Cell entry of BmCPV can be promoted by tyrosine-protein kinase Src64B-like protein

Enzyme and Microbial Technology 121 (2019) 1–7

Contents lists available at ScienceDirect

Enzyme and Microbial Technology journal homepage: www.elsevier.com/locate/enzmictec

Cell entry of BmCPV can be promoted by tyrosine-protein kinase Src64B-like protein

T

Yiling Zhanga,b,1, Liyuan Zhua,1, Guangli Caoa,c,d, Mian Sahib Zara,e, Xiaolong Hua,c,d, ⁎ Yuhong Weia, Renyu Xuea,c,d, Chengliang Gonga,c,d, a

School of Biology and Basic Medical Sciences, Soochow University, Suzhou, 215123, China School of Biotechnology, Jiangsu University of Science and Technology, Zhenjiang, 212018, China c National Engineering Laboratory for Modern Silk, Soochow University, Suzhou, 215123, China d Agricultural Biotechnology Research Institute, Agricultural biotechnology and Ecological Research Institute, Soochow University, Suzhou, 215123, China e Institute of Synthetic Biology (iSynBio), Shenzhen Institute of Advanced Technology (SIAT), Chinese Academy of Sciences, 1068 Xuevuan Avenue, Shenzhen University Town, Shenzhen, 518055, China b

A R T I C LE I N FO

A B S T R A C T

Keywords: BmCPV Cell entry Src kinase Cellular signaling pathway

Bombyx mori cytoplasmic polyhedrosis virus (BmCPV) is a non-enveloped dsRNA virus, which specifically infect the midgut epithelium of B. mori. BmCPV enters permissive cells via clathrin-dependent endocytosis employing β1 integrin mediated internalization. Until now, the cell entry mechanism of BmCPV has not been known clearly. Here, we investigated whether tyrosine-protein kinase Src64B-like is involved in the cell entry of BmCPV. The Src64B-like gene was cloned and expressed in Escherichia coli (E. coli), and the recombinant protein Src64B-like was used to immunize mouse for preparation of anti-Src64B-like polyclonal antibody (pAb). After Src64B-like gene was silenced by RNAi, the infection of BmCPV was reduced by 59.48% ± 2.18% and 92.22% ± 1.12% in vitro and in vivo autonomously. Contrary to it, BmCPV infection could be enhanced by increasing the expression of Src64B-like. In addition, immunofluorescence assay showed that Src64B-like protein did not co-localize with BmCPV in the cultured BmN cells during viral infection. These results indicate that Src64B-like protein participates and plays an important role in the cell entry of BmCPV, but not contacting directly with BmCPV.

1. Introduction The cell entry of non-enveloped virus is initiated by recruitment of cell surface receptors by the capsid proteins of virus. This interaction subsequently elicit a series of alterations for virus and the host cell, including the dissociation and conformation change of capsid component and the opening of cell signal pathway, which ultimately results in the internalization of virus. Cytoplasmic polyhedrosis viruses (CPVs) are non-enveloped and double stranded RNA viruses, belong to Cypovirus in the family of Reoviridae [1–4] and have been found to specifically infect insects. CPV has a special polyhedra shell consists of polyhedrin surrounding the virions. Bombyx mori cytoplasmic polyhedrosis virus (BmCPV), a member of Cypovirus, is a catastrophic pathogen of silkworm that has distressed the sericulturists for long time. How to effectively control the silkworm cytoplasmic polyhedrosis is a serious concern for researchers. In theory, the inhibition of the virus invasion to host cells can avoid the

occurrence of silkworm cytoplasmic polyhedrosis. Therefore, it is important to make clear the real concept about the molecular mechanism of the BmCPV cell entry. Whereas so far, it has not been illustrated and there has been few reports about this issue. It has been reported that after swallowed by insect larvae, the polyhedra of CPVs is dissolved in the alkaline environment of intestinal juice, followed by release of virus particles into the intestine and attachment of virus particles to the microvilli faces of columnar epithelial cells. Subsequently, the viral genome (dsRNAs) is injected through the protuberance of virions and move towards the cell nucleus, leaving vacant shell outside of the cell [5]. Replication of viral dsRNAs is then proceeded in cell nucleus and mature virion is assembled in cytoplasm [6–8]. However, in 2006, it was reported that the BmCPV probably enter into the cylindrical cells with intact virions. After penetrated through the peritrophic membrane, the virions attached and invaded the microvilli to infect the cylindrical cells, followed by the degradation of the virus whereby the viral cores were exposed and entered into the nucleus to replicate [9].

