cDNA cloning and functional expression of KM+, the mannose-binding lectin from Artocarpus integrifolia seeds

Biochimica et Biophysica Acta 1726 (2005) 251 – 260 http://www.elsevier.com/locate/bba

cDNA cloning and functional expression of KM+, the mannose-binding lectin from Artocarpus integrifolia seeds Luis L.P. daSilva a,1, Jeanne Blanco de Molfetta-Machado a, Ademilson Panunto-Castelo b, Jurgen Denecke c, Gustavo Henrique Goldman d, Maria-Cristina Roque-Barreira b, Maria Helena S. Goldman a,* a

d

Depto. Biologia, FFCLRP/Universidade de Sa˜o Paulo, Av. Bandeirantes, 3900 Ribeira˜o Preto, SP 14040-901, Brazil b Depto. Biologia Celular e Molecular e Bioagentes Patogeˆnicos, FMRP/Universidade de Sa˜o Paulo, Av. Bandeirantes, 3900 Ribeira˜o Preto, SP 14049-900, Brazil c Centre for Plant Sciences, Faculty of Biological Sciences, University of Leeds, Leeds LS2 9JT, UK Depto. C. Farmaceˆuticas, FCFRP/Universidade de Sa˜o Paulo, Av. do Cafe´ s/no, Ribeira˜o Preto, SP 14040-903, Brazil Received 19 May 2005; received in revised form 7 September 2005; accepted 11 September 2005 Available online 29 September 2005

Abstract KM+, a mannose-binding lectin present in the seeds of Artocarpus integrifolia, has interesting biological properties and potential pharmaceutical use [A. Panunto-Castelo, M.A. Souza, M.C. Roque-Barreira, J.S. Silva, KM(+), a lectin from Artocarpus integrifolia, induces IL-12 p40 production by macrophages and switches from type 2 to type 1 cell-mediated immunity against Leishmania major antigens, resulting in BALB/c mice resistance to infection, Glycobiology 11 (2001) 1035 – 1042. [1]; L.L.P. daSilva, A. Panunto-Castelo, M.H.S. Goldman, M.C. Roque-Barreira, R.S. Oliveira, M.D. Baruffi, J.B. Molfetta-Machado, Composition for preventing or treating appearance of epithelia wounds such as skin and corneal wounds or for immunomodulating, comprises lectin, Patent number WO20041008. [2]]. Here, we have isolated clones encoding the full-length KM+ primary sequence from a cDNA library, through matrix PCR-based screening methodology. Analysis of KM+ nucleotide and deduced amino acid sequences provided strong evidence that it neither enters the secretory pathway nor undergoes post-translational modifications, which is in sharp contrast with jacalin, the more abundant lectin from A. integrifolia seeds. Current investigations into the KM+ properties are often impaired by the difficulty in obtaining sufficient quantities of jacalin-free KM+ through direct seed extraction. To obtain active recombinant protein (rKM+) in larger amounts, we tested three different expression systems. Expression vectors were constructed to produce: (a) rKM+ in E. coli in its native form, (b) rKM+ with GST as an N-terminal tag and (c) native rKM+ in Saccharomyces cerevisiae. The presence of the GST-tag significantly improved the overall rKM+ yield; however, most of the obtained rGSTKM+ was insoluble. Production of rKM+ in the yeast host yielded the highest quantities of soluble lectin that retained the typical highmannose oligosaccharide-binding properties of the natural protein. The possible biotechnological applications of recombinant KM+ are discussed. D 2005 Elsevier B.V. All rights reserved. Keywords: KM+ or artocarpin; Jackfruit lectin; cDNA cloning; Heterologous expression; Mannose-binding

1. Introduction

Abbreviations: rKM+, recombinant KM+ produced in a heterologous system; jfKM+, KM+ extracted from jackfruit seeds; HRP, horseradish peroxidase glycoprotein; JRLs, jacalin-related lectins; CRD, carbohydrate recognition domain * Corresponding author. Tel.: +55 16 3602 3702; fax: +55 16 3633 1758. E-mail address: [email protected] (M.H.S. Goldman). 1 Present address: Centre for Plant Sciences, Faculty of Biological Sciences, University of Leeds, Leeds LS2 9JT, UK. 0304-4165/$ - see front matter D 2005 Elsevier B.V. All rights reserved. doi:10.1016/j.bbagen.2005.09.006

Lectins are proteins displaying at least one non-catalytic domain, which reversibly binds to specific mono or oligosaccharides [3]. Lectins are known as being an extremely useful tool for carbohydrate investigation on cell surfaces, for glycoproteins isolation and characterization and for lymphocytes polyclonal activation. Numerous lectins have been isolated from many organisms ranging from viruses and bacteria to plants and animals, and they are known to play a

252

L.L.P. daSilva et al. / Biochimica et Biophysica Acta 1726 (2005) 251 – 260

key role in a variety of biological processes (reviewed in [4]). Plant lectins have been used in different biotechnological applications (reviewed in [5]), including recombinant proteins production for therapeutic purposes [6] or for targeted drug delivery (reviewed in [7]). Artocarpus integrifolia (jackfruit) seeds are known to contain two lectins – jacalin and KM+ – that exhibit significantly distinct carbohydrate binding specificities in spite of a high overall structural similarity [8]. Jacalin, the first of these lectins to be isolated [9], binds to d-galactose and its derivative Galh1-3GalNAc [10], a specificity that has given it a broad application in the isolation and detection of mammals O-glycosylated proteins and to selectively interact with human IgA1 from human serum and secretions [11 – 13]. Jacalin is synthesized on the rough endoplasmic reticulum, and after cotranslational cleavage of the signal peptide, the N-terminal propeptide as well as an internal linker peptide are processed, resulting in a a- and h-chain (20 and 133 amino acids, respectively) [14]. As revealed by the immunocytological analysis of jackfruit cotyledons, jacalin accumulates in small punctuate structures distributed throughout the cytoplasm [15], which could be storage vacuoles. However, the exact intracellular sites in which jacalin molecular modifications take place and its transport route within the secretory pathway still have to be elucidated. In the beginning of the last decade, a second lectin was identified in jackfruit seeds as being responsible for the effects that the crude extract from jackfruit seeds has on both T cell proliferation and B cell polyclonal activation [16]. The novel lectin, named KM+ or artocarpin, was isolated and characterized as a neutrophil migration inducer [17], a property attributed to its binding specificity towards d-mannose and d-glucose, but not d-galactose [17,18]. The KM+ primary structure was determined by Rosa et al. [8] as being a polypeptide chain of 149 amino acids sharing 52% identity with the jacalin sequence. The differences between jacalin and KM+ are mainly attributed to the fact that KM+ does not undergo internal post-translational cleavage, preserving a short glycine-rich linker sequence that holds the regions analogous to the jacalin a- and h-chains together [8]. According to molecular modeling and crystal studies, the consequent structural differences account for the distinct carbohydratebinding specificities exhibited by the two lectins [8,19,20], especially when the recognition of d-mannose, but not dgalactose, by KM+ is concerned. Indeed, the best ligands for KM+ are those with N-linked glycans containing the trimannoside core Mana1– 3[Mana1 –6]Man, such as the horseradish peroxidase glycoprotein (HRP) [18]. Recently, a reinvestigation of the KM+ carbohydrate-binding properties revealed its unexpected behaviour as a polyspecific lectin that reacts with a wider range of monosaccharides, although the preferential affinity is for mannose [21]. KM+ has been reported as a tool for multiple biomedical applications, including the induction of neutrophil migration [22,23], degranulation of mast cells [24], induction of IL-12 production by macrophages [1,25] and acceleration of wound healing [2]. However, advances in the studies are often limited

