CB2 and TRPV1 receptors mediate cannabinoid actions on MDR1 expression in multidrug resistant cells

Pharmacological Reports 2012, 64, 751–757 ISSN 1734-1140

Copyright © 2012 by Institute of Pharmacology Polish Academy of Sciences

Short communication

CB2 and TRPV1 receptors mediate cannabinoid actions on MDR1 expression in multidrug resistant cells Jonathon C. Arnold1, Phoebe Hone1, Michelle L. Holland1, John D. Allen2 

School of Medical Sciences (Pharmacology) and Bosch Institute, The University of Sydney, NSW 2006, Sydney, Australia The Centenary Institute of Cancer Medicine and Cell Biology, NSW 2006, Sydney, Australia Correspondence: Jonathon C. Arnold, e-mail: [email protected]

Abstract: Background: Cannabis is the most widely used illicit drug in the world that is often used by cancer patients in combination with conventional anticancer drugs. Multidrug resistance (MDR) is a major obstacle in the treatment of cancer. An extensively characterized mechanism of MDR involves overexpression of P-glycoprotein (P-gp), which reduces the cellular accumulation of cytotoxic drugs in tumor cells. Methods: Here we examined the role of cannabinoid receptors and transient receptor potential vanilloid type 1 (TRPV1) receptors in the effects of plant-derived cannabinoids on MDR1 mRNA expression in MDR CEM/VLB100 cells which overexpress P-gp due to MDR1 gene amplification. Results: We showed that both cannabidiol (CBD) and D9-tetrahydrocannabinol (D9-THC) (10 μM) transiently induced the MDR1 transcript in P-gp overexpressing cells at 4 but not 8 or 48 h incubation durations. CBD and THC also concomitantly increased P-gp activity as measured by reduced accumulation of the P-gp substrate Rhodamine 123 in these cells with a maximal inhibitory effect observed at 4 h that slowly diminished by 48 h. CEM/VLB100 cell lines were shown to express CB2 and TRPV1 receptors. D9-THC effects on MDR1 expression were mediated by CB2 receptors. The effects of CBD were not mediated by either CB2 or TRPV1 receptors alone, however, required activation of both these receptors to modulate MDR1 mRNA expression. Conclusion: This is the first evidence that CB2 and TRPV1 receptors cooperate to modulate MDR1 expression. Key words: cannabinoids, P-glycoprotein, CB , TRPV

Introduction Multidrug resistance (MDR) is a major obstacle in the treatment of cancer. MDR reduces the sensitivity of tumor cells to an array of structurally and functionally unrelated compounds, often through repeated exposure to cytotoxic agents [3, 28]. An extensively characterized mechanism of MDR involves a 170 kDa ef-

flux transporter termed P-glycoprotein (P-gp) [13], which reduces the cellular accumulation of diverse cytotoxic drugs [8]. P-gp belongs to the superfamily of adenosine triphosphate (ATP)-binding cassette (ABC) transporters [9] and is encoded by the MDR1 gene [17, 27]. P-gp was discovered due to its role in mediating MDR in cancer, however, it is also expressed in many tissues throughout the body where its Pharmacological Reports, 2012, 64, 751–757

751

modulation affects the pharmacokinetics of substrate drugs including cannabinoids [23, 24]. Cannabis is the most widely used illicit drug in the world and it is being increasingly used for medicinal purposes. The widespread use of this drug raises the question of whether plant-derived cannabinoids affect MDR1 expression. This might have implications for MDR and also the pharmacokinetics of co-administered therapeutic drugs. We have shown that the most abundant cannabinoid constituents, D'-tetrahydrocannabinol (D'-THC) and cannabidiol (CBD), inhibit P-gp expression in the acute T lymphoblastoid leukemic line CEM/VLB which overexpresses P-gp due to MDR1 gene amplification [2, 12]. Here we examined the role of cannabinoid and transient receptor potential vanilloid type 1 (TRPV) receptors in the effects of cannabinoids on MDR1 mRNA expression.