⁎

Corresponding author at: No. 199 Ren’ai Road, Suzhou Industrial Park, Suzhou, 215123, Jiangsu, PR China. E-mail address: [email protected] (C. Gong). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.enzmictec.2018.10.012 Received 14 May 2018; Received in revised form 30 September 2018; Accepted 26 October 2018 Available online 29 October 2018 0141-0229/ © 2018 Published by Elsevier Inc.

Enzyme and Microbial Technology 121 (2019) 1–7

Y. Zhang et al.

Fig. 1. Construction of recombinant pasmids and preparation of anti-Src64B-like pAb. a. Identification of recombinant plasmid pET28aSrc64B-like. Lane 1: Digested pET28a-Src64Blike with EcoRI and HindIII. Lane M: DNA marker; b. Identification of recombinant plasmid pIZT/V5-His-Src64B-like. Lane 2: Digested pIZT/V5-His-Src64B-like with EcoRI and XbaI. Lane M: DNA marker; c. Identification of recombinant protein Src64Blike with SDS-PAGE. Lane 3: pET28a-Src64Blike-transformed BL21 cells. Lane 4: pET28atransformed BL21 cells. Lane M: protein marker; d. Identification of recombinant protein Src64B-like by western blot. The 6×His mAb was used as a primary antibody and HRP conjugated goat anti-mouse IgG was used as a secondary antibody. Lane 5: pET28a-Src64Blike-transformed BL21 cells. Lane M: protein marker; e. Specificity of the prepared pAbs was identified by western blot. The prepared mouse anti-Src64B-like serum was used as the primary antibody, and HRP conjugated goat anti-mouse IgG was used as the secondary antibody. Lane 6: Src64B-like expressing BL21 cells. Lane M: protein marker.

the cell entry of BmCPV. But the BmCPV virions did not co-localize with Src64B-like during cell entry. There is no direct contact with each other.

The cell entry molecular mechanism of mammalian reovirus, a member of Reoviridae, has been well understood. Following binding to cell-surface receptors sialic acid (SA), not a necessary condition, and junctional adhesion molecule-A (JAM-A), reovirus is internalized utilizing β1 integrin, probably by clathrin involved receptor-mediated endocytosis [10–16]. Src oncogene was originally discovered in Rous sarcoma virus (RSV) of chicken, encodes a 60 kDa non-receptor tyrosine kinase Src and thereby is called virus Src (v-Src) [17]. Where after, Src was also found in normal chicken cell, which was accordingly named as c-Src [18]. Src family kinase (SFK) includes 9 members [19,20], of which Fyn, c-Src, and c-Yes are almost expressed in all cell types nevertheless the others are usually expressed in hematopoietic cells [21–24]. c-Src, a non-receptor tyrosine kinase, has been found to modulate lots of cell processes and biological activities, including metastasis, survival, proliferation, differentiation, angiogenesis cytoskeletal rearrangements, adhesion and migration [19,25]. c-Src has also been implicated to mediate cell entry of various viruses such as enveloped viruses including herpes simplex virus 8 [26], Japanese encephalitis virus (JEV) [27], human immunodeficiency virus (HIV) [28], and bovine ephemeral fever virus (BEFV) [29], and non-enveloped viruses including reovirus [30,31], coxsackievirus [32] and infectious bursal disease virus (IBDV) [33]. Our recent studies have illustrated that both ganglioside GM2 and cholesterol in the cell membrane are essential for BmCPV cell entry [34], clathrin-mediated endocytosis is a candidate entry sorting mechanism for BmCPV [35], and integrin beta and receptor for activated protein kinase C (RACK 1) have a key role in the cell entrance of BmCPV [36]. Considering that integrin can bind to RACK 1 and Src can also bind to RACK 1, it is predicated that the cell entry of BmCPV is associated with integrin-RACK1-Src axis. In order to investigate the function of Src in the cell entrance of BmCPV, anti-Src64B-like polyclonal antibody (pAb) was prepared, and the RNAi and antibodyblocking analysis revealed that the Src of host cell might participate in

