CB1 cannabinoid receptor expression is regulated by glucose and feeding in rat pancreatic islets

Regulatory Peptides 163 (2010) 81–87

Contents lists available at ScienceDirect

Regulatory Peptides j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / r e g p e p

CB1 cannabinoid receptor expression is regulated by glucose and feeding in rat pancreatic islets Alonso Vilches-Flores a, Norma Laura Delgado-Buenrostro a, Gabriel Navarrete-Vázquez b, Rafael Villalobos-Molina a,⁎ a b

Unidad de Biomedicina, FES Iztacala, Universidad Nacional Autónoma de México, Av. de Los Barrios 1, Los Reyes Iztacala, C.P. 54090, Tlalnepantla, Mexico Facultad de Farmacia, Universidad Autónoma del Estado de Morelos, Av. Universidad 1001, Chamilpa, C.P. 62209, Cuernavaca, Morelos, Mexico

a r t i c l e

i n f o

Article history: Received 30 November 2009 Received in revised form 1 April 2010 Accepted 28 April 2010 Available online 5 May 2010 Keywords: Endocannabinoid system Pancreatic islets Glucose Rimonabant analog

a b s t r a c t Endocannabinoid system is involved in food intake and energy balance. Beside the hypothalamus, pancreatic islet also expresses CB1 cannabinoid receptor, however little is known about its physiological role and regulation. Since gene expression of many specific proteins of the islet depends on the concentration of glucose, we studied CB1 receptor expression in response to fasting and feeding. Whole pancreas or islets were isolated from food-deprived adult Wistar rats, with or without a previous 1.5 g/kg glucose oral-intake. CB1, insulin and glucagon expressions were analyzed by confocal immunofluorescence and PCR. In vitro, rat islets were cultured at different glucose concentrations, in the presence of anandamide, or with Rimonabant analog BAR-1. CB1, insulin, glucagon, glucokinase, and PDX-1 expression were determined by real-time RT-PCR, and insulin secretion and islet content by ELISA. CB1 expression in pancreatic islets is upregulated during food restriction, and decreases in response to glucose intake or feeding. In cultured islets, 16 mmol/l glucose, BAR-1, and anandamide at low glucose reduced CB1 mRNA. Insulin, glucagon, glucokinase and PDX-1 expression increased in islets treated with anandamide at low glucose, while BAR-1 modified PDX-1 and glucagon mRNA at high glucose. Basal insulin secretion and insulin content in islets increased with anandamide, but not the glucose-stimulated response. Our results suggest that the endocannabinoid system has an important role in gene expression on islets and its close relationship with glucose response. © 2010 Elsevier B.V. All rights reserved.

1. Introduction Endocannabinoid system plays an important role in the regulation of appetite and body weight. It has been demonstrated that this control is distributed in several organs besides the hypothalamus [1], since the blockade of cannabinoid receptor CB1 with antagonist like SR141716 (Rimonabant) causes modifications in energy metabolism and food intake, and induces weight reduction in animal models and patients with obesity [2,3]. The expression of CB1 and CB2 receptors, their endogenous ligands, anandamide and 2-arachidonoylglycerol (2-AG), and the biosynthesizing/degrading enzymes, have been found in pancreatic β, α and δ cells from rodents and human, by different methods [4–14]. These observations suggest the potential role of endocannabinoid system in the regulation of pancreatic hormones secretion. Today the function of activation or inhibition of CB1 receptor in pancreatic islets is not clear. Isolated islets from rat exposed to Δ-9tetrahydrocannabinol enhance basal and glucose-stimulated insulin ⁎ Corresponding author. Tel.: + 52 55 5623 1333x39795; fax: + 52 55 5623 1333x39780. E-mail address: [email protected] (R. Villalobos-Molina). 0167-0115/$ – see front matter © 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.regpep.2010.04.013