by fruit harvesting and the hard task of purifying large quantities of jacalin-free KM+. Jacalin, which is present in jackfruit seed extracts in approximately 60 times higher concentration than KM+, is a major contaminant in natural KM+ preparations [17], making difficult the interpretation of experiments using this material. The availability of appropriate amounts of homogeneous KM+ is a pre-requisite for reproducible mechanistic studies for a better insight into the lectin mode of action on cells and the evaluation of its pharmaceutical application in extensive pre-clinical models. Considering the KM+ applications and the interest in further exploring the basis of its biological actions at a molecular level, we have aimed at cloning its cDNA and produce the recombinant KM+ to avoid the problems with seed extracts. In this work, the recombinant product has been successfully expressed and purified, its sugar binding characteristics have been compared to those of the plant-derived product, and equivalence has been determined. Differences between KM+ and jacalin at the DNA level and their implications have also been discussed. 2. Materials and methods 2.1. RNA isolation and northern blot analysis Total RNA was isolated from mid-maturation seeds (about 29  18 mm in size) of a jackfruit tree from Brazil. About 6 g of this material was ground in liquid nitrogen and extracted as described in the literature [26]. RNA was separated by electrophoresis on a 1.5% agarose gel containing 2.2 M formaldehyde and transferred to Hybond N+ for 2.5 h, in a vacuum blotter apparatus (Bio-Rad, Hercules, CA, USA), using 10 SSC. For northern analysis, hybridization was performed with a DNA probe in 6 SSC, 5 Denhardt’s solution, 0.5% SDS, and 100 Ag/ml denatured carrier DNA at 50 -C, overnight. Filters were washed at 50 -C, in 6 SSC, 0.5% SDS for 15 min and subsequently in decreasing salt concentrations (2 SSC, 1 SSC, 0.5 SSC and 0.1 SSC) in 0.1% SDS for 30 min. Hybridized filters were exposed to Kodak X-Omat films for the appropriate time period, at 70 -C, in between intensifying screens.

2.2. Construction of a jackfruit seed cDNA library RNA integrity was examined by testing the presence of the jacalin transcript by northern blot analysis before it was used for cDNA synthesis (not shown). The poly(A)+ RNA was isolated by the PolyATract mRNA Isolation System (Promega, Madison, WI, USA), according to the manufacturer’s instructions. A cDNA library was constructed from the mRNA, using the SuperScripti Plasmid System for cDNA Synthesis and Plasmid Cloning (Invitrogen, Carlsbad, CA, USA), which allowed the directional insertion of the cDNA fragments into the SalI and NotI restriction sites of pSPORT-P (Invitrogen). The library was propagated in Escherichia coli DH10B cells (Invitrogen). The cDNA clones were individually transferred to plates of 96 wells containing 2 YT liquid medium, supplemented with 100 Ag/ml ampicillin and 20% glycerol, and stored at 80 -C. The whole cDNA library was organized in a total of 136 plates.

2.3. Screening of the cDNA library by matrix PCR and sequencing of the positive clones A matrix containing ordered pools of the library clones was created in 96well microtiter plates. It was achieved by inoculating a replica from each of the 136 microtiter plates in one master plate, resulting in 96 pools of 136 clones each (Fig. 1, panel B). The matrix plate was then incubated for 4 h at 37 -C with slow shaking to allow further growth of pooled bacteria.

L.L.P. daSilva et al. / Biochimica et Biophysica Acta 1726 (2005) 251 – 260

253

Fig. 1. Screening of the cDNA library via matrix PCR. (A) Schematic illustration of the expected topology of a library clone containing the KM+ encoding cDNA insert. The three positions correspond to the degenerated oligonucleotides 1S, 2S and 3AS within the KM+ cDNA (white bar) and the relative locations of the oligos SP6 and T7 within the plasmid vector (black bar) are illustrated. (B) Screening of positive clones from a library with 1.2  104 clones after only two PCR rounds. The left panel explains how the matrix plate, representing all clones of the library, was generated. The 96 clone pools present in this matrix plate were used as templates in the first PCR round using the pair of oligos SP6 and 3AS. The right panel shows the electrophoretic analysis of the products of the second PCR round, using the oligos T7 and 1S. In the second round, only 28 clone pools, which previously resulted in amplification products of the expected size, were used as template. The position of the clone pools on the matrix plate is indicated above each lane. Only eight of those reactions resulted in amplification, and the two clone pools were chosen to continue the screening (white arrowhead). (C) Elaboration of a second matrix and identification of two positive clones. The left panel illustrates the elaboration of a second matrix, using aliquots of the original 272 clones that formed the two mixtures selected as described in panel B. The right panel shows the results of 36 PCR in which the clone pools of the second matrix were used as template. The result indicates the presence of positive clones in column 1 and lines A* and E* (white arrowheads). Initial library screening was performed by successive PCR amplifications using 1 Al of each matrix pool as templates and the enzyme Taq DNA polymerase (Invitrogen). Three degenerate oligonucleotides were synthesized from KM+ specific regions of the amino acid sequence [8], as follows: oligo-1 sense (1S) 5V[GCGAATTCGARCCNTTYWSNGGNCCNAA]3V, oligo-2 sense (2S) 5V[GCGAATTCAARYTNCCNTAYAARAA]3V, oligo-3 antisense (3AS) 5V[GCGGATCCGCCATATGNACNCCDATNGC]3V, corresponding to the amino acid sequences EPFSGPK, KLPYKN and AIGVHMA, respectively. The above oligos were used on PCRs in different combinations, or with the SP6

promoter primer and the T7 promoter primer (as described in Results). The SP6 primer hybridizes upstream of the SalI site in the pSPORT-P polylinker (5V end of the cDNA inserts), while the T7 primer hybridizes downstream of the NotI site (3V end of the cDNA inserts). The PCRs were performed under the following conditions: initial denaturation at 94 -C for 4 min, followed by 40 cycles of 94 -C for 1 min, 48 -C for 1 min, and 72 -C for 2 min, and then final extension at 72 -C for 10 min. The reaction products were resolved by agarose gel electrophoresis. Clone pools, which resulted in amplification products with the predicted size, were used as templates in a second round of nested PCRs

