- Email: [email protected]
Cell coupling regulates Ins1, Pdx-1 and MafA to promote insulin secretion in mouse pancreatic beta cells
Process Biochemistry 46 (2011) 1853–1860
Contents lists available at ScienceDirect
Process Biochemistry journal homepage: www.elsevier.com/locate/procbio
Cell coupling regulates Ins1, Pdx-1 and MafA to promote insulin secretion in mouse pancreatic beta cells Kai-Chiang Yang a,b,c , Zhi Qi a,d , Goichi Yanai a , Yasumasa Shirouza a , Dai-Hua Lu b , Hsuan-Shu Lee b,e,∗∗ , Shoichiro Sumi a,∗ a
Department of Organ Reconstruction, Institute for Frontier Medical Sciences, Kyoto University, 53 Kawahara-cho, Shogoin, Sakyo-ku, Kyoto 606-8507, Japan Institute of Biotechnology, National Taiwan University, 4F., No. 81, Chang-Xing St., Taipei 106, Taiwan c Research Center for Biomedical Devices, Taipei Medical University, Taipei 110, Taiwan d Department of Histology and Embryology, Nankai University School of Medicine, Nankai University, Tianjin 300071, China e Department of Internal Medicine, National Taiwan University Hospital, Taipei 10002, Taiwan b
a r t i c l e
i n f o
Article history: Received 13 April 2011 Received in revised form 21 June 2011 Accepted 21 June 2011 Keywords: Beta-cell Glucose-stimulated insulin secretion Cell coupling
a b s t r a c t The intracellular contact between pancreatic -cells plays an important role in functional insulin secretion. We propose cell coupling may regulate glucose-stimulated insulin gene expression. MIN-6, a murine -cell line, was cultured on the Lipidure-coat dish for cell clusters formation. The responses to glucosestimulation between monolayers and clusters were compared. The coupling of -cells was evaluated by immunohistochemical (IHC) staining. After the establishment of cell coupling was confirmed, the transcription factors of insulin gene expression were assessed by RT-PCR. Results showed that in addition to secrete insulin in a glucose-regulated manner, MIN-6 clusters had biphasic insulin secretion. Relative to monolayer, clusters have higher stimulation-index and lower constitutive insulin release. IHC staining showed the connexin 36 highly expressed in clusters. Compared with monolayers, the mRNA expression of insulin 1 (Ins1) and homeodomain transcription factor pancreatic/duodenal homebox-1 (Pdx-1) of clusters were downregulated in low glucose level. On the contrary, these gene expressions were upregulated when clusters cultured in high glucose environment. The V-maf musculoaponeurotic fibrosarcoma oncogene homologue A (MafA) was relative highly expressed in clusters under high glucose condition. This study reveals that cell coupling regulates glucose-stimulated insulin gene expression to promote insulin secretion in mouse -cells. © 2011 Elsevier Ltd. All rights reserved.
1. Introduction Although the normal composition of - and non -cells is not necessary for successful islet transplantation [1], it is well demonstrated that the communication between pancreatic -cells is essential for normal insulin secretion [2]. The intracellular contact is purposed to coordinate the functions of -cells by homogenizing and synchronizing cells activities. This coordination is mediated by junctional structures and cell adhesion molecules. Generally, the -cells are coupled by gap junction channels which are composed of connexin 36 (Cx36) [3]. This gap junction may allow -cells to exchange cytoplasmic molecules, ensure electrical coupling, and
∗ Corresponding author. Tel.: +81 75 751 4866; fax: +81 75 751 4145. ∗∗ Co-corresponding author at: Institute of Biotechnology, National Taiwan University, Department of Internal Medicine, National Taiwan University Hospital, No. 7, Chung Shan S. Rd., Taipei 10002, Taiwan. Tel.: +886 2 2312 3456x65194; fax: +886 2 3366 6001. E-mail addresses: [email protected] (H.-S. Lee), [email protected] (S. Sumi). 1359-5113/$ – see front matter © 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.procbio.2011.06.018
promote insulin secretion [4]. Some cell adhesion molecules such as integrins and cadherins are also reported to influence insulin secretion in islets [5–7]. Isolated -cells have been reported have heterogeneous insulin secretory activity [4]. Recent studies further provide convincible evidences that the beta cell-to-cell signaling is not only crucial for the insulin secretion but also for the regulation of the biosynthesis and storage of insulin [8]. In some diabetic animals, the islet cytoarchitecture is disturbed because of the ␣ and ␦-cells intermingle in -cells, which implicates the perturbation of cell-to-cell contact could be possible pathology in diabetes [9]. The separated -cells lost the intracellular communication display alterations in insulin secretion [10]. The deficiency of Cx36 leads to uncoordinated calcium signaling between -cells, arrhythmic insulin release and high basal insulin secretion in mouse [11,12]. Moreover, the loss of communication desynchronizes -cells subsequently results in the secretory defects that echo the observation in human pre-diabetes, type 1, and type 2 diabetics [12]. These findings show that the perturbation of cell-to-cell contact influences the normal functions of -cells seriously [13].
1854
K.-C. Yang et al. / Process Biochemistry 46 (2011) 1853–1860
Fig. 1. (a) MIN-6 cells cultured on a TCPS dish (40×). (b) Cell formed clusters on the Lipidure-coat dish after 7 days culture (40×). The phase contrast images: (c) monolayer cells (40×) and (d) cell cluster (40×). (e) Size distribution of clusters cultured for 7 days.
All previous studies revealed that intracellular contact between -cells, which mediated by Cx36, plays an important role in insulin secretory activity [3–13]. However, most of current studies demonstrated the influences of cell coupling to insulin secretion only. In here, we propose the cell coupling may also regulate glucosestimulated insulin gene expression. The expressions of Ins1, Pdx-1, MafA, NeuroD1, and Nkx2.2 were analyzed. These transcription factors have important role in pancreas development, and also regulate each other precisely in a coordinated and synergistic manner to control insulin gene expression in adult [14]. In order to prevent the paracrine effects of ␣- and ␦-cells to -cells [15], a reliable pancreatic beta cell-lines was needed. MIN-6 cell has been reported to secrete insulin in a glucose-regulated manner [16]. On the contrary, in spite of maintaining the ability of insulin secretion, most of other beta cell-lines lose the function of responding glucose stimulation [17]. This responsiveness to glucose stimulation makes MIN-6 a considerable cell source for diabetic researches;
and it has been used extensively in the study of insulin secretion mechanisms [18–20].In this study, MIN-6 cells were cultured on Lipidure-coat dish, which is typically used for forming embryoid body [21]. The transcription factors implicated the regulation of insulin gene expression were analyzed after cell aggregates formation. The purpose of study was to demonstrate the influences of -cells coupling to glucose-stimulated insulin gene expressions. 2. Materials and methods 2.1. MIN-6 cell culture and cell morphology observation Mouse -cell line, MIN-6, is a generous gift from Prof. Miyazaki (Department of Nutrition and Physiological Chemistry, Graduate School of Medicine, Osaka University). Cells were cultured in the tissue culture polystyrene (TCPS) dishes (353003, Falcon, USA) in high glucose DMEM (12100-061, Gibco, USA) supplemented with 5 l/l -mercaptoethanol (21985-023, Gibco, USA), 1% penicillin–streptomycin (15240-062, Gibco, USA) and 10% FBS (15622-029, Gibco, USA) in an incubator set at 5% CO2 and 37 ◦ C.
K.-C. Yang et al. / Process Biochemistry 46 (2011) 1853–1860
1855
Fig. 2. (a) The survival rate of MIN-6 clusters was 89.2 ± 5.7% at day 1 (100×) and (b) 86.8 ± 6.7% after 7 days culture (100×). (c) The survival rate of mouse islet was 85.6 ± 7.3% at day 1 (100×), and (d) central necrosis was observed with a survival of 23.1 ± 11.4% at day 7 (100×). For cell cluster forming, MIN-6 cells (passage 28–31) were detached from TCPS dishes by trypsin–EDTA (15400, Gibco, USA), re-suspended in DMEM at a density of 5 × 106 cells/ml, seeded to the Lipidure-coat dish (A-60D, 51011614, NOF Corporation, Japan), and cultured for 7 days. The cell morphology was observed with an optical microscope and the images were recorded daily.
