CD8 Dimer Usage on αβ and γδ T Lymphocytes from Equine Lymphoid Tissues

Immunobiol., vol. 19S, pp. 424-43S (1997/9S)

IDepartment of Veterinary Microbiology and Pathology, Washington State University, Pullman, Washington, and 2Department of Microbiology, Pathology and Parasitology, North Carolina State University, Raleigh, North Carolina, USA

CDS Dimer Usage on a~ and y'6 TLymphocytes from Equine Lymphoid Tissues JOLYNNE R. TSCHETIER'\ WILLIAM TRAVIS C. MCGUIRE'

c. DAVIS', LANCE E. PERRYMAN2 and

Received: April 9, 1997 . Accepted in revised form: September 19, 1997

Abstract Eight murine monoclonal antibodies (mAb) were used to identify the equine CDSa or CDSp chains and to define the expression of these chains on lymphocytes from various lymphoid tissues. CDSa was a 39 kDa protein and CDSp was a 32 kDa protein. Both chains were expressed on most of the CDS+ T lymphocytes in the peripheral blood, spleen, thymus, mesenteric lymph nodes and ileal intraepitheliallymphocytes (IEL), however, in each lymphoid compartment a percentage of lymphocytes expressed only the CDSa chain. The largest percentage of CDSaa expressing T lymphocytes was 37.7% of the IELs. Purified T lymphocytes from the ileum expressing CDSap co-expressed the ap T cell receptor (TCR). In contrast, purified CDS+ T lymphocytes from the PBMC co-expressed either the ap or y8 TCR by RT-PCR. Use of pooled anti-CDSa mAb of the murine IgG2a isotype and rabbit complement resulted in lysis of the entire CDS expressing population in peripheral blood mononuclear cells (PBMC). These results indicated that CDS dimer usage by equine T lymphocytes is similar to other species and that the mAb described can be further used to separate equine CDS+ T lymphocyte subsets from the lymphoid tissues to define their function in protection against viral and other infections.

~. Current address: Experimental Immunology Branch, National Cancer Institute, National Institutes of Health, Building 10, Room 4B17, Bethesda, MD 20S92, USA

Abbreviations: mAb = monoclonal antibodies; IELs = intraepitheliallymphocytes; TCR = T cell receptor; PBMC = peripheral blood mononuclear cells; HRPO = horseradish peroxidase; FITC = fluorescein; R-PE = phycoerythrin; TEN = 50 mM Tris; 5 mM (ethylenedinitrilo)tetracetic acid; 0.5% Nonidet P-40; HBSS = Hanks' Balanced Salt Solution; EIAV = equine infectious anemia virus; SDS-PAGE = sodium dodecyl sulphate-polyacrylamide gel electrophoresis; DMEM = Dulbecco's Modified Eagle Medium; RT-PCR = reverse transcriptasepolymerase chain reaction. 01998 by Gustav Fischer Verlag

CD8 dimer usage on equine a~ and

yo T lymphocytes

. 425

Introduction CD8 is expressed as either a CD8aa homodimer or a CD8a~ heterodimer on the surface of a T lymphocyte subset. Recent research indicates that CD8 has a multifaceted role during immunologic development and immune surveillance. CD8a has a multifaceted role during immunologic development and immune surveillance. CD8a is responsible for signal transduction following binding of CD8 to the MHC class I molecule on an antigen presenting cell through the CD8a chain interactions with p56 lck (1, 2). Further, following activation of CD8+ T lymphocytes by lectins or antibodies to the TCR, p56 lck is modified by the addition of phosphate groups (3). Experiments addressing the role of CD8~ indicate that CD8~ expression is involved in immune selection and maturation of CD8+ T lymphocytes in the thymus and is a regulatory protein in the mature lymphocyte. Disruption of CD8~ expression in murine embryonic stem cells results in normal maturation of T lymphocytes through the CD4+CD8+ stage in the thymus, but they do not efficiently mature past this point resulting in few CD4-CD8+ T lymphocytes in the peripheral blood (4). Further, analysis of CD8~ in mature T lymphocytes determined that binding of CD8~ to MHC class I molecules results in alterations of the sialyic acid residues of this glycoprotein (5). The resulting alteration in the charge of CD8~ causes a conformational change in CD8a altering its interaction with p56 lck (6) indicating a regulatory role of CD8~ in T lymphocyte responses. Therefore, CD8 molecules are important in T lymphocyte maturation and in regulation of the T lymphocyte responses to foreign antigens. CD8 has been described in the horse as a 68 kDa dimer composed of a 32 kDa and 39 kDa subunits by immunoprecipitation of 1251 labeled peripheral blood mononuclear cells (PBMC) run under non-reducing or reducing conditions (7, 8). The mAb that immunoprecipitate the 68 kDa dimer protein identify 4-7% of equine PBMC by flow cytometry (7, 8) and are associated with expression of CD8a as determined by Northern blot analysis of RNA from cells positively selected using these mAb and probed with mouse cDNA for CD8a (9). To further define the equine T lymphocyte responses to viral and other infections it is necessary to define the CD8+ T lymphocyte phenotypes in the horse, to determine if both CD8aa and CD8a~ are expressed and to begin to ascribe functions to the CD8aa homodimer and CD8a~ heterodimer. In this paper, mAb to equine CD8a and CD8~ chains were used to determine the expression of CD8aa and CD8a~ dimers in lymphoid tissues and to relate this to expression of a~ and "{8 TCR.