Materials and Methods Cell lines

The CEM/VLB100 cell line over-expresses P-gp, as a result of MDR1 gene amplification, yielding an approximate 200- to 800-fold resistance to VLB [12]. The cell line was grown in complete medium consisting of RPMI-1640 supplemented with 10% (v/v) fetal calf serum (FCS), 50 IU/ml penicillin and 50 mg/ml streptomycin (all purchased from Invitrogen, Australia) in a humidified atmosphere of 5% CO2 at 37°C. Cells were grown in 75 cm2 culture flasks maintained at a density between 105 and 106 cells/ml, in exponential growth, and subcultured every 3–4 days. Viable cells were counted on a hemocytometer using trypan blue exclusion. Drugs and drug treatment

D9-THC and CBD were purchased from Sigma-Aldrich (Sydney, NSW) and Tocris Cookson Inc. (Sydney, NSW), respectively, and prepared as described previously [10–12]. The selective CB2 receptor antagonist SR 144528 (Sanofi-Aventis Pharmaceuticals, France) and the selective TRPV1 receptor antagonist SB 366791 (Sapphire Biosciences, Australia) were stored as stock solutions in ethanol and were diluted with complete medium prior to each experiment. The final ethanol concentration in the medium never exceeded

752

Pharmacological Reports, 2012, 64, 751–757

0.1%. Cells were treated in 25 cm2 culture flasks at a cell density of 107 cells/ml with 10 μM CBD and/or D9-THC or an equivalent volume of ethanol vehicle (VEH), in each case diluted in complete medium and incubated for 4, 8 or 48 h. In 4 h experiments where cannabinoid receptor antagonists were also included, they were added at the same time as the cannabinoids, to a final concentration of 5 μM. For each drug treatment and incubation time we repeated the experiment at least 3 times in separate culture flasks. RNA was extracted on each occasion and analyzed in triplicate by real time reverse transcriptase polymerase chain reaction (real time RT PCR). RNA extraction and reverse transcription

Total RNA was isolated using the TRIzol reagent (Invitrogen, Australia). RNA was treated with DNase I to remove any contaminating genomic DNA. The concentration of RNA was assessed using the Nanodrop ND-1000 (NanoDrop Technologies Inc., USA). RNA (2 μg) was reverse transcribed with moloney-murine leukemia virus reverse transcriptase (Promega, Australia), random hexamers and dNTPs. Real time reverse transcriptase polymerase chain reaction

The real-time reverse transcriptase polymerase chain reaction (RT PCR) was performed in multiplex using TaqMan Gene Expression Assay primer and probes and TaqMan Universal PCR Master Mix (Applied Biosystems, USA). Briefly, PCR was performed in triplicate in standard 96-well plates containing 1.25 μl of TaqMan MDR1 forward and reverse primers and MGB FAM-labelled probe, 1.25 μl of the TaqMan endogenous control 18s rRNA forward and reverse primers and MGB VIC-labelled probe, 12.5 μl of TaqMan universal PCR master mix, 1 μl of cDNA template and 9 μl of diethyl pyrocarbonate (DEPC)treated water to give a total reaction volume of 25 μl per well. The RT PCR products were amplified using the ABI Prism 7000 Sequence Detection System (Applied Biosystems, USA). Thermal cycling conditions were 50°C for 2 min, followed by 95°C for 10 min, 40 cycles of 95°C for 15 s, with a final annealing temperature of 60°C for 60 s. TaqMan primers and probes were designed to amplify a 67 bp region of the MDR1 mRNA sequence (NCBI Entrez nucleotide sequence ID: NM_000927.3), and a 187 bp amplicon from the

CB and TRPV mediate cannabinoid action on MDR1 expression Jonathon C. Arnold et al.

Tab. 1. National Centre for Biotechnology Information database accession number, primer sequences, annealing temperature (Tm), amplification cycle number (n) and amplicon sizes of CB1, CB2 and TRPV1 receptor mRNA

Accession (mRNA)

Forward primer (5’-3’)

Reverse primer (5’-3’)

Tm (°C)

n

Amplicon size (bp) cDNA

DNA

Cannabinoid receptor (CB1) NM_016083.3

aagaccctggtcctgatcct

cgcaggtccttactcctcag

52

35

188

188

57

35

243

243

56

35

177

177

55

30

234

329

Cannabinoid receptor (CB2) NM_001841

tagacacggacccctttttg

ttctcccaagtccctcattg

Transient Receptor Potential Vanilloid (subtype 1) (TRPV1) NM_080704

gcctggagctgttcaagttc

tctcctgtgcgatcttgttg b actin (ACTB)

NM_001101

ggacttcgagcaagagatgg

agcactgtgttggcgtacag

18s rRNA mRNA sequence (NCBI Entrez nucleotide sequence ID: X03205.1). A non-template control using DEPC-treated water instead of cDNA was used as a negative control in each plate analyzed.