monolayers and clusters were extracted (A1120, Wizard Genomic DNA Purification Kit, Promega, WI, USA). The DNA content of monolayers was quantified by a UV–vis (Ultrospec 3000 pro UV/Visible Spectrophotometer, GE Healthcare) to normalize the cell number of clusters. This test was done in four replicates. 2.5. Glucose-stimulated insulin secretion and stimulation-index
2.2. Size distribution of the MIN-6 cell clusters By the 7th day of culture, the MIN-6 clusters were stained with 1% dithizone (D5130, Sigma–Aldrich, USA) in dimethyl sulfoxide to estimate cluster numbers and size under an optical microscope. The diameter of cell clusters was determined by measuring the length and width of the cell aggregates. Clusters less than 20 m in diameter and faintly stained clusters were ignored. The size of clusters was arranged into seven groups: smaller than 50, 50–100, 100–150, 150–200, 200–250, 250–300, and larger than 300 m. 100 clusters were harvested from one culture dish and six independent dishes were used for analysis. 2.3. Cell survival The cell clusters underwent live-dead staining (QIA76, Calbiochem, Merck, Darmstadt, Germany) to identify the cell survival after being cultured for 1 and 7 days. After treatment, clusters were observed through a fluorescent microscope (IX70, Olympus, Japan). Each fluorescent dot represents one cell, and the live/dead cell ratio was determined by dividing the number of live cells (green dot) by the sum of live (green dot) and dead cells (red dot). Six images were chosen randomly from independent culture dishes, and one image may have more than 2 clusters. Totally 12 clusters were counted to estimate the average live/dead cell ratio. For comparative purpose, mouse islets were isolated according to methods in the previous study and cultured in the CMRL-1066 medium [22]. Mouse islets were underwent identical staining procedure as cell clusters. 2.4. Cell response to different concentration of glucose The responses of MIN-6 monolayers and clusters to different levels of glucose were compared. RPMI-1640 medium (11879, Gibco, USA) supplemented with 0.5% BSA (15622-029, Gibco, USA) and different glucose contents were prepared (0, 6.25, 12.5, 25, 50, 75, 100, 150, 200, and 250 mg/dl). MIN-6 monolayers and clusters were cultured in RPMI-1640 medium without glucose for 1 h, and then cultured in media with varied glucose concentration for another 1 h. Finally, the culture media were collected at the end of test period and the total insulin content was determined by a mouse ELISA assay (AKRIN-011H, Shibayagi, Japan) with a microplate reader (iMarkTM , BIO-RAD, CA, USA) at the wavelength of 450 nm. The total DNA of MIN-6
MIN-6 monolayers and clusters were cultured in the RPMI-1640 medium containing 60 mg/dl for 1 h before cultured in medium containing 300 mg/dl for another 1 h at 37 ◦ C. The medium was collected every 5 min and the insulin content was analyzed. The static glucose stimulation-index was calculated by dividing the total insulin secretion from the high glucose incubation period by the total insulin secretion during low glucose incubation period. 2.6. Immunohistochemical examination for connexin 36 MIN-6 monolayers and clusters were fixed in 10% neutral buffered formalin for 10 min. The samples were first incubated with 10% blocking serum (sc-2044, Santa Cruz Biotechnology, USA) for 20 min to suppress non-specific binding of IgG. Then the samples were incubated with primary anti-Cx36 antibody (sc-14904, Santa Cruz Biotechnology, USA) for 2 h. The localization of antigen was indicated by a FITC fluorochrome (sc-2024, Santa Cruz Biotechnology, USA). Samples were further stained with DAPI (sc-3598, Santa Cruz Biotechnology, USA) for 10 min and examined by a fluoresce microscope. The relative expression of Cx36 was defined as the FITC area divided by the DAPI area. Eight images were chosen randomly from monolayer and cluster group to estimate the average expression ratio. 2.7. RNA extraction and RT-PCR of MIN-6 cells MIN-6 monolayers and clusters were cultured in the RPMI-1640 medium with 25 or 250 mg/ml glucose for 1 h. Total RNA was then extracted (PureLinkTM RNA Mini Kit, 12183-018A, Invitrogen, CA, USA), and RNA yield was quantified using a UV–vis. The cDNA was synthesized from RNA using a PrimeScript RT-PCR kit (RR014A, Takara, Shiga, Japan) by a RT-PCR machine (iCycle, BIO-RAD, CA, USA). The cDNA was stored at −80 ◦ C until further analyses. Insulin 1 (Ins1), homeodomain transcription factor pancreatic/duodenal homebox-1 (Pdx-1), V-maf musculoaponeurotic fibrosarcoma oncogene homologue A (MafA), neurogenic differentiation 1 (NeuroD1), and homeobox protein Nkx2.2 (Nkx2.2) were chosen as target genes (primer sequences are listed in Table 1). Actin was amplified as an endogenous control and distilled water was included as a negative control. The PCR amplification included 2 l primer solution, 4 l cDNA, and 9.25 l PCR Mix (RR001A, Takara, Shiga, Japan) supplemented with distilled
1856
K.-C. Yang et al. / Process Biochemistry 46 (2011) 1853–1860
Table 1 The primer design for RT-PCR. Genbank number
Forward and reverse primer sequence
Size
Ins1
NM 008386.3
164
Pdx-1
NM 008814.3
MafA
NM 194350.1
NeuroD1
NM 010894.2
Nkx2.2
NM 010919.2
-Actin
NM 007393.3
TGGAGCTGGGAGGAAGCCCC ATTGCAAAGGGGTGGGGCGG CAAAGCGATCTGGGGTGGCGT CGCTGAACTCTGGCACCGGG CTGCTGCGGCCTATGAGGCC GCACGTGGTGGCCTGCGC ACAGCGAGAGCGGGCTGATG TTGTCCAGCGCCGCGTTCAG AGAGCCCTCGGCTGACGAGT CAGAGGCGTCACCTCCATACCTTT TAGGCACCAGGGTGTGATGG CATGGCTGGGGTGTTGAAGG
194 213 355 280 283
Insulin1 (Ins1); Homeodomain transcription factor pancreatic/duodenal homebox1 (Pdx-1); V-maf musculoaponeurotic fibrosarcoma oncogene homologue A (MafA); Neurogenic differentiation 1 (NeuroD1); NK homeobox-2.2 (Nkx2.2).
water to the final volume of 30 l. After a 5 min start at 94 ◦ C, the amplification was carried out in the PCR machine for 30–32 cycles (30 for Pdx-1, NeuroD1 and Nkx2.2; 31 for Ins1, and MafA; and 32 for -actin), each cycle comprising 20 s at 94 ◦ C, 30 s at 58 ◦ C, and 1 min at 72 ◦ C. A final cycle comprised 5 min at 72 ◦ C. The amplified DNA fragment were separated on a 2% agarose gel and stained with 0.5 mg/ml ethidium bromide. The densitometric analysis of the gels for 4 independent experiments was performed with the ImageJ software. 2.8. Statistical analysis All data were expressed as mean ± SEM. Statistical analyses of cell survival, static glucose stimulation-index, relative expression of Cx36, and densitometric analysis of PCR were analyzed by one-way ANOVA. Cell response to different concentration of glucose and glucose-stimulated insulin secretion were analyzed by two-way ANOVA. Difference was considered significant when p-value was less than 0.05.
3. Results 3.1. MIN-6 cell cluster and size distribution The MIN-6 cells displayed an epithelial morphology when cultured on the TCPS culture dish (Fig. 1a, 40×). On the contrary, MIN-6 cells suspended with round-shape appearance when cultured on the Lipidure-coat dish after 7 days culture (Fig. 1b, 40×). The phase contract images clear showed that cells aggregated as clusters with varied sizes opposite to monolayers (Fig. 1c and d, 40×). The size distribution of clusters is arranged in Fig. 1e; the diameter of most clusters was in the range of 50–100 m at day 7.
Fig. 3. (a) Insulin secretion of MIN-6 monolayers and clusters in a glucose-regulated manner. (b) MIN-6 clusters showed a biphasic secreting pattern which is composed by the first phase with a peak at 5 min, and the second phase showed gradually increasing insulin secretion (stimulation-index: 4.28 ± 0.65). Monolayers showed a similar secreting fashion (stimulation-index: 2.13 ± 0.41) with a lag of peak point in first phase and a lower stimulation-index (4.28 ± 0.65 for clusters and 2.13 ± 0.41 for monolayers).
when cultured in high glucose media (150, 200, 250 mg/dl; n = 6, p < 0.05). 3.4. Glucose-stimulated insulin secretion and stimulation-index
3.2. Cell survival The survival of MIN-6 clusters was 89.2 ± 5.7% at day 1 and 86.8 ± 6.7% after 7 days culture, there was no significant difference (n = 12, p > 0.05) between day 1 and 7 (Fig. 2a and b, 100×). Mouse islets had a survival of 85.6 ± 7.3% at day 1 (Fig. 2c, 100×). However, central necrosis with significantly lower survival (23.1 ± 11.4%; n = 12, p < 0.05) was observed at day 7 (Fig. 2d, 100×). 3.3. Cell response to different concentration of glucose The MIN-6 monolayers secreted insulin in a glucose-regulated manner, the amount of secreted insulin increased as the glucose contents in medium (Fig. 3a). The MIN-6 clusters also secreted insulin in a similar fashion as monolayers. However, compared with monolayers, a decreasing insulin secretion was observed when clusters cultured in media with low glucose contents (0, 6.25, 12.5, and 50 mg/dl; n = 6, p < 0.05). The insulin secretion of MIN-6 clusters was significantly higher than that of monolayers
MIN-6 clusters secreted low amounts of insulin at 60 mg/dl glucose medium. As changing to 300 mg/dl glucose medium, the clusters secreted high level of insulin (Fig. 3b). A biphasic secreting pattern was observed which is composed by the first phase with a peak at 5 min, and the second phase showed gradually increasing insulin secretion. MIN-6 monolayers showed a similar secreting fashion with a lag of peak point in first phase and a lower stimulation-index (5.12 ± 0.75 for clusters and 2.84 ± 0.59 for monolayers; n = 6, p < 0.05). 3.5. Immunohistochemical staining The Cx36 proteins were expressed rarely in monolayers (Fig. 4a, 200×); some cell–cell contacts showed positive staining weakly. For the MIN-6 clusters, the Cx36 proteins were relative highly expressed (Fig. 4b, 200×). Fig. 4c showed the expression ratio of Cx36 (FITC) to cell number (DAPI), cluster group had a significantly higher ratio than monolayer group (n = 8, p < 0.01).
K.-C. Yang et al. / Process Biochemistry 46 (2011) 1853–1860
1857
Fig. 4. (a) Confluent cell monolayers formed and the Cx36 proteins were rarely expressed in monolayers (FITC for Cx36 and DAPI for nucleus, 200X). (b) The MIN-6 cluster expressed Cx36 proteins strongly (FITC for Cx36 and DAPI for nucleus, 200×). (c) The relative expression of FITC/DAPI in clusters was significantly higher than that of monolayers (n = 8, p < 0.01).