Materials and Methods mAb production

mAb were produced from splenocytes (10, 11) from a BALB/c mouse immunized with affinity purified equine CD8. Hybridomas were cloned by limiting dilution and all antibodies used in these experiments were produced in ascitic fluid. Isotype was determined using a commercial

426 .

J. R. TSCHETTER et al.

ELISA isotyping kit (Hyclone Laboratories, Inc., Logan, UT, USA) and immunoglobulin concentration was determined using isotype-specific single radial immunodiffusion plates (The Binding Site, San Diego, CA, USA). Conjugation of mAb to horse radish peroxidase (HRPO), fluorescein (FITe) and phycoerythrin (R-PE)

mAb were purified from ascitic fluid by precipitation using 50% saturated ammonium sulfate followed by column chromatography over DE52 (Whatman, Hillsboro, OR, USA). mAb were conjugated to HRPO using a modification of a described method (12). Conjugation of mAb to FITC was done as described (13) and mAb were conjugated to R-PE by Caltag Laboratories (Burlingame, CA, USA). Purification of equine CD8

CD8 was purified from thymocytes using an affinity matrix made with a previously defined anti-equine CD8 mAb, HT14A (8), conjugated to cyanogen bromide-activated Sepharose 4B beads. Equine thymus was harvested, minced and the cells lysed using 50 mM Tris (pH 8.0) with 5 mM (ethylendinitrilo)tetracetic acid and 0.5% Nonidet P-40 (TEN buffer) plus 5 mM iodoacetamide. Celllysates were run on a column containing the affinity matrix and purified CD8 was eluted with TEN buffer plus 1% deoxycholate and 2 M potassium thiocyanate. Fractions were concentrated using a pressure cell and PM-30 membranes (Amicon Corp., Danvers, MA, USA). Immunoblot analysis of equine CD8

Affinity purified CD8 was run under reducing conditions on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), transferred to nitrocellulose and immunoblotted with mAb. Fifteen percent polyacrylamide gels were run to detect the individual CD8 chains. mAb were directly conjugated to HRPO and included 68/14.4, an IgG2a mAb recognizing an epitope on the 32 kDa protein, ANAF16C1, and IgG2a mAb to an irrelevant protein, ETC91A, and IgG3 mAb recognizing an epitope on the 39 kDa protein and ANA22B1, an IgG3 mAb to an irrelevant protein. Bound mAb were detected using chemiluminescence (Dupont NEN Research Products, Boston, MA, USA). Isolation of lymphocyte populations

Horses used in this study were Arabian mares or mixed breed Ponies between the ages of 2 and 24. All horses were maintained according to institutional animal care and committee guidelines at Washington State University. Lymphocytes were isolated from the peripheral blood, spleen, thymus, mesenteric lymph node and intraepithelial compartment of the ileum of 3 horses following euthanasia. The horses euthanized in this study were Arabian mares, two under 2 years of age (A2112 and A2116) and one over the age of 20 (A120). PBMC were isolated according to standard procedures (14). Lymphocytes from the spleen, thymus and mesenteric lymph node were isolated by teasing the cells through a mesh screen followed by differential density centrifugation using Histopaque 1077 (Sigma Chemical Corporation, St. Louis, MO, USA). IELs were isolated according to published protocols (15). Briefly, an 8 inch section of intact ileum was flushed with cold phosphate buffered saline to remove debris, one end was tied shut and the ileum inverted leaving the villi on the exterior of the segment. The intestinal segment was filled with cold phosphate buffered saline and the remaining end tied closed. The inverted intestinal segment was then placed in a beaker filled with Hanks' balanced salt solution (HBSS) containing 5 mM dithiothreitol and incubated at 37°C for 12 minutes. The HBSS containing sloughed cells was removed from the beaker and fresh HBSS with dithiothreitol added a total of three times. Sloughed cells in HBSS were kept on ice until they could be pooled and lymphocyte populations isolated. IELs were separated from contaminating epithelial cells using a discontinuous

