- Email: [email protected]
cDNA-AFLP analysis on transcripts associated with hydroxysafflor yellow A(HSYA) biosynthetic pathway in Carthamus tinctorius
Biochemical Systematics and Ecology 38 (2010) 971–980
Contents lists available at ScienceDirect
Biochemical Systematics and Ecology journal homepage: www.elsevier.com/locate/biochemsyseco
cDNA-AFLP analysis on transcripts associated with hydroxysafflor yellow A(HSYA) biosynthetic pathway in Carthamus tinctorius Na Feng, Yakui Li, Jie Tang, Yan Wang, Meili Guo* Department of Pharmacognosy, College of Pharmacy, Second Military Medical University, Shanghai 200433, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 10 May 2010 Accepted 1 September 2010 Available online 29 September 2010
Hydroxysafflor yellow A (HSYA), an important active compound, is uniquely present in florets of Carthamus tinctorius. In current study, we applied cDNA amplified fragment length polymorphism (cDNA-AFLP) to screen genes expressed differently between plants with and without HSYA. One hundred and thirty-two primer combinations produced 6751 fragments, seven transcript-derived fragments (TDFs) showed consistent difference between two gene pools. An independent RT-PCR expression analysis validated the expression pattern for 3 TDFs (TDF-8, TDF-9 and TDF-27). The 3 TDFs were only transcripted in plants that contained HSYA, implying that they were associated with the formation of HSYA. In addition, a full length of TDF-8 was achieved, which termed as WV-prl. Bioinformatics analysis showed that it carried a sequence highly homologous to the Broad bean wilt virus. Our study revealed that the three genes are involved in the process of response to some virus infection and functioning in HSYA production. Ó 2010 Elsevier Ltd. All rights reserved.
Keywords: Bulked segregant analysis (BSA) Carthamus tinctorius L. cDNA-AFLP Evolution analysis Hydroxysafflor yellow A (HSYA) Rapid amplification of cDNA ends (RACE)
1. Introduction Flavonoids are important secondary metabolites in the plant kingdom. Plants produce a wide variety of flavonoid compounds, which play important roles in the survival of plants in their ecosystem. Plant flavonoids are therefore involved in resistance against pests, pathogens and diseases, attraction of pollinators, formation of anthocyanidins, and interaction with symbiotic microorganisms (Dixon and Paiva, 1995; Dixon, 2001). As flavonoid compounds provide many pharmacologically active agents with antioxidant, anticarcinogenic, anti-inflammatory and cardiovascular protective activities with low toxicity (Dixon and Steel, 1999), they have attracted much attention over the past decade (Barnes et al., 1994; Krakauer et al., 2001; Takahashi et al., 2001). Many investigations have disclosed the chemical structures of flavonoids in Carthamus tinctorius L. (2n ¼ 2x ¼ 24) (Meselhy et al., 1993; Hang and Tang, 1995; Li and He, 2002), commonly known as safflower. Hydroxysafflor yellow A (HSYA), an important active member of flavonoids uniquely existing in the organ rather in the leaf, stem or root of safflower, is found to have a variety of biological actions (Zang et al., 2002; Jin et al., 2004; Sato et al., 2005). For example, HSYA is able to raise hypoxia tolerance, dilate the coronary artery, increase coronary blood flow, and inhibit ADP-induced platelet aggregation in rabbits (Zhu et al., 2003). But as safflower has a long history of plantation and good adaptation to the environment, intraspecific variation occurs and the content of HSYA in safflower varies greatly among different varieties (Guo et al., 2006a,b). In most cases, the natural yields of HSYA are very low, or even absent in partition of varieties.
Abbreviations: Bp, base pair(s); ORF, open reading frame; HSYA, Hydroxysafflor yellow A; HPLC, high performance liquid chromatography; cDNA-AFLP, cDNA amplified fragment length polymorphism; BSA, Bulked segregant analysis; TDFs, transcript-derived fragments; RACE, rapid amplification of cDNA ends. * Corresponding author. Tel./fax: þ86 21 25074576. E-mail address: [email protected] (M. Guo). 0305-1978/$ – see front matter Ó 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.bse.2010.09.001
972
N. Feng et al. / Biochemical Systematics and Ecology 38 (2010) 971–980
Recently, various approaches such as introducing genes encoding the key biosynthetic enzymes or antisense genes to block competitive pathways, or genes encoding regulatory proteins to overcome the specific rate-limiting steps have been used to manipulate biosynthesis of flavonoids (Tanaka et al., 1998; Yu et al., 2000; Vom Endt et al., 2002). However, in comparison to other medical plants, very little research has been done on safflower with respect to transcriptome wide information of specific gene expression patterns based on various molecular tools, much less genes in relation to the formation of HSYA. Analysis of the molecular mechanism controlling the expression and differentiation of HSYA by more efficient investigations is immensely important for exploitation and development of potential new medicines. cDNA amplified fragment length polymorphism (cDNA-AFLP) is a reliable, stable and highly reproducible AFLP-based mRNA fingerprinting technique (Bachem et al., 1996) and has been widely used in displaying gene differential expression and isolating genes of plants (Breyne et al., 2003; Albertini et al., 2004; Sarosh and Meijer, 2007). Recently, successful combination of the cDNA-AFLP technique with bulked segregant analysis (BSA) (Michelmore et al., 1991) was used to detect expressed tags (ESTs) and clone candidate genes (Barcaccia et al., 2001; Murata et al., 2006), demonstrating that the cDNA-AFLP based BSA approach could reveal the naturally existing genetic polymorphisms between two parental varieties contrasting in a given trait, which can be used to get candidate genes. Since 1997, we have undertaken studies on a molecular marker assisted breeding program targeting on HSYA analysis of safflower. We found that there was great genetic diversity in safflower populations by AFLP (Zhang et al., 2006) and RAPD (Guo et al., 2003). Also, pharmacologic studies with respect to chemical components of safflower showed that HSYA in safflower varies with different varieties, suggesting that the difference in HSYA content is mainly decided by heredity (Guo et al., 2006a). Zhang et al. used AFLP technology to screen the HSya-related genes. Four HSya-related genes from genomic DNA of Safflower have been identified and converted into SCAR markers (Zhang et al., 2009). To understand the mechanism of HSYA formation, we utilized the cDNA-AFLP based BSA approach to reveal the genetic polymorphisms in expressed cDNA sequences between an HSYA present (H) pool and an HSYA absent (H0) pool and obtained a sHsp gene which suppressed the expression of HSya (Tang et al., 2009). Furthermore, we achieved three other genes (TDF-8, TDF-9 and TDF-27) by the same method as Tang et al. (2009). Analysis of TDFs has revealed that TDFs as well as WV-prl gene share high homology with Broad bean wilt virus. Further investigation shows that these three genes may involve in the metabolic pathway of flavonoids and induce the expression of HSya. The following is our first open report about this study. 2. Materials and methods 2.1. Plant materials Two parental strains (No.0016 and No.0025) were selected from Chinese populations by our laboratory. The former (P1) was in the presence of HSYA with a content of 2.11% 0.09% (n ¼ 83), and the latter (P2) was in the absence of HSYA with a content of 0.00% 0.00% (n ¼ 89). The reciprocal crosses (P1 P2, P2 P1) were made and F1 seeds (87, 93) were handharvested in the summer of 2003 from the medicinal plant garden of the Second Military Medical University (Shanghai, China). The F2 seeds of the crosses were produced in the field of Sanya, Hainan Province by bagging F1 plants in paper bags prior to the flowering period during 2003 and 2004. A segregating F2 population was obtained by shifting a single F1 (P1P2) plant the next year in the medicinal plant garden of the said university. Two hundred and sixty-six segregating F2 individuals were obtained. F2 populations possessed the same genetic background except for HSYA difference. 2.2. Determination of HSYA content HSYA standard sample (C27H32O16) was extracted from Flos Carthami, the purity of which was 99.5% by HPLC analysis and the structure of which is illustrated in Fig. 1 (Guo et al., 2006b). Chromatography was performed on Agilent 1100 (USA) model 510 binary gradient equipment, and an Agilent 1100 chromatography workstation equipped with an injection valve with 20 mL sample loop. HSYA was separated on a 250 mm 4.6 mm i.d., 5 mm particle, ZORBAX SB-C18 column (Agilent Company). Optimum HPLC separation was achieved by use of 10% aqueous acetonitrile at a 1.0 mL min1 low rate. The detection wavelength was 403 nm and the temperature was 22 C. Dry safflower florets (approx. 0.5 g) were weighed accurately into a 250 mL tube, extracted with 100 mL water by soaking overnight, ultrasonicated for 20 min in a sealed container, and filtered through a 0.45 lm Nylon syringe filter (Millex-HN, Ireland) before injection for HPLC analysis.
Fig. 1. The chemical structure of HSYA (C27H32O16).