3.6. Glucose-regulated gene expression Regarding to monolayers cultured in low glucose condition, the RT-PCR amplification of cells RNA revealed that transcripts for Ins1, Pdx-1 and NeuroD1 were abundant under high glucose medium (Fig. 5a). However, compared the RNA expression between monolayers and clusters, the lower expression levels for Ins1, and Pdx-1 were found in the clusters under low glucose condition (Fig. 5b, p < 0.05). Relative to monolayers, these expressions were upregulated significantly when clusters cultured in high glucose medium (p < 0.05 for Pdx-1; p < 0.01 for Ins1). The MafA expressed weakly both under low and high glucose conditions in monolayers, and also expressed weakly in clusters under low glucose condition. For clusters, the expression of MafA was significantly stronger (p < 0.01) under high glucose condition. The NeuroD1 was upregulated with significant differences (p < 0.05) under high glucose condition both for monolayers and clusters. The NeuroD1 expression of clusters was significantly higher than that of monolayers (p < 0.05) under low glucose condition; however, no significant difference was observed between monolayers and clusters under high glucose condition (p > 0.05). For Nkx2.2, there was also no significant difference between monolayers and clusters under low and high glucose conditions (p > 0.05). 4. Discussion Although the differences between species in islet cytoarchitecture have been described, the cell-to-cell contact is crucial for insulin secretion [23]. In addition to homogenize and synchronize -cells activities, the influence of cell coupling to glucosestimulated insulin gene expressions was further demonstrated in
this study. First, the contacts between -cells were established using a Lipidure-coat dish. MIN-6 cells displayed totally different morphology when cultured on lipidure, which was most cells suspending and aggregating as clusters in the range of 50–100 m (Fig. 1e). The cell number of clusters was estimated based on the total DNA of clusters relative to monolayers; a cell cluster in the size of 50–100 m has 800–1800 cells. Hypoxia-induced central necrosis is a familiar problem for islets after long term culturing; this phenomenon was also observed in mouse islets in this study [24]. Oppositely, MIN-6 clusters had high survival after 7 days culture (Fig. 2) and even 14 days culture (data not shown), revealing that oxygen/nutrient accessed by passive diffusion was adequate to maintain the cell survival within clusters. Luther et al. reported the forming of clusters influences proliferative marker expression. The clusters were not necrotic, although the apoptosis were upregulated [25]. Regarding the possibility of oxygen level influencing insulin secretion, a pervious study demonstrated that low oxygen tension reduced the amount of insulin releasing [26]. Moreover, islet cells require high oxygen tension to survival and function, and hypoxia has deleterious effect to islet cells [27]. Therefore, the difference in oxygen tension between monolayers and clusters shall not attribute to the enhancing insulin secretion. The responses of MIN-6 monolayers and clusters to media were varied in different contents of glucose, monolayer cells secreted insulin under low glucose levels, and the amounts of insulin increased in a dose-dependent fashion (Fig. 3a). Interestingly, when cell clusters forming, there was a decrease in basal insulin secretion under low glucose conditions. In contrast, the insulin secretion in clusters was higher than monolayers when the glucose level was higher than 100 mg/dl. Concerning the results
1858
K.-C. Yang et al. / Process Biochemistry 46 (2011) 1853–1860
Fig. 5. (a) The results of RT-PCR for monolayers and clusters under low and high glucose conditions. (b) The densitometric analysis of RT-PCR lower levels for transcripts for Ins1 and Pdx-1 were found in the clusters under low glucose condition, these expressions were upregulated when clusters cultured in high glucose level medium. MafA highly expressed in clusters under high glucose condition. The NeuroD1 was upregulated with significant differences under high glucose condition both for monolayers and clusters. The expression of Nkx2.2 was not affected when cell cluster formation revealed that the Ins1 and Pdx-1 expression of clusters were significantly higher than that of monolayers under high glucose condition (p < 0.05 for Pdx-1; p < 0.01 for Ins1). For clusters, the expression of MafA was significantly stronger (p < 0.01) at high glucose medium. There was no significant difference between monolayers and clusters under high glucose condition (p > 0.05) for NeuroD1. For Nkx2.2, there was no significant difference (p > 0.05) between monolayers and clusters under low and high glucose conditions.
of glucose-stimulated insulin secretion, the biphasic secreting pattern was first reported in MIN-6 clusters, which is a typical fashion in fresh-isolated islets (Fig. 3b). The disturbances in biphasic secreting pattern was an early feature that reported in Type II diabetes, and we speculate the phenotype of MIN-6 clusters is more similar to normal islets [28]. In spite of MIN-6 monolayers also showed similar secreting pattern, the stimulation-index for clusters was higher than that of monolayers significantly. After establishing the different responses to glucose stimulation between clusters and monolayers, the glucose-stimulated insulin gene expressions were analyzed. Pdx-1, an important mediator for embryonic development of the pancreas, is also a major regulator of glucose-stimulated insulin gene transcription [29]. For the cell clusters, the Pdx-1 was downregulated when compared with that of monolayers under low glucose condition (Fig. 5b). The expression of Pdx-1 was upregulated for clusters under high glucose level. We assume this may attribute to the cell clusters established cellto-cell contact that coordinates insulin secretion. This point of view could be approved by the expression of Ins1, and further verified
by the expression of gap junctional protein Cx36. In spite of confluent cell monolayers formed, the monolayers had weak expression of Cx36 which reveals the cell–cell contact should be limited that could not homogenize or synchronies cells activities (Fig. 4c). Nlend et al. also demonstrated that cell-cell contact is required but not sufficient to ensure -cell function [30]. On the contrary, the Cx36 proteins were highly expressed in clusters. The gap junction channels may exchange ions, such as intracellular calcium and second messengers, to contribute to the coordination of insulin secretion in clusters. It is reported the loss of Cx36 results in impaired electrical coupling, desynchronization of Ca2+ oscillations and alters insulin release of -cells [18]. Therefore, the improvement of insulin secretion in clusters may attribute to the establishment of Cx36 gap junction. A pervious study also reported this ameliorating responsiveness of MIN-6 clusters may attribute to the E-cadherin since the glucose evoked a Ca2+ influx in only a small fraction of the monolayers but >80% in clusters [31]. Pdx-1 is reported to regulate the transcription of MafA [32]. Other studies also showed the expression of MafA itself is glucosestimulation responsible [33]. Transcription of MafA is only induced under high glucose level, whereas MafA transcription is downregulated in low glucose condition [34]. The finding in this study is consistent with the above reports: the MafA was upregulated under high glucose level in clusters; MafA expressed weakly in monolayers under both high and low glucose conditions (Fig. 5b). The downregulated expression of MafA also provides a possible clue for the decreasing basal insulin secretion for clusters under low glucose condition. The decreased expression and proteasomal degradation of MafA may inhibit insulin transcription rapidly under low glucose conditions [14]. NeuroD1 is related to the regulation of insulin and glucagon gene expression and it was found in both the developing and adult pancreas [35,36]. NeuroD1 modulates the expression of genes such as neuronatin which is an ion channel transporter, and Sur1 that forms potassium channels with Kir6.2, to regulate insulin secretion [37,38]. The expression of NeuroD1 was upregulated under high glucose condition both for monolayers and clusters (Fig. 5b). NeuroD1 also regulates insulin exocytosis by directly inducing the expression of genes involved in exocytosis [39]. Despite there is no significant difference between monolayers and clusters under high glucose environment, clusters showed relative high NeuroD1 expression under low glucose level. The cell aggregate may upregulate the expression of NeuroD1. However, in spite of the high NeuroD1 expression, clusters still secreted relative low insulin under low glucose condition. The low Ins1 and Pdx-1expressions for clusters shall attribute to this result. Moreover, the upregulated NeuroD1 at high glucose condition may explain both monolayers and clusters secreted high level insulin. Nkx2.2 has a critical role in the maintenance of normal islet structure and insulin gene activity in mice [40,41]. The expression of Nkx2.2 was not affected when cells forming aggregates and this may benefit the long-term function of clusters. To summarize the results of glucose-stimulated insulin gene expressions, Ins1, Pdx-1, NeuroD1, and MafA were upregulated in clusters under high glucose environment. The Pdx1 binds to the A3 element and the NeuroD1 binds to the element of insulin gene, and the MafA also functions as a potent transactivator for the insulin gene [42]. The upregulation of MafA together with Pdx-1 and NeuroD1 markedly induces insulin biosynthesis. Therefore, we conclude the formation of cell aggregates regulates insulin-related gene expressions to improve insulin secretion at high glucose level. Regarding the finding of this study, islets isolated from donor were cultured in non-treat TCPS dishes overnight before transplantation in clinic currently. However, 15–20% islets lost integrity during this culture period. It is well demonstrated that the coating-substrates on culture dishes influence cells morphology
K.-C. Yang et al. / Process Biochemistry 46 (2011) 1853–1860
and subsequently determine cells behaviors extremely [43]. Therefore, we consider that the result of this study may provide an alternative substrate for islet culture and may benefit the islet transplantation. In summary, the formation of pancreatic -cell clusters influence the insulin gene expression. Relative to monolayer, clusters has higher stimulation-index and lower constitutive insulin release. Besides, Cx36 protein plays an important role in the regulating pathway. In low glucose condition, the RNA expressions of clusters showed that most genes previously activated in monolayers were downregulated. The expressions of Ins1, Pdx1 and MafA were further upregulated for clusters under high glucose environment. This study reveals that cell coupling regulates glucose-stimulated insulin gene expression to promote insulin secretion in mouse -cells. Author contributions Kai-Chiang Yang: Participated in research design, research performing, data analysis, and paper writing. Zhi Qi: Participated in research design and research performing. Goichi Yanai: Participated in research design and research performing. Yasumasa Shirouza: Participated in research performing and data analysis. Dai-Hua Lu: Participated in data analysis and paper writing. Hsuan-Shu Lee: Participated in research design, data analysis and paper writing. Shoichiro Sumi: Participated in research design, data analysis and paper writing. Conflict of interest statement There are no conflicts. Acknowledgement Kai-Chiang Yang thanks the Takeda Science Foundation for supporting the postdoctoral fellow program in Kyoto University. References [1] King AJ, Fernandes JR, Hollister-Lock J, Nienaber CE, Bonner-Weir S, Weir GC. Normal relationship of beta- and non-beta-cells not needed for successful islet transplantation. Diabetes 2007;56:2312–8. [2] Bavamian S, Klee P, Britan A, Populaire C, Caille D, Cancela J, et al. Islet-cell-tocell communication as basis for normal insulin secretion. Diabetes Obes Metab 2007;9:118–32. [3] Charpantier E, Cancela J, Meda P. Beta cells preferentially exchange cationic molecules via connexin 36 gap junction channels. Diabetologia 2007;50:2332–41. [4] Wojtusciszyn A, Armanet M, Morel P, Berney T, Bosco D. Insulin secretion from human beta cells is heterogeneous and dependent on cell-to-cell contacts. Diabetologia 2008;51:1843–52. [5] Bosco D, Rouiller DG, Halban PA. Differential expression of E-cadherin at the surface of rat -cells as a marker of functional heterogeneity. J Endocrinol 2007;194:21–9. [6] Rogers GJ, Hodgkin MN, Squires PE. E-cadherin and cell adhesion: a role in architecture and function in the pancreatic islet. Cell Physiol Biochem 2007;20:987–94. [7] Kaido T, Yebra M, Cirulli V, Rhodes C, Diaferia G, Montgomery AM. Impact of defined matrix interactions on insulin production by cultured human betacells: effect on insulin content, secretion, and gene transcription. Diabetes 2006;55:2723–9. [8] Kanno T, Gopel SO, Rorsman P, Wakui M. Cellular function in multicellular system for hormone-secretion: electrophysiological aspect of studies on alpha, beta and delta-cells of the pancreatic islet. Neurosci Res 2002;42:79–90. [9] Starich GH, Zafirova M, Jablenska R, Petkov P, Lardinois CK. A morphological and immunohistochemical investigation of endocrine pancreata from obese ob+ /ob+ mice. Acta Histochem 1991;90:93–101. [10] Michon L, Nlend Nlend R, Bavamian S, Bischoff L, Boucard N, Caille D, et al. Involvement of gap junctional communication in secretion. Biochim Biophys Acta 2005;1719:82–101.
