Cell cycle progression is disrupted in murine MPS VII growth plate leading to reduced chondrocyte proliferation and transition to hypertrophy

Journal Pre-proof Cell cycle progression is disrupted in murine MPS VII growth plate leading to reduced chondrocyte proliferation and transition to hypertrophy

Zhirui Jiang, Ainslie L.K. Derrick-Roberts, Clare Reichstein, Sharon Byers PII:

S8756-3282(19)30491-0

DOI:

https://doi.org/10.1016/j.bone.2019.115195

Reference:

BON 115195

To appear in:

Bone

Received date:

8 October 2019

Revised date:

2 December 2019

Accepted date:

17 December 2019

Please cite this article as: Z. Jiang, A.L.K. Derrick-Roberts, C. Reichstein, et al., Cell cycle progression is disrupted in murine MPS VII growth plate leading to reduced chondrocyte proliferation and transition to hypertrophy, Bone(2018), https://doi.org/10.1016/ j.bone.2019.115195

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2018 Published by Elsevier.

Journal Pre-proof Cell cycle progression is disrupted in murine MPS VII growth plate leading to reduced chondrocyte proliferation and transition to hypertrophy.

Zhirui Jiang1,2, Ainslie LK Derrick-Roberts2,3, Clare Reichstein1,2 and Sharon Byers1,2,3

School of Bioscience, The University of Adelaide, Adelaide SA, Australia

2

Genetics and Molecular Pathology, SA Pathology, Adelaide SA, Australia

ro

The University of Adelaide Medical School, Adelaide SA, Australia

lP

Correspondence should be addressed to:-

re

-p

3

of

1

Jo ur

na

Zhirui Jiang, Ph.D. Department of Orthopaedic Surgery University of Pennsylvania 371 Stemmler Hall, 3450 Hamilton Walk Philadelphia, PA 19104, USA Ph. 215 573 9416 Fax. 215 573 2133 Email: [email protected]

1

Journal Pre-proof Abstract Endochondral bone growth is abnormal in 6 of the 11 types of mucopolysaccharidoses (MPS) disorders; resulting in short stature, reduced size of the thoracic cavity and compromised manual dexterity. Current therapies for MPS have had a limited effect on bone growth and to improve these therapies or develop adjunct approaches requires an understanding of the underlying basis of abnormal bone growth in MPS. The MPS VII mouse model replicates the reduction in long bone and vertebral length observed in human MPS. Using this model we

of

have shown that the growth plate is elongated but contains fewer chondrocytes in the

ro

proliferative and hypertrophic zones. Endochondral bone growth is in part regulated by entry

-p

and exit from the cell cycle by growth plate chondrocytes. More MPS VII chondrocytes were

re

positive for Ki67, a marker for active phases of the cell cycle, suggesting that more MPS VII chondrocytes were in the cell cycle. The number of cells positive for phosphorylated histone

lP

H3 was significantly reduced in MPS VII chondrocytes, suggesting fewer MPS VII

na

chondrocytes progressed to mitotic division. While MPS VII HZ chondrocytes continued to express cyclin D1 and more cells were positive for E2F1 and phos pRb than normal, fewer

Jo ur

MPS VII HZ chondrocytes were positive for p57kip2 a marker of terminal differentiation, suggesting fewer MPS VII chondrocytes were able to exit the cell cycle. In addition, multiple markers typical of PZ to HZ transition were not downregulated in MPS VII, in particular Sox9, Pthrpr and Wnt5a. These findings are consistent with MPS VII growth plates elongating at a slower rate than normal due to a delay in progression through the cell cycle, in particular the transition between G1 and S phases, leading to both reduced cell division and transition to the hypertrophic phenotype.

Keywords: Lysosomal Storage Disorder, Mucopolysaccharidosis, Endochondral Ossification, Cell Cycle, Chondrocyte Proliferation, Hypertrophic Differentiation

2

Journal Pre-proof Introduction The mucopolysaccharidoses (MPS) are a group of 11 lysosomal storage disorders caused by a partial or total loss of a lysosomal enzyme activity required for the catabolism of glycosaminoglycans (GAGs) [1]. GAGs are integral components of most tissues and in MPS undegraded and partially degraded GAGs progressively build up within a wide range of tissues. The specific tissue range affected in an individual MPS type is dependent upon the enzyme deficiency and thus the GAG that accumulates. MPS in which dermatan sulphate or

of

keratan sulphate GAG accumulate display prominent skeletal pathology that is collectively

ro

termed dysostosis multiplex and manifests as early as 1 year of age. Short stature is an

re

-p

obvious visible feature of abnormal bone development and affects 6 of the 11 MPS [1-8].

Bone elongation occurs at the growth plate; a specialised, rapidly growing, transient

lP

cartilaginous structure that is transformed into bone [9-11]. Chondrocytes in the growth plate

na

are arranged into distinct morphological zones (resting, proliferative and hypertrophic) reflecting their functional properties. Chondrocytes in the proliferative zone (PZ) divide and

Jo ur

form into columns parallel to the axis of growth. They subsequently undergo hypertrophic expansion in the hypertrophic zone (HZ) and produce a matrix conducive to new bone deposition [12-14]. This strict temporal and spatial sequence of events as cartilage is transformed into bone is termed endochondral ossification (EO). A combination of chondrocyte proliferation, matrix synthesis and hypertrophic expansion dictate the rate of bone growth at an individual growth plate [15-18]. Central to EO is the synchronized entry into and exit out of the cell cycle by growth plate chondrocytes in order to initiate proliferation and subsequent terminal differentiation (hypertrophy) [19-21]. The time chondrocytes spend on completing a cell cycle varies in growth plates growing at different

3

Journal Pre-proof rates, leading to the differential growth of long bones [22]. In particular chondrocytes in slower growing growth plates spend more time in the G1 phase of the cell cycle [22].

Commonly observed abnormalities in MPS patient growth plates are enlarged and vacuolefilled chondrocytes, disorganized columnar architecture in the proliferative (PZ) and hypertrophic zones (HZ), as well as reduced calcification of cartilage tissue [23, 24]. Similar histopathology is observed in animal models of MPS. Growth plate chondrocyte vacuolation

of

and disorganised columnar structure is observed in MPS I dog, cat and mouse [25-28], MPS

ro

VI cat and mouse [29-31], MPS VII dog, cat and mouse [32-35] while chondrocyte

-p

vacuolation has been reported in MPS IIIA and IVA mice [36, 37]. Long bone and vertebral

re

length is reduced in MPS VII and the development of both primary and secondary centres of ossification are delayed [38]. Reduced chondrocyte proliferation arising from decreased

lP

activation of STAT3 [33] and delayed hypertrophic differentiation due to persistence of

Jo ur

MPS.

na

SOX9 [39] have been suggested as mechanisms underlying poor growth plate function in

To further investigate the mechanism of impaired EO a morphometric analysis of growth plate structure and cellularity and an immunohistochemical analysis of cell cycle markers was undertaken. Growth plate height increased due to an enlarged RZ and HZ in MPS VII mice, while cell number decreased in the PZ and HZ. More MPS VII chondrocytes were in the cell cycle but fewer MPS VII chondrocytes were positive for a marker of mitotic division. In addition, fewer MPS VII HZ were positive for a marker of hypertrophic differentiation. This was supported by real-time PCR analysis in which the expression of Ihh was reduced in MPS VII growth plate while there was sustained expression of Sox9, Pthrpr and Wnt5a. Thus, cell

4

Journal Pre-proof cycle progression was disrupted in the MPS VII growth plate affecting the ability to both proliferate and to transition to the hypertrophic phenotype. Materials and Methods: Animal husbandry: All research procedures using mice were approved by the Womens and Childrens Health Network and the University of Adelaide animal ethics committees. Founder MPS VII mice (Gusmps/mps strain) were obtained from Jackson Labs (stock number 006407, Bar Harbor,

of

Maine, USA). MPS VII and normal (homozygous) mice were bred from heterozygous

ro

parents and genotype determined by PCR as previously described [40, 41]. Mice were housed

re

-p

in a 14/10 light/dark cycle with food and water ad libitum.