N. Feng et al. / Biochemical Systematics and Ecology 38 (2010) 971–980
973
Table 1 cDNA-AFLP adapters and primer nucleotide sequences. Adapters and primers
Nucleotide sequence
EcoRI adapter
50 -CTCGTAGACTGCGTACC-30 30 -CTGACGCATGGTTAA-50 50 -GACGATGAGTCCTGAG-30 30 -TACTCAGGACTCAT-50 50 -GACTGCGTACCAATTC-30 50 -GATGAGTCCTGAGTAA-30 50 -GACTGCGTACCAATTCNN -30 (N ¼ A or C or G or T) 50 -GATGAGTCCTGAGTAANN -30 (N ¼ A or C or G or T)
MseI adapter EcoRI pre-amplification primer(E00) EcoRI pre-amplification primer(M00) MseI selective amplification primer (Eþ 2) MseI selective amplification primer (Mþ 2)
2.3. Total RNA extraction and cDNA synthesis Total RNA was extracted from fresh florets using Plant RNA Mini Kit (Watson, China) according to the manufacturer’s handbook. First and second cDNA strands were synthesized from 20 mg total RNA with the M-MLVRTase cDNA synthesis Kit (TaKaRa, Japan) according to the manufacturer’s instructions. 2.4. Bulked segregant analysis (BSA) For BSA, an equivalent amount of cDNA from 10 HSYA present and 10 HSYA absent in F2 populations was pooled to create H and H0 bulks, respectively, based on the previous HSYA content from HPLC results. Both pools were analyzed using cDNAAFLP methodology to identify different specific fragments that may be associated with the formation of HSYA. 2.5. cDNA-AFLP analysis The cDNA-AFLP procedure was performed according to the method described by Bachem et al. (1998) with some modifications. Double-stranded cDNA (500 ng) was digested with EcoRI and MseI (New England Biolabs, Beverly, MA, USA) in a final volume of 25 mL. EcoRI and MseI adapters (listed in Table 1) were subsequently ligated to the digested cDNA fragments. Based on the intensity on gel, digested-ligated products were diluted 10-fold for pre-amplification using primers corresponding to the EcoRI and MseI adapters without extension and a temperature profile including an initial step of 2 min at 94 C, followed by 25 cycles of 30 s at 94 C, 30 s at 56 C, 1 min at 72 C and a final step of 10 min at 72 C. The 150-fold diluted pre-amplification products were used as templates for selective amplification with two selective base extensions at the 30 -end of the primers, and 132 possible primer combinations were performed. Amplification products were separated by electrophoresis through a 6% denaturing polyacrylamide gel and visualized by silver staining. 2.6. Isolation and sequencing of fragments Films were aligned with markings on gels. The bands of interest were cut out with a razor blade with meticulous care, and incubated in 50 mL water at 65 C for 15 min and then left overnight at room temperature for elution. Eluted cDNA was reamplified using the same PCR conditions and primer combinations as for selective amplification. The re-amplified products representing were cloned into PMD-18T vector (Takara, Japan) and sequenced (Shanghai Sangon, China). 2.7. Confirming the markers in cDNA from individual Carthamus tinctorius L. cDNA by RT-PCR To confirm sequenced fragments, total RNA was extracted from fresh florets using Plant RNA Mini Kit (Watson, China) according to the manufacturer’s handbook, and then treated with DNase I (RNAfree, TaKaRa, Japan). RNA concentrations were
Table 2 Primers used in SMART cDNA synthesis, PCRs, and sequencing. Experiment
Primer name
Sequence (50 –30 )
SMARTcDNA synthesis
SMART IIÔ A Oligo 50 - RACE CDS primer A 30 - RACE CDS primer A Universal primer A Mix (UPM) Nested universal primer A (NUP)
AAG CAG TGG TAT CAA CGC AGA ATA CGC GGG (T)25 V N AAG CAG TGG TAT CAA CGC AGA ATA C (T)30 V N Long: CTAATACGACTCACTATAGGGCAA GCA GTG TAT CAA CGC AGC GT Short: CTA ATA CGA CTC ACT ATA GGG C AAG CAG TGG TAT CAA CGC AGA GT AAA CCA TTG ATA GCG GTG TCC AGAT ATAGCGGTGTCCAGATCTACCTCAT GGTAGATCTGGACACCGCTATCAATGG GACACCGCTATCAATGGTTTGGAAA
RACE PCR 50 - RACE 0
3 - RACE
GSP_anti5Race NGSP_anti5Race GSP_sense3Race NGSP_sense3Race
974
N. Feng et al. / Biochemical Systematics and Ecology 38 (2010) 971–980
Fig. 2. HPLC chromatogram of the HSYA assay from Carthamus tinctorius populations. A. standard sample; B. No. 3–118, F2 individual with HSYA; C No. 3–93, F2 individual without HSYA.
estimated spectrophotometrically at 260 nm. Single-stranded cDNA was synthesized using a Reverse Transcriptase XL (AMV, TaKaRa, Japan). Specific primers were designed by Primer Premier 5.0 (Primer Biosoft International, USA) software. The RTPCR thermo-cycling conditions and reaction system were as follows: an initial denaturation at 94 C for 3 min was followed by 30 cycles of 35 s at 94 C, 35 s at 58 C, and 1 min at 72 C with a final extension for 5 min at 72 C. PCR was conducted in 25 mL volume containing 100 ng template cDNA, 0.2 mM primer each, 0.2 mM dNTPs, 1 Taq buffer, and 1.5 mM MgCl2. The products were analyzed by 2% agarose gel electrophoresis. 2.8. Rapid amplification of cDNA ends (RACE) To obtain complete sequences of TDFs, 50 and 30 RACEs (rapid amplification of cDNA ends) were performed using an SMART RACE cDNA Amplification Kit (Clontech, USA) according to the supplier’s instructions. But the complete cDNA of
N. Feng et al. / Biochemical Systematics and Ecology 38 (2010) 971–980
975
TDF-8 was only achieved in these TDFs. SMART cDNA synthesis was performed on total RNA extracts of the fresh florets according to the manufacturer’s instructions (Clontech, USA), in two parallel steps. These reactions produced 50 - RACEready cDNA and 30 - RACE-PCR cDNA, respectively. Primers for each cDNA synthesis are listed in Table 2. Gene-specific primers (GSP) and nested universal primer (NUP) were designed from the known TDF-8 domain. RACE PCR were performed using the AdvantageÒ 2 PCR System (Clontech, USA). PCR conditions for RACE PCR comprised of 30 s at 94 C, 30 s at 68 C, 3 min at 72 C for 25 cycles. The program of PCR conditions for nested RACE PCR was the same as the former for 20 cycles. RACE PCR products were analyzed by agarose gel electrophoresis. Selected bands were purified, and cDNA fragments were cloned into PMD-18T vector (TaKaRa, Japan) according to manufacturer’s recommendations. Both strands were sequenced by Invitrogen Biological Technology Company, Shanghai, China. 2.9. Nucleotide and protein sequence analysis Database searches were performed using the BLAST Network service [NCBI (National Center for Biotechnology Information); http://www.ncbi.nlm.nih.gov/BLAST]. The sequence of each TDF was searched against all sequences in the databases using the BLASTN and BLASTX programs (Altschul et al., 1997). And the deduced amino acid (aa) sequences of the full length of the TDF-8 were compared with the homologous sequences from other species in the databases. 3. Results 3.1. cDNA-AFLP analysis Two hundred and sixty-six F2 segregating plants were obtained by selfing a single F1 plant. F2 segregating plants were classified into two groups: 203 plants present in HSYA and 63 absent in HSYA. A representative HPLC chromatogram revealed the present and absent HSYA in safflower extracts (Fig. 2). H and H0 pools were established from F2 for BSA. Each pool contained individuals that were identical to a particular HSYA trait but arbitrary at all unlinked regions. cDNA-AFLP analysis between the two pools and F2 individuals verification based on BSA made it easier to find the polymorphism on the expression level. To investigate different expressions between present and absent HSYA in safflower, cDNA-AFLP was used as the first step toward identifying candidate genes. Reproducibility of the technique was verified with several primer combinations on independent cDNA synthesis and PCR amplification. Poly (Aþ) RNA was extracted for each sample and cDNA was amplified to screen 132 out of the 256 possible EcoRI/MseI (Nþ2) selective primer combinations on the two pools. The majority of the bands were monomorphic and no significant variation in intensity was observed between the two pools. 6751 fragments ranging from 50 to 750 bp were surveyed in H and H0 pools, with a mean of about 51 bands per pair. A total of 33 differentially accumulated TDFs from genes were identified that were present only in one pool and absent in the other. They were regarded as candidate fragments linked to HSYA. In addition, to make a further selection, silver stained cDNA-AFLP analysis was performed on the two parental lines and 266 individuals in the F2 segregating population to screen for the presence or absence of TDFs and further characterize the differentially expressed genes. Figs. 3 and 4 indicated the representative amplification
Fig. 3. Silver-stained cDNA-AFLP gel showing the differential expression of the TDF-8 and TDF-9 between present and absent HSYA in Carthamus tinctorius populations by primer combination EcoRI-GA/MseI-CA; Arrows designate TDFs that differ significantly in expression. M: maker; 1: female parent; 2: H pool; 3–12: F2 populations with HSYA; 13: male parent; 14: H0 pool; 15–18: F2 populations without HSYA.