release [13]. Similar results were observed in RIN-m5F β cells cultured at high glucose media [7], and in human islets [8], treated with the CB1 agonist. Antagonism of CB1 receptors with SR141716 (Rimonabant) reduced glucose-stimulated insulin secretion, in RIN-m5F β cells and in isolated islets from Zucker rats [9,14]. However, other studies have shown that CB1 receptor activation with agonists reduces Ca2+ mobilization, and insulin secretion [4–6]. These differences could be attributed to the co-participation of CB2 receptor in β-cells, or of endocannabinoid receptors in α and δ cells to stimulate glucagon and somatostatin secretions [8,10–12,14,15], involving complex paracrine actions within islet. There is an increasing evidence of the close relationship between food intake and the endocannabinoid system, but little is known about its regulation. The levels of anandamide and 2-AG are elevated in food deprivation and decreased after feeding, in different organs, including pancreas [16–19]. These observations suggest an interaction between peripheral endocannabinoid system and hormones involved in energetic and metabolic balance. About the regulation of cannabinoid receptors expression by nutriments or hormonal control there are few data: Di Marzo et al. [20] showed that CB1 receptor knockout reduce food intake in mice, like Rimonabant treatment does. In mice fed with a high-fat diet for 14 weeks, the CB1 mRNA in the antrum of

82

A. Vilches-Flores et al. / Regulatory Peptides 163 (2010) 81–87

the stomach decreased [21], but not in the visceral adipose tissue [10]. In the forebrain of bonyfish Carassius auratus, fasting led to a timedependent increase of CB1 receptor mRNA levels, reversed by refeeding or by administration of exogenous anandamide [22]. More recently, it was determined that fasting increased CB1 receptor mRNA in different sections of the hypothalamus and brainstem in lean rats, and in ad libitum fed obese Zucker rats, suggesting a possible regulation by leptin [20,23]. Since gene expression of many proteins and hormones in pancreatic islet cells is regulated in response to changes in glucose [24,25], we assumed that CB1 receptor expression would be modified according to food intake. In this study we have found that CB1 receptor mRNA abundance is reduced after an oral glucose challenge in pancreatic islets from food-deprived rats, and it changed in the presence of anandamide or with a Rimonabant analog, in cultured islets. 2. Materials and methods 2.1. Reagents and animals Anandamide, mouse monoclonal anti-glucagon and rabbit antiCB-1 receptor antibodies, and Ficoll were purchased from Sigma Aldrich (St. Louis, MO, USA); Trizol reagent was from Invitrogen (Carlsbad, CA, USA). DMEM low-glucose media, fetal bovine serum and antibiotics were obtained from Gibco/Invitrogen Corp. (Grand Island, NY, USA). Mouse anti-insulin antibody was from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA). Anti-mouse IgG-FITC, antirabbit IgG-Texas Red or Cy5 were from Jackson Immuno Research (PA, USA). Real-time PCR reagents, DNA probes and TAQurate Green RealTime PCR mastermix were purchased from Epicentre Biotechnologies (Madison, WI, USA) and Molecular Probes Inc. (a subsidiary of Invitrogen Corp.). PCR probes were obtained from Integrated DNA Technologies (Coralville, IA, USA). Enzyme-Linked Immunosorbent Assay (ELISA) kit for insulin (rat) determination was purchased from ALPCO Diagnostics (Salem, NH, USA). Rimonabant analog BAR-1 (1-(4-chlorophenyl)-2-(2,4-dichlorophenyl)-N-(1-piperidinyl)-1H-benzimidazole-5-carboxamide) was synthesized in the laboratory in an overall yield of 65% after seven step synthesis. The chemical structure of the synthesized compound was confirmed on the basis of their spectral data (NMR and mass spectra), and its purity ascertained by microanalysis (data not shown) (Fig. 1). Male Wistar rats of 8 weeks of age were obtained from the local animal facility. Animals were maintained in controlled environmental conditions and light–dark cycles (12:12 h), and all experiments were conducted in accordance with the Federal Guidelines for the Care and Use of Animals (NOM-062-ZOO-1999 Ministry of Agriculture, Mexico) and were approved by the Institutional Ethics Committee of the National Autonomous University of Mexico's Faculty of Higher Studies Iztacala. For studies in vivo, animals were maintained overnight in food restriction for 16 h, and received an oral load of 1.5 g/kg glucose. One hour later, rats were anaesthetized by intraperitoneal injection of sodium pentobarbital, and pancreas were fixed in paraformaldehyde Boulin solution, or were removed for islet isolation by collagenase digestion and discontinuous Ficoll-density gradient, as described previously [26]. Islets were handpicked and collected in TriZol reagent for further PCR analysis. 2.2. Immunohistochemistry for CB1, insulin and glucagon Paraffin-embedded sections of pancreas (n = 3) were analyzed for the presence of CB1 receptor in α- and β-cells by double immunofluorescence. Paraffin sections were dewaxed, rehydrated and blocked with 1% BSA. Then, cells were permeated in 1% PBS-triton X100 for

Fig. 1. Chemical structures of SR141716 (Rimonabant) and its analogue synthesized BAR-1.