RT-PCR analysis of receptor expression

All receptor PCR reactions were performed using 0.05 × the final volume of template in reactions consisting of 1 × HotStarTaq PCR buffer, 125 nM of each primer, 100 nM dNTPs and 0.1 U/μl of HotStarTaq DNA Polymerase. Thermal cycling conditions consisted of an initial activation step of 95°C for 15 min, followed by n cycles of 94°C for 45 s, annealing temperature (Tm) °C for 20 s and 72°C for 30 s, with a final cycle of 72°C for 5 min. Both the number of amplification cycles (n), and the Tm were determined for each primer set. Primers were designed based on sequences available from the National Centre for Biotechnology Information databases, using Primer 3 software [22]. Where alternatively spliced transcripts of the gene exist, primers were designed across a region that is common to all variants. Specific reaction conditions, primer sequences and amplicon sizes are described in Table 1. We utilized a negative RT control which showed no signal upon amplification highlighting that our product derived from cDNA rather than genomic DNA.

Rhodamine 123 accumulation assay of P-gp activity

Cells were plated at 2 × 105/ml and 1/10th volume of 11X cannabinoids added to wells to a final concentration of 10 μM, 48, 8 or 4 h prior to harvest. Untreated controls received 1/10th volume complete medium 4 h prior to harvest. At harvest, cells were pelleted, washed free of cannabinoids, and resuspended in complete medium. Rhodamine 123 accumulation was performed in triplicate. Aliquots of 0.5 ml (~4 × 105) cells were transferred to 5 ml serology tubes preloaded with 0.5 ml 1 μM Rhodamine 123 in complete medium. The racked tubes were placed in a humidified CO2 incubator at 37°C for 60 min, with quick mixing every 20 min, and then cooled in ice-water slurry. Cells were pelleted by centrifugation at 2°C, washed once with PBS containing 1% FCS and 1 mM EDTA, resuspended in 0.3 ml of the same, and kept on ice until analysis. Rhodamine 123 accumulation was assayed by flow cytometry, using 488 nm excitation and 530 nm fluorescence. Data analysis

The changes in gene expression levels were evaluated by relative quantification between cDNA templates from drug-treated cells and their respective vehicletreated controls at each time point. The expression of the housekeeping gene, 18s rRNA, was used as an en-

Pharmacological Reports, 2012, 64, 751–757

753

dogenous control, to normalize the data between samples. Data were analyzed according to the mathematical model for relative quantification modified in accordance with ‘delta-delta method’ used by Applied Biosystems [20]. Real-time RT PCR CT results were analyzed using Sequence detection software version 1.2.3 (Applied Biosystems, USA) where baseline and threshold parameters were kept constant between plates. The relative expression ratios between treated and vehicle control groups were statistically analyzed using the non-parametric Mann-Whitney U test as an equality of variance F-test showed that the variance between experimental groups were heterogenous. Rhodamine 123 accumulation was analyzed by oneway ANOVA with the difference between untreated cells and the 4, 8 and 48 h time-points tested explicitly by Tukey’s post-test (here, variances were homogeneous).

Results We determined whether changes in MDR1 mRNA levels occurred in the CEM/VLB100 cells in response to treatment with cannabinoids for 4, 8 or 48 h. At 4 h, both D9-THC and CBD (10 μM) significantly increased MDR1 mRNA expression, by approximately 2.5 and 2.0 fold, respectively, over VEH-treated cells (p < 0.05, Fig. 1A, B). The induction of the MDR1 transcript was short-lived as no significant effects were observed at 8 or 48 h for either cannabinoid. The functional consequences of MDR1 induction were tested by cellular Rhodamine 123 accumulation; the dye is a good P-gp substrate and its accumulation is inversely related to P-gp efflux activity. The increased MDR1 transcript levels in the cannabinoid-treated cells were accompanied by reduced Rhodamine 123

Fig. 1. Effects of cannabinoids on MDR1 mRNA levels and P-gp function. The mean (± SEM) MDR1 mRNA expression relative to vehicle-treated CEM/VLB100 cells following treatment for 4, 8 and 48 h with (A) 10 μM D'-THC and (B) 10 μM CBD. (C, D) Consequent changes in cellular Rhodamine 123 accumulation; relative to untreated controls. The levels of MDR1 mRNA were normalized to the 18s rRNA housekeeping gene. Statistical significance is denoted by * p < 0.05, ** p < 0.01 or *** p < 0.001 (n = 3–4 per group)

754

Pharmacological Reports, 2012, 64, 751–757

CB and TRPV mediate cannabinoid action on MDR1 expression Jonathon C. Arnold et al.