976
N. Feng et al. / Biochemical Systematics and Ecology 38 (2010) 971–980
Fig. 4. Silver-stained cDNA-AFLP gel showing the differential expression of the TDF-27 between present and absent HSYA in Carthamus tinctorius populations by primer combination EcoRI-TT/MseI-AC; Arrow designates the TDF that differ significantly in expression. M: maker; 1: female parent; 2: H pool; 3–12: F2 populations with HSYA; 13: male parent; 14: H0 pool; 15–18: F2 populations without HSYA.
profiles after polyacrylamide gel electrophoresis. In addition to these presence/absence polymorphisms, polymorphisms of less pronounced intensity were also observed within the presence/absence polymorphisms. These fragments were not characterized for further research. 7 TDFs showed consistent difference between each member of the two gene pools. 3.2. Validation of differential expression patterns by RT-PCR To further characterize the differentially expressed genes, 7 of the selected differentially accumulated TDFs were checked by RT-PCR. The RT-PCR analysis is sensitive, highly reproducible and able to reflect the complexity and relative abundance of the original RNA sample (Vernon et al., 2000). Suitable primer combinations were designed for 7 TDFs to test 12 random F2 populations based on the TDF sequence itself, of which 3 RT-PCR products were validated. The resulting amplified products are shown in Fig. 5. The three TDFs that matched in the segregation analysis based on cDNA-AFLP patterns were termed as TDF-8, TDF-9 and TDF-27, whose GenBank accession number and sequence are listed below. In the 6 F2 plants, RT-PCR fragments of the expected length were present in only 6 plants with HSYA. TDF-8 (GenBank accession number: EU567303) 118bp. CGATGAGTCCTGAGTAAGCAAGTGTGTTCAGGAATTGTTGAGATATGGGAGGATGCATCAGCAGATTTCCCTATGGATGAGGTAGATC TGGACACCGCTATCAATGGTTTGGAAAATG. TDF-9 (GenBank accession number: EU567305) 450bp. GCCAAAGTTCCCAGCTCCTTGCGGSSCATGAATGCTGGGGCATGCTCCAAAGTTGCTATTTGTTTGGGTAACACAATGGAAGGCTCAT AGTAAATTGCAAAGCTAATTCTAGCATCAACTTTTGGAGCGTTTAGCCACTTGGACAATGTCTGTATAACCACCACAGGAGCATATTTGAA AGATCCTAGGTAATGCATATTCCACCAATCTGCACAAGAAAAGGGCTTGAAAACAAATTCCACGAACGGTTCTATGGCCGGATTCCACTTG TAGTGTTGAATGCCTAACAAACGTCCCAAACTTGAGCCCAAATTTGCGCTTTCATTACCCTCAACGTAACAGACTGCCAACCCTATGCCACA TGTTGGAGCTACCTGACAATTGATCTTACTCAGGACTCATCAGTCATGATGAGTCCTGAGTAAGATCAGGTCCAGAATTGGTACGCTA. TDF-27 (GenBank accession number: EU567304) 282bp. GGAGGATAAAGAGGAGGATCAGGAACTACCAATTGGGGAAGGTCATGTGGAAGAGATTGTTGACGAGTTTTTAACTAATTGCAATAT TTCTGAGCGGAATGATCAACTATCCATTGTGGGAAACGCCAATTACCCATTTGGCCAGGGATTGTATGAGTACGCAACTCGGGTCAGTGAC TCATTACTTGCAGTGATTTCGGGATCAATCAAGAAAGGCATAAATGACTTTTTGGATAAAGTGTACGCAGCTGTGAATCAGATTTTTGCAG CGTGGATGCCCAA.
Fig. 5. The confirmed results of three TDFs in Carthamus tinctorius individuals by RT-PCR. TDF-8, 9, 27 were confirmed in individuals with HSYA. 1–6: results of HSYA present individuals; 7–12: results of HSYA absent individuals.
N. Feng et al. / Biochemical Systematics and Ecology 38 (2010) 971–980
977
Fig. 6. The full length of TDF-8 was presumed to contain a 1257bp open reading frame (ORF), starting with an GTG codon at position 366–368 and terminating with an TAA codon at position 1620–1622, encoding a protein of 419 amino acids.
3.3. The full length of WV-prl obtained by RACE RT-PCR analysis indicated that 3 TDFs were closely associated with HSYA, so the full length of 3 TDFs was cloned, only to achieve TDF-8. The 429 bp and 1858 bp cDNA for TDF-8 were obtained by 50 and 30 RACE, respectively. The full length of TDF-8
978
N. Feng et al. / Biochemical Systematics and Ecology 38 (2010) 971–980
obtained 2315 bp cDNA and was designated as WV-prl (GenBank accession no. GU380344). The sequence of this cDNA and its putative derived protein are shown in Fig. 6. 3.4. Analysis of nucleotide and protein sequence The putative gene function for each sequence was investigated by a similarity search using BLAST Network service. BLAST searches in the NCBI database indicated that 3 sequences were highly homologous (>80%) with known genes. Nucleotide sequence analysis showed that TDF-8 shared high homology with BBWV-2 RNA1 putative RNA polymerase, and that TDF-9 was a homologue of BBWV-2 mRNA. TDF-27 showed great homology with Patchouli Mild Mosaic Virus RNA1 for polyprotein. The full length cDNA of WV-prl was presumed to contain a 1257 bp open reading frame (ORF), starting with an GTG codon at position 366–368 and terminating with an TAA codon at position 1620–1622, encoding a protein of 419 amino acids with a calculated molecular mass of 48011.34D (pI 7.07). Homologous analysis at the protein level showed that WV-prl carried a highly homology (97%) to Broad bean wilt virus. These results indicated that WV-prl was a member of the genus Fabavirus. Broad bean wilt virus is a member of the genus Fabavirus of the family Comoviridae (Fauquet et al., 2005), and contains a cofactor required for proteinase (Co-pro), putative helicase (Hel), genome-linked protein (VPg), proteinase (Pro), and RNA-dependent RNA polymerase (RdRp) conserved domains. Alignments of WV-prl and Broad bean wilt virus2 indicated that WV-prl is of high identity to RdRp, ranging from 1349 bp to 1638 bp (Fig. 7). 4. Discussion Our previous studies showed that sHSP only expressed in HSYA-absent lines and it might be directly or indirectly disturb the HSYA biosynthetic pathway (Tang et al., 2009). The present study further investigated differentially expressed TDFs of
Fig. 7. A. Lines and large boxes represent non-coding sequence and long open reading frames, respectively. Vertical lines through the boxes indicate putative cleavage sites. Calculated relative molecular mass values for each protein and positions of consensus sequences for cofactor required for proteinase (Co-pro), helicase(Hel), genome-linked protein(VPg), proteinase (Pro), and RNA-dependent RNA polymerase(RdRp) are indicated. B. Alignments of CT-cpl and Broad bean wilt virus2.
N. Feng et al. / Biochemical Systematics and Ecology 38 (2010) 971–980
979
interest on the basis of BSA-AFLP analysis, using RACE to get the full-length gene of TDF-8. We compared the differential gene expression patterns between HSYA present and absent segregating bulks. 266 F2 individual identification and RT-PCR validation were also processed. The results showed that the three TDFs were present only in the female parent and in HSYApresent lines, implying that proteins encoded by these fragments may be involved in regulation of HSYA. Homologous analysis of the TDFs sequences generated significant matches to sequence databases. Interestingly, the TDFs were highly homologous with the gene coding protein of Broad bean wilt virus and Patchouli mild mosaic virus. Broad bean wilt virus 1 (BBWV-1), BBWV-2, Patchouli mild mosaic virus (PatMMV) and Lamium mild mosaic virus (LMMV) are four recognized species that compose the genus Fabavirus of the family Comoviridae (Wellink et al., 2000). Fabaviruses have icosahedral virions composed of two coat proteins and bipartite, infecting a wide range of host plants worldwide, including economically important horticultural and ornamental species, and aphid-transmitted in a nonpersistent mode (Vittoria and Guido, 1996). BBWV, in particular, infested a lot of beans, complicated with ring spot, stunting, wilting or withering. Besides, secondary metabolites such as flavonoids could be mobilized to protect the plant from pathogen attacks. Flavonoids are a diverse group of compounds with a wide range of biological effects, especially anti-viral activity against a range of plant viruses, for example, high concentrations of flavonoids in fruits often go parallel with a low incidence by pathogens (Lattanzio et al., 1994; Lattanzio, 2003). Tobacco mosaic virus infectivity was reduced by a range of flavonoids. Quercetin and morin were also reported to prevent the formation of lesion in quinoa effected by potato virus X in a low concentration (1g$mL1) (French and Towers, 1992). Beckman reviewed the possible role of preformed phenolics in periderm formation in wilt disease resistance in a time–space model of host–parasite interactions (Beckman, 2000). The connection between the amount of flavonoids and the degree of wilt-resistance of the plants such as cotton, kenaf was also observed (Navrezova et al., 1986). Flavonoids could inactivate recognition sites on the viral coat protein which interact with host recognition sequences required for the initiation of infection (French and Towers, 1992). However, the replication of viruses was not inhibited by flavonoids treated such as in Tobacco mosaic virus (TMV) situations (Chen et al., 2003). In China, after Chinese soybeans were infested by soybean mosaic virus, the content of flavonoids was significant higher in resistant species than susceptible species (Zhu et al., 2001). All the opinions were supported by Ryder et al. (1987) with the similar conclusion that the CHS gene could be induced by fungus infested and mechanical wounding. It also happened in CHS gene of Phaseolus vulgaris (Mehdy and Lamb, 1987). All the evidence implies that safflower might be infested by BBWV, mosaic virus or other virus or fungus long time ago, which induced the production of HSYA with antivirus activity to inhibit the virus at the moment, but cannot prevent the replication of virus. Finally, safflower allowed the microbe to enter the symbiotic modus and caused systemic acquired resistance (SAR). More interestingly, we also obtained a full length of TDF-8 (WV-prl gene) by RACE that carried a highly homologous sequence (97% identity) to the Broad bean wilt virus from safflower. In conclusion, the study clearly shows various genes involved in HSYA production. Although further clues are needed to understand physiological roles of these genes, the findings obtained suggest that these three genes are absolutely involved in a process of response to some virus infection and functioning in HSYA production. Our work may help elucidate the molecular basis of this pathway and identify more genes closely related to this pathway. Acknowledgments This study was supported by the National Natural Science Foundation of China (30772734), “863” project (2008AA02Z137) grants from the Ministry of Science and Technology of P. R. China. References Albertini, E., Marconi, G., Barcaccia, G., Raggi, L., Falcinelli, M., 2004. Isolation of candidate genes for apomixis in Poa pratensis L. Plant Mol. Biol. 56, 879–894. Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389–3402. Bachem, C.W.B., Van der Hoeven, R.S., de Bruijn, S.M., Verudenhil, D., Zabeau, M., Visser, R.G.F, 1996. Visualization of differential gene expression using a novel method of RNA fingerprinting based on AFLP analysis of gene expression during potato tuber development. Plant J 9, 745–753. Bachem, C.W.B., Oomen, R.J.F.J., Visser, R.G.F., 1998. Transcript imaging with cDNA-AFLP: a step-by- step protocol. Plant Mol. Biol. Rep. 16, 157–173. Barcaccia, G., Varotto, S., Meneghetti, S., Albertini, E., Porceddu, A., Parrini, P., Lucchin, M., 2001. Analysis of gene expression during flowering in apomeiotic mutants of Medicago spp: cloning of ESTs and candidate genes for 2n eggs. Sex Plant Reprod. 14, 233–238. Barnes, S., Peterson, T.G., Grubbs, C., Setchell, K.D.R., 1994. Potential role of dietary isoflavones in the prevention of cancer. In: Jacobs, M.M. (Ed.), Diet and Cancer: Markers, Prevention, and Treatment. Plenum Press, New York, pp. 135–147. Beckman, C.H., 2000. Phenolic-storing cells: keys to programmed cell death and periderm formation in wilt disease resistance and in general defence responses in plants. Physiol. Mol. Plant Pathol. 57, 101–110. Breyne, P., Dreesen, R., Cannoot, B., Rombaut, D., Vandepoele, K., Rambauts, S., Vanderhaeghen, R., Inze, D., Zabeau, M., 2003. Quantitative cDNA-AFLP analysis for genome-wide expression studies. Mol. Genet. Genomics 269, 173–179. Chen, Q.J., Liu, G.K., Wu, Z.J., Lin, Q.Y., Xie, L.H., 2003. The inhibition effect of flavonoids extracted from Bidens pliosa L. on TMV. Journal of Fujian Agriculture and Forestry University 32, 181–184. Dixon, R.A., 2001. Natural products and plant disease resistance. Nature 411, 843–847. Dixon, R.A., Paiva, N.L., 1995. Stress-induced phenylpropanoid metabolism. Plant Cell 7, 1085–1097. Dixon, R.A., Steel, C.L., 1999. Flavonoids and isoflavonoids-a gold mine for metabolic engineering. Trends Plant Sci. 4, 394–400. Fauquet, C.M., Mayo, M.A., Maniloff, J., Desselberger, U., Ball, L.A., 2005. Virus Taxonomy, Eighth Report of the International Committee on Taxonomy of Viruses. Elsevier Academic Press, San Diego. French, C.J., Towers, G.H.N., 1992. Inhibition of infectivity of potato virus X by flavonoids. Phytochemistry 31, 3017–3020. Guo, J., Jiang, R.H., Kamphuis, L.G., Govers, F., 2006a. A cDNA-AFLP based strategy to identify transcripts associated with avirulence in Phytophthora infestans. Fungal Genet. Biol. 43, 111–123.