7 min at 27 °C, and washed with PBS. Sections were incubated overnight at room temperature with rabbit polyclonal anti-insulin (1:500; Santa Cruz), mouse monoclonal anti-glucagon (1:500; Sigma), or rabbit polyclonal anti-CB1 receptor (1:500; Sigma) antibodies. Secondary antibodies used were anti-mouse IgG-FITC, or anti-rabit IgG-Cy5 (1:500; Jackson Immuno Research). After washing, immunofluorescent signal from 3 to 5 islets were obtained in a Leica TCS SP2 inverted confocal laser-scanning microscope (Leica, Leidemberg, Germany) without background autofluorescence. 2.3. Gene expression study in isolated islets In vitro studies were carried out in isolated pancreatic islets from food-deprived Wistar rats, as described above. Batches of 200 islets were cultured in DMEM medium with low glucose (5.5 mmol/l), supplemented with 5% fetal bovine serum and 200 units/ml penicillin G, 200 mg/ml streptomycin, and 0.5 mg/ml amphotericin B. After 16 h incubation at 37 °C in a humidified atmosphere of 5% CO2, cultured media were replaced and islets were treated 1 h with vehicle (DMSO), 1 µmol/l of anandamide, 1 µmol/l CB1 antagonist synthesized analog, or both compounds, in a 3 mmol/l or 16 mmol/l glucose media. After treatment, islets were collected and total RNA was extracted with TRIzol. RNA concentration was determined by absorbance at 260 nm, and its integrity was confirmed by electrophoresis on 1% denaturing agarose gel. Single-stranded cDNA was synthesized from 0.5 µg of total RNA by reverse-transcription reaction with 500 units of M-MVL RT. Relative gene expression was evaluated in real-time PCR with materials and methods supplied by Epicentre Biotechnologies and Molecular Probes Inc. Twenty ng of cDNA were mixed with TAQurate SYBR green PCR master mix, and specific probes, in a total volume of 25 µl. Forward and reverse primers sequence for Rattus norvergicus mRNA were: 18S rRNA: GGGAGCCTGAGAAACGGC and GGGTCGGGAGTGGGTAATTT CB1: CATCATCATCCACACGTCAG and ATGCTGTTGTCTAGAGGCTG Insulin: ATTGTTCCAACATGGCCCTGT and TTGCAGTAGTTCCCAGTTGG Glucagon: ATTCACAGGGCACATTCACC and CCAGTTGATGAAGTCTCTGG

A. Vilches-Flores et al. / Regulatory Peptides 163 (2010) 81–87

83

PDX-1: CTCGCTGGGAACGCTGGAACA and GCTTTGGTGGATTTCATCCACGG Glucokinase: GCTTCACCTTCTCCTTCCC and CCCATATACTTCCCACCGA Real-time PCR was performed on a Corbette Research Rotor Gene3000 equipment (Sydney, Australia). The samples were analyzed in triplicate and corrected for the 18S rRNA expression used as internal standard. Standard curves were constructed from 0.1 to 10 ng of cDNA from untreated rat islets. Relative gene expression was calculated from cycle threshold (Ct) values by the abundant relative quantification model of the delta-delta Ct [27]. 2.4. Insulin secretion assay and insulin content

Fig. 2. CB1 receptor mRNA abundance in pancreatic islets from food-deprived (fasted) rats decreases after oral administration of 1.5 g/kg glucose in 1 h. Data are expressed as fold change of CB1 mRNA abundance relative to fasted rats. Values represent mean ± SD of tree independent experiments. * indicates P b 0.05 from control.

Isolated islets from food-deprived Wistar rats were incubated for 16 h as described before. Groups of 10 islets were washed twice in a buffer solution containing 115 mmol/l NaCl, 10 mmol/l NaHCO3, 5 mmol/l KCl, 2.5 mmol/l CaCl2, 1.2 mmol/l NaH2PO4, 1.1 mmol/ l MgCl2, 25 mmol/l HEPES, and 1% BSA (pH 7.4), and incubated 1 h with 3 mmol/l or 16 mmol/l glucose, in presence of either 1 µmol/l of anandamide, 1 µmol/l CB1 antagonist synthesized analog, or both. Static insulin secretion and insulin content in sonicated/disrupted islets were determined with an ultrasensitive ELISA kit (ALPCO) for insulin (rat).

