI-H460 cell line along the edges of the wound comparing to the NCl-H460 and shNC-NClH460 cells (Fig. 7). No difference was observed between NCl-H460 and shNC-NCl-H460 cells. 3.7. The stable knockdown of caveolin-1 (CAV-1) decreased the expression of E-cadherin and increased the expression of b-catenin The result of Western blot revealed that NCl-H460 cells had a lower E-cadherin expression and a higher b-catenin expression after stable knockdown of CAV-1. The stable knockdown of CAV-1 induced a 1.8-fold decrease of E-cadherin protein expression and a 2-fold increase of expression of b-catenin protein as compared with the shNC-NCl-H460 cells (Fig. 8B).
4. Discussion We previously reported that the re-expression of CAV-1 gene inhibited cell proliferation and promoted cell metastasis in NCIH446 cells [14]. In the present study, we investigated the effect of stable knockdown of CAV-1 in NCI-H460 cells on cell morphology, growth, cell cycle, mobility and metastasis. The result of yeast two-hybrid screen identified that the actinbinding filamin was a ligand for CAV-1 [15]. Possibly, the interaction between CAV-1 and actin or filamin participated in filopodia formation. Our results of morphological studies showed the cells became smaller cell shape with few filopodia and grew with colonies formation after stable knockdown of CAV-1. CCK-8 and colony formation assay were used to detect the effect of CAV-1 knockdown on the proliferation of NCI-H460. The results indicated that downregulation of CAV-1 results in an inhibition of cell proliferation comparing to NCI-H460 and shNC-NCI-H460 cells in vitro, however there was no different between NCI-H460 and shNC-NCI-H460 cells. This finding is consistent with the results of Casey Trimmer [13]. He studied the effect of CAV-1 on the growth of several NSCLC cell lines by using RNAi technology. The results showed that siRNA-mediated downregulation of CAV-1 expression significantly inhibited colony formation in soft agar and liquid culture of cells. Although CAV-1 has been implicated as a candidate
446
Y. Song et al. / Biomedicine & Pharmacotherapy 66 (2012) 439–447
Fig. 8. Western blot of cyclin D1, PCNA, E-cadherin and b-catenin. A. The expression of cyclin D1 and PCNA by Western blot. The levels of cyclin D1 and PCNA were downregulated in shRNA-caveolin-1 (CAV-1)-NCI-H460. (*P < 0.01). B. E-cadherin and b-catenin detected by Western blot. shRNA-CAV-1-NCI-H460 cells had much lower Ecadherin expression than that from NCl-H460 and shNC-NCI-H460 cells (*P < 0.01). The expression of b-catenin was significantly increased in shRNA-CAV-1-NCI-H460 cells (*P < 0.01).
tumor suppressor gene in many human tumors including lung cancer, it seems that CAV-1 expression is required for in vitro tumor growth of NSCLC cell lines that express CAV-1. Flow cytometry assay was used to detect the ratio of cells in cell cycle. Stable knockdown of CAV-1 in NCI-H460 cells resulted in an increase in the G0/G1 phase population the cell cycle and a significant reduction in the S phase population as well. It indicated the cells were arrested at G1/S phase. CAV-1 maybe inhibits the cell growth by suppressing the cell cycle. The expressions of PCNA and cyclin D1 of Western blot validate the results of cell cycle. The proliferating cell nuclear antigen (PCNA), a protein which is synthesized mainly during the G1/S phase of the cell cycle and plays an important role for both DNA synthesis and DNA repair by binding with DNA polymerase d in eukaryotic [16,17]. Many studies support the role of PCNA as a potential marker of cellular proliferation and oncogenesis [18,19]. Cyclin D1, a member of G1 cyclins, controls the cell cycle transition from the G1 to S phase. It acts by forming a complex with either CDK4 or CDK6. Thus cyclin D1 is an essential molecule for the dividing cell to enter the DNA synthesis phase [20]. Our data showed that stable knockdown of CAV-1 could downregulate the expression of cyclin D1 and PCNA on NCI-H460 cells. It maybe the one of the reasons that the transfected cell shows a poor proliferation. Metastasis is a very complex biological process in carcinomas, which mainly relies on the invasion and migration abilities of the malignant tumor cells [14]. Activation of ‘epithelial-mesenchymal transition’ (EMT) is crucial for the dissemination and invasion of certain cancer cells [21]. The first important event of EMT is loss of E-cadherin, which is an important cell-cell adhesion protein,
forming junction complex by binding of b-catenin to a-catenin and mediating adhesion stability [22,23]. Impairment of Ecadherin/b-catenin junction complex has been demonstrated to play an important role in induction of EMT in development and tumorigenesis [24,25]. It is reported that downregulation of CAV-1 in human tumor cells causes the downregulation of E-cadherin, increases b-catenin-TCF/LEF-1 transcriptional activity and promotes invasion [26–28]. A controversial role for CAV-1 in metastasis has emerged from various types of cancers. Fiucci et al. [29] reported that overexpression of CAV-1 in human breast cancer MCF-7 cells inhibited soft agar growth and matrix invasion. The result of transwell migration assay and scratch-wound assay demonstrated that the shRNA-CAV-1-NCI-H460 cell line migrated faster than the NCl-H460 and shNC-NCI-H460 cells, which suggested that stable knockdown of CAV-1 could promote the migration for the NCl-H460 cell line. In the transwell invasion assay, the shRNA-CAV-1-NCI-H460 cells showed a significant higher invasion capability relative to the NCI-H460 cells and shNCNCl-H460 cells. It indicated that the stable knockdown of CAV-1 could strongly enhance the capability of cells invasion. The following results of Western blot, showing a significant reduction in the E-cadherin expression and increasing in the b-catenin expression in shRNA-CAV-1-NCI-H460 cells, which were consistent with their elevated motility and metastatic potential in vitro. It demonstrated that CAV-1 maybe effect the E-cadherin/b-catenin pathway in shRNA-CAV-1- NCI-H460 cells. Taken together the above results implicate that stable knockdown of CAV-1 enhance the capabilities of metastasis in the transfected NCI-H460 cell in vitro.