1859
[11] Ravier MA, Guldenagel M, Charollais A, Gjinovci A, Caille D, Söhl G, et al. Loss of connexin36 channels alters -cell coupling, islet synchronization of glucose-induced Ca2+ and insulin oscillations, and basal insulin release. Diabetes 2005;54:1798–807. [12] Wellershaus K, Degen J, Deuchars J, Theis M, Charollais A, Caille D, et al. A new conditional mouse mutant reveals specific expression and functions of connexin36 in neurons and pancreatic beta-cells. Exp Cell Res 2008;314:997– 1012. [13] Serre-Beinier V, Bosco D, Zulianello L, Charollais A, Caille D, Charpantier E, et al. Cx36 makes channels coupling human pancreatic beta-cells, and correlates with insulin expression. Hum Mol Genet 2009;18:428–39. [14] Andrali SS, Sampley ML, Vanderford NL, Ozcan S. Glucose regulation of insulin gene expression in pancreatic beta-cells. Biochem J 2008;415:1–10. [15] Caton D, Calabrese A, Mas C, Serre-Beinier V, Wonkam A, Meda P. Beta-cell crosstalk: a further dimension in the stimulus-secretion coupling of glucoseinduced insulin release. Diabetes Metab 2002;6(Pt2):3S45–13S. [16] Minami K, Yano H, Miki T, Nagashima K, Wang CZ, Tanaka H, et al. Insulin secretion and differential gene expression in glucose-responsive and -unresponsive MIN6 sublines. Am J Physiol Endocrinol Metab 2000;279:E773–81. [17] O’Driscoll L, Gammell P, Clynes M. Mechanisms associated with loss of glucose responsiveness in beta cells. Transplant Proc 2004;36:1159–62. [18] Calabrese A, Zhang M, Serre-Beinier V, Caton D, Mas C, Satin LS, et al. Connexin 36 controls synchronization of Ca2+ oscillations and insulin secretion in MIN6 cells. Diabetes 2003;52:417–24. [19] Calabrese A, Caton D, Meda P. Differentiating the effects of Cx36 and E-cadherin for proper insulin secretion of MIN6 cells. Exp Cell Res 2004;294:379–91. [20] Ohsugi M, Cras-Méneur C, Zhou Y, Bernal-Mizrachi E, Johnson JD, Luciani DS, et al. Reduced expression of the insulin receptor in mouse insulinoma (MIN6) cells reveals multiple roles of insulin signaling in gene expression, proliferation, insulin content, and secretion. J Biol Chem 2005;280:4992–5003. [21] Mogi A, Ichikawa H, Matsumoto C, Hieda T, Tomotsune D, Sakaki S, et al. The method of mouse embryoid body establishment affects structure and developmental gene expression. Tissue Cell 2009;41:79–84. [22] Yang KC, Qi Z, Wu CC, Shirouzu Y, Lin FH, Yanai G, et al. The cytoprotection of chitosan based hydrogels in xenogeneic islet transplantation: an in vivo study in streptozotocin-induced diabetic mouse. Biochem Biophys Res Commun 2010;393:818–23. [23] Cabrera O, Berman DM, Kenyon NS, Ricordi C, Berggren PO, Caicedo A. The unique cytoarchitecture of human pancreatic islets has implications for islet cell function. Proc Natl Acad Sci USA 2006;103:2334–9. [24] Giuliani M, Moritz W, Bodmer E, Dindo D, Kugelmeier P, Lehmann R, et al. Central necrosis in isolated hypoxic human pancreatic islets: evidence for postisolation ischemia. Cell Transplant 2005;14:67–76. [25] Luther MJ, Davies E, Muller D, Harrison M, Bone AJ, Persaud SJ, et al. Cellto-cell contact influences proliferative marker expression and apoptosis in MIN6 cells grown in islet-like structures. Am J Physiol Endocrinol Metab 2005;288:E502–9. ´ [26] Ohta M, Nelson D, Nelson J, Meglasson MD, Erecinska M. Oxygen and temperature dependence of stimulated insulin secretion in isolated rat islets of Langerhans. J Biol Chem 1990;265(29):17525–32. [27] Sato Y, Endo H, Okuyama H, Takeda T, Iwahashi H, Imagawa A, et al. Cellular hypoxia of pancreatic beta-cells due to high levels of oxygen consumption for insulin secretion in vitro. J Biol Chem 2011;286(14):12524–32. [28] Rorsman P, Eliasson L, Renström E, Gromada J, Barg S, Göpel S. The cell physiology of biphasic insulin secretion. News Physiol Sci 2000;15:72–7. ˜ [29] Santana A, Ensenat-Waser R, Arribas MI, Reig JA, Roche E. Insulin-producing cells derived from stem cells: recent progress and future directions. J Cell Mol Med 2006;10:866–83. [30] Nlend RN, Michon L, Bavamian S, Boucard N, Caille D, Cancela J, et al. Connexin36 and pancreatic beta-cell functions. Arch Physiol Biochem 2006;112:74–81. [31] Hauge-Evans AC, Squires PE, Persaud SJ, Jones PM. Pancreatic beta-cell-tobeta-cell interactions are required for integrated responses to nutrient stimuli: enhanced Ca2+ and insulin secretory responses of MIN6 pseudoislets. Diabetes 1999;48:1402–8. [32] Kaneto H, Miyatsuka T, Kawamori D, Yamamoto K, Kato K, Shiraiwa T, et al. PDX1 MafA play a crucial role in pancreatic beta-cell differentiation maintenance of mature beta-cell function. Endocr J 2008;55:235–52. [33] Vanderford NL, Andrali SS, Ozcan S. Glucose induces MafA expression in pancreatic -cell lines via the hexosamine biosynthetic pathway. J Biol Chem 2007;282:1577–84. [34] Zhao L, Guo M, Matsuoka TA, Hagman DK, Parazzoli SD, Poitout V, et al. The islet beta cell-enriched MafA activator is a key regulator of insulin gene transcription. J Biol Chem 2005;80:11887–94. [35] Anderson KR, Torres CA, Solomon K, Becker TC, Newgard CB, Wright CV, et al. Cooperative transcriptional regulation of the essential pancreatic islet gene NeuroD1 (beta2) by Nkx2.2 and neurogenin 3. J Biol Chem 2009;284:31236–48. [36] Chao CS, Loomis ZL, Lee JE, Sussel L. Genetic identification of a novel NeuroD1 function in the early differentiation of islet alpha PP and epsilon cells. Dev Biol 2007;312:523–32. [37] Chu K, Tsai MJ. Neuronatin a downstream target of BETA2/NeuroD1 in the pancreas, is involved in glucose-mediated insulin secretion. Diabetes 2005;54:1064–73. [38] Kim JW, Seghers V, Cho JH, Kang Y, Kim S, Ryu Y, et al. Transactivation of the mouse sulfonylurea receptor I gene by BETA2/NeuroD. Mol Endocrinol 2002;16:1097–107.
1860
K.-C. Yang et al. / Process Biochemistry 46 (2011) 1853–1860
[39] Ishizuka N, Minami K, Okumachi A, Okuno M, Seino S. Induction by NeuroD of the components required for regulated exocytosis. Biochem Biophys Res Commun 2007;354:271–7. [40] Doyle MJ, Sussel L. Nkx2.2 regulates beta-cell function in the mature islet. Diabetes 2007;56:1999–2007. [41] Servitja JM, Ferrer J. Transcriptional networks controlling pancreatic development and beta cell function. Diabetologia 2004;47:597–613.
[42] Kaneto H, Matsuoka TA, Kawashima S, Yamamoto K, Kato K, Miyatsuka T, et al. Role of MafA in pancreatic beta-cells. Adv Drug Deliv Rev 2009;61: 489–96. [43] Bratt-Leal AM, Carpenedo RL, Ungrin MD, Zandstra PW, McDevitt TC. Incorporation of biomaterials in multicellular aggregates modulates pluripotent stem cell differentiation. Biomaterials 2011;32(1):48–56.