Fig. 3. Immunofluorescence for insulin (panel A in green), glucagon (panel B in green) and CB1 receptor (panel A and panel B in blue) of pancreatic islets from fasted rats, with or without an 1-h oral glucose challenge. Image is representative of 3 to 5 islets observed in three different sections from 3 rats for each condition.

84

A. Vilches-Flores et al. / Regulatory Peptides 163 (2010) 81–87

2.5. Statistical analysis Calculations were obtained with the Statview statistical analysis program V.4.5 (Abacus Concepts, Berkeley, CA, USA). Each result is expressed as the mean ± SD of the number of experiments indicated in the text. Data were analyzed using 1 and 2-way ANOVA. Bonferroni correction was used for the post hoc detection of significant differences. Differences were considered significant at P b 0.05. 3. Results

Fig. 4. CB1 receptor mRNA abundance in isolated pancreatic islets from fasted rats, in presence of 1 μmol/l anandamide (CB1 agonist, AEA), 1 μmol/l Rimonabant analog BAR-1 (CB1 antagonist), or both compounds, exposed 1 h at 3 or 16 mmol/l glucose media. Data are expressed as fold change relative to that measured with vehicle (DMSO) at 3 mmol/l glucose. Values represent mean±SD of three independent experiments. * indicates P b 0.05 versus corresponding vehicle at the same glucose concentration; # indicates Pb 0.05 between treatments at 3 and 16 mmol/l glucose.

In fasting (food-deprived) condition, the CB1 receptor is highly expressed in freshly isolated pancreatic islets from rat. One hour after a glucose oral challenge, the mRNA abundance of CB1 receptors decreased 80% in pancreatic islets (Fig. 2). Immunofluorescence images show that CB1 receptor is localized in peripheral cells of the islet, with a strong intensity in the food-deprived condition (Fig. 3). After the oral administration of 1.5 g/kg glucose, CB1 intensity decreased in islets, as well as glucagon, while insulin signal was enhanced. CB1 is immunolocated in peripheral cells of the islet, and less intense in inner cells, some positive to glucagon or insulin. In cultured pancreatic islets, after 1 h of exposure to 16 mmol/l glucose, CB1 receptor mRNA abundance was reduced over 50% (Fig. 4). Treatment with CB1 agonist anandamide at low glucose (3 mmol/l), or with antagonist BAR-1 (a synthesized Rimonabant analog) at high glucose

Fig. 5. Insulin (A), glucagon (B), PDX-1 (C) and glucokinase (D) mRNA abundance in isolated pancreatic islets from fasted rats, in presence of 1 μmol/l anandamide (CB1 agonist, AEA), 1 μmol/l Rimonabant analog BAR-1 (CB1 antagonist), or both compounds, exposed 1 h at 3 or 16 mmol/l glucose media. Data are expressed as fold change relative to that measured with vehicle (DMSO) at 3 mmol/l glucose. Values represent mean ± SD of three independent experiments. * indicates P b 0.05 versus corresponding vehicle at the same glucose concentration; # indicates P b 0.05 between treatments at 3 and 16 mmol/l glucose.

A. Vilches-Flores et al. / Regulatory Peptides 163 (2010) 81–87

induced an 80% decrease in CB1 receptor mRNA. Anandamide's effect on CB1 mRNA at 3 mmol/l glucose was partially blocked by BAR-1. At 16 mM glucose, anandamide, alone or in presence of BAR-1, increased CB1 mRNA abundance with respect to vehicle. In the same treated islets, we evaluated the gene expression of insulin, glucagon, glucokinase and transcription factor PDX-1 (Fig. 5). At 3 mmol/l glucose, anandamide increased over 5-fold mRNA abundance of insulin, glucagon and PDX-1. CB1 antagonist BAR-1 blocked this effect and induced a 50% reduction of glucokinase relative expression, with respect to vehicle. Islets treated at the same time with both treatments reduced significantly glucagon, PDX-1 and glucokinase mRNA expression. Islets exposed 1 h at high glucose increased PDX-1 and glucokinase mRNA abundance, but in the presence of anandamide, diminished their expression, even with BAR-1. Insulin and glucagon mRNA abundance did not change with respect to vehicle, but presented a significant reduction with respect to the same treatments at 3 mmol/l glucose. Basal and glucose-stimulated insulin secretion increased with respect to vehicle, in islets treated with anandamide, BAR-1 or both compounds (Fig. 6A). The presence of CB1 agonist showed a more significant effect on insulin release at 3 mmol/l glucose, while CB1 antagonist enhanced it at 16 mmol/l glucose. However, the ratio from