Y. Song et al. / Biomedicine & Pharmacotherapy 66 (2012) 439–447
Overall, our data show that downregulation of CAV-1 suppresses the proliferation of NCI-H460 cells whereas dramatically promotes their abilities to metastasize in vitro. Mechanistically, this phenotype was associated with inhibition of E-cadherin/bcatenin pathway and downregulations of cyclinD1 and PCNA. CAV1 plays different roles between SCLC and NSCLC. The mechanisms of the differences in the roles of CAV-1 will be our further studies.
[12]
[13]
[14]
Disclosure of interest [15]
The authors have not supplied their declaration of conflict of interest. Funding: Financially supported by Mega-Projects of National Science Research of China (973 Program, 2012CB967003), National Natural Science Foundation of China (20935004), National Natural Science Foundation of China (30971539) and Education Department Foundation of Liaoning Province of China (L2010112) References [1] Poulsen TT, Pedersen N, Poulsen HS. Replacement and suicide gene therapy for targeted treatment of lung cancer. Clin Lung Cancer 2005;6:227–36 [PubMed: 15694015]. [2] NavabR, Liu J, Seiden-Long I, Shih W, Li M, Bandarchi B, et al. Co-overexpression of met and hepatocyte growth factor promotes systemic metastasis in NCIH460 non-small cell lung carcinoma cells. Neoplasia 2009;11:1292–300 [PubMed: 20019837]. [3] Shaul PW, Anderson RG. Role of plasmalemmal caveolae in signal transduction. Am J Physiol 1998;275:L843–51 [PubMed: 9815100]. [4] Sternberg PW, Schmid SL. Caveolin-1, cholesterol and Ras signalling. Nat Cell Biol 1999;1:98–105 [PubMed: 10559891]. [5] Williams TM, Lisanti MP. Caveolin-1 in oncogenic transformation, cancer, and metastasis. Am J Physiol 2005;288:C494–6 [PubMed: 15692148]. [6] Yang G, Truong LD, Wheeler TM, Thompson TC. Caveolin-1 expression in clinically confined human prostate cancer: a novel prognostic marker. Cancer Res 1999;59:5719–23 [PubMed: 10582690]. [7] Joo HJ, Oh DK, Kim YS, Lee KB, Kim SJ. Increased expression of caveolin-1 and microvessel density correlates with metastasis and poor prognosis in clear cell renal cell carcinoma. BJU Int 2004;93:291–6 [PubMed: 14764125]. [8] Kato K, Hida Y, Miyamoto M, Hashida H, Shinohara T, Itoh T, et al. Overexpression of caveolin-1 in esophageal squamous cell carcinoma correlates with lymph node metastasis and pathologic stage. Cancer 2002;94:929–33 [PubMed: 11920460]. [9] Yoo SH, Park YS, Kim HR, Sung SW, Kim JH, Shim YS, et al. Expression of caveolin-1 is associated with poor prognosis of patients with squamous cell carcinoma of the lung. Lung Cancer 2003;42:195–202 [PubMed: 14568687]. [10] Kato T, Miyamoto M, Kato K, Cho Y, Itoh T, Morikawa T, et al. Difference of caveolin-1 expression pattern in human lung neoplastic tissue. Atypical adenomatous hyperplasia, adenocarcinoma and squamous cell carcinoma. Cancer Lett 2004;214:121–8 [PubMed: 15331180]. [11] Ho CC, Huang PH, Huang HY, Chen YH, Yang PC, Hsu SM. Up-regulated caveolin-1 accentuates the metastasis capability of lung adenocarcinoma
[16] [17]
[18]
[19]
[20]
[21] [22] [23] [24] [25]
[26]
[27]
[28]
[29]
447