Fig. 2. The expression of CB1, CB2 and TRPV1 mRNA in MCF-7 (+ve) and CEM/VLB100 (VLB) cells as determined by RT-PCR. b-Actin (ACTB) was used as a control for cDNA quality. Water was used as a negative control (–ve). n = 2, single experiment shown

accumulation (Fig. 1C, D). The increased P-gp activity persisted longer than the elevated transcript level as reduced Rhodamine 123 accumulation was observed for all THC and CBD incubation times (that is 4, 8 and 48 h) compared to untreated controls. Such an effect is consistent with P-gp protein having a longer half-life than MDR1 transcript [1, 5, 21]. However, a maximal inhibitory effect on Rhodamine 123 accumulation was observed at 4 h which slowly dissipated as Rhodamine 123 levels were significantly higher at 48 h than the 4 h time-point for both THC and CBD (p < 0.001 and 0.05, respectively). The ability of D'-THC or CBD to modulate MDR1 mRNA levels raises the important question of whether such effects are mediated by receptors. We assessed the expression in CEM/VLB cells of some common targets of cannabinoid drugs, namely CB, CB and TRPV receptors, using RT-PCR [19]. Both CB and TRPV receptor mRNAs were found to be present in these cells, but not CB receptor mRNA (Fig. 2). We then attempted to block the induction of MDR1 by CBD or D'-THC with receptor antagonists. The CB receptor antagonist, SR 144528, effectively blocked D'-THC-induced upregulation of MDR1 mRNA (p < 0.05, Fig. 3) whereas the TRPV1 receptor antagonist

Fig. 3. Effect of cannabinoid receptor antagonists on cannabinoid induction of MDR1 mRNA. Graphs show the mean (± SEM) MDR1 mRNA expression, relative to vehicle-treated controls (VEH), of CEM/VLB cells treated with (A) 10 μM D'-THC and (B) 10 μM CBD, co-administered with either VEH or 5 μM of the CB receptor antagonist SR 144528 and/or the TRPV receptor antagonist SB 366791 for 4 h. The levels of MDR1 mRNA were normalized to the 18s rRNA housekeeping gene. Statistical significance was determined by comparing cannabinoid-antagonist relative to the cannabinoidVEH control group (* p < 0.05, n = 3–4 per condition)

SB 366791 had little, if any, effect. In contrast, the combination of these antagonists was required to reverse CBD-mediated induction of MDR1 mRNA (p < 0.05, Fig. 3). Neither SR 144528, SB 366791 or their combination significantly modulated MDR1 mRNA in the absence of cannabinoid exposure compared to VEH-treated CEM/VLB cells (83.33 ± 10.40, 184.30 ± 72.12, 79.67 ± 20.33; the mean ± SEM, respectively).

Discussion D9-THC and CBD were shown to modulate MDR1 gene expression by inducing the levels of transcript in CEM/VLB100 cells. In the present study, 10 μM D9-THC significantly increased the level of MDR1 mRNA at 4 h in CEM/VLB100 cells. The effect on MDR1 mRNA expression was only short-lived as it was not sustained at 8 or 48 h. The consequent increase in P-gp activity, reflected in reduced Rhodamine 123 accumulation, persisted longer, as expected from the half-life of the protein [1, 5, 21]. Further, we Pharmacological Reports, 2012, 64, 751–757