254

L.L.P. daSilva et al. / Biochimica et Biophysica Acta 1726 (2005) 251 – 260

under the same conditions described above, but using a different primer combination. Further elimination of negative clone pools was possible and only two of these samples were selected to continue the screening. The 136 individual clones represented in each of the two selected clone pools were rearranged into a new matrix for the final screening step (Fig. 1, panel C). The final positive clones were sequenced according to the dideoxynucleotide chain termination method, using Big-Dye chemistry (Applied Biosystems, Foster City, CA, USA) and automated sequencer ABI3100 (Applied Biosystems). DNA and deduced amino acid sequences were analyzed using freely available computer software like Phred/Phrap/Consed and tools accessible from the NCBI (http://www.ncbi.nlm.nih.gov/) and Expasy (http:// us.expasy.org/tools/) sites. The sequence data reported here is available in the GenBank under accession numbers AY957581 and AY957582.

2.4. Southern blot analysis Genomic DNA isolated from A. integrifolia seeds was digested with EcoRI, HindIII and PstI, separated by electrophoresis on a 1% agarose gel [27], and transferred to Hybond N+, according to the alkaline method from the Amersham protocol. Hybridization, subsequent washes and film exposition were essentially the same as described for the northern blot analysis (see above).

the lithium acetate method, as described in the literature [28]. Transformants were selected onto SC/agar minimal medium devoid of uracil (SC-U; 0.67% yeast nitrogen base, 0.072% Dropout mix without URA—Sigma, St. Louis, MO, USA, 2% glucose). Selected transformants were cultured in SC-U medium at 30 -C, overnight, to reach an OD600 of approximately 3. The culture was spun for 5 min at 1500 g, and the supernatant discarded. Cells were resuspended to an approximate OD600 of 0.4 in induction medium (SC-U in which glucose was replaced by 2% galactose and 1% raffinose), and incubated at 30 -C with shaking (250 rpm). After induction, cells were washed in distilled water, and cell pellets were stored at 80 -C. Cell samples harvested at different time-points (0, 4, 8, 16 and 24 h) were analyzed to optimize induction time (not shown). To prepare cell lysates, frozen cell pellets were resuspended in breaking buffer (50 mM sodium phosphate buffer, pH 7.4, 1 mM EDTA, 5% glycerol, 1 mM PMSF), and an equal volume of acid-washed glass beads was added. The mixtures were submitted to 4 sections of 30 s vortex, followed by 30 s ice incubation and, after 10 min centrifugation at 25,000g, the supernatants were isolated and used for subsequent analysis. The higher protein yield necessary to perform the functional assays was obtained by scaling up the procedure described above to 3 l culture. Preparation of cell lysates from high culture volumes was achieved by using a French Press.

2.8. Gel blot analysis 2.5. Expression vectors construction For KM+ expression, the cDNA encoding KM+ from the pLL29 clone was inserted into the pDONR201 entry vector of the Gateway system (Invitrogen), according to the manufacturer’s instructions. For this purpose, the following oligos were used: OL 17 sense 5V [GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGAAGGAGATAGAACCATGGCGAGCCAGACGATAACAGTCGGG]3V, OL 18 antisense 5V[GGGGACCACTTTGT ACAAGAAAGCTGGGTCTAAAGTGCCGTGAACGCCAATAGC]. This allowed the introduction of sites for sequence specific recombination, as well as the addition of optimal translational initiation sites for both eukaryotic and prokaryotic cells (sequences from KM+ are underlined). The PCR reactions were performed under the following conditions: 25 cycles of 94 -C for 30 s, 45 -C for 1 min and 72 -C for 3 min, and then final extension at 72 -C for 10 min. The reaction product was introduced into pDONR201 (Invitrogen) by site specific recombination, yielding pEntryKM+, from which the KM+ coding sequence was transferred to the pDEST14, pDEST15 and pYESDEST52 (Invitrogen) expression vectors, using the LR recombinase. This resulted in the generation of vectors for KM+ expression in E. coli, either in its native form (pExpKM+) or with an Nterminal GST tag (pExpGST-KM+), in addition to a vector for KM+ expression in S. cerevisiae (pYESKM+). All the constructs were confirmed by sequence analysis.

2.6. KM+ expression in E. coli A single E. coli BL21 (SI) colony transformed with either pExpKM+ or pExpGST-KM+ was selected and grown overnight at 37 -C, in LB medium devoid of NaCl and supplemented with ampicillin (100 Ag/ml). The culture was diluted 100 fold into LB medium without NaCl and incubated at 30 -C for 2 h (OD600 å0.5). NaCl was added to a 0.3-M final concentration, and induction was allowed to proceed for increasing time periods, to optimized expression level. Aliquots of 1 ml culture were harvested, and cells expressing rKM+ or rGST-KM+ were pelleted by brief centrifugation. The cell pellet was suspended in 200 Al of 10 mM Tris – HCl (pH 7.5), supplemented with Tosyl Lysyl Chloromethylketone (TLCK) as a protease inhibitor. Cellular proteins were analyzed separately as soluble and insoluble proteins. To extract soluble proteins, the cell suspensions were sonicated and spun at 25,000g for 15 min. The supernatant containing soluble proteins was recovered (S). The resulting pellet, enriched in insoluble proteins and protein aggregates, was resuspended in 200 Al of the same buffer, sonicated, and left in suspension (I).