by inducing filopodia formation. Am J Pathol 2002;161:1647–56 [PubMed: 12414512]. Moon KC, Lee GK, Yoo SH, Jeon YK, Chung JH, Han J, et al. Expression of caveolin-1 in pleomorphic carcinoma of the lung is correlated with a poor prognosis. Anticancer Res 2005;25:4631–7 [PubMed: 16334154]. Sunaga N, Miyajima K, Suzuki M, Sato M, White MA, Ramirez RD, et al. Different roles for caveolin-1 in the development of non-small cell lung cancer versus small cell lung cancer. Cancer Res 2004;64:4277–85 [PubMed: 15205342]. Yeh D, Chen C, Sun MZ, Shao S, Hao L, Song Y, et al. Caveolin-1 is an important factor for the metastasis and proliferation of human small cell lung cancer NCIH446 cell. Anat Rec (Hoboken) 2009;292:1584–92 [PubMed: 19718715]. Stahlhut M, van Deurs B. Identification of filamin as a novel ligand for caveolin-1: evidence for the organization of caveolin-1-associated membrane domains by the actin cytoskeleton. Mol Biol Cell 2000;11:325–37 [PubMed: 10637311]. Shivji KK, Kenny MK, Wood RD. Proliferating cell nuclear antigen is required for DNA excision repair. Cell 1992;69:367–74 [PubMed: 1348971]. Essers J, Theil AF, Baldeyron C, van Cappellen WA, Houtsmuller AB, Kanaar R, et al. Nuclear dynamics of PCNA in DNA replication and repair. Mol Cell Biol 2005;25:9350–9 [PubMed: 16227586]. Fujita S, Seki S, Fujiwara M, Ikeda T. Midkine expression correlating with growth activity and tooth morphogenesis in odontogenic tumors. Hum Pathol 2008;39:694–700 [PubMed: 18329695]. Barboza CA, Pereira Pinto L, Freitas Rde A, Costa Ade L, Souza LB. Proliferating cell nuclear antigen (PCNA) and p53 protein expression in ameloblastoma and adenomatoid odontogenic tumor. Braz Dent J 2005;16:56–61 [PubMed: 16113935]. Todd R, Hinds PW, Munger K, Rustgi AK, Opitz OG, Suliman Y, et al. Cell cycle dysregulation in oral cancer. Crit Rev Oral Biol Med 2002;13:51–61 [PubMed: 12097237]. Yilmaz M, Christofori G, Lehembre F. Distinct mechanisms of tumor invasion and metastasis. Trends Mol Med 2007;13:535–41 [PubMed: 17981506]. Perez-Moreno M, Jamora C, Fuchs E. Sticky business: orchestrating cellular signals at adherens junctions. Cell 2003;112:535–48 [PubMed: 12600316]. Perez-Moreno M, Fuchs E. Catenins: keeping cells from getting their signals crossed. Dev Cell 2006;11:601–12 [PubMed: 17084354]. Wheelock MJ, Johnson KR. Cadherins as modulators of cellular phenotype. Ann Rev Cell Dev Biol 2003;19:207–35 [PubMed: 14570569]. Brabletz T, Hlubek F, Spaderna S, Schmalhofer O, Hiendlmeyer E, Jung A, et al. Invasion and metastasis in colorectal cancer: epithelial-mesenchymal transition, mesenchymal-epithelial transition, stem cells and beta-catenin. Cells Tissues Organs 2005;179:56–65 [PubMed: 15942193]. Lu Z, Ghosh S, Wang Z, Hunter T. Downregulation of caveolin-1 function by EGF leads to the loss of E-cadherin, increased transcriptional activity of beta-catenin, and enhanced tumor cell invasion. Cancer Cell 2003;4:499–515 [PubMed: 14706341]. Fiucci G, Ravid D, Reich R, Liscovitch M. Caveolin-1 inhibits anchorageindependent growth, anoikis and invasiveness in MCF-7 human breast cancer cells. Oncogene 2002;21:2365–75 [PubMed: 11948420]. Miotti S, Tomassetti A, Facetti I, Sanna E, Berno V, Canevari S. Simultaneous expression of caveolin-1 and E-cadherin in ovarian carcinoma cells stabilizes adherens junctions through inhibition of src-related kinases. Am J Pathol 2005;167:1411–27 [PubMed: 16251425]. Torres VA, Tapia JC, Rodriguez DA, Lladser A, Arredondo C, Leyton L, et al. Ecadherin is required for caveolin-1-mediated downregulation of the inhibitor of apoptosis protein survivin via reduced beta-catenin-Tcf/Lef- dependent transcription. Mol Cell Biol 2007;27:7703–17 [PubMed: 17785436].