Contents lists available at ScienceDirect
Process Biochemistry journal homepage: www.elsevier.com/locate/procbio
Cell coupling regulates Ins1, Pdx-1 and MafA to promote insulin secretion in mouse pancreatic beta cells Kai-Chiang Yang a,b,c , Zhi Qi a,d , Goichi Yanai a , Yasumasa Shirouza a , Dai-Hua Lu b , Hsuan-Shu Lee b,e,∗∗ , Shoichiro Sumi a,∗ a
Department of Organ Reconstruction, Institute for Frontier Medical Sciences, Kyoto University, 53 Kawahara-cho, Shogoin, Sakyo-ku, Kyoto 606-8507, Japan Institute of Biotechnology, National Taiwan University, 4F., No. 81, Chang-Xing St., Taipei 106, Taiwan c Research Center for Biomedical Devices, Taipei Medical University, Taipei 110, Taiwan d Department of Histology and Embryology, Nankai University School of Medicine, Nankai University, Tianjin 300071, China e Department of Internal Medicine, National Taiwan University Hospital, Taipei 10002, Taiwan b
a r t i c l e
i n f o
Article history: Received 13 April 2011 Received in revised form 21 June 2011 Accepted 21 June 2011 Keywords: Beta-cell Glucose-stimulated insulin secretion Cell coupling
a b s t r a c t The intracellular contact between pancreatic -cells plays an important role in functional insulin secretion. We propose cell coupling may regulate glucose-stimulated insulin gene expression. MIN-6, a murine -cell line, was cultured on the Lipidure-coat dish for cell clusters formation. The responses to glucosestimulation between monolayers and clusters were compared. The coupling of -cells was evaluated by immunohistochemical (IHC) staining. After the establishment of cell coupling was confirmed, the transcription factors of insulin gene expression were assessed by RT-PCR. Results showed that in addition to secrete insulin in a glucose-regulated manner, MIN-6 clusters had biphasic insulin secretion. Relative to monolayer, clusters have higher stimulation-index and lower constitutive insulin release. IHC staining showed the connexin 36 highly expressed in clusters. Compared with monolayers, the mRNA expression of insulin 1 (Ins1) and homeodomain transcription factor pancreatic/duodenal homebox-1 (Pdx-1) of clusters were downregulated in low glucose level. On the contrary, these gene expressions were upregulated when clusters cultured in high glucose environment. The V-maf musculoaponeurotic fibrosarcoma oncogene homologue A (MafA) was relative highly expressed in clusters under high glucose condition. This study reveals that cell coupling regulates glucose-stimulated insulin gene expression to promote insulin secretion in mouse -cells. © 2011 Elsevier Ltd. All rights reserved.
1. Introduction Although the normal composition of - and non -cells is not necessary for successful islet transplantation [1], it is well demonstrated that the communication between pancreatic -cells is essential for normal insulin secretion [2]. The intracellular contact is purposed to coordinate the functions of -cells by homogenizing and synchronizing cells activities. This coordination is mediated by junctional structures and cell adhesion molecules. Generally, the -cells are coupled by gap junction channels which are composed of connexin 36 (Cx36) [3]. This gap junction may allow -cells to exchange cytoplasmic molecules, ensure electrical coupling, and
∗ Corresponding author. Tel.: +81 75 751 4866; fax: +81 75 751 4145. ∗∗ Co-corresponding author at: Institute of Biotechnology, National Taiwan University, Department of Internal Medicine, National Taiwan University Hospital, No. 7, Chung Shan S. Rd., Taipei 10002, Taiwan. Tel.: +886 2 2312 3456x65194; fax: +886 2 3366 6001. E-mail addresses: [email protected] (H.-S. Lee), [email protected] (S. Sumi). 1359-5113/$ – see front matter © 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.procbio.2011.06.018
promote insulin secretion [4]. Some cell adhesion molecules such as integrins and cadherins are also reported to influence insulin secretion in islets [5–7]. Isolated -cells have been reported have heterogeneous insulin secretory activity [4]. Recent studies further provide convincible evidences that the beta cell-to-cell signaling is not only crucial for the insulin secretion but also for the regulation of the biosynthesis and storage of insulin [8]. In some diabetic animals, the islet cytoarchitecture is disturbed because of the ␣ and ␦-cells intermingle in -cells, which implicates the perturbation of cell-to-cell contact could be possible pathology in diabetes [9]. The separated -cells lost the intracellular communication display alterations in insulin secretion [10]. The deficiency of Cx36 leads to uncoordinated calcium signaling between -cells, arrhythmic insulin release and high basal insulin secretion in mouse [11,12]. Moreover, the loss of communication desynchronizes -cells subsequently results in the secretory defects that echo the observation in human pre-diabetes, type 1, and type 2 diabetics [12]. These findings show that the perturbation of cell-to-cell contact influences the normal functions of -cells seriously [13].
1854
K.-C. Yang et al. / Process Biochemistry 46 (2011) 1853–1860
Fig. 1. (a) MIN-6 cells cultured on a TCPS dish (40×). (b) Cell formed clusters on the Lipidure-coat dish after 7 days culture (40×). The phase contrast images: (c) monolayer cells (40×) and (d) cell cluster (40×). (e) Size distribution of clusters cultured for 7 days.
All previous studies revealed that intracellular contact between -cells, which mediated by Cx36, plays an important role in insulin secretory activity [3–13]. However, most of current studies demonstrated the influences of cell coupling to insulin secretion only. In here, we propose the cell coupling may also regulate glucosestimulated insulin gene expression. The expressions of Ins1, Pdx-1, MafA, NeuroD1, and Nkx2.2 were analyzed. These transcription factors have important role in pancreas development, and also regulate each other precisely in a coordinated and synergistic manner to control insulin gene expression in adult [14]. In order to prevent the paracrine effects of ␣- and ␦-cells to -cells [15], a reliable pancreatic beta cell-lines was needed. MIN-6 cell has been reported to secrete insulin in a glucose-regulated manner [16]. On the contrary, in spite of maintaining the ability of insulin secretion, most of other beta cell-lines lose the function of responding glucose stimulation [17]. This responsiveness to glucose stimulation makes MIN-6 a considerable cell source for diabetic researches;
and it has been used extensively in the study of insulin secretion mechanisms [18–20].In this study, MIN-6 cells were cultured on Lipidure-coat dish, which is typically used for forming embryoid body [21]. The transcription factors implicated the regulation of insulin gene expression were analyzed after cell aggregates formation. The purpose of study was to demonstrate the influences of -cells coupling to glucose-stimulated insulin gene expressions. 2. Materials and methods 2.1. MIN-6 cell culture and cell morphology observation Mouse -cell line, MIN-6, is a generous gift from Prof. Miyazaki (Department of Nutrition and Physiological Chemistry, Graduate School of Medicine, Osaka University). Cells were cultured in the tissue culture polystyrene (TCPS) dishes (353003, Falcon, USA) in high glucose DMEM (12100-061, Gibco, USA) supplemented with 5 l/l -mercaptoethanol (21985-023, Gibco, USA), 1% penicillin–streptomycin (15240-062, Gibco, USA) and 10% FBS (15622-029, Gibco, USA) in an incubator set at 5% CO2 and 37 ◦ C.
K.-C. Yang et al. / Process Biochemistry 46 (2011) 1853–1860
1855
Fig. 2. (a) The survival rate of MIN-6 clusters was 89.2 ± 5.7% at day 1 (100×) and (b) 86.8 ± 6.7% after 7 days culture (100×). (c) The survival rate of mouse islet was 85.6 ± 7.3% at day 1 (100×), and (d) central necrosis was observed with a survival of 23.1 ± 11.4% at day 7 (100×). For cell cluster forming, MIN-6 cells (passage 28–31) were detached from TCPS dishes by trypsin–EDTA (15400, Gibco, USA), re-suspended in DMEM at a density of 5 × 106 cells/ml, seeded to the Lipidure-coat dish (A-60D, 51011614, NOF Corporation, Japan), and cultured for 7 days. The cell morphology was observed with an optical microscope and the images were recorded daily.