Growth plate zone height, chondrocyte number and size.

lP

Knee joints of both normal and MPS VII mice at postnatal 14 days, 1 month, 2 months and 6

na

months of age were dissected free of soft tissue Joints were fixed in 10% (v/v) neutral buffered formalin overnight and then decalcified in ImmunocalTm (Decal Corporation, NY,

Jo ur

USA) prior to routine processing and embedding in paraffin blocks. Five-micron sections were cut using a Leica RM2235 microtome (Leica Microsystems Pty Ltd, NSW, Australia) and stained with 0.1% (w/v) safranin O and 0.05% (w/v) fast green [38]. All measurements were made on the proximal tibial growth plate using an Olympus BX41 microscope (Olympus Australia Pty. Ltd., Gulfview Heights, SA) and analyzed using Olympus analySIS® LS Research Olympus Soft Imaging Solutions (version 3.1) software. Individual growth plate zones were defined using morphological criteria [42]. The resting zone (RZ) was defined as the region distal to the secondary ossification center containing round, single chondrocytes. The PZ adjacent to the RZ was characterized by flattened cells packed into multicellular clusters to form columns of chondrocytes perpendicular to the growth axis. The

5

Journal Pre-proof HZ was considered to start at the point at which chondrocyte size had doubled and terminated at the metaphysis. Zone height of the RZ, PZ and HZ was measured at 100 μm intervals across the growth plate for a total of 8 measurements in 14 day old mice and 16 measurements in 1 and 2 month old mice. Measurements were averaged to yield a single value for each zone for each animal. The total height of the proximal tibial growth plate was determined by summing the heights of the RZ, PZ. Distinct zones were difficult to define in 6 month old mice and individual zone heights were not measured. The total growth plate height

of

at 6 months of age was therefore taken as the distance between the epiphysis and metaphysis,

ro

with 16 measurements taken at 100 μm intervals across the growth plate and averaged for

-p

each animal. Eight, sixteen and eight 50 μm x 50 μm squares were randomly selected in the RZ,

re

PZ and HZ respectively of each animal, the number of chondrocytes within each square was counted and values for all squares averaged to yield the final cell number per animal per zone.

lP

Chondrocytes shrink within their lacunae during fixation and processing [43] and lacunae height

na

and width were therefore measured as surrogates for chondrocyte vertical and horizontal diameter respectively in the same areas where cell number was determined. Vertical and horizontal

Jo ur

diameter was averaged for each animal in each zone per time point.

Immunohistochemistry and immunofluorescence Fourteen day old normal and MPS VII proximal tibiae were fixed in 10% (v/v) neutral buffered formalin, decalcified in ImmunocalTm prior to routine processing and embedded in paraffin. Immunohistochemisty was carried out on 5 µm sections after deparaffinization using the following antibodies and concentrations: caspase 3, activated caspase 3 and phosphorylated histone H3 (phos hisH3) (Cell Signalling Technology #9662, #9661 and #9701 and dilutions of 1:1000, 1:300 and 1:200 respectively), cyclin D1 (ThermoFisher #MA5-14512 at a dilution of 1:50), E2F1, E2F4, phos pRb, phos p130, phos MCM2 and DNA polymerase α (Abcam #ab179445, #ab53060, #ab47763, #ab68136, #ab 109133 and 6

Journal Pre-proof #ab31777 and dilutions of 1:50, 1:100, 1:50, 1:200, 1:100 and 1:100 respectively). Antigen retrieval was carried out in 10mM sodium citrate pH6.0 containing 0.05% (v/v) Tween 20 at 60°C overnight for anti- phos hisH3, cyclin D1, E2F1, E2F4, phos pRb, phos p130, phos MCM2 and DNA polymerase α. Antigen retrieval was carried out in 10mM sodium citrate pH6.0 containing 0.05% (v/v) Tween 20 at 60°C overnight followed by 0.01U/mL chondroitinase ABC at 37°C for 1 hour for anti-caspase 3 and activated caspase 3. Blocking solutions and biotinylated secondary antibody were as per the Cell and Tissue Staining Kit

of

(anti-rabbit or anti-goat, R&D systems, Minneapolis, USA) for all antibodies except phos-

ThermoFisher,

Australia)

and

incubated

with

goat-anti-rabbit

fluorescein

-p

Gibco,

ro

hisH3. For phos-hisH3, tibia sections were blocked with 5% normal horse serum (16050130,

re

isothiocyanate (FITC) secondary antibody (1 in 1000 dilution, 656111, ThermoFisher, Australia). Sections were counterstained with Mayer’s hematoxylin (Prosci Tech, QLD,

lP

Australia) or Prolong-Gold DAPI (P36931, ThermoFisher, Australia) and evaluated under an

na

Olympus BX51 microscope (Olympus Australia Pty. Ltd., Gulfview Heights, SA) fitted with Soft Imaging System’s Colorview III camera and analySIS® LS software at Adelaide

Jo ur

Microscopy. Representative images of each antibody stain and the boundary between each growth plate zone is shown in the supplementary figure. The total number of cells and the number of cells staining positive for each antibody was determined in a 250μm wide strip that encompassed all growth plate zones using Olympus analySIS® LS Research Olympus Soft Imaging Solutions (version 3.1) software. This was repeated for a total of 3 measurements across the growth plate and the percentage of positive cells (% of total) was averaged for each zone.

Transmission electron microscopy

7

Journal Pre-proof Tibiae from normal and MPS VII mice aged 14 days were fixed in Karnovsky’s fixative supplemented with 0.7% (v/v) safranin O [44] for 2 hours and then decalcified for 7 days in 14% EDTA (pH 7.4) with 0.1% glutaraldehyde. Tibia were post fixed in 2% (w/v) osmium tetroxide, processed and embedded in Araldite-Procure resin (Pelco BioWave; Pelco International) [40, 41, 45]. Semithin (1µm) sections were stained with 1% (w/v) toluidine blue in 1% (w/v) borax for orientation. Ultrathin (80nm) sections were cut on a Leica UltraCut S Ultramicrotome (Leica system, Germany) with an ultra-diamond knife. The

of

sections were mounted on copper grids and stained with uranyl acetate and lead citrate for

ro

7mins. The ultrathin sections were examined with a Tecnai G2 Spirit transmission electron

-p

microscope (FEI, Eindhoven, the Netherlands) equipped with a VELETA CCD camera

re

(Olympus SIS, Münster, Germany) and EDS system comprising an Apollo XLT SDD

na

Gene expression analysis

lP

running EDAX's TEAM software were used.