980
N. Feng et al. / Biochemical Systematics and Ecology 38 (2010) 971–980
Guo, M.L., Jiang, W., Zhang, Z.Z., Zhang, G., Mao, J.F., Yin, M., Su, Z.W., 2003. Randomly amplified polymorphic DNA technique in molecular identification of germplasms of Carthamus tinctorius L. Acad. J. Sec Mil Med. Univ. 24, 1116–1119. Guo, M.L., Zhang, G., Zhang, W., Zhang, H.M., Su, Z.W., 2006b. Determination of Safflor yellow A by RP-HPLC and Resources quality comparison in safflower. China J. Chin. Materia Med. 31, 1234–1236. Hang, L.J., Tang, Y.X., 1995. Study on the chemical component of Cartharmus timctorious. Mod. Appl. Pharm 12, 19–21. Jin, M., Li, J.R., Wu, W., et al., 2004. Study on the antioxidative effect of Safflor Yellow. China J. Chin. Materia Med. 29, 447–449. Krakauer, T., Li, B.Q., Young, H.A., 2001. The flavonoid baicalin inhibits superantigen-induced inflammatory cytokines and chemokines. FEBS Lett. 500, 52–55. Lattanzio, V., 2003. Bioactive polyphenols: their role in quality and storability of fruit and vegetables. J. Appl. Bot. 77, 128–146. Lattanzio, V., Cardinali, A., Palmieri, S., 1994. The role of phenolics in the potsharvest physiology of fruits and vegetables: browning reactions and fungal diseases. Ital J. Food Sci. 1, 3–22. Li, F., He, Z.S., 2002. Flavonoids from Carthamus tinctorius. Chin. J. Chem. 20, 699–702. Mehdy, M.C., Lamb, C.J., 1987. Chalcone isomerase cDNA cloning and mRNA induction by fungal elicitor, wounding and infection. EMBO J. 6, 1527–1533. Meselhy, M.R., Kadota, S., Momose, Y., Hatakeyama, N., Kusai, A., Hattori, M., Namba, T., 1993. Two new quinochalcone yellow pigments from Carthamus tinctorius and Ca2þ antagonistic activity of tinctormine. Chem. Pharm. Bull. 41, 1796–1802. Michelmore, R.W., Paran, I., Kesseli, R.V., 1991. Identification of markers linked to disease-resistance genes by bulked segregant analysis: a rapid method to detect markers in specific genomic regions by using segregating populations. Proc. Natl. Acad. Sci. USA 88, 9828–9832. Murata, J., Bienzle, D., Brandle, J.E., Sensen, C.W., De, Luca V, 2006. Expressed sequence tags from Madagascar periwinkle (Catharanthus roseus). FEBS Lett. 580, 4501–4507. Navrezova, N., Agzamova, M., Stepanichenko, N.N., Makhsudova, B., 1986. Action of the flavonoids quercetin 3-rutinoside and kaempferol 3, 7-dirhamnoside on the biosynthesis of melanin in Verticillium dahliae. Chem. Nat. Comp. 22, 229–230. Ryder, T.B., Hedrick, S.A., Bell, J.N., Liang, X.W., Clouse, S.D., Lamb, C.J., 1987. Organization and differential activation of a gene family encoding the plant defense enzyme chalcone synthase in Phaseolus vulgaris. Mol. Genet. Genomics. 210, 219–233. Sarosh, B.R., Meijer, J., 2007. Transcriptional profiling by cDNA-AFLP reveals novel insights during methyl jasmonate, wounding and insect attack in Brassica napus. Plant Mol. Biol. 64, 425–438. Sato, S., Nojiri, T., Onodera, J.I., 2005. Studies on the synthesis of safflomin-A, a yellow pigment in safflower petals: oxidation of oxidation of 3-C-beta-Dglucopyranosyl-5-methylphloroacetoPhenone. Carbohydr. Res. 340, 389–393. Takahashi, K., Morikawa, A., Kato, Y., Sugiyama, T., Koide, N., Mu, M.M., Yoshida, T., Yokochi, T., 2001. Flavonoids protect mice from two types of lethal shock induced by endotoxin. FEMS Immunol. Med. Microbiol. 3l, 29–33. Tanaka, Y., Tsuda, S., Kusumi, T., 1998. Metabolic engineering to modify flower color. Plant Cell Physiol 39, 1119–1126. Tang, J., Lou, Z.Y., Wang, Y., Guo, M.L., 2009. Expression of a small heat shock protein (CTL-hsyapr), screened by cDNA-AFLP approach, correlated with hydroxysafflor yellow A in Safflower (Carthamus tinctorius L.). BIOCHEM SYST ECOL. Accepted. Vernon, S.D., Unger, E.R., Rajeevan, M., Dimulescu, I.M., Nisenbaum, R., Campbell, C.E., 2000. Reproducibility of alternative probe synthesis approaches for gene expression profiling with arrays. J. Mol. Diagn. 2, 124–127. Vittoria, L., Guido, B., 1996. Fabaviruses: Broad bean wilt virus and allied viruses. In: Harrison, B.H., Murant, A.F. (Eds.), The Plant Viruses. Polyhedral Virions and Bipartite RNA Genomes, vol. 5. Plenum Press, New York, pp. 229–250. Vom Endt, D., Kijne, J.W., Memelink, J., 2002. Transcription factors controlling plant secondary metabolism: what regulates the regulators. Phytochemistry 61, 107–114. Wellink, J., Le Gall, O., Sanfacon, H., Ikegami, M., Jones, A.T., 2000. Family Comoviridae. In: Van Regenmortal, M.H.V., Fauquet, C.M., Bishop, D.H.L., Carstens, E.B., Estes, M.K., Lemon, S.M., Maniloff, J., Mayo, M.A., McGeoch, D.J., Pringle, C.R., Wickner, R.B. (Eds.), Virus Taxonomy: Seventh Report of the International Committee on Taxonomy of Viruses. Academic Press, San Diego, pp. 695–697. Yu, O., Jung, W., Shi, J., Croes, R.A., Fader, G.M., McGonigle, B., Odell, J.T., 2000. Production of the isoflavones genistein and daidzein in non-legume dicot and monocot tissues. Plant Physiol. 124, 781–794. Zang, B.X., Jin, M., Si, N., Zhang, Y., Wu, W., Piao, Y.Z., 2002. Antagonistic effect of hydroxysafflor yellow A on the platelet activating factor receptor. Acta Pharm. Sin. 37, 696–699. Zhang, L., Huang, B.B., Yin, K.G., Guo, M.L., 2006. Analysis of intraspecific variation of Chinese Carthamus tinctorius L. using AFLP markers. Acta Pharm. Sin. 41, 91–96. Zhang, Z.Z., Guo, M.L., Zhang, J.D., 2009. Identification of AFLP fragments linked to hydroxysafflor yellow A in Flos Carthami and conversion to a SCAR marker for rapid selection. Mol. Breed. 23, 229–237. Zhu, H.B., Teng, B., Gao, F.L., Wu, Z.P., 2001. Changes of some biochemical characters of soybean with different resistant levels infected by SMV1. Acta Agriculturae Boreali-occidentalis Sinica 10, 38–40. Zhu, H.B., Wang, Z.H., Ma, C., Tian, J., Fu, F., Li, C., Guo, D., Roeder, E., Liu, K., 2003. Neuroprotective effects of hydroxysafflor yellow A: in vivo and in vitro studies. Planta Med. 69, 429–433.