755

showed that CEM/VLB100 express CB2 and TRPV1 receptors but not CB1 receptors. The ability of the cannabinoids to modulate MDR1 mRNA was dependent on slightly different mechanisms, with the actions of D9-THC mediated by the CB2 receptor alone, whereas CBD’s effects required both CB2 and TRPV1 activation, as neither a CB2 or a TRPV1 antagonist alone were effective in reversing CBD-induced MDR1 mRNA upregulation. In the present study, 10 μM D'-THC and CBD transiently increased the level of MDR1 mRNA that correlated with increased functional P-gp activity as supported by reduced Rhodamine 123 accumulation in CEM/VLB cells at 4 h but not 8 or 48 h. We have previously demonstrated that CBD and D'-THC reduce the protein expression of P-gp in CEM/VLB cells after 72 h exposure, which correlated with increased Rhodamine 123 accumulation and enhanced sensitivity of the cells to the cytotoxic actions of the P-gp substrate, vinblastine [12]. Taken together with the present results this suggests that THC and CBD have opposing effects on P-gp expression and consequent transport capacity that is dependent on incubation duration – that is short-term cannabinoid exposure (4 h) transiently increases P-gp transport whereas longer-term exposure (72 h) decreases P-gp activity. The literature is replete with examples of cannabinoids having biphasic effects on various biological measures e.g., [6, 18, 25, 26]. The mechanism responsible for this biphasic action of cannabinoids on P-gp expression and activity requires further investigation. D'-THC binds to both CB and CB with similar affinities and behaves as a partial agonist at these receptors [7, 14, 16, 19, 29], however, it does not bind TRPV receptors [15]. Thus, given that only CB receptor mRNA was found expressed in CEM/VLB100 cells, it is not surprising that this receptor accounted for all of D'-THC’s ability to upregulate MDR1 mRNA. Interestingly, CBD exhibited a more complex profile, as only combination blockade of CB and TRPV significantly inhibited CBD-induced MDR1 mRNA expression, and neither CB nor TRPV antagonists were effective when tested alone. CBD, in its (–)-enantiomeric form utilized here, lacks affinity for CB and CB receptors, unlike its (+)-enantiomer which displays significant affinity for both receptor subtypes [4]. This raises the possibility that CBD’s effectiveness here is explained by CBD’s propensity to inhibit endogenous fatty acid amide hydrolase and elevate levels of the endocannabinoid anandamide.

756

Pharmacological Reports, 2012, 64, 751–757

This suggests that anandamide’s simultaneous activation of both CB and TRPV receptors [4] is necessary for increased MDR1 mRNA expression following CBD exposure. Here we provide the first evidence showing that TRPV and CB receptors may cooperate to affect MDR1 expression.

Acknowledgments: This work was supported by a National Health and Medical Research Council (NH&MRC) Project Grant and a NARSAD Young Investigator Award awarded to JCA.

References: 1. Aleman C, Annereau JP, Liang XJ, Cardarelli CO, Taylor B, Yin JJ, Aszalos A, Gottesman MM: P-glycoprotein, expressed in multidrug resistant cells, is not responsible for alterations in membrane fluidity or membrane potential. Cancer Res, 2003, 63, 3084–3091. 2. Beck WT, Mueller TJ, Tanzer LR: Altered surface membrane glycoproteins in Vinca alkaloid-resistant human leukemic lymphoblasts. Cancer Res, 1979, 39, 2070–2076. 3. Biedler JL, Riehm H: Cellular resistance to actinomycin D in Chinese hamster cells in vitro: cross-resistance, radioautographic, and cytogenetic studies. Cancer Res, 1970, 30, 1174–1184. 4. Bisogno T, Hanus L, De Petrocellis L, Tchilibon S, Ponde DE, Brandi I, Moriello AS, Davis JB et al.: Molecular targets for cannabidiol and its synthetic analogues: effect on vanilloid VR1 receptors and on the cellular uptake and enzymatic hydrolysis of anandamide. Br J Pharmacol, 2001, 134, 845–852. 5. Chin KV, Tanaka S, Darlington G, Pastan I, Gottesman MM: Heat shock and arsenite increase expression of the multidrug resistance (MDR1) gene in human renal carcinoma cells. J Biol Chem, 1990, 265, 221–226. 6. Fan SF, Yazulla S: Biphasic modulation of voltagedependent currents of retinal cones by cannabinoid CB1 receptor agonist WIN 55212-2. Vis Neurosci, 2003, 20, 177–188. 7. Felder CC, Joyce KE, Briley EM, Mansouri J, Mackie K, Blond O, Lai Y, Ma AL et al.: Comparison of the pharmacology and signal transduction of the human cannabinoid CB1 and CB2 receptors. Mol Pharmacol, 1995, 48, 443–450. 8. Fojo A, Akiyama S, Gottesman MM, Pastan I: Reduced drug accumulation in multiply drug-resistant human KB carcinoma cell lines. Cancer Res, 1985, 45, 3002–3007. 9. Gottesman MM, Fojo T, Bates SE: Multidrug resistance in cancer: role of ATP-dependent transporters. Nat Rev Cancer, 2002, 2, 48–58. 10. Holland ML, Allen JD, Arnold JC: Interaction of plant cannabinoids with the multidrug transporter ABCC1 (MRP1). Eur J Pharmacol, 2008, 591, 128–131.

CB and TRPV mediate cannabinoid action on MDR1 expression Jonathon C. Arnold et al.