85

3 to 16 mmol/l glucose-induced insulin secretion was diminished significantly in the presence of anandamide (Fig. 6B). The insulin content in islets treated with anandamide, alone or with Rimonabant analog BAR-1, was higher than vehicle at 3 mmol/l glucose. At high glucose (16 mmol/l), insulin content was increased in islets, but not in the presence of BAR-1. 4. Discussion From food restriction to feeding there are many endogenous signals and mechanisms acting in different organs to maintain energetic homeostasis. The endocannabinoid system is involved in this metabolic control, and includes the brain, peripheral tissues and pancreatic islets [3]. There is evidence that starving and feeding change the content and release of anandamide and 2-AG in the brain [16], small intestine [18,19], liver, adipocytes and pancreatic cells [7,19]. However, there are few reports about the regulation of CB1 receptor expression and its implications on gene expression. In this study, we report that oral glucose administration to fooddeprived rats changes the CB1 receptor mRNA abundance in pancreatic islets. In vitro we observed the same effect in isolated islets treated with 16 mol/l glucose and CB1 agonist anandamide. The control on CB1

Fig. 6. Glucose-stimulated insulin secretion (panel A), ratio of insulin secretion (panel B) and insulin content (panel C), in isolated pancreatic islets from fasted rats, in presence of 1 μmol/l anandamide (CB1 agonist, AEA), 1 μmol/l Rimonabant analog BAR-1 (CB1 antagonist), or both compounds, exposed 1 h at 3 or 16 mmol/l glucose. Data in panel A are expressed as ng/ml per 10 islets in 1 h. In panel B, as fold of stimulated insulin secretion from 3 to 16 mmol/l glucose. In panel C, data are expressed as ng insulin/ml per islet. Values represent mean ± SD of three independent experiments. * indicates P b 0.05 versus corresponding vehicle at the same glucose concentration; # indicates P b 0.05 between treatments at 3 and 16 mmol/l glucose.