The proximal tibial growth plate from 14 day old normal and MPS VII mice was dissected

Jo ur

clear of bone, epiphyseal cartilage and surrounding perichondrium. For gene expression analysis in the whole growth plate, samples were snap-frozen in liquid nitrogen and stored at -80 ºC until RNA isolation. Whole growth plates were finely ground in liquid nitrogen, homogenised by passage over a QIAshredder column (Qiagen, Maryland, USA) and RNA isolated using the RNaqueous® Micro Kit (Ambion, Life technologies, VIC, Australia) including a DNaseI digestion. For gene expression analysis in the PZ, whole growth plates were snap frozen in OCT using pre-cooled isopentane in liquid nitrogen and stored at -80°C. Five µm longitudinal sections were cut using a Microm HM 505E Cryostat (Thermo Scientific, VIC, Australia), pre-cooled to -22°C (maintained between -20 and 23°C) and mounted on Leica® polyethylene terephthalate slides (Leica Microsystems Pty Ltd, NSW,

8

Journal Pre-proof Australia). Slides were fixed in 70% (v/v) EtOH in diethylpyrocarbonate (DEPC) treated water for five minutes with regular agitation. The PZ, which included pre-hypertrophic cells (see supplementary figure for definition of growth plate zones), was excised using a Leica Applied Solution Laser Microdissection microscope (Leica Microsystems Pty Ltd, NSW, Australia) and RNA isolated using the RNAqueous®-Micro Kit according to the RNA Isolation Procedure for LCM Samples. The concentration of RNA isolated by either procedure was determined using a Thermo Scientific NanoDrop 1000 and its operating

of

software, version 3.8.1 (Thermo Scientific, VIC, Australia). cDNA was prepared using the

ro

QuantiTect® Reverse Transcription Kit (Qiagen, Maryland, USA). Primer sequences are

-p

shown in Table 1. Quantitative real-time PCR was performed on an ABI 7300 real-time PCR

re

system (Applied Biosystems, Life Technologies, California, USA) using SYBR® Green

Statistics

na

using the ΔΔCt method [46].

lP

Master Mix. Data was normalized to cyclophillin A and the fold change to normal calculated

Jo ur

Statistical significance was determined by a Student’s t-test or two-way ANOVA with a Tukey’s HSD post-hoc analysis using GraphPad Prism version 7.0 (GraphPad Software Inc., California, USA). Statistical significance was assumed when p<0.05.

9

Journal Pre-proof Results: Growth plate height Total growth plate height decreased with age in both normal and MPS VII but was significantly greater than normal in MPS VII mice from 1 month of age onwards (Figure. 1A). Measurement of individual growth plate zone heights was determined at 14 days, 1 month and 2 months of age only as individual zones were difficult to distinguish in older (6 months old) animals. Normal RZ height decreased with age while MPS VII RZ height

of

remained constant and was significantly greater than normal at all ages (Figure 1B). Both

ro

normal and MPS VII PZ heights decreased with age and there was no significant difference

-p

was observed between genotype at any age (Figure 1C). Normal HZ height decreased with

re

age while MPS VII HZ height remained relatively constant and was significantly lower than

na

Cell number and apoptosis

lP

normal at day 14 and significantly higher than normal at 2 months of age (Figure 1D).

In the RZ, the cell number per unit area declined from 14 days to 1 month of age, with no

Jo ur

difference observed between normal and MPS VII at 14 days and 1 month of age (Figure 2A). However, at 2 months of age, a significant increase in the number of cells per mm 2 was observed in MPS VII (2471 ± 118 cells/mm2) compared to normal (1600 ± 157 cells/mm2). While cell number in normal PZ remained constant, cell number in MPS VII PZ was declined with age and was significantly lower at 1 month and 2 months of age when compared to normal (Figure 2B). More hypertrophic cells (Figure 2C) were observed in MPS VII mice (2623 ± 72 cells/mm2) at 14 days of age when compared to normal mice (2255 ± 55 cells/mm2; p<0.05), but MPS VII mice had significantly fewer hypertrophic cells (2152 ± 85 cells/mm2) at 2 months of age when compared to normal mice (2935 ± 93 cells/mm 2; p<0.05).

10

Journal Pre-proof

To determine whether the changes in cell number in the RZ, PZ and HZ of MPS VII growth plates was the result of impaired apoptosis, the expression of apoptosis-related genes in whole growth plate was evaluated. The Bax/Bcl2 ratio was not significantly different to normal in the MPS VII growth plate (Figure 2D). Casp3 expression was significantly increased in MPS VII mice (Figure 2E). Immunohistochemistry using an antibody to caspase 3 confirmed these results, however, there was no evidence of active caspase 3 expression in

of

either MPS VII or normal growth plate (Figure 2F). FasL was not detected in either normal

-p

ro

or MPS VII growth plate (data not shown).

re

Cell size:

lP

During formalin fixation chondrocytes shrink in size and detach from their lacunae wall [43]. To determine cell size in growth plate cartilage, the average vertical and horizontal diameter

na

of lacunae was measured as proxies of chondrocyte size. Both vertical and horizontal

Jo ur

diameter significantly increased in MPS VII RZ cells from 14 days onwards (Figure 3A). Horizontal cell diameters increased in both PZ and HZ from 1 month of age onwards, but vertical diameter was not significantly different at any age. The increase in cell size is most likely related to storage of undegraded GAG which was clearly visible in all growth plate zones from 14 days of age (Figure 3B).

Cell cycle analysis: Cells throughout the normal growth plate were positive for Ki67 antigen, a marker for all active phases of the cell cycle (Figure 4A). The total number of cells positive for Ki67 in the MPS VII growth plate was significantly increased, with the number of positive cells in the PZ and HZ 175.5 ± 23.8% and 251.5 ± 62.6% of normal respectively. Normal PZ chondrocytes 11

Journal Pre-proof stained strongly for phos hisH3, a marker of cells undergoing mitosis (Figure 4B). In contrast, the number of chondrocytes staining for phos hisH3 decreased to 62.9 ± 23.7% of normal in the MPS VII PZ. Chondrocytes in the HZ did not stain for phos hisH3 in either normal or MPS VII growth plate. Expression of cyclin/CDK inhibitor p57kip2, a marker for terminally differentiated cells destined to exit the cell cycle, was significantly increased in the HZ compared to the PZ in the normal growth plate (Figure 4C). In MPS VII the number of HZ chondrocytes positive for p57kip2 was significantly less than normal (50.9 ± 18.9% of

of

normal). In addition, the number of MPS VII HZ cells expressing p57kip2 was not

ro

significantly different to the number expressing p57kip2 in the PZ indicating that the normal

re

-p

upregulation of p57kip2 during PZ to HZ transition necessary for chondrocytes was impaired.

To investigate why fewer MPS VII chondrocytes were progressing to either mitosis or

lP

terminal differentiation the number of cells positive for markers of cell cycle checkpoint

na

regulators was examined. Cells positive for cyclin D1, a G1 phase marker that regulates effectors of G1/S phase transition, were observed predominantly in the PZ of normal growth

Jo ur

plate, while HZ chondrocytes were negative for cyclin D1 (Figure 4D). In MPS VII a higher level of cyclin D1 staining was observed throughout the growth plate and unlike normal MPS VII HZ cells persisted in expressing cyclin D1. pRb, p130 and p107 are pocket proteins, regulated by cyclin D1. They bind to E2F transcription factors that promote G1/S phase entry. Cells positive for the pocket protein phos pRb were predominantly observed in the normal RZ and PZ and the number of positive cells significantly decreased in the HZ (Figure 4E). In contrast, the number of MPS VII chondrocytes positive for phos pRb was relatively consistent throughout the growth plate zones. The number of MPS VII HZ cells positive for phos pRb was the same as in the PZ and was significantly greater than normal (387.1 ± 81.2% of normal). Cells positive for the pocket protein phos p130, were observed throughout

12

Journal Pre-proof the normal growth plate (Figure 4F). In MPS VII growth plate the number of cells positive for phos p130 in the three zones was not significantly different to normal. The expression of phosphorylated pocket protein p107 was not observed in the growth plate of either normal or MPS VII mice (data not shown). E2F1, the activator E2F protein, was mainly observed in the RZ and PZ of the normal growth plate and the number of positive cells significantly decreased in the HZ (Figure 4G). An increased number of cells positive for E2F1 was observed in all zones of the MPS VII growth plate, with an increase of 123.8 ± 24.6%, 170.3

of

± 22.6%, 279.6 ± 15.7% of normal in the RZ, PZ and HZ, respectively. Unlike normal no

ro

decrease in the number of cells positive for E2F1 was observed in the HZ compared to PZ.