2.7. KM+ expression in Saccharomyces cerevisiae The pYESKM+ expression vector was used to transform S. cerevisiae cells—strain INVSc1 (MATa, his3-Dl, leu2, trp1-289, ura3-52; Invitrogen) by

For the comparison of the relative rKM+ yield in the different expression systems used, each of the protein extracts obtained as described above was split into two identical aliquots, one of which was immediately frozen after mixing with an equal volume of 2 SDS loading buffer (125 mM Tris – HCl pH 6.8, 4% SDS, 10% glycerol, 0.2% bromophenol blue and 4% beta-mercaptoethanol). The remaining aliquots were used for protein quantification through the use of the Protein Assay kit (Bio-Rad), following the manufacturer’s instructions. To allow the loading of equal protein levels per lane (1 Ag/Al), samples were adjusted to the appropriate dilution by considering their initial protein concentration, using a 50/50 Tris-buffer/SDS loading buffer. After such adjustment, the samples were briefly boiled (5 min at 95 -C). Proteins in SDSPAGE were transferred onto a nitrocellulose membrane and blocked for 1 h with 1% gelatin in TBS (20 mM Tris – HCl, 150 mM NaCl, pH 7.5) containing 0.1% Tween 20. Immunodetections were performed using a 1/1000 dilution rabbit polyclonal anti-KM+ serum, 1/2000 [17,22] alkaline phosphatase-conjugated anti-rabbit IgG antibody (Promega), and nitroblue tetrazolium/5-bromo4-chloro-3-indolyl-phosphate (Gibco-BRL, Rockville, MD).

2.9. Lectin binding assay Each well of a 96-microtiter plate (MaxiSorp FluoroNunc, Roskilde, Denmark) was coated with 100 Al of one of the following proteins (10 Ag/ml in carbonate buffer pH 9.6): (1) KM+ from jackfruit (jfKM+), (2) recombinant KM+ (rKM+), (3) jacalin, or (4) bovine serum albumin (BSA), overnight, at 4 -C. After washing with 0.05% Tween-20 in PBS (PBS-T), the non-specific interactions were blocked with 3% gelatin in PBS-T, at room temperature (RT). After 1 h incubation, the plate was washed and incubated with a 100-Al serial dilution of horseradish peroxidase (HRP, Sigma Chemical Co.) in 1% gelatin in PBS-T, for 2 h at RT. In inhibition assays, the coated jfKM+ or rKM+ reacted with 1 or 10 Ag HRP, respectively, in the presence of different concentrations (from 0.1 to 1000 mM) of d-mannose or d-galactose. The wells were washed, and the bound HRP was detected using H2O2/OPD (ortho-phenylenediamine) as substrate (Abbott Laboratories, Abbott Park, IL, USA). The reactions were stopped by adding 1 N sulfuric acid and the samples were read at 490 nm in a microwell plate reader (Elisa Power Wave X; Bio-Tek Instruments, Inc., Winosky, VT, USA). The binding assays were repeated at least three times.

3. Results 3.1. KM+ cDNA clones isolation by matrix PCR A cDNA library from A. integrifolia seeds with approximately 13  103 clones was produced through the directional

L.L.P. daSilva et al. / Biochimica et Biophysica Acta 1726 (2005) 251 – 260

cDNA insertion into the plasmid vector. Thus, we could predict the orientation of the primer sequences situated in the vector in relation to the three degenerate oligonucleotides designed based on KM+ amino acid sequence (Fig. 1A). This feature allowed us to develop a screening strategy based on successive PCR amplifications in a matrix format using different primer combinations. Three regions were rationally selected to design degenerate oligonucleotides for KM+ amplification to avoid similarities with jacalin. The primer selection was particularly important, considering that there is a 52% primary sequence identity between KM+ and jacalin [8], along with the likely higher incidence of jacalin clones in the library. An ordered mixture of aliquots from each individual library clone was performed, resulting in a template matrix containing 96 pools of 136 clones each (see Materials and methods). For the first screening step, an aliquot of each of the 96 clone pools was used as template for PCR, employing SP6 and 3AS oligonucleotides as primers. This would lead to the amplification of the 5V end of the cDNAs and permit selection of full length clones by size. Only 28 templates resulted in amplification products, allowing the elimination of at least 9  103 negative clones (not shown). The selected templates with amplification products were used in a second PCR round, using the 1S and T7 oligonucleotides as primers. In the latter reactions, only eight of the templates resulted in amplification (Fig. 1B), leading to a further elimination of negative clones. Based on the sizes obtained in the first and the second PCR screen, two pools were chosen for individual analysis. The original 136 clones represented in each of the two selected templates were then rearranged in a new matrix. The ordered mixture of the clones located in the twelve columns and twenty-four lines of the new matrix resulted in 36 clone pools (Fig. 1C), which were templates for PCRs, using the 2S and T7 oligonucleotides as primers. This third nested reaction would exclude any false positives and three pools generated amplification products with the expected size. The latter result allowed us to identify two individual clones by recalling their positions in the matrix and repeating the PCR. These clones were sequenced and confirmed as containing a cDNA sequence encoding KM+ due to their match with the protein sequence previously determined by Rosa et al. [8]. In the last screening of the matrix comprising 272 clones, four jacalin clones were identified, which corresponds to a frequency of approximately 1.5% of the total library (data not shown). This shows that jacalin transcripts are much more abundant compared to KM+ transcripts. The entire cDNA and the deduced amino acid sequence present in one of the isolated clones (pLL29) are shown in Fig. 2A. In Fig. 2B, the primary sequences deduced from both positive clones are compared through alignment with the KM+ amino acid sequence identified in reference [8]. The sequence corresponding to pLL29 displays two amino acid substitutions, both from charged to non-charged residues and the one from pLL30 shows a single amino acid substitution, in which it is identical to the pLL29 sequence. Both clones contain an open reading frame of 507 bp encoding 169 amino acids residues with a likely start codon at position 20 of the deduced amino acid sequence. This hypothesis is strengthened by the presence

255

of sequence 5V[ACCATGG]3V surrounding the codon region for the first amino acid of the mature KM+ [8], which exactly corresponds to the sequence described in references [29,30] as being the optimal context for translational initiation in eukaryotes. Moreover, no signal sequence could be recognized, supporting the notion that KM+ does not enter the secretory pathway. In fact, the absence of signal peptide, no posttranslational processing and cytosolic residence are now believed to be main features of the mannose-specific jacalinrelated lectins, JRLs [31,32]. To gain insight into the KM+ transcript, we performed northern blot analysis, in which mRNA extracted from seeds was probed with the insert from pLL29. A single mRNA band with a size of approximately 750 nucleotides was detected (Fig. 3A), which corresponds to the total length of the cDNA sequences of the identified clones. 3.2. Contrary to jacalin, KM+ is encoded by a small multigene family It has previously been reported that jacalin, the prototype of the galactose-specific JRLs, is encoded by a large family of genes at multiple loci in the A. integrifolia genome [14]. To investigate whether this also occurs with KM+, Southern blot analysis of the genomic DNA extracted from jackfruit seeds was performed. KM+ genes were probed using the cDNA sequence from pLL29. Since a total of four clones encoding full-length jacalin cDNA sequences were also isolated from our library (data not shown), we could use one of these clone inserts to probe jacalin genes. The hybridization pattern obtained for each of the employed probes is clearly distinct. While the jacalin probe produced a great number of bands with different hybridization identities, the KM+ probe revealed a much lower number of bands (Fig. 3B; compare the two panels). Considering the presence of an EcoRI site in the KM+ cDNA sequence, it is likely that two of these bands represent a single gene. In addition, due to the high sequence similarity, there are bands recognized by both probes, however, with different hybridization intensities (Fig. 3B, black arrow-heads). Considering the probable heterozygous condition of jackfruit plants in nature and in the light of our results, the most likely conclusion is that the KM+ gene is present as a small gene family in the A. integrifolia genome, which is in sharp contrast to jacalin. 3.3. Expression of rKM+ in heterologous systems A number of attractive biological effects and the potential for biotechnological and pharmaceutical uses have been reported for KM+ [1,2,22]. However, its isolation from jackfruit seeds and purification from the highly predominant jacalin is time consuming and generally result in low yield. To overcome this limitation, we aimed at establishing a recombinant system capable of producing biologically active KM+ in large quantities. Our first approach was the expression of recombinant KM+ (rKM+) in its native form using E. coli cells—strain BL21 (SI).