11. Holland ML, Lau DT, Allen JD, Arnold JC: The multidrug transporter ABCG2 (BCRP) is inhibited by plant-derived cannabinoids. Br J Pharmacol, 2007, 152, 815–824. 12. Holland ML, Panetta JA, Hoskins JM, Bebawy M, Roufogalis BD, Allen JD, Arnold JC: The effects of cannabinoids on P-glycoprotein transport and expression in multidrug resistant cells. Biochem Pharmacol, 2006, 71, 1146–1154. 13. Juliano RL, Ling V: A surface glycoprotein modulating drug permeability in Chinese hamster ovary cell mutants. Biochim Biophys Acta, 1976, 455, 152–162. 14. Karl T, Cheng D, Garner B, Arnold JC: The therapeutic potential of the endocannabinoid system for Alzheimer’s disease. Expert Opin Ther Targets, 2012, 16, 407–420. 15. Lam PM, McDonald J, Lambert DG: Characterization and comparison of recombinant human and rat TRPV1 receptors: effects of exo- and endocannabinoids. Br J Anaesth, 2005, 94, 649–656. 16. Long LE, Chesworth R, Huang XF, McGregor IS, Arnold JC, Karl T: Transmembrane domain Nrg1 mutant mice show altered susceptibility to the neurobehavioural actions of repeated THC exposure in adolescence. Int J Neuropsychopharmacol, 2012, 1–13. 17. Milojkovic M, Stojnev S, Jovanovic I, Ljubisavljevic S, Stefanovic V, Sunder-Plassman R: Frequency of the C1236T, G2677T/A and C3435T MDR1 gene polymorphisms in the Serbian population. Pharmacol Rep, 2011, 63, 808–814. 18. Parker LA, Kwiatkowska M, Burton P, Mechoulam R: Effect of cannabinoids on lithium-induced vomiting in the Suncus murinus (house musk shrew). Psychopharmacology (Berl), 2004, 171, 156–161. 19. Pertwee RG: The diverse CB1 and CB2 receptor pharmacology of three plant cannabinoids: D9-tetrahydrocannabinol, cannabidiol and D9-tetrahydrocannabivarin. Br J Pharmacol, 2008, 153, 199–215. 20. Pfaffl MW: A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res, 2001, 29, e45. 21. Richert ND, Aldwin L, Nitecki D, Gottesman MM, Pastan I: Stability and covalent modification of

22. 23.

24.

25. 26.

27.

28.

29.

P-glycoprotein in multidrug-resistant KB cells. Biochemistry, 1988, 27, 7607–7613. Rozen S, Skaletsky H: Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol, 2000, 132, 365–386. Schinkel AH, Mayer U, Wagenaar E, Mol CA, van Deemter L, Smit JJ, van der Valk MA, Voordouw AC et al.: Normal viability and altered pharmacokinetics in mice lacking mdr1-type (drug-transporting) P-glycoproteins. Proc Natl Acad Sci USA, 1997, 94, 4028–4033. Spiro AS, Wong A, Boucher AA, Arnold JC: Enhanced brain disposition and effects of D9-tetrahydrocannabinol in p-glycoprotein and breast cancer resistance protein knockout mice. PLoS One, 2012, 7, e35937. Sulcova E, Mechoulam R, Fride E: Biphasic effects of anandamide. Pharmacol Biochem Behav, 1998, 59, 347–352. Tzavara ET, Wade M, Nomikos GG: Biphasic effects of cannabinoids on acetylcholine release in the hippocampus: site and mechanism of action. J Neurosci, 2003, 23, 9374–9384. Ueda K, Cornwell MM, Gottesman MM, Pastan I, Roninson IB, Ling V, Riordan JR: The mdr1 gene, responsible for multidrug-resistance, codes for P-glycoprotein. Biochem Biophys Res Commun, 1986, 141, 956–962. Wang Z, Ravula R, Cao M, Chow M, Huang Y: Transporter-mediated multidrug resistance and its modulation by Chinese medicines and other herbal products. Curr Drug Discov Technol, 2010, 7, 54–66. Wong A, Gunasekaran N, Hancock DP, Denyer GS, Meng L, Radford JL, McGregor IS, Arnold JC: The major plant-derived cannabinoid D9-tetrahydrocannabinol promotes hypertrophy and macrophage infiltration in adipose tissue. Horm Metab Res, 2012, 44, 105–113.

Received: April 18, 2011; in the revised form: January 17, 2012; accepted: February 2, 2012.

Pharmacological Reports, 2012, 64, 751–757

757