-p

The number of cells positive for E2F4, the most abundant transcription repressor of the E2F

re

family, was relatively constant throughout the zones of the normal growth plate (Figure 4H). In the MPS VII growth plate, the number of cells positive for E2F4 were significantly

lP

decreased to 13.8 ± 12.2% and 8.8 ± 7.9% of normal in the RZ and PZ, respectively. While

na

the number of cells positive for cyclin D1, phos pRb and E2F1 decreased in the HZ compared to the PZ of normal growth plates, the number of cell positive for these factors did not

Jo ur

decrease in MPS VII HZ, suggesting that transition to the hypertrophic phenotype is disrupted in MPS VII.

Markers of the initiation of DNA synthesis (S phase) were also examined. Cells positive for DNA polymerase α were observed throughout the normal growth plate (Figure 4I) and this was not significantly altered in MPS VII. Likewise, cells positive for phos MCM2 were observed throughout the normal growth plate (Figure 4J) a similar pattern was observed in MPS VII.

Expression of genes regulating chondrocyte proliferation and hypertrophy

13

Journal Pre-proof RNA was extracted from whole growth plate cartilage, comprising a combination of the RZ, PZ and HZ. The expression of the majority of genes examined was not significantly different between normal and MPS VII with the exception of Ihh and Gli3 which were downregulated (0.46 ± 0.06 fold change to normal) and upregulated (2.07 ± 0.04 fold change to normal) respectively in MPS VII (Figure 5, grey bars). Because the expression of structural and regulatory genes occurs in a highly organised and spatially specific manner in the growth plate the PZ and pre-hypertrophic zone was isolated using laser capture microdissection to

of

analyse gene expression in this discrete region [10, 47]. In this region an increased expression

ro

of genes associated with a delay in hypertrophy was observed (Figure 5, white bars). Pthrpr,

-p

expression was increased 4.4 ± 0.6 fold over normal, its downstream effector Sox9 was

Jo ur

na

lP

re

increased 3.1 ± 0.6 fold over normal, while Wnt5a increased 4.4 ± 0.7 fold over normal.

14

Journal Pre-proof DISCUSSION Of the 206 bones in the adult skeleton the majority form and subsequently elongate via EO, where a rapidly growing cartilage template is transformed into bone during childhood. EO is disturbed in MPS with a delay in the development of ossification centres observed in murine MPS VII [38] and a reduction in growth velocity and height in MPS I, II, IVA, IVB, VI and VII children [2-5, 8, 48]. Growth plate structural irregularities are observed in both human and MPS animal models [23, 24, 28, 29, 31, 33, 36, 42, 49]. Current therapeutic approaches

of

have so far been unable to restore normal bone length [50-52], although sibling studies show

ro

that the earlier children start treatment the better the outcome [53, 54] as younger children

-p

still retain some capacity for growth. It is becoming apparent that alternate approaches will be

re

needed to maximise bone growth most likely in the area of adjunct treatment to specifically target this aspect of MPS disease. Here, a MPS VII mouse model was used to characterise the

lP

temporal and spatial abnormalities of the structure and cellularity of MPS growth plate and to

Jo ur

na

gain insight into the underlying mechanism of impaired EO in MPS.

In the normal tibia, total growth plate height decreased with age due to a decrease in the height of each zone. The MPS VII growth plate was significantly larger than normal due predominantly to an increase in RZ height and to a lesser extent to an increase in the HZ at 2 months of age. A similar increase in growth plate height is observed in the MPS VI cat [29, 42], again due to an increase in the RZ and HZ [42], indicating that this disturbance may be common to multiple MPS types. The number of cells per unit area decreased with age in the normal RZ but did not significantly change with age in the PZ and HZ, while an overall decrease in cellularity was observed in the PZ and HZ regions of the MPS VII growth plate. Unlike in the normal growth plate where skeletal stem cells in the RZ refill the pool of proliferative cells [55] the number of cells in the MPS VII RZ remained at a relatively 15

Journal Pre-proof consistent level with age, indicating that MPS VII RZ chondrocytes may not receive the correct cues to initiate cell division. Despite the similarity in PZ height, cell number per unit area progressively fell below normal with age in MPS VII. HZ cell number was also significantly lower than normal by 2 months of age although HZ height had increased. Growth plates that grow rapidly have more chondrocytes and longer cell columns in the PZ [16]. The observation that cell density is reduced in MPS VII together with fewer cells per column [33], suggest that the MPS VII proximal tibial growth plate is elongating at a slower

of

rate than normal. Hypertrophic expansion accounts for greater than 50% of growth depending

ro

on species and individual growth plate [17, 18] and a reduction in HZ cells would be

-p

expected to reduce the level of expansion and therefore of growth rate. Both the reduction in

re

PZ and HZ cells in MPS VII point towards a slower rate of growth than normal leading to a reduction in bone length. Although the expression of caspase 3 increased in the MPS VII

lP

growth plate, the absence of activated caspase 3, the normal Bax/Bcl2 ratio and the lack of

na

TUNEL staining [33] suggest that increased apoptosis was not implicated as a mechanism

Jo ur

leading to the reduced number of PZ and RZ cells.

Bone growth is a consequence of proliferation, matrix synthesis and hypertrophic expansion by growth plate chondrocytes [17]. Proliferation and hypertrophy are strictly controlled by synchronized cell cycle progression of growth plate chondrocytes [20, 21]. Chondrocytes enter the cell cycle, undergo several rounds of proliferation and then exit the cell cycle to terminally differentiate (hypertrophy) [20]. The length of time needed to complete 1 cell cycle varies between growth plates, with chondrocytes in slower growing growth plates taking longer to complete the cycle due mainly to extended time periods in the G1 phase [22].

16

Journal Pre-proof In the normal growth plate 20.2% ± 3.6 % cells were found to be in the cell cycle as demonstrated by staining for Ki67. Cells undergoing mitosis (phos hisH3 positive) were observed primarily in the PZ and RZ with no cells staining for this marker in the HZ. There was a significant increase in the number of cells staining for p57kip2 in the HZ as chondrocytes exit the cell cycle and terminally differentiate. This was supported by the lack of cyclin D1 expression by cells in the HZ. In contrast to this normal progression through the cell cycle, more MPS VII chondrocytes were found to be in the cell cycle (38.2 ± 2.9%), but

of

significantly fewer PZ cells were positive for phos hisH3 and fewer HZ cells were positive

ro

for p57kip2. In addition MPS VII HZ cells still expressed cyclin D1. Similar to MPS VII mice,

-p

p57kip2 knockout mice have shorter limbs and smaller ossification centres due to delayed cell

re

cycle exit during chondrocyte hypertrophy [56, 57]. In contrast to MPS VII, p57kip2 knockout mice display enhanced chondrocyte proliferation, whereas in MPS VII proliferative capacity

lP

is adversely affected with fewer chondrocytes positive for a marker of mitosis. Cyclin D1

na

overexpression is observed in the dtd mouse model of GAG under-sulphation which displays decreased limb length [58, 59]. Overall, our results suggest that fewer MPS VII chondrocytes

differentiate.