86

A. Vilches-Flores et al. / Regulatory Peptides 163 (2010) 81–87

expression in the islet cells could be a metabolic effect in response to food disposition, or an autocrine effect of the glucose-stimulated insulin secretion. Similar findings have been recently reported in brain regions involved in appetite regulation, from bonyfish Carassius auratus [22], and from lean and obese Zucker rats [23]. In these works, CB1 receptor mRNA levels from food-sensing region in the forebrain, brainsteam and hypothalamic nuclei, increased in fasting conditions, and decreased when animals were re-fed. Di Marzo et al. [21] reported changes in CB1 mRNA in the antrum of stomach of mice fed with a high-fat diet for 14 weeks. Immunofluorescence studies on pancreatic islets from mouse, rat and human have demonstrated the presence of CB1 receptor in αcells and δ-cells, and in less proportion in β-cells [5,8,10,11]. Our results coincide with previous studies, pointing to a possible paracrine regulatory role. Starowicz et al. [10] suggested that the role of endocannabinoids and its receptors in α-cells could be autocrine mediators, so it is possible that the glucose effect on CB1 receptors could be through α-cells more than β-cells. In the long term, CB1 expression in islet cells from mice fed with a high-fat diet does not change, but endocannabinoids biosynthesizing and degrading enzymes do. We found that CB1 presence is different between fasted rats and after a glucose challenge, as well as glucagon and insulin, in response to a feeding state in the short term. It would be interesting to study the CB1 expression in other peripheral tissues that also participate in carbohydrate metabolism from fasting and feeding. CB1 receptor expression and activity are directly associated with satiety and the anorexigenic response. CB1 antagonist Rimonabant can induce a rapid change in Acrp30 (adiponectin) expression, in mouse 3T3 adipocytes [28], and increase expression of proteins involved in glucose metabolism in adipose tissue [29]. On the other hand, CB1 activation stimulates the synthesis of hepatic enzymes and transcription factors involved in fat metabolism [30]. We found that cannabinoid agonists and antagonists are involved in CB1 receptor expression regulation in pancreatic islets. CB1 stimulation with anandamide reduced its expression in starving conditions and promotes it at high glucose conditions. This could be a negativefeedback pathway to control starving and satiety responses through islet secretions. On the other hand, our synthetic Rimonabant analog BAR-1 shows a partial blockade of CB1 receptor, probably due to a lower affinity towards it than anandamide. The expression of some specific pancreatic genes that participate in glucose regulation also seems to be regulated by the activation/blockade of CB1 receptor. PDX-1 is an important transcription factor for the gene expression of many specific proteins involved in glucose metabolism, including glucokinase, insulin and glucagon [31]. CB1 activation with anandamide increases PDX-1 and glucagon mRNA, but not glucokinase, in a low-glucose condition. The increase of insulin mRNA could be result of a paracrine pathway, with an enhanced glucagon expression and possible secretion. In a stimulatory glucose concentration, PDX-1 and glucokinase expressions change as an adaptive process, and the presence of anandamide seems to block this response. Thus, the activity of the endocannabinoid system on islets could modify their specific gene expression in response to changes of feeding states. We did not observe changes on insulin and glucagon mRNA expression with glucose at 1 h, since effects of carbohydrates on transcription are present until after 2 h [25]. Pancreatic glucokinase has a very important role in the glucoseinduced insulin and glucagon secretions [26,32], and it is quite interesting that its expression could be modulated by CB1 antagonist, which provides an alternative control for glucagon secretion in a fasting condition, and insulin after food intake. CB1 receptor blockade or its knockout have important effects on metabolism and feeding behavior, through the expression and action of regulatory enzyme and hormones, at the brain and several peripheral tissues [2,20] Tissue-specific glucokinase expression at the liver and hypothalamus could possibly be modulated by the endocannabinoid system in the same way that it does at pancreatic islets.