Contents lists available at ScienceDirect
Biochemical Systematics and Ecology journal homepage: www.elsevier.com/locate/biochemsyseco
cDNA-AFLP analysis on transcripts associated with hydroxysafflor yellow A(HSYA) biosynthetic pathway in Carthamus tinctorius Na Feng, Yakui Li, Jie Tang, Yan Wang, Meili Guo* Department of Pharmacognosy, College of Pharmacy, Second Military Medical University, Shanghai 200433, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 10 May 2010 Accepted 1 September 2010 Available online 29 September 2010
Hydroxysafflor yellow A (HSYA), an important active compound, is uniquely present in florets of Carthamus tinctorius. In current study, we applied cDNA amplified fragment length polymorphism (cDNA-AFLP) to screen genes expressed differently between plants with and without HSYA. One hundred and thirty-two primer combinations produced 6751 fragments, seven transcript-derived fragments (TDFs) showed consistent difference between two gene pools. An independent RT-PCR expression analysis validated the expression pattern for 3 TDFs (TDF-8, TDF-9 and TDF-27). The 3 TDFs were only transcripted in plants that contained HSYA, implying that they were associated with the formation of HSYA. In addition, a full length of TDF-8 was achieved, which termed as WV-prl. Bioinformatics analysis showed that it carried a sequence highly homologous to the Broad bean wilt virus. Our study revealed that the three genes are involved in the process of response to some virus infection and functioning in HSYA production. Ó 2010 Elsevier Ltd. All rights reserved.
Keywords: Bulked segregant analysis (BSA) Carthamus tinctorius L. cDNA-AFLP Evolution analysis Hydroxysafflor yellow A (HSYA) Rapid amplification of cDNA ends (RACE)
1. Introduction Flavonoids are important secondary metabolites in the plant kingdom. Plants produce a wide variety of flavonoid compounds, which play important roles in the survival of plants in their ecosystem. Plant flavonoids are therefore involved in resistance against pests, pathogens and diseases, attraction of pollinators, formation of anthocyanidins, and interaction with symbiotic microorganisms (Dixon and Paiva, 1995; Dixon, 2001). As flavonoid compounds provide many pharmacologically active agents with antioxidant, anticarcinogenic, anti-inflammatory and cardiovascular protective activities with low toxicity (Dixon and Steel, 1999), they have attracted much attention over the past decade (Barnes et al., 1994; Krakauer et al., 2001; Takahashi et al., 2001). Many investigations have disclosed the chemical structures of flavonoids in Carthamus tinctorius L. (2n ¼ 2x ¼ 24) (Meselhy et al., 1993; Hang and Tang, 1995; Li and He, 2002), commonly known as safflower. Hydroxysafflor yellow A (HSYA), an important active member of flavonoids uniquely existing in the organ rather in the leaf, stem or root of safflower, is found to have a variety of biological actions (Zang et al., 2002; Jin et al., 2004; Sato et al., 2005). For example, HSYA is able to raise hypoxia tolerance, dilate the coronary artery, increase coronary blood flow, and inhibit ADP-induced platelet aggregation in rabbits (Zhu et al., 2003). But as safflower has a long history of plantation and good adaptation to the environment, intraspecific variation occurs and the content of HSYA in safflower varies greatly among different varieties (Guo et al., 2006a,b). In most cases, the natural yields of HSYA are very low, or even absent in partition of varieties.
Abbreviations: Bp, base pair(s); ORF, open reading frame; HSYA, Hydroxysafflor yellow A; HPLC, high performance liquid chromatography; cDNA-AFLP, cDNA amplified fragment length polymorphism; BSA, Bulked segregant analysis; TDFs, transcript-derived fragments; RACE, rapid amplification of cDNA ends. * Corresponding author. Tel./fax: þ86 21 25074576. E-mail address: [email protected] (M. Guo). 0305-1978/$ – see front matter Ó 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.bse.2010.09.001
972
N. Feng et al. / Biochemical Systematics and Ecology 38 (2010) 971–980
Recently, various approaches such as introducing genes encoding the key biosynthetic enzymes or antisense genes to block competitive pathways, or genes encoding regulatory proteins to overcome the specific rate-limiting steps have been used to manipulate biosynthesis of flavonoids (Tanaka et al., 1998; Yu et al., 2000; Vom Endt et al., 2002). However, in comparison to other medical plants, very little research has been done on safflower with respect to transcriptome wide information of specific gene expression patterns based on various molecular tools, much less genes in relation to the formation of HSYA. Analysis of the molecular mechanism controlling the expression and differentiation of HSYA by more efficient investigations is immensely important for exploitation and development of potential new medicines. cDNA amplified fragment length polymorphism (cDNA-AFLP) is a reliable, stable and highly reproducible AFLP-based mRNA fingerprinting technique (Bachem et al., 1996) and has been widely used in displaying gene differential expression and isolating genes of plants (Breyne et al., 2003; Albertini et al., 2004; Sarosh and Meijer, 2007). Recently, successful combination of the cDNA-AFLP technique with bulked segregant analysis (BSA) (Michelmore et al., 1991) was used to detect expressed tags (ESTs) and clone candidate genes (Barcaccia et al., 2001; Murata et al., 2006), demonstrating that the cDNA-AFLP based BSA approach could reveal the naturally existing genetic polymorphisms between two parental varieties contrasting in a given trait, which can be used to get candidate genes. Since 1997, we have undertaken studies on a molecular marker assisted breeding program targeting on HSYA analysis of safflower. We found that there was great genetic diversity in safflower populations by AFLP (Zhang et al., 2006) and RAPD (Guo et al., 2003). Also, pharmacologic studies with respect to chemical components of safflower showed that HSYA in safflower varies with different varieties, suggesting that the difference in HSYA content is mainly decided by heredity (Guo et al., 2006a). Zhang et al. used AFLP technology to screen the HSya-related genes. Four HSya-related genes from genomic DNA of Safflower have been identified and converted into SCAR markers (Zhang et al., 2009). To understand the mechanism of HSYA formation, we utilized the cDNA-AFLP based BSA approach to reveal the genetic polymorphisms in expressed cDNA sequences between an HSYA present (H) pool and an HSYA absent (H0) pool and obtained a sHsp gene which suppressed the expression of HSya (Tang et al., 2009). Furthermore, we achieved three other genes (TDF-8, TDF-9 and TDF-27) by the same method as Tang et al. (2009). Analysis of TDFs has revealed that TDFs as well as WV-prl gene share high homology with Broad bean wilt virus. Further investigation shows that these three genes may involve in the metabolic pathway of flavonoids and induce the expression of HSya. The following is our first open report about this study. 2. Materials and methods 2.1. Plant materials Two parental strains (No.0016 and No.0025) were selected from Chinese populations by our laboratory. The former (P1) was in the presence of HSYA with a content of 2.11% 0.09% (n ¼ 83), and the latter (P2) was in the absence of HSYA with a content of 0.00% 0.00% (n ¼ 89). The reciprocal crosses (P1 P2, P2 P1) were made and F1 seeds (87, 93) were handharvested in the summer of 2003 from the medicinal plant garden of the Second Military Medical University (Shanghai, China). The F2 seeds of the crosses were produced in the field of Sanya, Hainan Province by bagging F1 plants in paper bags prior to the flowering period during 2003 and 2004. A segregating F2 population was obtained by shifting a single F1 (P1P2) plant the next year in the medicinal plant garden of the said university. Two hundred and sixty-six segregating F2 individuals were obtained. F2 populations possessed the same genetic background except for HSYA difference. 2.2. Determination of HSYA content HSYA standard sample (C27H32O16) was extracted from Flos Carthami, the purity of which was 99.5% by HPLC analysis and the structure of which is illustrated in Fig. 1 (Guo et al., 2006b). Chromatography was performed on Agilent 1100 (USA) model 510 binary gradient equipment, and an Agilent 1100 chromatography workstation equipped with an injection valve with 20 mL sample loop. HSYA was separated on a 250 mm 4.6 mm i.d., 5 mm particle, ZORBAX SB-C18 column (Agilent Company). Optimum HPLC separation was achieved by use of 10% aqueous acetonitrile at a 1.0 mL min1 low rate. The detection wavelength was 403 nm and the temperature was 22 C. Dry safflower florets (approx. 0.5 g) were weighed accurately into a 250 mL tube, extracted with 100 mL water by soaking overnight, ultrasonicated for 20 min in a sealed container, and filtered through a 0.45 lm Nylon syringe filter (Millex-HN, Ireland) before injection for HPLC analysis.
Fig. 1. The chemical structure of HSYA (C27H32O16).