Jo ur

were able progress out of G1 phase and through the cell cycle in order to divide or terminally

Movement between cell cycle phases is governed by checkpoint regulators [60]. The balance of activator and repressor E2F proteins and their associated pocket proteins pRB, p107 and p130 regulate G1/S phase transition of the cell cycle [61]. While free E2F1 promotes transcription of genes required for DNA replication [62], nuclear E2F4/pocket protein complexes inhibit this process [61]. In the normal growth plate the number of cells positive for E2F1 decreased as cells transition from the proliferative to hypertrophic state as did the number of cells positive for the E2F1 associated pocket protein pRb. As E2F1 accumulates in

17

Journal Pre-proof late G1 and is degraded in S/G2 this suggests that normal chondrocytes are progressing through the cell cycle, which in the case of HZ cells results in cell cycle exit and hypertrophy. In contrast, the number of MPS VII cells positive for E2F1 and phos pRb did not alter as chondrocytes transition to the hypertrophic phenotype with a significantly higher number of MPS VII HZ chondrocytes positive for E2F1 and phos pRb compared to normal. Thus their ability to progress through the cell cycle to hypertrophy is reduced and this is confirmed by the reduced number of MPS VII HZ cells positive for p57kip2. The number of PZ

of

chondrocytes positive for E2F1 in MPS VII was also significantly higher than normal. Again

ro

this suggests a reduced capacity to move out of the G1 phase of the cell cycle and in this

-p

instance would affect MPS VII PZ cell capacity to divide. E2F1 overexpression is known to

re

inhibit chondrocyte hypertrophic differentiation resulting in delayed endochondral ossification [63] while an abnormal expression pattern of pRb is observed in the dwarfed

lP

ATF2 null mouse [64]. E2F4 is a transcriptional repressor of cell cycle genes and thus is

na

expected to promote cell cycle exit. E2F4 appeared to be constitutively expressed across the normal growth plate with little variation in the number of cells positive for E2F4 in the

Jo ur

different zones. Similarly no variation in the number of cells positive for E2F4 in different zones was noted in the MPS VII growth plate, but the number of positive cells was much lower than in the corresponding zone of the normal growth plate. This reduction in E2F4 particularly in the MPS VII HZ is expected to contribute to the reduction in the number of cells positive for p57kip2 and thus exiting the cell cycle.

The ubiquitin-proteasome pathway is responsible for the degradation of a number of cell cycle proteins including cyclin D1 and E2F1. [65-70]. This pathway is abnormal in MPS and other lysosomal storage disorders [71, 72], leading to the build-up of ubiquinated proteins

18

Journal Pre-proof and a reduction in proteasome activity. Therefore, it is possible that ubiquitin-dependent degradation of cyclin D1 and E2F1 is reduced in the MPS VII growth plate. In addition pRb protects E2F1 from ubiquitin-dependent degradation and the increased number of HZ cells positive for pRb combined with a potential impairment of the proteasome itself would result in the persistence of E2F1 in MPS VII HZ chondrocytes thus hampering proliferative to

of

hypertrophic transition.

ro

The reduced ability of MPS VII growth plate chondrocytes to progress to the hypertrophic

-p

phenotype was further supported by the sustained expression of Pthrpr, Sox9 and Wnt5a by PZ cells. PTHrP maintains chondrocytes in the proliferative stage by promoting the

re

expression of SOX9; and delays chondrocyte hypertrophy by repressing the expression of

lP

RUNX2 and p57kip2 [73, 74]. Therefore, for chondrocytes transiting from proliferative to

na

hypertrophic stage SOX9 and PTHrP should be downregulated while RUNX2 and p57kip2 should be upregulated. MPS VII PZ chondrocytes exhibited higher level of Pthrpr and Sox9

Jo ur

as compared to normal, suggesting a delayed transition from proliferation to hypertrophic differentiation. Similarly SOX9 protein was not downregulated in MPS VII dog vertebral chondrocytes during proliferative-hypertrophic turnover [39]. WNT5A promotes entry into the pre-hypertrophic stage, but conversely blocks hypertrophy [75, 76]. Wnt5a expression was elevated in the MPS VII PZ supporting the notion that transition to hypertrophy is reduced in MPS VII chondrocytes. The reduced number of chondrocytes in MPS VII HZ therefore also be attribute to an impairment in the PTHrP and WNT signalling pathways. Although these chondrocytes were morphologically hypertrophic, they were more typical of proliferative cells, failing to undergo phenotypical changes for hypertrophic differentiation. Interestingly, these changes were not observed when whole growth plate RNA was examined. The growth plate is a highly organised structure and many factors function in the growth 19

Journal Pre-proof plate in both a temporally and spatially specific manner [10, 47]. Assessment of gene expression in the whole growth plate potentially masks subtle divergence from normal and careful dissection to isolate specific growth plate regions is required to fully uncover differences.

No difference was observed between normal and MPS VII in the number of chondrocytes

of

expressing phos MCM2 or DNA polymerase α, both of which function to initiate DNA

ro

replication [77-79]. However, BrdU incorporation is reduced in MPS VII growth plate [33]

-p

indicating that while DNA replication is initiated it is not completed. In cancer cells, S phase blockage using hydroxyurea or aphidicolin triggers similar responses in that DNA replication

re

ceases and cells are unable to progress to mitosis, leading to return to G1 phase [80-83]. This

na

chondrocytes was inhibited.

lP

also support the notion that DNA replication during mid-late S phase in MPS VII PZ

Jo ur

In agreement with Metcalf and colleagues the expression of Ihh was reduced in MPS VII chondrocytes [33] and this correlated with an increase in expression of Gli3 the downstream mediator of IHH function [84, 85]. IHH is expressed by pre-HZ chondrocytes and diffuse to the PZ to promote chondrocyte proliferation [86] and is known to interact with the major cartilage proteoglycan aggrecan via its chondroitin sulfate glycosaminoglycan side chains [59, 87]. The abnormal degradation of GAG and the resultant build-up of partially degraded fragments particularly in cartilage extracellular matrix interferes with the IHH morphogen gradient crucial for chondrocyte proliferation and differentiation.

Overall the picture that emerges is one of reduced proliferation combined with reduced transition to the hypertrophic phenotype. MPS VII chondrocytes appear to have entered the 20

Journal Pre-proof cell cycle but are less able to transition from G1 to S phase and therefore less able to progress to mitosis or to exit the cell cycle. This results in a growth plate with fewer PZ and HZ cells combined with HZ cells that are more phenotypically aligned with PZ cells. Together this presents a picture typical of slowly growing growth plates rather than the grossly abnormal growth plate structure and function observed in some other genetic skeletal dysplasias [88]. Impaired IHH, PTHrP and WNT signalling pathways are implicated in the abnormal control of MPS VII bone growth and suggest potential intervention points for the restoration of

ro

of

normal growth.

-p

Acknowledgements:

re

This project was supported by a grant from the WCH Research Foundation. A Derrick-

Authors’ contribution:

na

lP

Roberts is the recipient of the “Malcolm Douglas Grant Post-Doctoral” research fellowship.

Jo ur

ZJ contributed to conceptual design, performed experiments, data analysis, and drafted the manuscript; ADR provided conceptual input on experiment design and data analysis; CR performed gene expression experiment and analyses; SB contributed to conceptual design, data analysis and drafted the manuscript. All authors reviewed and approved the manuscript prior to submission.

Figure Legends. Figure 1: Growth plate height.

21

Journal Pre-proof Total growth plate height (A) and the height of the resting zone (B), proliferative one (C) and hypertrophic zone (D) in normal (solid line) and MPS VII (dashed line) mice aged 14 days to 2 months. Results are expressed as the mean ± std dev. Animal numbers per age are 14 days: 10 normal and 10 MPS VII, 1 month: 6 normal and 8 MPS VII, 2 months: 5 normal and 5 MPS VII, 6 months: 4 normal and 4 MPS VII. * represents significant difference (p<0.05) between normal and MPS VII, two-way ANOVA

-p

Figure 2: Chondrocyte number and apoptosis.

ro

of

Tukey’s HSD post-hoc.

re

The number of chondrocytes in the resting zone (A), proliferative zone (B) and hypertrophic

lP

zone (C) of normal (solid line) and MPS VII (dashed line) mice aged 14 days to 2 months. Results are expressed as the mean ± std dev. The Bax/Bcl2 gene expression ratio (D) and

na

caspase 3 expression (E) in 14 days old MPS VII growth plate are expressed as the fold change compared to normal. Results are expressed as the mean ± std dev. IHC of caspase 3

Jo ur

(F) and activated caspase 3 (G) in 14 days old normal and MPS VII growth plate. * denotes significant difference (p<0.05) between normal and MPS VII; # denotes significant difference (p<0.05) to 14 days of age in either normal or MPS VII; § denotes significant difference (p<0.05) to 1 month of age in either normal or MPS VII (only relevant to 2 months of age data); two-way ANOVA Tukey’s HSD post-hoc for A) to C), and Student’s t-test for E).