CD8 dimer usage on equine a~ and y8 T lymphocytes . 427 Percoll gradient of 43 and 67% (Sigma Chemical Company, St. Louis, MO, USA). Lymphocytes were collected from the interface between the 43 and 67% Percoil layers and washed four times. Flow cytometric analysis of lymphocytes Once the lymphocytes were isolated from the different lymphoid compartments they were stained for analysis by flow cytometry. Cells were examined using mAb to detect expression of CD2 (16), CDS (8), CD4 (8), CD4 subset (17), CD8a and CD8~ using described staining procedures (11). For single color staining, primary mAb were detected using affinity purified goat antibodies to mouse IgG that were conjugated to FITC. For two color procedures unlabeled mAb to CD2, CDS and CD8~ were incubated with lymphocytes followed by incubation with FITC-labeled goat antibodies to mouse IgG. Following labeling of cells with the first set of antibodies, the lymphocytes were incubated in the presence of an anti-CD8a mAb, ETC91A, directly conjugated to R-PE. These protocols were scaled up for flow cytometric cell sorting by staining lymphocytes in 50 ml conical centrifuge tubes. FITC-labeled 68/14.4 (anti-CD8~) and R-PE-labeled ETC91A (anti-CD8a) were added to a final concentration of 16 pg/ml to tubes containing lymphocytes at lxl0 7 cells/m!. All flow cytometry was done on either a FACSort or FACScan equipped with a Macintosh Quadra computer and CellQuest software (Becton-Dickinson, San Jose, CA, USA). Reverse transcriptase-polymerase chain reaction to define TCR expression in purified total CD8+ and CD8a~ populations CD8+ and CD8a~+ lymphocytes were purified by cell sorting and adhered to a Nucleopore polycarbonate membrane (Costar, Cambridge, MA), RNA isolation was accomplished using TRIZol Reagent (Gibco/BRL, Grand Island, NY, USA). First strand synthesis was done using the Superscript Preamplification System (Gibco/BRL) with oligo(dT)s. Cells expressing the a~ TCR were detected using primers (Integrated DNA Technologies, Inc., Coralville, lA, USA) specific for the constant region of the a chain (ACTTCCATCTGCCTATTCACC and AAACTTCTCACAACATTCTCC) as determined by Oligo 4.1, a computer program designed to pick primer pairs, and the published sequence of the equine TCR a chain (18). For cells expressing the y'6 TCR a second set of primers was developed (CAAAGAAGGTCAAAGAGAAGT and GTCAAAGGAACAAAACATAAC) recognizing a portion of the equine TCR'6 chain constant region (18). These primers were used to assess the TCR expression of separated CD8+ and CD8a~+ T lymphocytes in multiplexed reactions using both TCRa and TCR'6 primers in one PCR reaction. RT-PCR reactions of the TCRa or TCR'6 chain constant regions resulted in one band being detected in agarose gels by ethidium bromide staining. Sequencing of PCR products was done using ABI Prism DNA sequencing kits (Applied Biosystems Division, Foster City, CA, USA) and an ABI373A DNA Sequencer. Blocking of cytotoxic T lymphocyte (CTl) function by mAb PBMC were isolated from equine infectious anemia virus (£lAV) infected horses according to standard procedures (14). The isolated PBMC were divided into effector cell and feeder cell populations. Feeder cells were irradiated with 3 krads from a 50Cobalt source (Nuclear Radiation Center, Washington State University, Pullman, WA, USA). Monocytes were isolated from the irradiated PBMC on gelatin/plasma coated flasks (19, 20), infected with EIAV at a multiplicity of infection of 1 for 1 hour at 37°C. Monocytes were then transferred into 96-well U-bottomed plates containing 20,000 effector PBMC per well. Cells were cultured in humidity chambers with Dulbecco's Modified Eagle Medium (DMEM) containing 15% bovine calf serum and 15% fetal bovine serum at 37°C for 7 days. After 7 days in culture, half of the medium was removed and replaced with similar medium supplemented with 40 U/ml recombinant human IL-2 (Gibco/BRL). Effector cells were used in cytotoxic T lymphocyte assays at 23 days post stimu-

428 .

J. R. TSCHETTER et aL

lation. mAbs were incubated with the effector cells for 1 hour at 37°C prior to the addition of target cells. All mAbs were used at a final concentration of 5 }Jg/well. Target cells were autologous and MHC-mismatched equine kidney cells obtained from biopsied tissues and infected with EIAV (21). The percent-specific lysis and standard error was determined as previously published (21).

Complement Lysis of CD8+ T lymphocyte subsets PBMC from horses were isolated and suspended in DMEM (Gibco/BRL, Grand Island, NY; USA) plus 5% bovine calf serum at lxl0 7 cells/mL Cells were incubated on ice for 30 minutes in the presence of 15 j.1g/ml of 68/14.4 (anti-CD8P) or 15 j.1g/ml of each ETC154A (anti-CD8a) and ETC142BIA (anti-CD8a). Freshly hydrated rabbit complement (Cedar Lane Laboratories, Ontario, Canada) was added at a final dilution of 1:2. Additionally, cells were incubated with mAb 68/14.4 (anti-CD8P) at 0.15, 1.5 and 150 }Jg/ml prior to the addition of freshly hydrated rabbit complement (Cedar Lane Laboratories, Ontario, Canada). Cells were incubated in the presence of complement for 30 minutes at 37°C, pelleted, suspended in DMEM plus 5% bovine calf serum and fresh complement added for an additional 30 minute incubation at 37°C. Following complement lysis, cells were pelleted and the cell populations analyzed by single color flow cytometry.

Results Identification of mAb that bind COB subunits

Results from immunoprecipitation experiments indicate that equine CD8 is composed of 32 and 39 kDa subunits that are covalently linked to form a 68 kDa surface glycoprotein (8). From this evidence it was assumed that equine CD8 is composed of an a and ~ chain as reported for other species (22-24). To identify the CD8a and CD8~ chains, mAb were made by immunizing mice with affinity purified CD8. Eight mAb were developed that recognized either the 32 or the 39 kDa protein in immunoblots of affinity purified CD8 as antigen after SDS-PAGE separation using reducing conditions (Table I). The immunoblot reactivity of two representative mAb and their isotype controls

Table I. Specificity of anti-equine CD8 monoclonal antibodies. Monoclonal Antibody

Isotype

Protein Recognizied by Monoclonal Antibody

HT14N 68/14.4 68/14.7 ETC91A

IgGl IgG2a IgG2a IgG3 IgG2b IgG2b IgG2a IgG2a IgG3

32 kDa 32 kDa 32 kDa 39kDa 39kDa 39kDa 39kDa 39kDa 39kDa

ETC98A

ECTl08A ETC142BIA ETC154A 73/6.9.1 I

This mAb was described in KYDD et aL, 1994.