N. Feng et al. / Biochemical Systematics and Ecology 38 (2010) 971–980
973
Table 1 cDNA-AFLP adapters and primer nucleotide sequences. Adapters and primers
Nucleotide sequence
EcoRI adapter
50 -CTCGTAGACTGCGTACC-30 30 -CTGACGCATGGTTAA-50 50 -GACGATGAGTCCTGAG-30 30 -TACTCAGGACTCAT-50 50 -GACTGCGTACCAATTC-30 50 -GATGAGTCCTGAGTAA-30 50 -GACTGCGTACCAATTCNN -30 (N ¼ A or C or G or T) 50 -GATGAGTCCTGAGTAANN -30 (N ¼ A or C or G or T)
MseI adapter EcoRI pre-amplification primer(E00) EcoRI pre-amplification primer(M00) MseI selective amplification primer (Eþ 2) MseI selective amplification primer (Mþ 2)
2.3. Total RNA extraction and cDNA synthesis Total RNA was extracted from fresh florets using Plant RNA Mini Kit (Watson, China) according to the manufacturer’s handbook. First and second cDNA strands were synthesized from 20 mg total RNA with the M-MLVRTase cDNA synthesis Kit (TaKaRa, Japan) according to the manufacturer’s instructions. 2.4. Bulked segregant analysis (BSA) For BSA, an equivalent amount of cDNA from 10 HSYA present and 10 HSYA absent in F2 populations was pooled to create H and H0 bulks, respectively, based on the previous HSYA content from HPLC results. Both pools were analyzed using cDNAAFLP methodology to identify different specific fragments that may be associated with the formation of HSYA. 2.5. cDNA-AFLP analysis The cDNA-AFLP procedure was performed according to the method described by Bachem et al. (1998) with some modifications. Double-stranded cDNA (500 ng) was digested with EcoRI and MseI (New England Biolabs, Beverly, MA, USA) in a final volume of 25 mL. EcoRI and MseI adapters (listed in Table 1) were subsequently ligated to the digested cDNA fragments. Based on the intensity on gel, digested-ligated products were diluted 10-fold for pre-amplification using primers corresponding to the EcoRI and MseI adapters without extension and a temperature profile including an initial step of 2 min at 94 C, followed by 25 cycles of 30 s at 94 C, 30 s at 56 C, 1 min at 72 C and a final step of 10 min at 72 C. The 150-fold diluted pre-amplification products were used as templates for selective amplification with two selective base extensions at the 30 -end of the primers, and 132 possible primer combinations were performed. Amplification products were separated by electrophoresis through a 6% denaturing polyacrylamide gel and visualized by silver staining. 2.6. Isolation and sequencing of fragments Films were aligned with markings on gels. The bands of interest were cut out with a razor blade with meticulous care, and incubated in 50 mL water at 65 C for 15 min and then left overnight at room temperature for elution. Eluted cDNA was reamplified using the same PCR conditions and primer combinations as for selective amplification. The re-amplified products representing were cloned into PMD-18T vector (Takara, Japan) and sequenced (Shanghai Sangon, China). 2.7. Confirming the markers in cDNA from individual Carthamus tinctorius L. cDNA by RT-PCR To confirm sequenced fragments, total RNA was extracted from fresh florets using Plant RNA Mini Kit (Watson, China) according to the manufacturer’s handbook, and then treated with DNase I (RNAfree, TaKaRa, Japan). RNA concentrations were
Table 2 Primers used in SMART cDNA synthesis, PCRs, and sequencing. Experiment
Primer name
Sequence (50 –30 )
SMARTcDNA synthesis
SMART IIÔ A Oligo 50 - RACE CDS primer A 30 - RACE CDS primer A Universal primer A Mix (UPM) Nested universal primer A (NUP)
AAG CAG TGG TAT CAA CGC AGA ATA CGC GGG (T)25 V N AAG CAG TGG TAT CAA CGC AGA ATA C (T)30 V N Long: CTAATACGACTCACTATAGGGCAA GCA GTG TAT CAA CGC AGC GT Short: CTA ATA CGA CTC ACT ATA GGG C AAG CAG TGG TAT CAA CGC AGA GT AAA CCA TTG ATA GCG GTG TCC AGAT ATAGCGGTGTCCAGATCTACCTCAT GGTAGATCTGGACACCGCTATCAATGG GACACCGCTATCAATGGTTTGGAAA
RACE PCR 50 - RACE 0
3 - RACE
GSP_anti5Race NGSP_anti5Race GSP_sense3Race NGSP_sense3Race
974
N. Feng et al. / Biochemical Systematics and Ecology 38 (2010) 971–980
Fig. 2. HPLC chromatogram of the HSYA assay from Carthamus tinctorius populations. A. standard sample; B. No. 3–118, F2 individual with HSYA; C No. 3–93, F2 individual without HSYA.
estimated spectrophotometrically at 260 nm. Single-stranded cDNA was synthesized using a Reverse Transcriptase XL (AMV, TaKaRa, Japan). Specific primers were designed by Primer Premier 5.0 (Primer Biosoft International, USA) software. The RTPCR thermo-cycling conditions and reaction system were as follows: an initial denaturation at 94 C for 3 min was followed by 30 cycles of 35 s at 94 C, 35 s at 58 C, and 1 min at 72 C with a final extension for 5 min at 72 C. PCR was conducted in 25 mL volume containing 100 ng template cDNA, 0.2 mM primer each, 0.2 mM dNTPs, 1 Taq buffer, and 1.5 mM MgCl2. The products were analyzed by 2% agarose gel electrophoresis. 2.8. Rapid amplification of cDNA ends (RACE) To obtain complete sequences of TDFs, 50 and 30 RACEs (rapid amplification of cDNA ends) were performed using an SMART RACE cDNA Amplification Kit (Clontech, USA) according to the supplier’s instructions. But the complete cDNA of
N. Feng et al. / Biochemical Systematics and Ecology 38 (2010) 971–980
975
TDF-8 was only achieved in these TDFs. SMART cDNA synthesis was performed on total RNA extracts of the fresh florets according to the manufacturer’s instructions (Clontech, USA), in two parallel steps. These reactions produced 50 - RACEready cDNA and 30 - RACE-PCR cDNA, respectively. Primers for each cDNA synthesis are listed in Table 2. Gene-specific primers (GSP) and nested universal primer (NUP) were designed from the known TDF-8 domain. RACE PCR were performed using the AdvantageÒ 2 PCR System (Clontech, USA). PCR conditions for RACE PCR comprised of 30 s at 94 C, 30 s at 68 C, 3 min at 72 C for 25 cycles. The program of PCR conditions for nested RACE PCR was the same as the former for 20 cycles. RACE PCR products were analyzed by agarose gel electrophoresis. Selected bands were purified, and cDNA fragments were cloned into PMD-18T vector (TaKaRa, Japan) according to manufacturer’s recommendations. Both strands were sequenced by Invitrogen Biological Technology Company, Shanghai, China. 2.9. Nucleotide and protein sequence analysis Database searches were performed using the BLAST Network service [NCBI (National Center for Biotechnology Information); http://www.ncbi.nlm.nih.gov/BLAST]. The sequence of each TDF was searched against all sequences in the databases using the BLASTN and BLASTX programs (Altschul et al., 1997). And the deduced amino acid (aa) sequences of the full length of the TDF-8 were compared with the homologous sequences from other species in the databases. 3. Results 3.1. cDNA-AFLP analysis Two hundred and sixty-six F2 segregating plants were obtained by selfing a single F1 plant. F2 segregating plants were classified into two groups: 203 plants present in HSYA and 63 absent in HSYA. A representative HPLC chromatogram revealed the present and absent HSYA in safflower extracts (Fig. 2). H and H0 pools were established from F2 for BSA. Each pool contained individuals that were identical to a particular HSYA trait but arbitrary at all unlinked regions. cDNA-AFLP analysis between the two pools and F2 individuals verification based on BSA made it easier to find the polymorphism on the expression level. To investigate different expressions between present and absent HSYA in safflower, cDNA-AFLP was used as the first step toward identifying candidate genes. Reproducibility of the technique was verified with several primer combinations on independent cDNA synthesis and PCR amplification. Poly (Aþ) RNA was extracted for each sample and cDNA was amplified to screen 132 out of the 256 possible EcoRI/MseI (Nþ2) selective primer combinations on the two pools. The majority of the bands were monomorphic and no significant variation in intensity was observed between the two pools. 6751 fragments ranging from 50 to 750 bp were surveyed in H and H0 pools, with a mean of about 51 bands per pair. A total of 33 differentially accumulated TDFs from genes were identified that were present only in one pool and absent in the other. They were regarded as candidate fragments linked to HSYA. In addition, to make a further selection, silver stained cDNA-AFLP analysis was performed on the two parental lines and 266 individuals in the F2 segregating population to screen for the presence or absence of TDFs and further characterize the differentially expressed genes. Figs. 3 and 4 indicated the representative amplification
Fig. 3. Silver-stained cDNA-AFLP gel showing the differential expression of the TDF-8 and TDF-9 between present and absent HSYA in Carthamus tinctorius populations by primer combination EcoRI-GA/MseI-CA; Arrows designate TDFs that differ significantly in expression. M: maker; 1: female parent; 2: H pool; 3–12: F2 populations with HSYA; 13: male parent; 14: H0 pool; 15–18: F2 populations without HSYA.
976
N. Feng et al. / Biochemical Systematics and Ecology 38 (2010) 971–980
Fig. 4. Silver-stained cDNA-AFLP gel showing the differential expression of the TDF-27 between present and absent HSYA in Carthamus tinctorius populations by primer combination EcoRI-TT/MseI-AC; Arrow designates the TDF that differ significantly in expression. M: maker; 1: female parent; 2: H pool; 3–12: F2 populations with HSYA; 13: male parent; 14: H0 pool; 15–18: F2 populations without HSYA.