Figure 3: Chondrocyte size and lysosomal storage.

22

Journal Pre-proof Chondrocyte size was determined as the mean vertical diameter and mean horizontal diameter of the cell lacunae in the resting zone (A), proliferative zone (B) and hypertrophic zone (C) of the growth plate. Results are expressed as the mean ± std dev. Animal numbers per age are 14 days: 7 normal and 5 MPS VII, 1 month: 6 normal and 8 MPS VII, 2 months: 3 normal and 5 MPS VII. EM of chondrocytes from MPS VII growth plate at 14 days of age (D).

ro

of

* denotes significant difference (p<0.05) between normal and MPS VII, Student’s t-test.

-p

Figure 4. Immunohistochemistry of cell cycle markers.

re

Day 14 normal (white bar) and MPS VII (grey bar) mouse proximal tibia growth plates were

lP

incubated with antibodies to Ki67 (A), phos hisH3 (B), p57kip2 (C), cyclin D1 (D), phos pRb (E), phos p130 (F), E2F1 (G), E2F4 (H), DNA polymerase α (I) and phos MCM2 (J). The

na

number of positive staining cells was calculated as a percentage of the total cell number ineach growth plate zone. Results are expressed as the mean ± std dev of n=3 replicates per

Jo ur

genotype, except for histone H3 (phosphor Ser10) (phos-hisH3) and DNA polymerase α where n=5 replicates per genotype were analyzed. Scale bar= 200μm. RZ = resting zone, PZ= proliferating zone and HZ= hypertrophic zone. * indicates MPS VII significantly different to normal, p <0.05, two-way ANOVA Tukey’s HSD post-hoc # indicates HZ significantly different to PZ, p<0.05, two-way ANOVA Tukey’s HSD posthoc

Figure 5. Expression of genes regulating chondrocyte hypertrophy. 23

Journal Pre-proof RNA was isolated from either the whole growth plate comprising the RZ, PZ and HZ (grey bars) or from the PZ only (white bars). Gene expression was normalised to cyclophilin A and expressed as the fold change MPS VII to normal. Results are presented as the mean ± std dev of n= 6 replicates. * denotes significant difference (p<0.05) between normal and MPS VII, Student’s t-test.

5. 6.

7. 8. 9. 10.

11. 12. 13. 14. 15.

ro

-p

re

4.

lP

3.

na

2.

Neufeld, E. and J. Muenzer, The Mucopolysaccharidoses, in The metabolic and molecular bases of inherited disease, C. Sciver, et al., Editors. 2001, McGraw hill: New York. p. 3421-3452. Rozdzynska-Swiatkowska, A., et al., Growth patterns in children with mucopolysaccharidosis I and II. World J Pediatr, 2015. 11(3): p. 226-31. Montaño, A.M., et al., Growth charts for patients affected with Morquio A disease. American Journal of Medical Genetics Part A, 2008. 146A(10): p. 1286-1295. Kubaski, F., et al., Bone mineral density in mucopolysaccharidosis IVB. Molecular Genetics and Metabolism Reports, 2016. 8: p. 80-84. Montano, A.M., et al., Clinical course of sly syndrome (mucopolysaccharidosis type VII). J Med Genet, 2016. 53(6): p. 403-18. Sly, W.S., et al., Beta glucuronidase deficiency: report of clinical, radiologic, and biochemical features of a new mucopolysaccharidosis. J Pediatr, 1973. 82(2): p. 24957. Melbouci, M., et al., Growth impairment in mucopolysaccharidoses. Mol Genet Metab, 2018. 124(1): p. 1-10. Quartel, A., et al., Growth Charts for Individuals with Mucopolysaccharidosis VI (Maroteaux-Lamy Syndrome). JIMD Rep, 2015. 18: p. 1-11. Burdan, F., et al., Morphology and physiology of the epiphyseal growth plate. Folia Histochem Cytobiol, 2009. 47(1): p. 5-16. Mackie, E.J., L. Tatarczuch, and M. Mirams, The skeleton: a multi-functional complex organ: the growth plate chondrocyte and endochondral ossification. J Endocrinol, 2011. 211(2): p. 109-21. Iannotti, J., Growth plate physiology and pathology. Orthopedic Clinics of North America, 1990. 21(1): p. 1–17. Byers, S., et al., Immunolocation analysis of glycosaminoglycans in the human growth plate. J Histochem Cytochem, 1992. 40(2): p. 275-82. Byers, S., et al., Effect of enzyme replacement therapy on bone formation in a feline model of mucopolysaccharidosis type VI. Bone, 1997. 21(5): p. 425-31. Gibson, G.J. and M.H. Flint, Type X collagen synthesis by chick sternal cartilage and its relationship to endochondral development. J Cell Biol, 1985. 101(1): p. 277-84. Hunziker, E.B., R.K. Schenk, and L.M. Cruz-Orive, Quantitation of chondrocyte performance in growth-plate cartilage during longitudinal bone growth. J Bone Joint Surg Am, 1987. 69(2): p. 162-73.

Jo ur

1.

of

References

24

Journal Pre-proof

23. 24.

25.

26. 27. 28. 29. 30. 31.

32. 33. 34. 35. 36.

37.

of

22.

ro

21.

-p

20.

re

19.

lP

18.

na

17.