256

L.L.P. daSilva et al. / Biochimica et Biophysica Acta 1726 (2005) 251 – 260

Fig. 2. The deduced amino acid sequences of the two isolated cDNA clones present high degree of similarity with the KM+ protein sequence. (A) Nucleotide sequence and deduced amino acid sequence of the cDNA present in the clone pLL29. The methionine at position 20 was assumed as the first amino acid; therefore, the preceding deduced residues are presented in lower case. The sequences corresponding to the degenerated oligonucleotides are shown in bold. (B) Alignment of the deduced amino acid sequences of the two identified KM+ cDNA clones and the KM+ protein sequence [8]. Amino acids that are not identical in the three sequences are shown in bold and the ones not present in the mature protein in italics.

To exploit this system, the entire open reading frame of the cDNA sequence present in the pLL29 clone, starting from the first methionine, was inserted into the pDEST14 expression vector by site-specific recombination (see Materials and methods). After induction with NaCl and incubation for increasing time periods (up to 5 h), the protein expression pattern was monitored via Coomassie blue stained SDS-PAGE analysis. No difference in the expression pattern could be noticed under these conditions when compared with the negative controls of both soluble and insoluble cell fractions (not shown). To test KM+ presence, immunoblots of the different samples were performed using anti-KM+ serum. An extremely low expression level was detected in the samples prepared from induced cells (Fig. 4). In addition, the rKM+ yield was on average three times higher in the insoluble cell fractions in terms of the total loaded protein, as estimated by the SDSPAGE gels scanning densitometry (not shown). To try to increase the rKM+ yield and to expand our tools to optimize rKM+ production, we have tested and compared two other expression systems: (a) E. coli expression of rKM+ with a GST fusion at the N-terminus (rGST-KM+), and (b) S.

cerevisiae (INVSc1 strain) expression of rKM+ in its native form. In these two systems, expression was achieved by introducing the KM+ encoding sequence into the pDEST15 and pYESDEST52 expression vectors, respectively. The expression of KM+ with an N-terminal GST tag resulted in a dramatic increase in the recombinant protein yield. Under the same growth conditions, the rGST-KM+ levels in terms of mass per liter of culture were approximately 40 times higher than the levels of rKM+ after a 4 h induction period, as determined by the SDS-PAGE gels scanning densitometry. However, the 50-kDa fusion protein almost completely accumulated in the insoluble cell fraction (Fig. 4), most likely as inclusion bodies. Although structure and therefore functionality of the protein as an insoluble aggregate is greatly compromised, successful restoration of protein activity through refolding procedures is achievable in several cases [33]. Therefore, this expression system could offer an alternative means to obtain functional rKM+ after GST cleavage. Instead, we decided to test whether rKM+ expression in S. cerevisiae would directly result in higher concentrations of soluble protein. A culture of transformed INVSc1 cells was

L.L.P. daSilva et al. / Biochimica et Biophysica Acta 1726 (2005) 251 – 260

257

This electrophoretical pattern is similar to the one provided by jackfruit KM+ (jfKM+). To evaluate the rKM+ lectin activity, this protein was coated to the wells of a microplate and incubated with different concentrations of HRP, a glycoprotein containing the trimannoside Mana1 –3[Mana1– 6]Man, which is a known ligand for jfKM+. rKM+ was able to bind HRP in a dose dependent manner, leading to a curve parallel to the one provided by jfKM+. Jacalin and BSA coated to the microplate wells were both unable to interact with HRP (Fig. 5A). Although rKM+ was less reactive with HRP than jfKM+, the glycan recognition was very specific, once it was inhibited by D-Man, and not by D-Gal, in a dose dependent manner (Fig. 5B). 4. Discussion 4.1. A fast and sensitive methodology for isolating cDNA clones

Fig. 3. The KM+ gene is present in a low number of copies on the genome. (A) RNA blot analysis of KM+ transcript. Poly(A)+ RNA isolated from A. integrifolia seeds was hybridized with the labeled KM+ cDNA insert of pLL29. A single transcript with size corresponding to approximately 750 nucleotides was detected. (B) Comparative Southern blot analysis of KM+ and jacalin genes. A. integrifolia genomic DNA was digested with the restriction enzymes as indicated on each lane, and hybridized with probes prepared with either KM+ (left panel) or jacalin (right panel) cDNAs clones. Bands highlighted by both probes with different intensities are indicated (black arrowheads).

Two full-length KM+ encoding clones were isolated from a cDNA library through an effective and straightforward screening methodology, in which ordered mixtures of the library clones were directly used as template in three PCR rounds. The successive exclusion of negative clones was achieved by using different combinations of three KM+ degenerated oligonucleotides as primers on matrix PCR amplifications (Fig. 1). There are several advantages to this screening approach. Firstly, it does not require the availability of a probe sequence and/or the manipulation of radioactive material. Secondly, results can be obtained much more quickly than with traditional hybridization-based approaches. In addition, this methodology

induced for a 24-h period, throughout which aliquots were collected and analyzed by SDS-PAGE. After Coomassie staining, a faint band corresponding to a protein of the expected size could be visualized in the soluble cell fraction after an 18-h induction (data not shown). Fig. 4 shows a Western blot analysis comparing the level of recombinant protein production in terms of total cellular protein, yielded by each of the three tested systems. Because the latter system comparatively provided the best soluble rKM+ yield, the S. cerevisiae based system was chosen to proceed with protein purification and functional assays. 3.4. Recombinant KM+ produced in S. cerevisiae is functional The total soluble protein fraction obtained from S. cerevisiae cells expressing rKM+ was submitted to affinity chromatography using a mannose-agarose column. The bound material eluted with D-Man corresponded to 0.15% of the total protein. When analyzed by SDS-PAGE, the D-Man bound fraction showed one broad band only, which corresponded to the 60- to 80-kDa molecular mass range. Such band was shifted to a single 16-kDa sharp band when the sample was heated at 100 -C for 3 min (data not shown).