The relationship between endocannabinoid system and insulin secretion has been very controversial. At low glucose (3 mmol/l), the high expression of CB1 receptor and anandamide showed a stimulating effect on basal insulin secretion, but a diminished response to glucose-stimulated secretion. This could be associated to the insulin resistance present on obesity and type 2 diabetes [10,15]. In RIN m5F insulinoma cells, a typical model for β-cell dysfunction, acylethanolamides level change in relation of glucose and insulin [17]. There are evidence that CB1 receptor activation decreases insulin secretion due to changes in intracellular Ca2+ concentration in β-cells [4,5], but since CB1 and CB2 receptors are also expressed in α- and δ-cells too [8,11,12,14], the role of endocannabinoid system as a regulatory signaling pathway of the insulin release could involve the paracrine action of glucagon and somatostatine. Our Rimonabant analog BAR-1 enhances glucose-induced insulin secretion, but does not alter the secretion ratio from low to high glucose, apparently promoting β-cell emptying. The difference between our results with BAR-1 and the previous studies with Rimonabant [15] could be explained by its affinity to CB1 receptor or the possibility of acting with a different receptor, like orphan receptor GPR55 [33]. In conclusion, CB1 receptor expression in pancreatic islets from rats can be modulated through fasting or feeding, and its activation or blockade is related to gene expression and insulin secretion. Acknowledgment This study was supported by grant PICDS08-69 from ICyT-GDF. G. Navarrete-Vazquez wishes to thank the postdoctoral fellowship given by DGAPA-UNAM, and Facultad de Farmacia, UAEM. We also thank Isela Vela Pérez for correcting the English version of the manuscript. References [1] Pagotto U, Marsicano G, Cota D, Lutz B, Pasquali R. The emerging role of the endocannabinoid system in endocrine regulation and energy balance. Endocrinol Rev 2006;27:73–100. [2] Kunos G. Understanding metabolic homeostasis and imbalance: what is the role of the endocannabinoid system? Am J Med 2007;120:S18–24 discussion S24. [3] Di Marzo V. CB(1) receptor antagonism: biological basis for metabolic effects. Drug Discov Today 2008;13:1026–41. [4] Juan-Picó P, Fuentes E, Bermúdez-Silva FJ, Javier Díaz-Molina F, Ripoll C, Rodríguez de Fonseca F, Nadal A. Cannabinoid receptors regulate Ca (2+) signals and insulin secretion in pancreatic β-cell. Cell Calcium 2006;39:155–62. [5] Nakata M, Yada T. Cannabinoids inhibit insulin secretion and cytosolic Ca2+ oscillation in islet β-cells via CB1 receptors. Regul Pept 2008;145:49–53. [6] De Petrocellis L, Marini P, Matias I, Moriello AS, Starowicz K, Cristino L, Nigam S, Di Marzo V. Mechanisms for the coupling of cannabinoid receptors to intracellular calcium mobilization in rat insulinoma beta-cells. Exp Cell Res 2007;313(14): 2993–3004. [7] Matias I, Gonthier MP, Orlando P, Martiadis V, De Petrocellis L, Cervino C, Petrosino S, Hoareau L, Festy F, Pasquali R, Roche R, Maj M, Pagotto U, Monteleone P, Di Marzo V. Regulation, function, and dysregulation of endocannabinoids in models of adipose and beta-pancreatic cells and in obesity and hyperglycemia. J Clin Endocrinol Metab 2006;91:3171–80. [8] Bermúdez-Silva FJ, Suárez J, Baixeras E, Cobo N, Bautista D, Cuesta-Muñoz AL, Fuentes E, Juan-Pico P, Castro MJ, Milman G, Mechoulam R, Nadal A, Rodríguez de Fonseca F. Presence of functional cannabinoid receptors in human endocrine pancreas. Diabetologia 2008;51(3):476–87. [9] Duvivier VF, Delafoy-Plasse L, Delion V, Lechevalier P, Le Bail JC, Guillot E, Pruniaux MP, Galzin AM. Beneficial effect of a chronic treatment with rimonabant on pancreatic function and beta-cell morphology in Zucker fatty rats. Eur J Pharmacol 2009;616:314–20. [10] Starowicz KM, Cristino L, Matias I, Capasso R, Racioppi A, Izzo AA, Di Marzo V. Endocannabinoid dysregulation in the pancreas and adipose tissue of mice fed with a high-fat diet. Obesity 2008;16(3):553–65. [11] Juan-Pico P, Ropero AB, Tuduri E, Quesada I, Fuentes E, Bermudez-Silva FJ, Rodriguez de Fonseca F, Nadal A. Regulation of glucose-induced [Ca2+] signals by cannabinoid CB1 and CB2 receptors in pancreatic α- and δ-cells within intact islets of Langerhans. Obes Metab 2009;5:20-8. [12] Bermúdez-Silva FJ, Sanchez-Vera I, Suárez J, Serrano A, Fuentes E, Juan-Pico P, Nadal A, Rodríguez de Fonseca F. Role of cannabinoid CB2 receptors in glucose homeostasis in rats. Eur J Pharmacol 2007;565:207–11. [13] Laychock SG, Hoffman JM, Meisel E, Bilgin S. Pancreatic islet arachidonic acid turnover and metabolism and insulin release in response to delta-9-tetrahydrocannabinol. Biochem Pharmacol 1986;35:2003–8.