monolayers and clusters were extracted (A1120, Wizard Genomic DNA Purification Kit, Promega, WI, USA). The DNA content of monolayers was quantified by a UV–vis (Ultrospec 3000 pro UV/Visible Spectrophotometer, GE Healthcare) to normalize the cell number of clusters. This test was done in four replicates. 2.5. Glucose-stimulated insulin secretion and stimulation-index
2.2. Size distribution of the MIN-6 cell clusters By the 7th day of culture, the MIN-6 clusters were stained with 1% dithizone (D5130, Sigma–Aldrich, USA) in dimethyl sulfoxide to estimate cluster numbers and size under an optical microscope. The diameter of cell clusters was determined by measuring the length and width of the cell aggregates. Clusters less than 20 m in diameter and faintly stained clusters were ignored. The size of clusters was arranged into seven groups: smaller than 50, 50–100, 100–150, 150–200, 200–250, 250–300, and larger than 300 m. 100 clusters were harvested from one culture dish and six independent dishes were used for analysis. 2.3. Cell survival The cell clusters underwent live-dead staining (QIA76, Calbiochem, Merck, Darmstadt, Germany) to identify the cell survival after being cultured for 1 and 7 days. After treatment, clusters were observed through a fluorescent microscope (IX70, Olympus, Japan). Each fluorescent dot represents one cell, and the live/dead cell ratio was determined by dividing the number of live cells (green dot) by the sum of live (green dot) and dead cells (red dot). Six images were chosen randomly from independent culture dishes, and one image may have more than 2 clusters. Totally 12 clusters were counted to estimate the average live/dead cell ratio. For comparative purpose, mouse islets were isolated according to methods in the previous study and cultured in the CMRL-1066 medium [22]. Mouse islets were underwent identical staining procedure as cell clusters. 2.4. Cell response to different concentration of glucose The responses of MIN-6 monolayers and clusters to different levels of glucose were compared. RPMI-1640 medium (11879, Gibco, USA) supplemented with 0.5% BSA (15622-029, Gibco, USA) and different glucose contents were prepared (0, 6.25, 12.5, 25, 50, 75, 100, 150, 200, and 250 mg/dl). MIN-6 monolayers and clusters were cultured in RPMI-1640 medium without glucose for 1 h, and then cultured in media with varied glucose concentration for another 1 h. Finally, the culture media were collected at the end of test period and the total insulin content was determined by a mouse ELISA assay (AKRIN-011H, Shibayagi, Japan) with a microplate reader (iMarkTM , BIO-RAD, CA, USA) at the wavelength of 450 nm. The total DNA of MIN-6
MIN-6 monolayers and clusters were cultured in the RPMI-1640 medium containing 60 mg/dl for 1 h before cultured in medium containing 300 mg/dl for another 1 h at 37 ◦ C. The medium was collected every 5 min and the insulin content was analyzed. The static glucose stimulation-index was calculated by dividing the total insulin secretion from the high glucose incubation period by the total insulin secretion during low glucose incubation period. 2.6. Immunohistochemical examination for connexin 36 MIN-6 monolayers and clusters were fixed in 10% neutral buffered formalin for 10 min. The samples were first incubated with 10% blocking serum (sc-2044, Santa Cruz Biotechnology, USA) for 20 min to suppress non-specific binding of IgG. Then the samples were incubated with primary anti-Cx36 antibody (sc-14904, Santa Cruz Biotechnology, USA) for 2 h. The localization of antigen was indicated by a FITC fluorochrome (sc-2024, Santa Cruz Biotechnology, USA). Samples were further stained with DAPI (sc-3598, Santa Cruz Biotechnology, USA) for 10 min and examined by a fluoresce microscope. The relative expression of Cx36 was defined as the FITC area divided by the DAPI area. Eight images were chosen randomly from monolayer and cluster group to estimate the average expression ratio. 2.7. RNA extraction and RT-PCR of MIN-6 cells MIN-6 monolayers and clusters were cultured in the RPMI-1640 medium with 25 or 250 mg/ml glucose for 1 h. Total RNA was then extracted (PureLinkTM RNA Mini Kit, 12183-018A, Invitrogen, CA, USA), and RNA yield was quantified using a UV–vis. The cDNA was synthesized from RNA using a PrimeScript RT-PCR kit (RR014A, Takara, Shiga, Japan) by a RT-PCR machine (iCycle, BIO-RAD, CA, USA). The cDNA was stored at −80 ◦ C until further analyses. Insulin 1 (Ins1), homeodomain transcription factor pancreatic/duodenal homebox-1 (Pdx-1), V-maf musculoaponeurotic fibrosarcoma oncogene homologue A (MafA), neurogenic differentiation 1 (NeuroD1), and homeobox protein Nkx2.2 (Nkx2.2) were chosen as target genes (primer sequences are listed in Table 1). Actin was amplified as an endogenous control and distilled water was included as a negative control. The PCR amplification included 2 l primer solution, 4 l cDNA, and 9.25 l PCR Mix (RR001A, Takara, Shiga, Japan) supplemented with distilled
1856
K.-C. Yang et al. / Process Biochemistry 46 (2011) 1853–1860
Table 1 The primer design for RT-PCR. Genbank number
Forward and reverse primer sequence
Size
Ins1
NM 008386.3
164
Pdx-1
NM 008814.3
MafA
NM 194350.1
NeuroD1
NM 010894.2
Nkx2.2
NM 010919.2
-Actin
NM 007393.3
TGGAGCTGGGAGGAAGCCCC ATTGCAAAGGGGTGGGGCGG CAAAGCGATCTGGGGTGGCGT CGCTGAACTCTGGCACCGGG CTGCTGCGGCCTATGAGGCC GCACGTGGTGGCCTGCGC ACAGCGAGAGCGGGCTGATG TTGTCCAGCGCCGCGTTCAG AGAGCCCTCGGCTGACGAGT CAGAGGCGTCACCTCCATACCTTT TAGGCACCAGGGTGTGATGG CATGGCTGGGGTGTTGAAGG
194 213 355 280 283
Insulin1 (Ins1); Homeodomain transcription factor pancreatic/duodenal homebox1 (Pdx-1); V-maf musculoaponeurotic fibrosarcoma oncogene homologue A (MafA); Neurogenic differentiation 1 (NeuroD1); NK homeobox-2.2 (Nkx2.2).
water to the final volume of 30 l. After a 5 min start at 94 ◦ C, the amplification was carried out in the PCR machine for 30–32 cycles (30 for Pdx-1, NeuroD1 and Nkx2.2; 31 for Ins1, and MafA; and 32 for -actin), each cycle comprising 20 s at 94 ◦ C, 30 s at 58 ◦ C, and 1 min at 72 ◦ C. A final cycle comprised 5 min at 72 ◦ C. The amplified DNA fragment were separated on a 2% agarose gel and stained with 0.5 mg/ml ethidium bromide. The densitometric analysis of the gels for 4 independent experiments was performed with the ImageJ software. 2.8. Statistical analysis All data were expressed as mean ± SEM. Statistical analyses of cell survival, static glucose stimulation-index, relative expression of Cx36, and densitometric analysis of PCR were analyzed by one-way ANOVA. Cell response to different concentration of glucose and glucose-stimulated insulin secretion were analyzed by two-way ANOVA. Difference was considered significant when p-value was less than 0.05.
3. Results 3.1. MIN-6 cell cluster and size distribution The MIN-6 cells displayed an epithelial morphology when cultured on the TCPS culture dish (Fig. 1a, 40×). On the contrary, MIN-6 cells suspended with round-shape appearance when cultured on the Lipidure-coat dish after 7 days culture (Fig. 1b, 40×). The phase contract images clear showed that cells aggregated as clusters with varied sizes opposite to monolayers (Fig. 1c and d, 40×). The size distribution of clusters is arranged in Fig. 1e; the diameter of most clusters was in the range of 50–100 m at day 7.
Fig. 3. (a) Insulin secretion of MIN-6 monolayers and clusters in a glucose-regulated manner. (b) MIN-6 clusters showed a biphasic secreting pattern which is composed by the first phase with a peak at 5 min, and the second phase showed gradually increasing insulin secretion (stimulation-index: 4.28 ± 0.65). Monolayers showed a similar secreting fashion (stimulation-index: 2.13 ± 0.41) with a lag of peak point in first phase and a lower stimulation-index (4.28 ± 0.65 for clusters and 2.13 ± 0.41 for monolayers).
when cultured in high glucose media (150, 200, 250 mg/dl; n = 6, p < 0.05). 3.4. Glucose-stimulated insulin secretion and stimulation-index
3.2. Cell survival The survival of MIN-6 clusters was 89.2 ± 5.7% at day 1 and 86.8 ± 6.7% after 7 days culture, there was no significant difference (n = 12, p > 0.05) between day 1 and 7 (Fig. 2a and b, 100×). Mouse islets had a survival of 85.6 ± 7.3% at day 1 (Fig. 2c, 100×). However, central necrosis with significantly lower survival (23.1 ± 11.4%; n = 12, p < 0.05) was observed at day 7 (Fig. 2d, 100×). 3.3. Cell response to different concentration of glucose The MIN-6 monolayers secreted insulin in a glucose-regulated manner, the amount of secreted insulin increased as the glucose contents in medium (Fig. 3a). The MIN-6 clusters also secreted insulin in a similar fashion as monolayers. However, compared with monolayers, a decreasing insulin secretion was observed when clusters cultured in media with low glucose contents (0, 6.25, 12.5, and 50 mg/dl; n = 6, p < 0.05). The insulin secretion of MIN-6 clusters was significantly higher than that of monolayers
MIN-6 clusters secreted low amounts of insulin at 60 mg/dl glucose medium. As changing to 300 mg/dl glucose medium, the clusters secreted high level of insulin (Fig. 3b). A biphasic secreting pattern was observed which is composed by the first phase with a peak at 5 min, and the second phase showed gradually increasing insulin secretion. MIN-6 monolayers showed a similar secreting fashion with a lag of peak point in first phase and a lower stimulation-index (5.12 ± 0.75 for clusters and 2.84 ± 0.59 for monolayers; n = 6, p < 0.05). 3.5. Immunohistochemical staining The Cx36 proteins were expressed rarely in monolayers (Fig. 4a, 200×); some cell–cell contacts showed positive staining weakly. For the MIN-6 clusters, the Cx36 proteins were relative highly expressed (Fig. 4b, 200×). Fig. 4c showed the expression ratio of Cx36 (FITC) to cell number (DAPI), cluster group had a significantly higher ratio than monolayer group (n = 8, p < 0.01).
K.-C. Yang et al. / Process Biochemistry 46 (2011) 1853–1860
1857
Fig. 4. (a) Confluent cell monolayers formed and the Cx36 proteins were rarely expressed in monolayers (FITC for Cx36 and DAPI for nucleus, 200X). (b) The MIN-6 cluster expressed Cx36 proteins strongly (FITC for Cx36 and DAPI for nucleus, 200×). (c) The relative expression of FITC/DAPI in clusters was significantly higher than that of monolayers (n = 8, p < 0.01).