Fig. 4. The S. cerevisiae based expression system produces a better yield of soluble rKM+. E. coli BL21 cells wild type (control) or transformed with either pExpKM+ or pExpGST-KM+ were induced with 0.3 M NaCl for 4 h, harvested and fractionated to obtain extracts enriched in soluble (S) and insoluble (I) proteins. Similarly, cell extracts enriched in soluble proteins were prepared from untransformed (S ) or pYESKM+ transformed (S+) S. cerevisiae cells, which were cultured in induction medium for 24 h. Before loading, the various cell extracts were equalized with respect to total protein content, allowing the comparison of the relative yield of recombinant protein from each system. An aliquot of KM+ purified from A. integrifolia seeds was also loaded. Following SDS-PAGE, protein gel blot was probed with anti-KM+ serum. The faint rKM+ bands resulting from E. coli cell extracts are indicated by white arrowheads.

258

L.L.P. daSilva et al. / Biochimica et Biophysica Acta 1726 (2005) 251 – 260

set. This was illustrated by the isolation of four full-length jacalin clones by screening only å1/50 of the same jackfruit seed library (data not shown). It is important to mention that the possibility of direct amplification of the cDNA using the degenerate oligos was discarded to avoid mutagenesis of possible isoforms containing sequence dissimilarities within the regions encoded by the oligos. In addition, this method alone would not provide information about the complete sequence of KM+ and its possible post-translational processing. Analysis of nucleotide and deduced amino acid sequences of the KM+ cDNA clones strongly suggests that, in contrast to jacalin, KM+ does not enter the secretory pathway and most likely remains in the cytosol. Mature KM+ appears to be the direct product of primary translation in which the initial methionine was removed and the resulting first amino acid alanine was acetylated. Another interesting difference between these two closely related lectins emerged from comparative Southern blot analysis of the A. integrifolia genomic DNA. Yang and Czapla [14] have provided evidence that jacalin is encoded by a large family of genes, and that the 10– 13 variant amino acids found in the different jacalin identified sequences ([14] and our own data) are most likely derived from independent transcripts. In contrast, the data from Fig. 3B clearly shows a much lower number of hybridization bands for KM+ than for jacalin. Therefore, it is tempting to speculate that KM+ is less represented in the A. integrifolia genome, and that this could possibly explain why a lower number of isoforms of this lectin seems to be present in jackfruit seeds. 4.2. Recombinant KM+ expression in S. cerevisiae is efficient to produce large quantities of functional lectin

Fig. 5. (A) Functionality of rKM+ is revealed by a glycoprotein binding assay. The wells of a microtiter plate were coated with either 1 Ag jfKM+ or 1 Ag yeast rKM+. Coating with jacalin or BSA was used as negative control. Peroxidase, a known specific ligand for KM+, was added in increasing concentrations to the wells. The KM+ binding to peroxidase was revealed with the addition of hydrogen peroxide and o-phenylenediamine. Color development was measured at 490 nm. Data are representative of three independent assays. (B) rKM+ binds to peroxidase through specific carbohydrate recognition. jfKM+ or rKM+ coated the wells of a microtiter plate reacted with optimal concentrations of peroxidase, as determined in A (1 and 10 Ag, respectively), in the presence of increasing concentrations of monosaccharides (d-mannose or d-galactose). d-mannose was able to inhibit the binding of both jackfruit KM+ and yeast rKM+ to peroxidase in a dose specific manner, while d-galactose had no effect on the binding ability. Data are representative of three independent assays.

sensitivity is particularly useful for the screening of cDNA clones derived from mRNAs sharing high homology with more abundantly transcribed ones, which is the case of KM+. Furthermore, the selection of abundant clones using a single pair of specific primers can be achieved after one mere PCR

The growing interest in obtaining jacalin-free KM+ in larger amounts than those typically obtained by direct extraction from jackfruit seeds was an additional motivation for the present work. E. coli remains as the simplest and most cost-effective host for foreign protein expression. Since our findings and data from a previous study [8] demonstrated that KM+ does not undergo post-translational modifications, an E. coli based system was our first choice for rKM+ production. Expression of rKM+ in its native form in the bacterial host was accomplished; however, this system failed to produce satisfactory quantities of recombinant protein within the different tested conditions, reaching a maximum of approximately 1.5 mg per liter of culture, nearly 75% of which as insoluble aggregates. There are several possible explanations for low yield of recombinant protein production in this host system, such as: instability at the mRNA, inefficient translation and proteolytic degradation [34,35]. KM+ has a high amount of glycine residues, 57% of which are encoded by either GGA or GGG. These codons are amongst the least used by E. coli, and can be detrimental to foreign protein synthesis by this host [36 – 38]. Interestingly, glutathione-S-transferase (GST) fusion as an N-terminal tag successfully increased the overall KM+ production level in the same host system and under similar