CD8P CD8P CD8P CD8a CD8a CD8a CD8a CD8a CD8a

CD8 dimer usage on equine a~ and

yo T lymphocytes

. 429

are depicted in Figure 1. mAb 68/14.4 recognized a 32 kDa protein from affinity purified CD8 while mAb ETC91A recognized a 39 kDa protein from the same antigen preparation. The faint band below the CD8a (39 kDa) may be a proteolytic digestion product of CD8a since the antigen used for the immunoblots was affinity purified from thymocyte lysates with a mAb to CD8p. The two faint bands between 44.1 and 87 kDa appear to be CD8ap heterodimers using both the forms of CD8a. The isotype controls, mAb ANAF16C1 and ANA22B1, did not bind any proteins in this antigen preparation.

1

2

3

4

87.0> 44.1>

32.7>

17.7>

7.1>

Figure 1. Immunoblot of affinity purified CD8 using anti-CD8 mAb. Immunoaffinity purified CD8 was separated by SDS-PAGE under reducing conditions on a 15% polyacrylamide gel and transferred to nitrocellulose. Lanes 1 and 3 were reacted with mAb ETC91A (IgG3) and mAb 68/14.4 (IgG2a), respectively. Lanes 2 and 4 were reacted with isotype control mAb ANA22B1 (IgG3) and ANAF16C1 (IgG2a), respectively. All mAb were directly conjugated to HRPO. Migration of the protein standards are indicated along the left edge of the panel in kilodaltons.

430 . J. R. TSCHETIER et al. Identification of CD8aa and CD8a~ T lymphocyte populatiom by flow cytometry

To evaluate CD8 expression in horses, two color flow cytometric analysis of PBMC was done. When mAb HT14A was compared with mAb 68/14.4, they recognized the same 8.5% of equine lymphocytes (Fig. 2A). Comparing mAb HT14A with ETC91A resulted in 2 populations of lymphocytes being identified. One population of lymphocytes, 6.8% of the total number of lymphocytes, was identified that co-expressed the 32 kDa CD8 chain identified by mAb HT14A and the 39 kDa CD8 chain identified by mAb ETCnA (Fig. 2B). A se,;ond population of 3.2% of the total lymphocytes was ~dentified with mAb ETC91A that expressed only the 39 kDa protein. This indicated that mt\b ETC91A recognized an epitope on the CD8a chain as CD8~ can not he expressed on the surface of lymphocytes in the absence of CD8a expression (25, 26). With the identification of mAb recognizing the different subunits of equine CD8, it was now possible to examine the tissue distribution of CD8aa and CD8a~ T lymphocytes in the ~ orse. A

'0

0.3%

B

8.5%

o~--..,...-------. 3.2% 6.8%

'0

-0

~

'
-00

'C

'0

1.0%

'0

10'

10'

10'

HT14A

10'

0.6%

10'

10'

10'

10'

10'

10'

HT14A

Figure 2. Reactivity of mAb 68/14.4 and ETC91A compared to a defined anti-CD8 mAb, HT14A, in two color flow cytometry. Lymphocytes were incubated first in the presence of mAb HT14A and a secondary antibody to mouse IgG conjugated to FITC and this was followed by incubation with either mAb 68/14.4 (A) or mAb ETC91A (B) directly conjugated to R-PE.

Tissue distribution of the CD8aa homodimer and the CD8a~ heterodimer

Lymphocytes were isolated from the PBMC, spleen, thymus, mesenteric lymph nodes and intraepithelial compartment of the ileum of three horses. Once isolated, the lymphocytes were stained with mAb recognizing CD2 (16), CDS (8), CD4 (8), a CD4 subset (17) and CD8 (8) to determine what T lymphocyte populations were present in each tissue (Table II). The percentage of CD2+ T lymphocytes in the horse varied between lymphoid compartments with a mean of 52.7% CD2+ T lymphocytes in the PBMC, 53.5% in the spleen, 79.7% in the

CD8 dimer usage on equine

up and yo T lymphocytes' 431

Table II. Lymphocyte subpopulations in lymphoid compartments.

CDS CD2 CD4 CD4 Subset CD8

PBMC

THYMUS

SPLEEN

56.2 ± 31.1' 52.7 ± 33.6 44.8 ± 31.4 6.8 ± 4.3 8.7 ± 1.3

72.0 ± 24.0 79.7 ± 7.7 67.6 ± 11.9 6.4 ± 0.4 54.9 ± 9.8

49.6 53.5 22.9 4.5 28.5

± 19.8 ± 22.1 ± 8.4 ± 1.7 ± 6.7

LN 47.4 35.5 28.7 4.5 12.5

± 8.2 ± 5.6 ± 4.3 ± 0.9 ± 4.0

lEL 94.4 85.5 44.4 13.5 50.8

± 2.8 ± 2.5

± 10.7 ± 3.3 ± 6.4

a Mean percent of total lymphocytes ± the standard deviation as determined in 3 horses by single-color flow cytometry.

thymus, 35.5% in the mesenteric lymph nodes and 85.5% in the IELs. The CD8+ T lymphocytes also varied between lymphoid compartments with a mean of 8.7% of the total lymphocyte population in the PBMC, 28.5% in the spleen, 54.9% in the thymus, 12.5% in the mesenteric lymph node and 50.8% in the IELs. To further analyze the CD8+ T lymphocyte populations in these lymphoid organs, two color flow cytometry experiments were done using mAb 68/14.4 (anti-CD8~) detected with a FITC-Iabeled secondary antibody and mAb ETC91A (anti-CD8a) directly conjugated to R-PE. Table III presents the analysis of the CD8 population in each lymphoid compartment by percentage of CD8aa+ and CD8aW T lymphocytes. The CD8+ T lymphocyte population in the PBMC was primarily CD8aW lymphocytes. This was demonstrated in the flow cytometry data in Figure 2b and tabulated in Table III with a mean of 76.1 % of the CD8+ lymphocytes being CD8a~+ and a mean of 23.9% of the CD8+ lymphocytes being CD8aa+ lymphocytes. The predominant CD8 dimer expressed in other equine lymphoid tissues was also the CD8aB heterodimer as this population of cells accounted for a mean 81.2% of the CD8+ lymphocytes in the spleen, 93.9% in the thymus, 85.8% in the mesenteric lymph node, and 62.9% in the lEL. TCR expression by T lymphocytes expressing either the CD8 or CD8a~ heterodimer