Farnum, C.E. and N.J. Wilsman, Determination of proliferative characteristics of growth plate chondrocytes by labeling with bromodeoxyuridine. Calcif Tissue Int, 1993. 52(2): p. 110-9. Wilsman, N.J., et al., Differential growth by growth plates as a function of multiple parameters of chondrocytic kinetics. J Orthop Res, 1996. 14(6): p. 927-36. Breur, G.J., et al., Linear relationship between the volume of hypertrophic chondrocytes and the rate of longitudinal bone growth in growth plates. J Orthop Res, 1991. 9(3): p. 348-59. Miller, J.P., et al., Interweaving the cell cycle machinery with cell differentiation. Cell Cycle, 2007. 6(23): p. 2932-8. LuValle, P. and F. Beier, Cell cycle control in growth plate chondrocytes. Front Biosci, 2000. 5: p. D493-503. Beier, F., Cell-cycle control and the cartilage growth plate. Journal of Cellular Physiology, 2005. 202(1): p. 1-8. Wilsman, N.J., et al., Cell cycle analysis of proliferative zone chondrocytes in growth plates elongating at different rates. J Orthop Res, 1996. 14(4): p. 562-72. Silveri, C.P., et al., Hurler syndrome with special reference to histologic abnormalities of the growth plate. Clin Orthop Relat Res, 1991(269): p. 305-11. McClure, J., et al., The histological and ultrastructural features of the epiphyseal plate in Morquio type A syndrome (mucopolysaccharidosis type IVA). Pathology, 1986. 18(2): p. 217-21. Breider, M.A., R.M. Shull, and G. Constantopoulos, Long-term effects of bone marrow transplantation in dogs with mucopolysaccharidosis I. Am J Pathol, 1989. 134(3): p. 677-92. de Oliveira, P.G., et al., Characterization of joint disease in mucopolysaccharidosis type I mice. Int J Exp Pathol, 2013. 94(5): p. 305-11. Haskins, M.E., et al., The pathology of the feline model of mucopolysaccharidosis I. Am J Pathol, 1983. 112(1): p. 27-36. Russell, C., et al., Murine MPS I: insights into the pathogenesis of Hurler syndrome. Clin Genet, 1998. 53(5): p. 349-61. Abreu, S., et al., Growth plate pathology in feline mucopolysaccharidosis VI. Calcif Tissue Int, 1995. 57(3): p. 185-90. Crawley, A.C., et al., Enzyme replacement therapy from birth in a feline model of mucopolysaccharidosis type VI. J Clin Invest, 1997. 99(4): p. 651-62. Evers, M., et al., Targeted disruption of the arylsulfatase B gene results in mice resembling the phenotype of mucopolysaccharidosis VI. Proc Natl Acad Sci U S A, 1996. 93(16): p. 8214-9. Haskins, M.E., et al., Beta-glucuronidase deficiency in a dog: a model of human mucopolysaccharidosis VII. Pediatr Res, 1984. 18(10): p. 980-4. Metcalf, J.A., et al., Mechanism of shortened bones in mucopolysaccharidosis VII. Mol Genet Metab, 2009. 97(3): p. 202-11. Schultheiss, P.C., et al., Mucopolysaccharidosis VII in a cat. Vet Pathol, 2000. 37(5): p. 502-5. Wang, P., et al., Mucopolysaccharidosis VII in a Cat Caused by 2 Adjacent Missense Mutations in the GUSB Gene. J Vet Intern Med, 2015. 29(4): p. 1022-8. Rowan, D.J., et al., Assessment of bone dysplasia by micro-CT and glycosaminoglycan levels in mouse models for mucopolysaccharidosis type I, IIIA, IVA, and VII. J Inherit Metab Dis, 2013. 36(2): p. 235-46. Tomatsu, S., et al., Enzyme replacement therapy in newborn mucopolysaccharidosis IVA mice: Early treatment rescues bone lesions? Mol Genet Metab, 2014.

Jo ur

16.

25

Journal Pre-proof

45.

46.

47. 48.

49.

50.

51.

52.

53.

54. 55.

of

44.

ro

43.

-p

42.

re

41.

lP

40.

na

39.

Jiang, Z., et al., Delayed development of ossification centers in the tibia of prenatal and early postnatal MPS VII mice. Molecular Genetics and Metabolism, 2018. 124(2): p. 135-142. Peck, S.H., et al., Delayed hypertrophic differentiation of epiphyseal chondrocytes contributes to failed secondary ossification in mucopolysaccharidosis VII dogs. Molecular Genetics and Metabolism, 2015. 116(3): p. 195-203. Macsai, C.E., et al., Skeletal response to lentiviral mediated gene therapy in a mouse model of MPS VII. Mol Genet Metab, 2012. 106(2): p. 202-13. Derrick-Roberts, A.L., et al., Lentiviral-mediated gene therapy results in sustained expression of beta-glucuronidase for up to 12 months in the gus(mps/mps) and up to 18 months in the gus(tm(L175F)Sly) mouse models of mucopolysaccharidosis type VII. Hum Gene Ther, 2014. 25(9): p. 798-810. Nuttall, J.D., et al., Histomorphometric analysis of the tibial growth plate in a feline model of mucopolysaccharidosis type VI. Calcif Tissue Int, 1999. 65(1): p. 47-52. Hunziker, E.B., K. Lippuner, and N. Shintani, How best to preserve and reveal the structural intricacies of cartilaginous tissue. Matrix Biology, 2014. 39: p. 33-43. Wilson, R., et al., Comprehensive profiling of cartilage extracellular matrix formation and maturation using sequential extraction and label-free quantitative proteomics. Mol Cell Proteomics, 2010. 9(6): p. 1296-313. Kopecki, Z., et al., Flightless I Regulates Hemidesmosome Formation and IntegrinMediated Cellular Adhesion and Migration during Wound Repair. Journal of Investigative Dermatology, 2009. 129(8): p. 2031-2045. Livak, K.J. and T.D. Schmittgen, Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods, 2001. 25(4): p. 402-8. Samsa, W.E., X. Zhou, and G. Zhou, Signaling pathways regulating cartilage growth plate formation and activity. Semin Cell Dev Biol, 2017. 62: p. 3-15. Patel, P., et al., Impact of Enzyme Replacement Therapy and Hematopoietic Stem Cell Therapy on Growth in Patients with Hunter Syndrome. Mol Genet Metab Rep, 2014. 1: p. 184-196. Simonaro, C.M., et al., Joint and bone disease in mucopolysaccharidoses VI and VII: identification of new therapeutic targets and biomarkers using animal models. Pediatr Res, 2005. 57(5 Pt 1): p. 701-7. Gardner, C.J., et al., Growth, final height and endocrine sequelae in a UK population of patients with Hurler syndrome (MPS1H). J Inherit Metab Dis, 2011. 34(2): p. 48997. Polgreen, L.E., et al., Effect of recombinant human growth hormone on changes in height, bone mineral density, and body composition over 1–2years in children with Hurler or Hunter syndrome. Molecular Genetics and Metabolism, 2014. 111(2): p. 101-106. Polgreen, L.E., et al., Growth and endocrine function in patients with Hurler syndrome after hematopoietic stem cell transplantation. Bone Marrow Transplant, 2008. 41(12): p. 1005-11. Furujo, M., M. Kosuga, and T. Okuyama, Enzyme replacement therapy attenuates disease progression in two Japanese siblings with mucopolysaccharidosis type VI: 10-Year follow up. Molecular genetics and metabolism reports, 2017. 13: p. 69-75. McGill, J.J., et al., Enzyme replacement therapy for mucopolysaccharidosis VI from 8 weeks of age--a sibling control study. Clin Genet, 2010. 77(5): p. 492-8. Newton, P.T., et al., A radical switch in clonality reveals a stem cell niche in the epiphyseal growth plate. Nature, 2019. 567(7747): p. 234-238.

Jo ur

38.

26

Journal Pre-proof

63.

64. 65.

66.

67.

68. 69. 70. 71.

72.

73.

74.

of

62.

ro

61.

-p

60.

re

59.

lP

58.

na

57.