L.L.P. daSilva et al. / Biochimica et Biophysica Acta 1726 (2005) 251 – 260

conditions used for native expression (Fig. 4). Besides facilitating protein purification, fusion partners, such as GST, are thought to increase protein stability within the host cell by accelerating proper folding and protecting the recombinant protein against protease degradation [39 – 42]. Additionally, the inhibitory effect on translation resulting from rare-codons is thought to be much more pronounced when these are located near the 5V end of the transcript [38,43], which provides an alternative explanation for the positive effect of GST. Nevertheless, despite the substantial increase in recombinant protein yield resulting from this alternative strategy, almost all the produced rGST-KM+ accumulated as insoluble protein. The use of the rGST-KM+ produced in this system as a source of active lectin would implicate on protein solubilization and possibly refolding, as well as GST-cleavage. Therefore, we decided to test an alternative means to directly obtain soluble KM+. Native rKM+ production in the alternative host S. cerevisiae improved in about 8 fold the yield of soluble rKM+ per liter of culture when compared to E. coli, reaching the level of approximately 4 mg/l of soluble rKM+ [2]. Moreover, this system produced not only a good protein yield, but also a functional lectin, since rKM+ was able to bind to HRP, in a dose dependent manner (Fig. 5A). The binding of both lectin forms, jfKM+ and rKM+, to HRP was inhibited by d-mannose, but not by d-galactose (Fig. 5B). Although rKM+ and jfKM+ have the same sugar specificity, the affinity of the former for carbohydrate is about 10 fold lower. Indeed, a 100-fold lower affinity for the specific carbohydrate methyl-a-galactose was demonstrated for the recombinant form of jacalin (another JRL member), in comparison to the native form [44]. The authors suggested that it is due to the lack of proteolytic processing of jacalin molecule in E. coli environment. In the case of rKM+, here reported, we have no noticeable explanation for the 10 times decreased affinity for d-mannose containing glycans, a point that is under investigation by our group. The aims achieved in this study, cDNA cloning and functional expression of KM+, are powerful tools for the study of the previously reported recognition by JRL of glycans containing mannose residues in a1 – 3 and a1 – 6 linkages [18 – 20], like those present in HRP and laminin. The dissection of the surprising KM+ polyspecificity for monosaccharides such as galactose, N-acetyl galactosamine, glucose, sialic acid and N-acetylmuramic acid, and its preferential binding to mannose, as revealed by surface plasmon resonance hapten inhibition experiments [21], will also be aided by the KM+ cDNA cloning and functional expression achieved in this work. The sugar discrimination described by Misquith et al. [18] and Pratap et al. [19] is consistent with molecular modeling studies that provided the basis for the recognition of Dmannose, but not D-galactose, by KM+ [8], and is also in agreement with recent detailed studies on the KM+ (or artocarpin) carbohydrate specificity carried out by comparing crystal structures of KM+ complexed to mannotriose or mannopentose [20]. This demonstrates that the lectin possesses a deep-seated binding site composed of two subsites of interaction with sugar residues. This CRD feature is relevant for the enhancement of KM+ affinity binding to longer

259

oligosaccharides, such as Mana1 – 6[Mana1,3][Xylh1 – 2] Manh1 – 4GlcNAch1 – 4[Fuca1,3]GlcNAc, found in HRP. While the trimannoside core interacts with the primary site through numerous hydrogen bonds, the GlcNAc, Xyl and Fuc residues bind to the secondary site, essentially through van der Waals interactions. These features could explain the high KM+ specificity in the recognition of glycans present in HRP, laminin and cell surfaces glycoconjugates, a question that can be more precisely clarified by taking up selected KM+ point mutations and examining their crystal structures. The detailed understanding of the KM+ sugar binding properties will allow a better application of its relevant pharmaceutical abilities [2], such as the induction of tissue regeneration after burning and the modulation of immune response to intracellular pathogens. Acknowledgements We thank Dr. Els J. M. Van Damme for stimulating discussion. We also thank Ms. Andre´a C. Quiapim and Mrs. Patrı´cia M. Vitorelli for their technical assistance in DNA sequencing, and Mrs. Sandra M.O. Thomaz for technical assistance on lectin purification and binding assays. L.L.P. daSilva, J.B. Molfetta-Machado and A. Panunto-Castelo were supported by fellowships from FAPESP. G.H. Goldman, M.-C. Roque-Barreira and M.H.S. Goldman are indebted to CNPq for their research fellowships. This work was supported by a grant from FAPESP (00/09333-2). References [1] A. Panunto-Castelo, M.A. Souza, M.C. Roque-Barreira, J.S. Silva, KM(+), a lectin from Artocarpus integrifolia, induces IL-12 p40 production by macrophages and switches from type 2 to type 1 cell-mediated immunity against Leishmania major antigens, resulting in BALB/c mice resistance to infection, Glycobiology 11 (2001) 1035 – 1042. [2] L.L.P. daSilva, A. Panunto-Castelo, M.H.S. Goldman, M.C. RoqueBarreira, R.S. Oliveira, M.D. Baruffi, J.B Molfetta-Machado, Composition for preventing or treating appearance of epithelia wounds such as skin and corneal wounds or for immunomodulating, comprises lectin, Patent number WO20041008. [3] W.J. Peumans, E.J.M. Van Damme, Lectins as plant defense proteins, Plant Physiol. 109 (1995) 347 – 352. [4] N. Sharon, H. Lis, History of lectins: from hemagglutinins to biological recognition molecules, Glycobiology 14 (2004) 53 – 62. [5] E.J. Van Damme, W.J. Peumans, A. Barre, P. Rouge, Plant lectins: a composite of several distinct families of structurally and evolutionary related proteins with diverse biological roles, Crit. Rev. Plant Sci. 17 (1998) 575 – 692. [6] T. Hajto´, K. Hostanska, T. Berki, L. Pa´linska´s, F. Boldizsa´r, P. Ne´meth, Oncopharmacological perspectives of a plant lectin (Viscum album Agglutinin-I): overview of recent results from in vitro experiments and in vivo animal models, and their possible relevance for clinical applications, eCAM 2 (2005) 59 – 67. [7] C. Bies, C.M. Lehr, J.F. Woodley, Lectin-mediated drug targeting: history and applications, Adv. Drug Deliv. Rev. 56 (2004) 425 – 435. [8] J.C. Rosa, R. Garratt, L. Beltramini, K. Resing, M.C. Roque-Barreira, L.J. Greene, KM+, a mannose-binding lectin from Artocarpus integrifolia: amino acid sequence, predicted tertiary structure, carbohydrate recognition, and analysis of the beta-prism fold, Protein Sci. 8 (1999) 13 – 24. [9] M.C. Roque-Barreira, A. Campos-Neto, Jacalin: an IgA-binding lectin, J. Immunol. 134 (1985) 1740 – 1743.