As CD8+ and CD8a~ expression are associated with different functions in the human (27), they may have different functions in the horse. The expression of CD8a~ on lymphocytes is associated with expression of the a~ TCR while expression of CD8aa is associated with both the a~ and y8 TCR in humans (27). A fluorescence-activated cell sorter was used to purify equine CD8+ lymphocyte populations stained with R-PE conjugated mAb ETC91A (antiCD8a) or CD8aW lymphocytes stained with FITC conjugated mAb 68/14.4 (anti-CD8~) and R-PE conjugated mAb ETC91A (anti-CD8a). PCR primers were chosen that recognized specific sequences within the constant regions of the a and 8 chains of the equine TCRs (18). The individual PCR products were sequenced and these sequences were compared to Genbank using

432 .

J. R. TSCHETIER et al.

Table III. Distribution of CD8aa and CD8a~ heterodimers in lymphoid tissues. CD8+lymphocytes

% CD8+ lymphocytes expressing CD8aab

% CD8+ lymphocytes expressing CD8aW

PBMC A120 A2112 A2116 Mean St. Dey.

10.1 8.4 7.5 8.7 1.3

30.1 18.6 23.1 23.9 5.8

69.9 81.4 76.9 76.1 5.8

Spleen A120 A2112 A2116 Mean St. Dev.

21.7 28.7 35.1 28.5 6.7

12.8 18.8 24.9 18.8 6.1

87.2 81.2 75.1 81.2 6.1

Thymus A120 d A2112 A2116 Mean St. Dey.

ND 73.5 48.2 60.9 ND

ND 7.2 5.0 6.1 ND

ND 92.8 95.0 93.9 ND

Mesenteric Lymph Node 13.2 A120 A2112 16.2 8.2 A2116 Mean 12.5 St. Dey. 4.0

24.1 11.1 7.4 14.2 8.8

75.9 89.0 92.6 85.8 8.8

Intraepithelial Lymphocytes 46.1 A120 A2112 48.0 58.1 A2116 50.8 Mean St. Dey. 6.4

29.8 41.5 40.0 37.1 6.4

70.2 58.5 60.0 62.9 6.4

a b

C

d

Percent of lymphocytes staining with mAb ETC91A to CD8a. Percent of lymphocytes staining only with mAb ETC91A but not mAb 68/14.4 to CD8~ in two color flow cytometry experiments. Percent of lymphocytes staining with both mAb ETC91A and mAb 68/14.4 in two color clow cytometry experiments. Horse A120 was >20 years old at the time of euthanasia and no thymus was found.

BLASTN accessed from the Baylor College of Medicine Search Launcher (hppt:// dot.imgen.bcm.tmc.edu:9331/seq-search/nucleic_acid-search.html). The TCRa primers used in these experiments resulted in the amplification of a PCR product that had homology only with TCRa constant regions of several species including the horse. Comparison of the PCR product with the one available

CD8 dimer usage on equine ap and yo T lymphocytes . 433

equine TCRa constant region sequence resulted in 87% homology (18) which may be due to polymorphisms within the TCRa gene. The TCR3 primers used in these experiments resulted in the amplification of a PCR product had 95% homology with equine TCR3 (18). To determine the TCR expression in the purified lymphocyte populations, total RNA was isolated from each population and cDNA synthesized using oligo(dT) primers. When total CD8+ lymphocytes were isolated from the peripheral blood (>94% purity) and tested for expression of the a and 3 chains of the TCR, both genes were found indicating that both a~ TCR+and ,¥3 TCR+T lymphocytes expressing CD8 are present in the peripheral blood of horses in multiplexed PCR reactions using both TCRa and TCR3 primers in the same reaction. CD8a~+ T lymphocytes from the IELs were isolated (>93% purity) and only the a~ TCR was detected using RT-PCR on 75,000 lymphocytes (Fig. 3) in ethidium bromide stained agarose gels.

2

TCR{l TCRb

3

4

5

6

7

8

9

~

~

Figure. 3. yo and ap TCR expression on CD8+ and CD8ap lymphocytes as determined by RTPCR in multiplexed reactions using primers to both the a and 0 chains of the TCR in one reaction. RT-PCR products to determine expression of the a and y chains of the TCR from IELs (lane 1), purified CD8ap+ from IELs (lane 2), PBMCs (lane 3) and purified CD8+ lymphocytes from PBMCs (lane 4) were run on 1.2% agarose gels. Controls containing no reverse transcriptase are in lanes 5-8 and lane 9 is a water control containing neither cDNA nor RNA. The RTPCR products are identified in the left margin of the figure.