3.6. Glucose-regulated gene expression Regarding to monolayers cultured in low glucose condition, the RT-PCR amplification of cells RNA revealed that transcripts for Ins1, Pdx-1 and NeuroD1 were abundant under high glucose medium (Fig. 5a). However, compared the RNA expression between monolayers and clusters, the lower expression levels for Ins1, and Pdx-1 were found in the clusters under low glucose condition (Fig. 5b, p < 0.05). Relative to monolayers, these expressions were upregulated significantly when clusters cultured in high glucose medium (p < 0.05 for Pdx-1; p < 0.01 for Ins1). The MafA expressed weakly both under low and high glucose conditions in monolayers, and also expressed weakly in clusters under low glucose condition. For clusters, the expression of MafA was significantly stronger (p < 0.01) under high glucose condition. The NeuroD1 was upregulated with significant differences (p < 0.05) under high glucose condition both for monolayers and clusters. The NeuroD1 expression of clusters was significantly higher than that of monolayers (p < 0.05) under low glucose condition; however, no significant difference was observed between monolayers and clusters under high glucose condition (p > 0.05). For Nkx2.2, there was also no significant difference between monolayers and clusters under low and high glucose conditions (p > 0.05). 4. Discussion Although the differences between species in islet cytoarchitecture have been described, the cell-to-cell contact is crucial for insulin secretion [23]. In addition to homogenize and synchronize -cells activities, the influence of cell coupling to glucosestimulated insulin gene expressions was further demonstrated in
this study. First, the contacts between -cells were established using a Lipidure-coat dish. MIN-6 cells displayed totally different morphology when cultured on lipidure, which was most cells suspending and aggregating as clusters in the range of 50–100 m (Fig. 1e). The cell number of clusters was estimated based on the total DNA of clusters relative to monolayers; a cell cluster in the size of 50–100 m has 800–1800 cells. Hypoxia-induced central necrosis is a familiar problem for islets after long term culturing; this phenomenon was also observed in mouse islets in this study [24]. Oppositely, MIN-6 clusters had high survival after 7 days culture (Fig. 2) and even 14 days culture (data not shown), revealing that oxygen/nutrient accessed by passive diffusion was adequate to maintain the cell survival within clusters. Luther et al. reported the forming of clusters influences proliferative marker expression. The clusters were not necrotic, although the apoptosis were upregulated [25]. Regarding the possibility of oxygen level influencing insulin secretion, a pervious study demonstrated that low oxygen tension reduced the amount of insulin releasing [26]. Moreover, islet cells require high oxygen tension to survival and function, and hypoxia has deleterious effect to islet cells [27]. Therefore, the difference in oxygen tension between monolayers and clusters shall not attribute to the enhancing insulin secretion. The responses of MIN-6 monolayers and clusters to media were varied in different contents of glucose, monolayer cells secreted insulin under low glucose levels, and the amounts of insulin increased in a dose-dependent fashion (Fig. 3a). Interestingly, when cell clusters forming, there was a decrease in basal insulin secretion under low glucose conditions. In contrast, the insulin secretion in clusters was higher than monolayers when the glucose level was higher than 100 mg/dl. Concerning the results
1858
K.-C. Yang et al. / Process Biochemistry 46 (2011) 1853–1860
Fig. 5. (a) The results of RT-PCR for monolayers and clusters under low and high glucose conditions. (b) The densitometric analysis of RT-PCR lower levels for transcripts for Ins1 and Pdx-1 were found in the clusters under low glucose condition, these expressions were upregulated when clusters cultured in high glucose level medium. MafA highly expressed in clusters under high glucose condition. The NeuroD1 was upregulated with significant differences under high glucose condition both for monolayers and clusters. The expression of Nkx2.2 was not affected when cell cluster formation revealed that the Ins1 and Pdx-1 expression of clusters were significantly higher than that of monolayers under high glucose condition (p < 0.05 for Pdx-1; p < 0.01 for Ins1). For clusters, the expression of MafA was significantly stronger (p < 0.01) at high glucose medium. There was no significant difference between monolayers and clusters under high glucose condition (p > 0.05) for NeuroD1. For Nkx2.2, there was no significant difference (p > 0.05) between monolayers and clusters under low and high glucose conditions.
of glucose-stimulated insulin secretion, the biphasic secreting pattern was first reported in MIN-6 clusters, which is a typical fashion in fresh-isolated islets (Fig. 3b). The disturbances in biphasic secreting pattern was an early feature that reported in Type II diabetes, and we speculate the phenotype of MIN-6 clusters is more similar to normal islets [28]. In spite of MIN-6 monolayers also showed similar secreting pattern, the stimulation-index for clusters was higher than that of monolayers significantly. After establishing the different responses to glucose stimulation between clusters and monolayers, the glucose-stimulated insulin gene expressions were analyzed. Pdx-1, an important mediator for embryonic development of the pancreas, is also a major regulator of glucose-stimulated insulin gene transcription [29]. For the cell clusters, the Pdx-1 was downregulated when compared with that of monolayers under low glucose condition (Fig. 5b). The expression of Pdx-1 was upregulated for clusters under high glucose level. We assume this may attribute to the cell clusters established cellto-cell contact that coordinates insulin secretion. This point of view could be approved by the expression of Ins1, and further verified
by the expression of gap junctional protein Cx36. In spite of confluent cell monolayers formed, the monolayers had weak expression of Cx36 which reveals the cell–cell contact should be limited that could not homogenize or synchronies cells activities (Fig. 4c). Nlend et al. also demonstrated that cell-cell contact is required but not sufficient to ensure -cell function [30]. On the contrary, the Cx36 proteins were highly expressed in clusters. The gap junction channels may exchange ions, such as intracellular calcium and second messengers, to contribute to the coordination of insulin secretion in clusters. It is reported the loss of Cx36 results in impaired electrical coupling, desynchronization of Ca2+ oscillations and alters insulin release of -cells [18]. Therefore, the improvement of insulin secretion in clusters may attribute to the establishment of Cx36 gap junction. A pervious study also reported this ameliorating responsiveness of MIN-6 clusters may attribute to the E-cadherin since the glucose evoked a Ca2+ influx in only a small fraction of the monolayers but >80% in clusters [31]. Pdx-1 is reported to regulate the transcription of MafA [32]. Other studies also showed the expression of MafA itself is glucosestimulation responsible [33]. Transcription of MafA is only induced under high glucose level, whereas MafA transcription is downregulated in low glucose condition [34]. The finding in this study is consistent with the above reports: the MafA was upregulated under high glucose level in clusters; MafA expressed weakly in monolayers under both high and low glucose conditions (Fig. 5b). The downregulated expression of MafA also provides a possible clue for the decreasing basal insulin secretion for clusters under low glucose condition. The decreased expression and proteasomal degradation of MafA may inhibit insulin transcription rapidly under low glucose conditions [14]. NeuroD1 is related to the regulation of insulin and glucagon gene expression and it was found in both the developing and adult pancreas [35,36]. NeuroD1 modulates the expression of genes such as neuronatin which is an ion channel transporter, and Sur1 that forms potassium channels with Kir6.2, to regulate insulin secretion [37,38]. The expression of NeuroD1 was upregulated under high glucose condition both for monolayers and clusters (Fig. 5b). NeuroD1 also regulates insulin exocytosis by directly inducing the expression of genes involved in exocytosis [39]. Despite there is no significant difference between monolayers and clusters under high glucose environment, clusters showed relative high NeuroD1 expression under low glucose level. The cell aggregate may upregulate the expression of NeuroD1. However, in spite of the high NeuroD1 expression, clusters still secreted relative low insulin under low glucose condition. The low Ins1 and Pdx-1expressions for clusters shall attribute to this result. Moreover, the upregulated NeuroD1 at high glucose condition may explain both monolayers and clusters secreted high level insulin. Nkx2.2 has a critical role in the maintenance of normal islet structure and insulin gene activity in mice [40,41]. The expression of Nkx2.2 was not affected when cells forming aggregates and this may benefit the long-term function of clusters. To summarize the results of glucose-stimulated insulin gene expressions, Ins1, Pdx-1, NeuroD1, and MafA were upregulated in clusters under high glucose environment. The Pdx1 binds to the A3 element and the NeuroD1 binds to the element of insulin gene, and the MafA also functions as a potent transactivator for the insulin gene [42]. The upregulation of MafA together with Pdx-1 and NeuroD1 markedly induces insulin biosynthesis. Therefore, we conclude the formation of cell aggregates regulates insulin-related gene expressions to improve insulin secretion at high glucose level. Regarding the finding of this study, islets isolated from donor were cultured in non-treat TCPS dishes overnight before transplantation in clinic currently. However, 15–20% islets lost integrity during this culture period. It is well demonstrated that the coating-substrates on culture dishes influence cells morphology
K.-C. Yang et al. / Process Biochemistry 46 (2011) 1853–1860
and subsequently determine cells behaviors extremely [43]. Therefore, we consider that the result of this study may provide an alternative substrate for islet culture and may benefit the islet transplantation. In summary, the formation of pancreatic -cell clusters influence the insulin gene expression. Relative to monolayer, clusters has higher stimulation-index and lower constitutive insulin release. Besides, Cx36 protein plays an important role in the regulating pathway. In low glucose condition, the RNA expressions of clusters showed that most genes previously activated in monolayers were downregulated. The expressions of Ins1, Pdx1 and MafA were further upregulated for clusters under high glucose environment. This study reveals that cell coupling regulates glucose-stimulated insulin gene expression to promote insulin secretion in mouse -cells. Author contributions Kai-Chiang Yang: Participated in research design, research performing, data analysis, and paper writing. Zhi Qi: Participated in research design and research performing. Goichi Yanai: Participated in research design and research performing. Yasumasa Shirouza: Participated in research performing and data analysis. Dai-Hua Lu: Participated in data analysis and paper writing. Hsuan-Shu Lee: Participated in research design, data analysis and paper writing. Shoichiro Sumi: Participated in research design, data analysis and paper writing. Conflict of interest statement There are no conflicts. Acknowledgement Kai-Chiang Yang thanks the Takeda Science Foundation for supporting the postdoctoral fellow program in Kyoto University. References [1] King AJ, Fernandes JR, Hollister-Lock J, Nienaber CE, Bonner-Weir S, Weir GC. Normal relationship of beta- and non-beta-cells not needed for successful islet transplantation. Diabetes 2007;56:2312–8. [2] Bavamian S, Klee P, Britan A, Populaire C, Caille D, Cancela J, et al. Islet-cell-tocell communication as basis for normal insulin secretion. Diabetes Obes Metab 2007;9:118–32. [3] Charpantier E, Cancela J, Meda P. Beta cells preferentially exchange cationic molecules via connexin 36 gap junction channels. Diabetologia 2007;50:2332–41. [4] Wojtusciszyn A, Armanet M, Morel P, Berney T, Bosco D. Insulin secretion from human beta cells is heterogeneous and dependent on cell-to-cell contacts. Diabetologia 2008;51:1843–52. [5] Bosco D, Rouiller DG, Halban PA. Differential expression of E-cadherin at the surface of rat -cells as a marker of functional heterogeneity. J Endocrinol 2007;194:21–9. [6] Rogers GJ, Hodgkin MN, Squires PE. E-cadherin and cell adhesion: a role in architecture and function in the pancreatic islet. Cell Physiol Biochem 2007;20:987–94. [7] Kaido T, Yebra M, Cirulli V, Rhodes C, Diaferia G, Montgomery AM. Impact of defined matrix interactions on insulin production by cultured human betacells: effect on insulin content, secretion, and gene transcription. Diabetes 2006;55:2723–9. [8] Kanno T, Gopel SO, Rorsman P, Wakui M. Cellular function in multicellular system for hormone-secretion: electrophysiological aspect of studies on alpha, beta and delta-cells of the pancreatic islet. Neurosci Res 2002;42:79–90. [9] Starich GH, Zafirova M, Jablenska R, Petkov P, Lardinois CK. A morphological and immunohistochemical investigation of endocrine pancreata from obese ob+ /ob+ mice. Acta Histochem 1991;90:93–101. [10] Michon L, Nlend Nlend R, Bavamian S, Bischoff L, Boucard N, Caille D, et al. Involvement of gap junctional communication in secretion. Biochim Biophys Acta 2005;1719:82–101.