260

L.L.P. daSilva et al. / Biochimica et Biophysica Acta 1726 (2005) 251 – 260

[10] M.V. Sastry, P. Banarjee, S.R. Patanjali, M.J. Swamy, G.V. Swarnalatha, A. Surolia, Analysis of saccharide binding to Artocarpus integrifolia lectin reveals specific recognition of T-antigen (beta-D-Gal(1 – 3)D-GalNAc), J. Biol. Chem. 261 (1986) 11726 – 11733. [11] G.L. Hortin, B.L. Trimpe, Lectin affinity chromatography of proteins bearing O-linked oligosaccharides: application of jacalin-agarose, Anal. Biochem. 188 (1990) 271 – 277. [12] S. Kabir, Jacalin: a jackfruit (Artocarpus heterophyllus) seed-derived lectin of versatile applications in immunobiological research, J. Immunol. Methods 212 (1998) 193 – 211. [13] H. Kondoh, K. Kobayashi, K. Hagiwara, T. Kajii, Jacalin, a jackfruit lectin, precipitates IgA1 but not IgA2 subclass on gel diffusion reaction, J. Immunol. Methods 88 (1986) 171 – 173. [14] H. Yang, T.H. Czapla, Isolation and characterization of cDNA clones encoding jacalin isolectins, J. Biol. Chem. 268 (1993) 5905 – 5910. [15] W.J. Peumans, B. Hause, E.J. Van Damme, The galactose-binding and mannose-binding jacalin-related lectins are located in different subcellular compartments, FEBS Lett. 477 (2000) 186 – 192. [16] I.K. De Miranda-Santos, J.O.J. Mengel, M.M. Bunn-Moreno, A. CamposNeto, Activation of T and B cells by a crude extract of Artocarpus integrifolia is mediated by a lectin distinct from jacalin, J. Immunol. Methods 140 (1991) 197 – 203. [17] R. Santos-de-Oliveira, M. Dias-Baruffi, S.M. Thomaz, L.M. Beltramini, M.C. Roque-Barreira, A neutrophil migration-inducing lectin from Artocarpus integrifolia, J. Immunol. 153 (1994) 1798 – 1807. [18] S. Misquith, P.G. Rani, A. Surolia, Carbohydrate binding specificity of the B-cell maturation mitogen from Artocarpus integrifolia seeds, J. Biol. Chem. 269 (1994) 30393 – 30401. [19] J.V. Pratap, A.A. Jeyaprakash, P.G. Rani, K. Sekar, A. Surolia, M. Vijayan, Crystal structures of artocarpin, a Moraceae lectin with mannose specificity, and its complex with methyl-alpha-d-mannose: implications to the generation of carbohydrate specificity, J. Mol. Biol. 317 (2002) 237 – 247. [20] A.A. Jeyaprakash, A. Srivastav, A. Surolia, M. Vijayan, Structural basis for the carbohydrate specificities of artocarpin: variation in the length of a loop as a strategy for generating ligand specificity, J. Mol. Biol. 338 (2004) 757 – 770. [21] A. Barre, W.J. Peumans, M. Rossignol, G. Borderies, R. Culerrier, E.J.M. Van Damme, P. Rouge´, Artocarpin is a polyspecific jacalin-related lectin with a monosaccharide preference for mannose, Biochimie 86 (2004) 685 – 691. [22] L. Ganiko, A.R. Martins, E.M. Espreafico, M.C. Roque-Barreira, Neutrophil haptotaxis induced by the lectin KM+, Glycoconj. J. 15 (1998) 527 – 530. [23] L. Ganiko, A.R. Martins, E. Freymuller, R.A. Mortara, M.C. RoqueBarreira, Lectin KM(+)-induced neutrophil haptotaxis involves binding to laminin, Biochim. Biophys. Acta 1721 (2005) 152 – 163. [24] A.N. Moreno, M.C. Jamur, C. Oliver, M.C. Roque-Barreira, Mast cell degranulation induced by lectins: effect on neutrophil recruitment, Int. Arch. Allergy Immunol. 132 (2003) 221 – 230. [25] C.R. Teixeira, K.A. Cavassani, R.B. Gomes, M.J. Teixeira, M.-C. RoqueBarreira, B.S. Cavada, J.S. Silva, A. Barral, M. Barral-Netto, Lectins potential as adjuvants in immunization against Leishmania amazonensis correlates to induction of inflammation in addition to the capacity to induce IFN-g production, Vaccine (submitted for publication).

[26] C. Dean, P. Van Den Elzen, S. Tamaki, P. Dunsmuir, J. Bedbrook, Differential expression of the eight genes of the petunia ribulose biphosphate carboxilase small subunit multi-gene family, EMBO J. 4 (1985) 3055 – 3061. [27] J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, 2nd edR, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989. [28] F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, K. Struhl, Short Protocols in Molecular Biology, Wiley, New York, 1995. [29] M. Kozak, Structural features in eukaryotic mRNAs that modulate the initiation of translation, J. Biol. Chem. 266 (1991) 19867 – 19870. [30] M. Kozak, Initiation of translation in prokaryotes and eukaryotes, Gene 234 (1999) 187 – 208. [31] E.J. Van Damme, B. Hause, J. Hu, A. Barre, P. Rouge, P. Proost, W.J. Peumans, Two distinct jacalin-related lectins with a different specificity and subcellular location are major vegetative storage proteins in the bark of the black mulberry tree, Plant Physiol. 130 (2002) 757 – 769. [32] H. Tateno, H.C. Winter, J. Petryniak, I.J. Goldstein, Purification, characterization, molecular cloning, and expression of novel members of jacalin-related lectins from rhizomes of the true fern Phlebodium aureum (L) J. Smith (Polypodiaceae), J. Biol. Chem. 278 (2003) 10891 – 10899. [33] H. Lilie, E. Schwarz, R. Rudolph, Advances in refolding of proteins produced in E. coli, Curr. Opin. Biotechnol. 9 (1998) 497 – 501. [34] F. Baneyx, Recombinant protein expression in Escherichia coli, Curr. Opin. Biotechnol. 10 (1999) 411 – 421. [35] F. Baneyx, M. Mujacic, Recombinant protein folding and misfolding in Escherichia coli, Nat. Biotechnol. 22 (2004) 1399 – 1408. [36] J.F. Kane, Effects of rare codon clusters on high-level expression of heterologous proteins in Escherichia coli, Curr. Opin. Biotechnol. 6 (1995) 494 – 500. [37] S.L. Martin, B. Vrhovski, A.S. Weiss, Total synthesis and expression in Escherichia coli of a gene encoding human tropoelastin, Gene 154 (1995) 159 – 166. [38] C. Gustafsson, S. Govindarajan, J. Minshull, Codon bias and heterologous protein expression, Trends Biotechnol. 22 (2004) 346 – 353. [39] D.B. Smith, K.S. Johnson, Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase, Gene 67 (1988) 31 – 40. [40] A.K. Chopra, A.R. Brasier, M. Das, X.J. Xu, J.W. Peterson, Improved synthesis of Salmonella typhimurium enterotoxin using gene fusion expression systems, Gene 144 (1994) 81 – 85. [41] R.B. Kapust, D.S. Waugh, Escherichia coli maltose-binding protein is uncommonly effective at promoting the solubility of polypeptides to which it is fused, Protein Sci. 8 (1999) 1668 – 1674. [42] D.S. Waugh, Making the most of affinity tags, Trends Biotechnol. 23 (2005) 316 – 320. [43] E. Goldman, A.H. Rosenberg, G. Zubay, F.W. Studier, Consecutive lowusage leucine codons block translation only when near the 5V end of a message in Escherichia coli, J. Mol. Biol. 245 (1995) 467 – 473. [44] A.A. Sahasrabuddhe, S.M. Gaikwad, M.V. Krishnasastry, M.I. Khan, Studies on recombinant single chain jacalin lectin reveal reduced affinity for saccharides despite normal folding like native jacalin, Protein Sci. 13 (2004) 3264 – 3273.