Direct blocking of cytotoxic T lymphocytes by anti-CD8 mAb

Several studies have been published using mAb to CD8 to directly block cytotoxic T lymphocyte activity (24, 27-29). Cytotoxic T lymphocyte assays were done to determine if any of the available mAb to equine CD8 could block cytotoxic T lymphocyte activity against cells infected with EIAV. In these CTL assays the percent-specific lysis of autologous EIAV infected EK cells was 42.7% with a standard error of 1.8%. The negative controls of uninfected autologous EK cells (2.5% specific lysis ± 0.4), uninfected MHC-mismatched EK cells (1.5% specific lysis ± 0.9) and EIAV infected MHC-mismatched EK cells (-0.1 % specific lysis ± 1.1) demonstrated the cytotoxicity as virus-specific and MHC-restricted. None of the 8 mAb tested blocked CTL activity against EIAV infected target cells nor did they block CTL activity when all 8 of the mAb were pooled.

434 .

J. R. TSCHETIER et al.

Complement lysis of CD8 T lymphocyte subsets

The ability to selectively deplete either the CD8aa or CD8a~ T lymphocyte populations in the horse would allow the identification of functions associated with these T lymphocyte populations. To deplete DC8a~ expressing cells mAb 68/14.4 was used, an IgG2a mAb recognizing the CD8~ chain. After 2 consecutive incubation periods of the PBMC with rabbit complement, a mean of 4.7 lymphocytes remained that stained with mAb 68/14.4. Altering the concentration of mAb 68/14.4 in 10-fold increments from 0.15 to 150 pg/ml did not alter the amount of lysis seen. The reason for the remaining CD8~ expressing population was not clear although the ability of this mAb to mediate complement lysis of CD8~ expressing PBMC varied between horses (range 1.4-7.7%). Complement lysis experiments were done to determine if two IgG2a mAb, ETC142B1A and ETC154A, both binding to the CD8a chain could selectively deplete CD8+ T lymphocytes. Following the complement lysis of PBMCs with these two mAb, <1 % of the remaining cells expressed CD8 (Table IV) indicating that it was possible to deplete the entire CD8 population of cells from the peripheral blood. Table IV. Complement Lysis of CD8+ Lymphocytes. Single-color flow cytometry

Untreated PBMC PBMC + mAb to CD8a+complement PBMC + mAb to CD8~+ complement

ETC91A mAbto CD8a

68/14.4

15.9 (15.0-16.4)' 0.4 (0.2-0.7)< 4.9 (1.5-8.3),

11.4 (7.4-16.2)b 0.4 (0.4-0.4)d 4.7 (1.4-7.7)d

mAbtoCD8~

• Percent of PBMC that are recognized by mAb ETC91A followed by the range in parenthesis. b Percent of PBMC that are recognized by mAb 68/14.4 followed by the range in parenthesis. < Percent of remaining PBMC after complement lysis that are recognized by mAb ETC91A followed by the range in parenthesis. d Percent of remaining PBMC after complement lysis that are recognized by mAb68/14.4 followed by the range in parenthesis.

Discussion Previous research identified the equine CD8 molecule as a 68 kDa protein composed of disulfide bonded 32 and 39 kDa proteins when examined by immunoprecipitation of radiolabeled PBMC (7, 8). Eight mAb to equine CD8 were developed and used in this study, 6 recognizing a 39 kDa chain and two recognizing a 32 kDa chain when evaluated by immunoblotting. The availability of mAb to CD8a in IgG1 and IgG2a and mAb to CD8~ in IgG2a, IgG2b and IgG3 are useful in two-color flow cytometry experiments using subclass-specific

CDS dimer usage on equine a~ and

yo T lymphocytes

. 435

secondary reagents. Two-color flow cytometry pairing a known anti-DC8 mAb, HT14A, with mAb 68/14.4 identified a cell population in the PBMC, spleen, thymus, mesenteric lymph node and IELs that was labeled with both mAb. Pairing mAb HT14A with mAb ETC91A in two color flow cytometry identifiec two lymphocyte populations. The largest population of CD8+ T lymphocytes expressed both the 32 kDa chain recognized by mAb HT14A and the 39 kDa chain recognized by mAb ETC91A. The second population of lymphocytes expressed only the 39 kDa protein recognized by mAb ETC91A and represented the CD8aa homodimer expressing lymphocytes in the horse. They were a relatively small percentage of lymphocytes being 1 to 3.4% of the totallymphocyte population in PBMC and 18.6 to 30.1 % of the CD8+ lymphocyte population in PBMC. In all lymphoid organs tested including, peripheral blood, spleen, thymus, mesenteric lymph node and IELs, the cells expressing the CD8a~ represented a higher percentage than the CD8aa homodimer expressing cells. The highest percentage of CD8+ T lymphocytes expressing the CD8aa homodimer were in the IEL (mean 37.7%), standard deviation 6.9% ). Expression of CD8aa and CD8a~ on the surface of lymphocytes is associated with differences in the cytolytic activity of lymphocytes (24, 27): NonMHC-restricted cytotoxicity in humans is associated with NK cells and T lymphocytes expressing the yo TCR (24, 27). These cells preferentially express the CD8aa homodimer while the MHC class I-restricted a~ TCR cytotoxic T lymphocytes express the CD8a~ heterodimer (24, 27). Identification of similar lymphocyte subsets in the horse and the reagents to study these lymphocyte subsets will enhance the comparative investigation of lymphocyte function and advance the study of immune responses to infections in the horse. As described in other species (30), equine CD8a~ T lymphocytes purified from IELs, exclusively expressed the a~ TCR while CD8+ T lymphocytes from the peripheral blood expressed either the a~ or yo TCR as detected by ethidium bromide stained agarose gels. CTL responses have been demonstrated in the horse following viral infections (21,31), but little is known about the populations involved other than that they express a CD8 molecule. The identification of monoclonal antibodies that recognize the CD8 a and ~ chains offer an opportunity to begin dissecting these immune responses by removing or blocking all CD8 lymphocytes using an antiCD8a mAb or selectively removing or blocking cells expressing the CD8~ chain using an anti-CD8~ mAb. Functions of each cell population can be determined by combining these approaches and looking for changes in effector function as cell populations are removed. All anti-CD8 mAb described in this paper were tested for their ability to block MHC class I-restricted CTL activity to EIAV infected target cells individually or combined. None of these mAb directly blocked this CTL activity. The ability of the mAb to mediate complement lysis of CD8a~ expressing lymphocytes was done using mAb 68/14.4 (anti-CD8~). Complete lysis of CD8aW lymphocytes was not achieved and may be due to mAb 68/14.4 having a low affinity for the CD8~ chain or the CD8~ chain being expressed at too low a density on the surface of lymphocytes. Complement lysis experiments using