1859
[11] Ravier MA, Guldenagel M, Charollais A, Gjinovci A, Caille D, Söhl G, et al. Loss of connexin36 channels alters -cell coupling, islet synchronization of glucose-induced Ca2+ and insulin oscillations, and basal insulin release. Diabetes 2005;54:1798–807. [12] Wellershaus K, Degen J, Deuchars J, Theis M, Charollais A, Caille D, et al. A new conditional mouse mutant reveals specific expression and functions of connexin36 in neurons and pancreatic beta-cells. Exp Cell Res 2008;314:997– 1012. [13] Serre-Beinier V, Bosco D, Zulianello L, Charollais A, Caille D, Charpantier E, et al. Cx36 makes channels coupling human pancreatic beta-cells, and correlates with insulin expression. Hum Mol Genet 2009;18:428–39. [14] Andrali SS, Sampley ML, Vanderford NL, Ozcan S. Glucose regulation of insulin gene expression in pancreatic beta-cells. Biochem J 2008;415:1–10. [15] Caton D, Calabrese A, Mas C, Serre-Beinier V, Wonkam A, Meda P. Beta-cell crosstalk: a further dimension in the stimulus-secretion coupling of glucoseinduced insulin release. Diabetes Metab 2002;6(Pt2):3S45–13S. [16] Minami K, Yano H, Miki T, Nagashima K, Wang CZ, Tanaka H, et al. Insulin secretion and differential gene expression in glucose-responsive and -unresponsive MIN6 sublines. Am J Physiol Endocrinol Metab 2000;279:E773–81. [17] O’Driscoll L, Gammell P, Clynes M. Mechanisms associated with loss of glucose responsiveness in beta cells. Transplant Proc 2004;36:1159–62. [18] Calabrese A, Zhang M, Serre-Beinier V, Caton D, Mas C, Satin LS, et al. Connexin 36 controls synchronization of Ca2+ oscillations and insulin secretion in MIN6 cells. Diabetes 2003;52:417–24. [19] Calabrese A, Caton D, Meda P. Differentiating the effects of Cx36 and E-cadherin for proper insulin secretion of MIN6 cells. Exp Cell Res 2004;294:379–91. [20] Ohsugi M, Cras-Méneur C, Zhou Y, Bernal-Mizrachi E, Johnson JD, Luciani DS, et al. Reduced expression of the insulin receptor in mouse insulinoma (MIN6) cells reveals multiple roles of insulin signaling in gene expression, proliferation, insulin content, and secretion. J Biol Chem 2005;280:4992–5003. [21] Mogi A, Ichikawa H, Matsumoto C, Hieda T, Tomotsune D, Sakaki S, et al. The method of mouse embryoid body establishment affects structure and developmental gene expression. Tissue Cell 2009;41:79–84. [22] Yang KC, Qi Z, Wu CC, Shirouzu Y, Lin FH, Yanai G, et al. The cytoprotection of chitosan based hydrogels in xenogeneic islet transplantation: an in vivo study in streptozotocin-induced diabetic mouse. Biochem Biophys Res Commun 2010;393:818–23. [23] Cabrera O, Berman DM, Kenyon NS, Ricordi C, Berggren PO, Caicedo A. The unique cytoarchitecture of human pancreatic islets has implications for islet cell function. Proc Natl Acad Sci USA 2006;103:2334–9. [24] Giuliani M, Moritz W, Bodmer E, Dindo D, Kugelmeier P, Lehmann R, et al. Central necrosis in isolated hypoxic human pancreatic islets: evidence for postisolation ischemia. Cell Transplant 2005;14:67–76. [25] Luther MJ, Davies E, Muller D, Harrison M, Bone AJ, Persaud SJ, et al. Cellto-cell contact influences proliferative marker expression and apoptosis in MIN6 cells grown in islet-like structures. Am J Physiol Endocrinol Metab 2005;288:E502–9. ´ [26] Ohta M, Nelson D, Nelson J, Meglasson MD, Erecinska M. Oxygen and temperature dependence of stimulated insulin secretion in isolated rat islets of Langerhans. J Biol Chem 1990;265(29):17525–32. [27] Sato Y, Endo H, Okuyama H, Takeda T, Iwahashi H, Imagawa A, et al. Cellular hypoxia of pancreatic beta-cells due to high levels of oxygen consumption for insulin secretion in vitro. J Biol Chem 2011;286(14):12524–32. [28] Rorsman P, Eliasson L, Renström E, Gromada J, Barg S, Göpel S. The cell physiology of biphasic insulin secretion. News Physiol Sci 2000;15:72–7. ˜ [29] Santana A, Ensenat-Waser R, Arribas MI, Reig JA, Roche E. Insulin-producing cells derived from stem cells: recent progress and future directions. J Cell Mol Med 2006;10:866–83. [30] Nlend RN, Michon L, Bavamian S, Boucard N, Caille D, Cancela J, et al. Connexin36 and pancreatic beta-cell functions. Arch Physiol Biochem 2006;112:74–81. [31] Hauge-Evans AC, Squires PE, Persaud SJ, Jones PM. Pancreatic beta-cell-tobeta-cell interactions are required for integrated responses to nutrient stimuli: enhanced Ca2+ and insulin secretory responses of MIN6 pseudoislets. Diabetes 1999;48:1402–8. [32] Kaneto H, Miyatsuka T, Kawamori D, Yamamoto K, Kato K, Shiraiwa T, et al. PDX1 MafA play a crucial role in pancreatic beta-cell differentiation maintenance of mature beta-cell function. Endocr J 2008;55:235–52. [33] Vanderford NL, Andrali SS, Ozcan S. Glucose induces MafA expression in pancreatic -cell lines via the hexosamine biosynthetic pathway. J Biol Chem 2007;282:1577–84. [34] Zhao L, Guo M, Matsuoka TA, Hagman DK, Parazzoli SD, Poitout V, et al. The islet beta cell-enriched MafA activator is a key regulator of insulin gene transcription. J Biol Chem 2005;80:11887–94. [35] Anderson KR, Torres CA, Solomon K, Becker TC, Newgard CB, Wright CV, et al. Cooperative transcriptional regulation of the essential pancreatic islet gene NeuroD1 (beta2) by Nkx2.2 and neurogenin 3. J Biol Chem 2009;284:31236–48. [36] Chao CS, Loomis ZL, Lee JE, Sussel L. Genetic identification of a novel NeuroD1 function in the early differentiation of islet alpha PP and epsilon cells. Dev Biol 2007;312:523–32. [37] Chu K, Tsai MJ. Neuronatin a downstream target of BETA2/NeuroD1 in the pancreas, is involved in glucose-mediated insulin secretion. Diabetes 2005;54:1064–73. [38] Kim JW, Seghers V, Cho JH, Kang Y, Kim S, Ryu Y, et al. Transactivation of the mouse sulfonylurea receptor I gene by BETA2/NeuroD. Mol Endocrinol 2002;16:1097–107.
1860
K.-C. Yang et al. / Process Biochemistry 46 (2011) 1853–1860
[39] Ishizuka N, Minami K, Okumachi A, Okuno M, Seino S. Induction by NeuroD of the components required for regulated exocytosis. Biochem Biophys Res Commun 2007;354:271–7. [40] Doyle MJ, Sussel L. Nkx2.2 regulates beta-cell function in the mature islet. Diabetes 2007;56:1999–2007. [41] Servitja JM, Ferrer J. Transcriptional networks controlling pancreatic development and beta cell function. Diabetologia 2004;47:597–613.
[42] Kaneto H, Matsuoka TA, Kawashima S, Yamamoto K, Kato K, Miyatsuka T, et al. Role of MafA in pancreatic beta-cells. Adv Drug Deliv Rev 2009;61: 489–96. [43] Bratt-Leal AM, Carpenedo RL, Ungrin MD, Zandstra PW, McDevitt TC. Incorporation of biomaterials in multicellular aggregates modulates pluripotent stem cell differentiation. Biomaterials 2011;32(1):48–56.