profiles after polyacrylamide gel electrophoresis. In addition to these presence/absence polymorphisms, polymorphisms of less pronounced intensity were also observed within the presence/absence polymorphisms. These fragments were not characterized for further research. 7 TDFs showed consistent difference between each member of the two gene pools. 3.2. Validation of differential expression patterns by RT-PCR To further characterize the differentially expressed genes, 7 of the selected differentially accumulated TDFs were checked by RT-PCR. The RT-PCR analysis is sensitive, highly reproducible and able to reflect the complexity and relative abundance of the original RNA sample (Vernon et al., 2000). Suitable primer combinations were designed for 7 TDFs to test 12 random F2 populations based on the TDF sequence itself, of which 3 RT-PCR products were validated. The resulting amplified products are shown in Fig. 5. The three TDFs that matched in the segregation analysis based on cDNA-AFLP patterns were termed as TDF-8, TDF-9 and TDF-27, whose GenBank accession number and sequence are listed below. In the 6 F2 plants, RT-PCR fragments of the expected length were present in only 6 plants with HSYA. TDF-8 (GenBank accession number: EU567303) 118bp. CGATGAGTCCTGAGTAAGCAAGTGTGTTCAGGAATTGTTGAGATATGGGAGGATGCATCAGCAGATTTCCCTATGGATGAGGTAGATC TGGACACCGCTATCAATGGTTTGGAAAATG. TDF-9 (GenBank accession number: EU567305) 450bp. GCCAAAGTTCCCAGCTCCTTGCGGSSCATGAATGCTGGGGCATGCTCCAAAGTTGCTATTTGTTTGGGTAACACAATGGAAGGCTCAT AGTAAATTGCAAAGCTAATTCTAGCATCAACTTTTGGAGCGTTTAGCCACTTGGACAATGTCTGTATAACCACCACAGGAGCATATTTGAA AGATCCTAGGTAATGCATATTCCACCAATCTGCACAAGAAAAGGGCTTGAAAACAAATTCCACGAACGGTTCTATGGCCGGATTCCACTTG TAGTGTTGAATGCCTAACAAACGTCCCAAACTTGAGCCCAAATTTGCGCTTTCATTACCCTCAACGTAACAGACTGCCAACCCTATGCCACA TGTTGGAGCTACCTGACAATTGATCTTACTCAGGACTCATCAGTCATGATGAGTCCTGAGTAAGATCAGGTCCAGAATTGGTACGCTA. TDF-27 (GenBank accession number: EU567304) 282bp. GGAGGATAAAGAGGAGGATCAGGAACTACCAATTGGGGAAGGTCATGTGGAAGAGATTGTTGACGAGTTTTTAACTAATTGCAATAT TTCTGAGCGGAATGATCAACTATCCATTGTGGGAAACGCCAATTACCCATTTGGCCAGGGATTGTATGAGTACGCAACTCGGGTCAGTGAC TCATTACTTGCAGTGATTTCGGGATCAATCAAGAAAGGCATAAATGACTTTTTGGATAAAGTGTACGCAGCTGTGAATCAGATTTTTGCAG CGTGGATGCCCAA.
Fig. 5. The confirmed results of three TDFs in Carthamus tinctorius individuals by RT-PCR. TDF-8, 9, 27 were confirmed in individuals with HSYA. 1–6: results of HSYA present individuals; 7–12: results of HSYA absent individuals.
N. Feng et al. / Biochemical Systematics and Ecology 38 (2010) 971–980
977
Fig. 6. The full length of TDF-8 was presumed to contain a 1257bp open reading frame (ORF), starting with an GTG codon at position 366–368 and terminating with an TAA codon at position 1620–1622, encoding a protein of 419 amino acids.
3.3. The full length of WV-prl obtained by RACE RT-PCR analysis indicated that 3 TDFs were closely associated with HSYA, so the full length of 3 TDFs was cloned, only to achieve TDF-8. The 429 bp and 1858 bp cDNA for TDF-8 were obtained by 50 and 30 RACE, respectively. The full length of TDF-8
978
N. Feng et al. / Biochemical Systematics and Ecology 38 (2010) 971–980
obtained 2315 bp cDNA and was designated as WV-prl (GenBank accession no. GU380344). The sequence of this cDNA and its putative derived protein are shown in Fig. 6. 3.4. Analysis of nucleotide and protein sequence The putative gene function for each sequence was investigated by a similarity search using BLAST Network service. BLAST searches in the NCBI database indicated that 3 sequences were highly homologous (>80%) with known genes. Nucleotide sequence analysis showed that TDF-8 shared high homology with BBWV-2 RNA1 putative RNA polymerase, and that TDF-9 was a homologue of BBWV-2 mRNA. TDF-27 showed great homology with Patchouli Mild Mosaic Virus RNA1 for polyprotein. The full length cDNA of WV-prl was presumed to contain a 1257 bp open reading frame (ORF), starting with an GTG codon at position 366–368 and terminating with an TAA codon at position 1620–1622, encoding a protein of 419 amino acids with a calculated molecular mass of 48011.34D (pI 7.07). Homologous analysis at the protein level showed that WV-prl carried a highly homology (97%) to Broad bean wilt virus. These results indicated that WV-prl was a member of the genus Fabavirus. Broad bean wilt virus is a member of the genus Fabavirus of the family Comoviridae (Fauquet et al., 2005), and contains a cofactor required for proteinase (Co-pro), putative helicase (Hel), genome-linked protein (VPg), proteinase (Pro), and RNA-dependent RNA polymerase (RdRp) conserved domains. Alignments of WV-prl and Broad bean wilt virus2 indicated that WV-prl is of high identity to RdRp, ranging from 1349 bp to 1638 bp (Fig. 7). 4. Discussion Our previous studies showed that sHSP only expressed in HSYA-absent lines and it might be directly or indirectly disturb the HSYA biosynthetic pathway (Tang et al., 2009). The present study further investigated differentially expressed TDFs of
Fig. 7. A. Lines and large boxes represent non-coding sequence and long open reading frames, respectively. Vertical lines through the boxes indicate putative cleavage sites. Calculated relative molecular mass values for each protein and positions of consensus sequences for cofactor required for proteinase (Co-pro), helicase(Hel), genome-linked protein(VPg), proteinase (Pro), and RNA-dependent RNA polymerase(RdRp) are indicated. B. Alignments of CT-cpl and Broad bean wilt virus2.
N. Feng et al. / Biochemical Systematics and Ecology 38 (2010) 971–980
979
interest on the basis of BSA-AFLP analysis, using RACE to get the full-length gene of TDF-8. We compared the differential gene expression patterns between HSYA present and absent segregating bulks. 266 F2 individual identification and RT-PCR validation were also processed. The results showed that the three TDFs were present only in the female parent and in HSYApresent lines, implying that proteins encoded by these fragments may be involved in regulation of HSYA. Homologous analysis of the TDFs sequences generated significant matches to sequence databases. Interestingly, the TDFs were highly homologous with the gene coding protein of Broad bean wilt virus and Patchouli mild mosaic virus. Broad bean wilt virus 1 (BBWV-1), BBWV-2, Patchouli mild mosaic virus (PatMMV) and Lamium mild mosaic virus (LMMV) are four recognized species that compose the genus Fabavirus of the family Comoviridae (Wellink et al., 2000). Fabaviruses have icosahedral virions composed of two coat proteins and bipartite, infecting a wide range of host plants worldwide, including economically important horticultural and ornamental species, and aphid-transmitted in a nonpersistent mode (Vittoria and Guido, 1996). BBWV, in particular, infested a lot of beans, complicated with ring spot, stunting, wilting or withering. Besides, secondary metabolites such as flavonoids could be mobilized to protect the plant from pathogen attacks. Flavonoids are a diverse group of compounds with a wide range of biological effects, especially anti-viral activity against a range of plant viruses, for example, high concentrations of flavonoids in fruits often go parallel with a low incidence by pathogens (Lattanzio et al., 1994; Lattanzio, 2003). Tobacco mosaic virus infectivity was reduced by a range of flavonoids. Quercetin and morin were also reported to prevent the formation of lesion in quinoa effected by potato virus X in a low concentration (1g$mL1) (French and Towers, 1992). Beckman reviewed the possible role of preformed phenolics in periderm formation in wilt disease resistance in a time–space model of host–parasite interactions (Beckman, 2000). The connection between the amount of flavonoids and the degree of wilt-resistance of the plants such as cotton, kenaf was also observed (Navrezova et al., 1986). Flavonoids could inactivate recognition sites on the viral coat protein which interact with host recognition sequences required for the initiation of infection (French and Towers, 1992). However, the replication of viruses was not inhibited by flavonoids treated such as in Tobacco mosaic virus (TMV) situations (Chen et al., 2003). In China, after Chinese soybeans were infested by soybean mosaic virus, the content of flavonoids was significant higher in resistant species than susceptible species (Zhu et al., 2001). All the opinions were supported by Ryder et al. (1987) with the similar conclusion that the CHS gene could be induced by fungus infested and mechanical wounding. It also happened in CHS gene of Phaseolus vulgaris (Mehdy and Lamb, 1987). All the evidence implies that safflower might be infested by BBWV, mosaic virus or other virus or fungus long time ago, which induced the production of HSYA with antivirus activity to inhibit the virus at the moment, but cannot prevent the replication of virus. Finally, safflower allowed the microbe to enter the symbiotic modus and caused systemic acquired resistance (SAR). More interestingly, we also obtained a full length of TDF-8 (WV-prl gene) by RACE that carried a highly homologous sequence (97% identity) to the Broad bean wilt virus from safflower. In conclusion, the study clearly shows various genes involved in HSYA production. Although further clues are needed to understand physiological roles of these genes, the findings obtained suggest that these three genes are absolutely involved in a process of response to some virus infection and functioning in HSYA production. Our work may help elucidate the molecular basis of this pathway and identify more genes closely related to this pathway. Acknowledgments This study was supported by the National Natural Science Foundation of China (30772734), “863” project (2008AA02Z137) grants from the Ministry of Science and Technology of P. R. China. References Albertini, E., Marconi, G., Barcaccia, G., Raggi, L., Falcinelli, M., 2004. Isolation of candidate genes for apomixis in Poa pratensis L. Plant Mol. Biol. 56, 879–894. Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389–3402. Bachem, C.W.B., Van der Hoeven, R.S., de Bruijn, S.M., Verudenhil, D., Zabeau, M., Visser, R.G.F, 1996. Visualization of differential gene expression using a novel method of RNA fingerprinting based on AFLP analysis of gene expression during potato tuber development. Plant J 9, 745–753. Bachem, C.W.B., Oomen, R.J.F.J., Visser, R.G.F., 1998. Transcript imaging with cDNA-AFLP: a step-by- step protocol. Plant Mol. Biol. Rep. 16, 157–173. Barcaccia, G., Varotto, S., Meneghetti, S., Albertini, E., Porceddu, A., Parrini, P., Lucchin, M., 2001. Analysis of gene expression during flowering in apomeiotic mutants of Medicago spp: cloning of ESTs and candidate genes for 2n eggs. Sex Plant Reprod. 14, 233–238. Barnes, S., Peterson, T.G., Grubbs, C., Setchell, K.D.R., 1994. Potential role of dietary isoflavones in the prevention of cancer. In: Jacobs, M.M. (Ed.), Diet and Cancer: Markers, Prevention, and Treatment. Plenum Press, New York, pp. 135–147. Beckman, C.H., 2000. Phenolic-storing cells: keys to programmed cell death and periderm formation in wilt disease resistance and in general defence responses in plants. Physiol. Mol. Plant Pathol. 57, 101–110. Breyne, P., Dreesen, R., Cannoot, B., Rombaut, D., Vandepoele, K., Rambauts, S., Vanderhaeghen, R., Inze, D., Zabeau, M., 2003. Quantitative cDNA-AFLP analysis for genome-wide expression studies. Mol. Genet. Genomics 269, 173–179. Chen, Q.J., Liu, G.K., Wu, Z.J., Lin, Q.Y., Xie, L.H., 2003. The inhibition effect of flavonoids extracted from Bidens pliosa L. on TMV. Journal of Fujian Agriculture and Forestry University 32, 181–184. Dixon, R.A., 2001. Natural products and plant disease resistance. Nature 411, 843–847. Dixon, R.A., Paiva, N.L., 1995. Stress-induced phenylpropanoid metabolism. Plant Cell 7, 1085–1097. Dixon, R.A., Steel, C.L., 1999. Flavonoids and isoflavonoids-a gold mine for metabolic engineering. Trends Plant Sci. 4, 394–400. Fauquet, C.M., Mayo, M.A., Maniloff, J., Desselberger, U., Ball, L.A., 2005. Virus Taxonomy, Eighth Report of the International Committee on Taxonomy of Viruses. Elsevier Academic Press, San Diego. French, C.J., Towers, G.H.N., 1992. Inhibition of infectivity of potato virus X by flavonoids. Phytochemistry 31, 3017–3020. Guo, J., Jiang, R.H., Kamphuis, L.G., Govers, F., 2006a. A cDNA-AFLP based strategy to identify transcripts associated with avirulence in Phytophthora infestans. Fungal Genet. Biol. 43, 111–123.