436 . J. R. TSCHETTER et al.

two IgG2a mAb recognizing the CD8a chain resulted in the complete depletion of the CD8+ population as detected by flow cytometry. Previous work has demonstrated that CD8aa homodimers are expressed on the surface of cells expressing CD8a~ heterodimer (24), thus the CDa chain is expressed in a higher density on the surface of lymphocytes than the CD8~ chain. While it was not possible to eliminate the CD8a~ subpopulation with rabbit complement, it will be possible to remove these cells using other techniques such as panning or magnetic bead separation. Therefore, it will be possible to isolate equine CD8aa and CD8a~ lymphocytes in future studies to determine the function of these subpopulations. Acknowledgements We would like to thank Drs. J. L. OAKS and S. L. RIDGELY for their assistance in the collection of tissues from horses used in this study. The authors would also like to acknowledge the technical assistance of EMMA KAREL, ELDON LIBSTAFF and STEVE LEIB. This research was supported in part by National Institute of Health grant AI24291 and National Institute of Health Biotechnology Training grant 5 T32 GM08336.

References 1. BARBER, D. K., J. D. DASGUPTA, S. F. SCHLOSSMAN, J. M. TREVILLYAN and C. E. RUDD. 1989. The CD4 and CD8 antigens are coupled to a protein-tyrosine kinase (p56 Ick) that phosphorylates the CD3 complex. Proc. Nat. Acad. Sci. USA 86: 3277. 2. FUING-LEUNG, W. P., M. C. LOUIE, A. LIMMER, P. S. OHASHI, K. NGO, L. CHEN, K. KAWAI, E. LACY, D. Y. LOH and T. W. MAK. 1993. The lack of CD8a cytoplasmic domain resulted in a dramatic decrease in efficiency in thymic maturation but only a moderate reduction in cytotoxic function of CD8+ T lymphocytes. Eur. J. Immunol. 23: 2834. 3. VEILLETTE, A., 1. D. HORAK, E. M. HORAK, M. A. BOOKMAN and J. B. BOLEN. 1988. Alterations of the lymphocyte-specific protein tyrosine kinase (p56 Ick ) during T-cell activation. Mol. Cell. BioI. 8: 4353. 4. NAKAYAMA, K., K. NAKAYAMA, 1. NEGISHI, K. KUIDA, M. C. LOUIE, O. KANAGAWA, H. NAKAUCHI and D. Y. LOH. 1994. Requirement for CD8~ chain in positive selection of CD8-lineage T cells. Science 263: 1131. 5. CASABO, L. G., C. MAMALAKI, D. DIOUSSIS and R. ZAMOYSKA. 1994. T cell activation results in physical modification of the mouse CD8~ chain. J. Immunol. 152: 397. 6. IRIE, H. Y., K. S. RAVICHANDRAN and S. J. BURAKOFF. 1995. CD8~ chain influences CD8a chain-associated Lck kinase activity. J. Exp. Med. 181: 1267. 7. LUNN, D. P., M. A. HOLMES and P. H. DUFFUS. 1991. Three monoclonal antibodies identifying antigens on all equine T lymphocytes, and two mutually exclusive T-lymphocyte subsets. Immunol. 74: 251. 8. KYDD, J., D. F. ANTCZAE, W. R. ALLEN, D. BARBIS, G. BUTCHER, W. DAVIS, W. P. H. DUFFUS, N. EDINGTON, G. GRUNIG, M. A. HOLMES, D. P. LUNN, J. MCCOLLOCH, A. O'BRIEN, L. E. PERRYMAN, A. TAVERNOR, S. WILLIAMSON and C. ZHANG. 1994. Report of the first international workshop on equine leukocyte antigens, Cambridge, UK, July 1991. Vet. Immunol. Immunopath. 42: 3. 9. GRUNIG, G., D. P. BARBIS, C. H. ZHANG, W. C. DAVIS, D. P. LUNN and D. F. ANTCZAK. 1994. Correlation between monoclonal antibody reactivity and 4expression of CD4 and CD8a genes in the horse. Vet. Immunol. Immunopath. 42: 61.

CD8 dimer usage on equine ap and yo T lymphocytes .