A. Vilches-Flores et al. / Regulatory Peptides 163 (2010) 81–87 [14] Tharp WG, Lee YH, Maple RL, Pratley RE. The cannabinoid CB1 receptor is expressed in pancreatic delta-cells. Biochem Biophys Res Commun 2008;372: 595–600. [15] Getty-Kaushik L, Richard AM, Deeney JT, Krawczyk S, Shirihai O, Corkey BE. The CB1 antagonist rimonabant decreases insulin hypersecretion in rat pancreatic islets. Obesity 2009;17(10):1856–60. [16] Kirkham TC, Williams CM, Fezza F, Di Marzo V. Endocannabinoid levels in rat limbic forebrain and hypothalamus in relation to fasting, feeding and satiation: stimulation of eating by 2-arachidonoyl glycerol. Br J Pharmacol 2002;136:550–7. [17] Matias I, Gonthier MP, Petrosino S, Docimo L, Capasso R, Hoareau L, Monteleone P, Roche R, Izzo AA, Di Marzo V. Role and regulation of acylethanolamides in energy balance: focus on adipocytes and beta-cells. Br J Pharmacol 2007;152:676–90. [18] Gómez R, Navarro M, Ferrer B, Trigo JM, Bilbao A, Del Arco I, Cippitelli A, Nava F, Piomelli D, Rodríguez de Fonseca F. A peripheral mechanism for CB1 cannabinoid receptor-dependent modulation of feeding. J Neurosci 2002;22(21):9612–7. [19] Izzo AA, Piscitelli F, Capasso R, Aviello G, Romano B, Borrelli F, Petrosino S, Di Marzo V. Peripheral endocannabinoid dysregulation in obesity: relation to intestinal motility and energy processing induced by food deprivation and refeeding. Br J Pharmacol 2009;158(2):451–61. [20] Di Marzo V, Goparaju SK, Wang L, Liu J, Bátkai S, Járai Z, Fezza F, Miura GI, Palmiter RD, Sugiura T, Kunos G. Leptin-regulated endocannabinoids are involved in maintaining food intake. Nature 2001;410:822–5. [21] Di Marzo V, Capasso R, Matias I, Aviello G, Petrosino S, Borrelli F, Romano B, Orlando P, Capasso F, Izzo AA. The role of endocannabinoids in the regulation of gastric emptying: alterations in mice fed a high-fat diet. Br J Pharmacol 2008;153 (6):1272–80. [22] Cottone E, Guastalla A, Pomatto V, Campantico E, Di Marzo V, Franzoni M. Goldfish CB1 mRNA expression is affected by fasting and anandamide administration. NeuroReport 2009;20:595–9. [23] Jelsing J, Larsen PJ, Vrang N. The effect of leptin receptor deficiency and fasting on cannabinoid receptor 1 mRNA expression in the rat hypothalamus, brainstem and nodose ganglion. Neurosci Lett 2009;463:125–9.

87

[24] Omori K, Mitsuhashi M, Todorov I, Rawson J, Shiang KD, Kandeel F, Mullen Y. Microassay for glucose-induced preproinsulin mRNA expression to assess islet functional potency for islet transplantation. Transplantation 2010;89(2):146–54. [25] Moede T, Leibiger B, Berggren PO, Leibiger IB. Online monitoring of stimulusinduced gene expression in pancreatic beta-cells. Diabetes 2001;50(Suppl 1):S15–9. [26] Vilches-Flores A, Tovar AR, Marin-Hernandez A, Rojas-Ochoa A, Fernandez-Mejia C. Biotin increases glucokinase expression via soluble guanylate cyclase/protein kinase G, adenosine triphosphate production and autocrine action of insulin in pancreatic rat islets. J Nutr Biochem 2010;21(7):606–12. [27] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2[-delta delta C(t)] method. Methods 2001;25: 402–8. [28] Bensaid M, Gary-Bobo M, Esclangon A, Maffrand JP, Le Fur G, Oury-Donat F, Soubrié P. The cannabinoid CB1 receptor antagonist SR141716 increases Acrp30 mRNA expression in adipose tissue of obese fa/fa rats and in cultured adipocyte cells. Mol Pharmacol 2003;63:908–14. [29] Jbilo O, Ravinet-Trillou C, Arnone M, Buisson I, Bribes E, Péleraux A, Pénarier G, Soubrié P, Le Fur G, Galiègue S, Casellas P. The CB1 receptor antagonist rimonabant reverses the diet-induced obesity phenotype through the regulation of lipolysis and energy balance. FASEB J 2005;19:1567–9. [30] Osei-Hyiaman D, DePetrillo M, Pacher P, Liu J, Radaeva S, Bátkai S, Harvey-White J, Mackie K, Offertáler L, Wang L, Kunos G. Endocannabinoid activation at hepatic CB1 receptors stimulates fatty acid synthesis and contributes to diet-induced obesity. J Clin Invest 2005;115:1298–305. [31] Ahlgren U, Jonsson J, Jonsson L, Simu K, Edlund H. Beta-cell-specific inactivation of the mouse Ipf1/Pdx1 gene results in loss of the beta-cell phenotype and maturity onset diabetes. Genes Dev 1998;12:1763–8. [32] Matschinsky FM. Regulation of pancreatic beta-cell glucokinase: from basics to therapeutics. Diabetes 2002;51:S394–404. [33] Lauckner JE, Jensen JB, Chen HY, Lu HC, Hille B, Mackie K. GPR55 is a cannabinoid receptor that increases intracellular calcium and inhibits M current. Proc Natl Acad Sci USA 2008;105(7):2699–704.