980
N. Feng et al. / Biochemical Systematics and Ecology 38 (2010) 971–980
Guo, M.L., Jiang, W., Zhang, Z.Z., Zhang, G., Mao, J.F., Yin, M., Su, Z.W., 2003. Randomly amplified polymorphic DNA technique in molecular identification of germplasms of Carthamus tinctorius L. Acad. J. Sec Mil Med. Univ. 24, 1116–1119. Guo, M.L., Zhang, G., Zhang, W., Zhang, H.M., Su, Z.W., 2006b. Determination of Safflor yellow A by RP-HPLC and Resources quality comparison in safflower. China J. Chin. Materia Med. 31, 1234–1236. Hang, L.J., Tang, Y.X., 1995. Study on the chemical component of Cartharmus timctorious. Mod. Appl. Pharm 12, 19–21. Jin, M., Li, J.R., Wu, W., et al., 2004. Study on the antioxidative effect of Safflor Yellow. China J. Chin. Materia Med. 29, 447–449. Krakauer, T., Li, B.Q., Young, H.A., 2001. The flavonoid baicalin inhibits superantigen-induced inflammatory cytokines and chemokines. FEBS Lett. 500, 52–55. Lattanzio, V., 2003. Bioactive polyphenols: their role in quality and storability of fruit and vegetables. J. Appl. Bot. 77, 128–146. Lattanzio, V., Cardinali, A., Palmieri, S., 1994. The role of phenolics in the potsharvest physiology of fruits and vegetables: browning reactions and fungal diseases. Ital J. Food Sci. 1, 3–22. Li, F., He, Z.S., 2002. Flavonoids from Carthamus tinctorius. Chin. J. Chem. 20, 699–702. Mehdy, M.C., Lamb, C.J., 1987. Chalcone isomerase cDNA cloning and mRNA induction by fungal elicitor, wounding and infection. EMBO J. 6, 1527–1533. Meselhy, M.R., Kadota, S., Momose, Y., Hatakeyama, N., Kusai, A., Hattori, M., Namba, T., 1993. Two new quinochalcone yellow pigments from Carthamus tinctorius and Ca2þ antagonistic activity of tinctormine. Chem. Pharm. Bull. 41, 1796–1802. Michelmore, R.W., Paran, I., Kesseli, R.V., 1991. Identification of markers linked to disease-resistance genes by bulked segregant analysis: a rapid method to detect markers in specific genomic regions by using segregating populations. Proc. Natl. Acad. Sci. USA 88, 9828–9832. Murata, J., Bienzle, D., Brandle, J.E., Sensen, C.W., De, Luca V, 2006. Expressed sequence tags from Madagascar periwinkle (Catharanthus roseus). FEBS Lett. 580, 4501–4507. Navrezova, N., Agzamova, M., Stepanichenko, N.N., Makhsudova, B., 1986. Action of the flavonoids quercetin 3-rutinoside and kaempferol 3, 7-dirhamnoside on the biosynthesis of melanin in Verticillium dahliae. Chem. Nat. Comp. 22, 229–230. Ryder, T.B., Hedrick, S.A., Bell, J.N., Liang, X.W., Clouse, S.D., Lamb, C.J., 1987. Organization and differential activation of a gene family encoding the plant defense enzyme chalcone synthase in Phaseolus vulgaris. Mol. Genet. Genomics. 210, 219–233. Sarosh, B.R., Meijer, J., 2007. Transcriptional profiling by cDNA-AFLP reveals novel insights during methyl jasmonate, wounding and insect attack in Brassica napus. Plant Mol. Biol. 64, 425–438. Sato, S., Nojiri, T., Onodera, J.I., 2005. Studies on the synthesis of safflomin-A, a yellow pigment in safflower petals: oxidation of oxidation of 3-C-beta-Dglucopyranosyl-5-methylphloroacetoPhenone. Carbohydr. Res. 340, 389–393. Takahashi, K., Morikawa, A., Kato, Y., Sugiyama, T., Koide, N., Mu, M.M., Yoshida, T., Yokochi, T., 2001. Flavonoids protect mice from two types of lethal shock induced by endotoxin. FEMS Immunol. Med. Microbiol. 3l, 29–33. Tanaka, Y., Tsuda, S., Kusumi, T., 1998. Metabolic engineering to modify flower color. Plant Cell Physiol 39, 1119–1126. Tang, J., Lou, Z.Y., Wang, Y., Guo, M.L., 2009. Expression of a small heat shock protein (CTL-hsyapr), screened by cDNA-AFLP approach, correlated with hydroxysafflor yellow A in Safflower (Carthamus tinctorius L.). BIOCHEM SYST ECOL. Accepted. Vernon, S.D., Unger, E.R., Rajeevan, M., Dimulescu, I.M., Nisenbaum, R., Campbell, C.E., 2000. Reproducibility of alternative probe synthesis approaches for gene expression profiling with arrays. J. Mol. Diagn. 2, 124–127. Vittoria, L., Guido, B., 1996. Fabaviruses: Broad bean wilt virus and allied viruses. In: Harrison, B.H., Murant, A.F. (Eds.), The Plant Viruses. Polyhedral Virions and Bipartite RNA Genomes, vol. 5. Plenum Press, New York, pp. 229–250. Vom Endt, D., Kijne, J.W., Memelink, J., 2002. Transcription factors controlling plant secondary metabolism: what regulates the regulators. Phytochemistry 61, 107–114. Wellink, J., Le Gall, O., Sanfacon, H., Ikegami, M., Jones, A.T., 2000. Family Comoviridae. In: Van Regenmortal, M.H.V., Fauquet, C.M., Bishop, D.H.L., Carstens, E.B., Estes, M.K., Lemon, S.M., Maniloff, J., Mayo, M.A., McGeoch, D.J., Pringle, C.R., Wickner, R.B. (Eds.), Virus Taxonomy: Seventh Report of the International Committee on Taxonomy of Viruses. Academic Press, San Diego, pp. 695–697. Yu, O., Jung, W., Shi, J., Croes, R.A., Fader, G.M., McGonigle, B., Odell, J.T., 2000. Production of the isoflavones genistein and daidzein in non-legume dicot and monocot tissues. Plant Physiol. 124, 781–794. Zang, B.X., Jin, M., Si, N., Zhang, Y., Wu, W., Piao, Y.Z., 2002. Antagonistic effect of hydroxysafflor yellow A on the platelet activating factor receptor. Acta Pharm. Sin. 37, 696–699. Zhang, L., Huang, B.B., Yin, K.G., Guo, M.L., 2006. Analysis of intraspecific variation of Chinese Carthamus tinctorius L. using AFLP markers. Acta Pharm. Sin. 41, 91–96. Zhang, Z.Z., Guo, M.L., Zhang, J.D., 2009. Identification of AFLP fragments linked to hydroxysafflor yellow A in Flos Carthami and conversion to a SCAR marker for rapid selection. Mol. Breed. 23, 229–237. Zhu, H.B., Teng, B., Gao, F.L., Wu, Z.P., 2001. Changes of some biochemical characters of soybean with different resistant levels infected by SMV1. Acta Agriculturae Boreali-occidentalis Sinica 10, 38–40. Zhu, H.B., Wang, Z.H., Ma, C., Tian, J., Fu, F., Li, C., Guo, D., Roeder, E., Liu, K., 2003. Neuroprotective effects of hydroxysafflor yellow A: in vivo and in vitro studies. Planta Med. 69, 429–433.