437

10. MCGUIRE, T. c., L. E. PERRYMAN and W. C. DAVIS. 1983. Analysis of serum and lymphocyte surface IgM of healthy and immunodeficient horses with monoclonal antibodies. Am. J. Vet. Res. 44: 1284. 11. DAVIS, W., J. DAVIS and M. HAMILTON. 1995. Monoclonal Antibody Protocols, Methods in Molecular Biology. The Humana Press, Inc., Totowa, N], 149 pp. 12. FARR, A. G., and P. K. NAKANE. 1981. Immunohistochemistry with enzyme labeled antibodies: a brief review. J. Immun. Meth. 47: 129. 13. CRAWFORD, T., T. MCGUIRE and J. HENSON. 1971. Detection of equine infectious anemia virus in vitro by immunofluorescence. Arch. Virol. 34: 332. 14. WYATT, c., W. DAVIS, T. MCGUIRE and L. PERRYMAN. 1988. T lymphocyte development in horses. I. Characterization of monoclonal antibodies identifying three stages of T lymphocyte differentiation. Vet. Immunol. Immunopatho. 18: 3. 15. WYATT, c., E. BRACKETT, L. PERRYMAN and W. DAVIS. 1996. Identification of yo T lymphocyte subsets that populate the calf ileal mucosa after birth. Vet. Immunol. Immunopath. 52: 91. 16. TUMAS, D., A. BRASSFIELD, A. TRAVENOR, M. HINES, W. DAVIS and T. MCGUIRE. 1994. Monoclonal antibodies to the equine CD2 T lymphocyte marker, to a pangranulocyte/ monocyte marker and to a unique pan-B lymphocyte marker. Immunobiol. 192: 48. 17. BYRNE, K., W. DAVIS, M. HOLMES, A. BRASSFIELD and T. MCGUIRE. 1997. Cytokine RNA expression in an equine CD4+ subsets differentiated by expression of a novel 46 kDa surface protein. Vet. Immunol. Immunopath. 56: 191. 18. SCHRENZEL, M., and D. FERRICK. 1995. Horse (Equus caballus) T-cell receptor alpha, gamma and delta chain genes: nucleotide sequences and tissue specific gene expression. Immunogenetics 42: 112. 19. FREUNDLICH, B., and N. AVDALOVIC. 1983. Vse of gelatin/plasma coated flasks for isolating human peripheral blood monocytes. J. Immun. Meth 62: 31. 20. MAURY, W. 1994. Monocyte maturation controls expression of equine infectious anemia virus. J. Virol. 68: 6270. 21. MCGUIRE, T. c., D. B. TUMAS, K. M. BYRNE, M. T. HINES, S. R. LEIB, A. L. BRASSFIELD, K. I. O'ROURKE and L. E. PERRYMAN. 1994. Major histocompatibility complex-restricted CD8+ cytotoxic T lymphocytes from horses with equine infectious anemia virus recognize Env and Gag/PR proteins. J. Virol. 68: 1459. 22. LEDBETTER, J. A., W. E. SEAMAN, T. T. Tsu and L. A. HERZENBERG. 1981. Lyt-2 and Lyt-3 antigens are expressed on two different polypeptide subunits linked by disulfide bonds. Relationship of subunits to T cell cytolytic activity. J. Exp. Med. 153: 1503. 23. JOHNSON, P., K. GAGMPM, A. N. BARCLAY and A. F. WILLIAMS. 1985. Purification, chain separation and sequence of the MRC OX-8 antigen, a marker of rat cytotoxic T lymphocytes. EMBO J. 4: 2539. 24. MOEBIUS, V., G. KOBER, A. L. GRISCELLI, T. HERCEND and S. C. MEUER. 1991. Expression of different CD8 isoforms on distinct human lymphocyte subpopulations. Eur. J. Immunol. 27: 1793. 25. DISANTO, ]., R. KNOWLES and N. FLOMENBERG. 1988. The human Ly-3 molecule requires CD8 for cell surface expression. EMBO J. 7: 3465. 26. GORMAN S. D., Y. H. SUN, R. ZAMOYSKA and]. R. PARNES. 1988. Molecular linkage of the Ly-3 and Ly-2 genes. Requirement of Ly-2 for Ly-3 surface expression. J. Immunol. 140: 3646. 27. BAUME, D. M., M. A. CALIGIURI, T. J. MANLEY,]. F. DAILEY and J. RITZ. 1990. Differential expression of CD8a and CD8P associated with MHC-restricted and non-MHC-restricted cytolytic effector cells. Cell. Immunol. 131: 352. 28. VAN TWUIYVER, E., R. J. D. MOOIJAART, I. J. M. TEN BERGE, A. R. VAN DER HORST, J. M. WILMINK, F. H. J. CLAAS and L. P. DE WAAL. 1994. High affinity cytotoxic T lymphocytes after non-HLA-sharing blood transfusion - the other side of the coin. Transplant. 57: 1246. 29. ZHU, X., M. TOMMASINO, K. VOUSDEN, E. SADOVNIKAVA, R. RAPPUOLI, L. CRAWFORD, M. KAST, C. J. MELIEF, P. C. BEVERLEY and H. J. STRAUSS. 1995. Both immunization with pro-

438 .

J. R. TSCHETTER et al.

tein and recombinant vaccinia virus can stimulate CTL specific for the £7 protein of human papilloma virus 16 in H-2d mice. Scand. J. Immunol. 42: 557. 30. REGNAULT, A., P. KOURILSKY and A. CUMANO. 1995. The TCR-beta chain repertoire of gut derived T lymphocytes. Seminars in Immunology. Academic Press Ltd. 307 pp. 31. ALLEN, G., M. YEARGAN, L. R. COSTA and R. CROSS. 1995. Major histocompatibility complex class I-restricted cytotoxic T-lymphocyte responses in horses infected with equine herpes virus I. J. Virol. 69: 606. Dr. TRAVIS MCGUIRE, Department of Veterinary Microbiology and Pathology, Washington State University, Pullman, Washington 99164-7040, USA.