Yan, Y., et al., Ablation of the CDK inhibitor p57Kip2 results in increased apoptosis and delayed differentiation during mouse development. Genes Dev, 1997. 11(8): p. 973-83. Zhang, P., et al., Altered cell differentiation and proliferation in mice lacking p57KIP2 indicates a role in Beckwith-Wiedemann syndrome. Nature, 1997. 387(6629): p. 151-8. De Leonardis, F., et al., Altered signaling in the G1 phase deregulates chondrocyte growth in a mouse model with proteoglycan undersulfation. J Cell Biochem, 2014. 115(10): p. 1779-86. Gualeni, B., et al., Defective proteoglycan sulfation of the growth plate zones causes reduced chondrocyte proliferation via an altered Indian hedgehog signalling. Matrix Biol, 2010. 29(6): p. 453-60. Barnum, K.J. and M.J. O'Connell, Cell cycle regulation by checkpoints. Methods Mol Biol, 2014. 1170: p. 29-40. Moberg, K., M.A. Starz, and J.A. Lees, E2F-4 switches from p130 to p107 and pRB in response to cell cycle reentry. Mol Cell Biol, 1996. 16(4): p. 1436-49. Gaubatz, S., et al., E2F4 and E2F5 Play an Essential Role in Pocket Protein– Mediated G1 Control. Molecular Cell, 2000. 6(3): p. 729-735. Scheijen, B., et al., Constitutive E2F1 overexpression delays endochondral bone formation by inhibiting chondrocyte differentiation. Mol Cell Biol, 2003. 23(10): p. 3656-68. Vale-Cruz, D.S., et al., Activating transcription factor-2 affects skeletal growth by modulating pRb gene expression. Mech Dev, 2008. 125(9-10): p. 843-56. Alt, J.R., et al., Phosphorylation-dependent regulation of cyclin D1 nuclear export and cyclin D1-dependent cellular transformation. Genes Dev, 2000. 14(24): p. 310214. Clurman, B.E., et al., Turnover of cyclin E by the ubiquitin-proteasome pathway is regulated by cdk2 binding and cyclin phosphorylation. Genes Dev, 1996. 10(16): p. 1979-90. Hateboer, G., et al., Degradation of E2F by the ubiquitin-proteasome pathway: regulation by retinoblastoma family proteins and adenovirus transforming proteins. Genes Dev, 1996. 10(23): p. 2960-70. Koepp, D.M., et al., Phosphorylation-dependent ubiquitination of cyclin E by the SCFFbw7 ubiquitin ligase. Science, 2001. 294(5540): p. 173-7. Lin, D.I., et al., Phosphorylation-dependent ubiquitination of cyclin D1 by the SCF(FBX4-alphaB crystallin) complex. Mol Cell, 2006. 24(3): p. 355-66. Marti, A., et al., Interaction between ubiquitin-protein ligase SCFSKP2 and E2F-1 underlies the regulation of E2F-1 degradation. Nat Cell Biol, 1999. 1(1): p. 14-9. Bifsha, P., et al., Altered gene expression in cells from patients with lysosomal storage disorders suggests impairment of the ubiquitin pathway. Cell Death Differ, 2007. 14(3): p. 511-23. Tessitore, A., M. Pirozzi, and A. Auricchio, Abnormal autophagy, ubiquitination, inflammation and apoptosis are dependent upon lysosomal storage and are useful biomarkers of mucopolysaccharidosis VI. PathoGenetics, 2009. 2: p. 4-4. MacLean, H.E., et al., The cyclin-dependent kinase inhibitor p57(Kip2) mediates proliferative actions of PTHrP in chondrocytes. J Clin Invest, 2004. 113(9): p. 133443. Guo, J., et al., PTH/PTHrP receptor delays chondrocyte hypertrophy via both Runx2dependent and -independent pathways. Dev Biol, 2006. 292(1): p. 116-28.

Jo ur

56.

27

Journal Pre-proof

82. 83. 84. 85. 86.

87.

88.

of

81.

ro

80.

-p

79.

re

78.

lP

77.

na

76.

Bradley, E.W. and M.H. Drissi, WNT5A regulates chondrocyte differentiation through differential use of the CaN/NFAT and IKK/NF-kappaB pathways. Mol Endocrinol, 2010. 24(8): p. 1581-93. Yang, Y., et al., Wnt5a and Wnt5b exhibit distinct activities in coordinating chondrocyte proliferation and differentiation. Development, 2003. 130(5): p. 100315. Bruck, I., et al., Insights into the Initiation of Eukaryotic DNA Replication. Nucleus, 2015. 6(6): p. 449-54. Thompson, H.C., R.J. Sheaff, and R.D. Kuchta, Interactions of calf thymus DNA polymerase alpha with primer/templates. Nucleic Acids Res, 1995. 23(20): p. 410915. Garg, P. and P.M. Burgers, DNA polymerases that propagate the eukaryotic DNA replication fork. Crit Rev Biochem Mol Biol, 2005. 40(2): p. 115-28. Cho, S.H., et al., Chk1 is essential for tumor cell viability following activation of the replication checkpoint. Cell Cycle, 2005. 4(1): p. 131-9. Chen, S., et al., Norcantharidin inhibits DNA replication and induces mitotic catastrophe by degrading initiation protein Cdc6. Int J Mol Med, 2013. 32(1): p. 4350. Iwasaki, T., et al., Cell-cycle-dependent invasion in vitro by rat ascites hepatoma cells. Int J Cancer, 1995. 63(2): p. 282-7. Hung, D.T., T.F. Jamison, and S.L. Schreiber, Understanding and controlling the cell cycle with natural products. Chem Biol, 1996. 3(8): p. 623-39. Koziel, L., et al., Gli3 acts as a repressor downstream of Ihh in regulating two distinct steps of chondrocyte differentiation. Development, 2005. 132(23): p. 5249-60. Vortkamp, A., et al., Regulation of rate of cartilage differentiation by Indian hedgehog and PTH-related protein. Science, 1996. 273(5275): p. 613-22. Gritli-Linde, A., et al., The Whereabouts of a Morphogen: Direct Evidence for Shortand Graded Long-Range Activity of Hedgehog Signaling Peptides. Developmental Biology, 2001. 236(2): p. 364-386. Cortes, M., A.T. Baria, and N.B. Schwartz, Sulfation of chondroitin sulfate proteoglycans is necessary for proper Indian hedgehog signaling in the developing growth plate. Development, 2009. 136(10): p. 1697-706. Krakow, D. and D.L. Rimoin, The skeletal dysplasias. Genet Med, 2010. 12(6): p. 327-41.

Jo ur

75.

Table 1. Real-time PCR primer sequences. Gene

Forward primer(5’-3’)

Reverse primer(5’-3’)

accession #

Bax

CGAGAGGTCTTCTTCCGGGT

CACAGGGCCTTGAGCACC

NM_007527.3

Bcl2

GCGTCAACAGGGAGATGTCA

GTTCCACAAAGGCATCCCAG

NM_009741.4

Casp3

TCATTCAGGCCTGCCGGGGTAC

TCAGCCTCCACCGGTATCTTCTGG

NM_001284409.1

Ccnd1

GAGCTGCTGCAAATGGAACTG

ATCCGCCTCTGGCATTTTGG

NM_007631.2

CycA

AGCATACAGGTCCTGGCATC

TTCACCTTCCCAAAGACCAC

NM_008907.1

28

Journal Pre-proof ATGCACAGAAGGGAAGGAGT

CAGGGTGCAGTTTGTTTCCA

NM_007987.2

FasL

TGGTTGGAATGGGATTAGGA

AAGGCTTTGGTTGGTGAACT

NM_010177.4

Ihh

GACTGCTGGCGCGCTTAGCA

GCGGCCGAATGCTCAGACTTGA

NM_010544.2

Gli3

CAGCCCTGCATTGAGCTTCA

GCGGAGCCTAAGCTTTGCTGTC

NM_008130.2

Pthrpr

CAGGCGCAATGTGACAAGC

TTTCCCGGTGCCTTCTCTTTC

NM_011199.2

Runx2

CCAAGTAGCCAGGTTCAACG

TGGGGAGGATTTGTGAAGAC

NM_001146038.2

Sox9

CGGAGCTCAGCAAGACTCTG

GGGTGGTCTTTCTTGTGCTG

NM_011448.4

Wnt5a

AGACAGGCATCAAGGAATGC

GTCTCTCGGCTGCCYATTTG

NM_009524.3

Wnt5b

CCAGTGCAGAGACCGGAGATG

GTTGTCCACGGTGCTGCAGTTC

NM_009525.3

ro

of

FasR

MPS VII mice have elongated growth plate in the long bones but fewer chondrocytes

re



-p

Highlights

in the proliferative and hypertrophic zones.

MPS VII growth plates have delayed progression through the cell cycle leading to

lP



Findings in this study present a picture typical of slowly growing growth plates in MPS which is different from other genetic skeletal dysplasias that have grossly

Jo ur



na

both reduced cell division and transition to the hypertrophic phenotype.

abnormal growth plate structure and function.

29

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5