2. Materials and methods 2.1. Silkworms, cells and virus TC-100 insect medium (Gibco-BRL, Gaithersburg, USA), supplemented with 10% (v/v) fetal bovine serum (Invitrogen, Carlsbad, USA), was used to culture the BmN cell line derived from B. mori ovary [37,38] at 26℃ in cell culture flask. The first three instars of silkworm larvae (strain Dazao) were reared on fresh mulberry leaves at 27 ± 1℃, while the last two instars of silkworm larvae were nurtured on fresh mulberry leaves at 24 ± 1℃ under same photoperiod of 12-h day/night cycles and 75 ± 5% relative humidity [39]. The “BmCPV strain Suzhou (BmCPV-SZ)” was obtained from the available stock culture of our laboratory, which was isolated from Suzhou suburbs in 1986 [40]. The polyhedra were isolated from the silkworms and purified by sucrose density gradient centrifugation, and then the virions were obtained from polyhedral by incubating with Na2CO3-NaHCO3 buffer (0.2 M) as previously described [36]. 2.2. cDNA preparation RNAiso Plus coupled with total RNA extraction reagent (TaKaRa, Dalian, China) was used for the extraction of total RNA from cultured cells or organs of Bombyx mori larvae. After treated with DNaseI, PrimeScript ™ RT Reagent Kit (TaKaRa, Dalian, China) was used for reverse transcription of the total RNA. The obtained cDNA was kept at -70℃ for use. 2.3. Anitibody preparation In order to prepare anti-Src64B-like pAb, the Src64B-like gene 2

Enzyme and Microbial Technology 121 (2019) 1–7

Y. Zhang et al.

the cells were infected with prepared virus particles of BmCPV with final concentration of 2 × 105 lysed polyhedra /mL. In vivo, 1 μg siRNA was used to be injected to the one-day-old fourth instar silkworm larva at the part between the third and fourth segment. After 48 h, the larvae were raised with fresh mulberry leaves coated with the final concentration of 108 polyhedra/mL. At 48 h post-infection, the cells or midgut were collected and washed with PBS for 3 × 1 min. RNAiso Reagent (TaKaRa, Dalian, China) was used for total RNA extraction and then reverse transcription was carried out for cDNA synthesis. The relative expression was estimated by real time PCR using cDNA as template.

(GenBank accession No. AK378283) was amplified by PCR from the midgut cDNA with primers src64b-1(GAATTCATGGGTAACAAGTGTT GCAGCC, the underline was EcoRI site) and src64b-2(AAGCTTTCAAT CGTGTACCTCCTTGTACGG, the underline was HindIII site), and then cloned into pET28a(+) (Novagen, Darmstadt, Germany) vector to construct recombined prokaryotic expression vector pET28a-Src64Blike. A specific DNA band representing Src64B-like gene was detected after pET28a-Src64B-like was digested with EcoRI/ HindIII (Fig.1a), indicating that the prokaryotic expression vector had been constructed successfully. The rSrc64B-like was induced to be expressed in the prokaryotic expression E. coli strain BL21 with IPTG and a specific protein band, with molecular weight around 60 kDa, was observed either by SDS-PAGE (Fig.1c) or by western blot (Fig.1d), indicating that the rSrc64B-like had been successfully expressed in E. coli strain BL21. After ultrasonication, the rSrc64B-like proteins were purified from BL21 cells by nickel column (GE healthy, Pittsburgh, USA) based affinity chromatography. The purified protein was used as antigen to immune mice so as to obtain anti-rSrc64B-like pAb as described by Li [41]. The validity of prepared antibody was verified by western blot. The result showed that a 60 kDa-sized protein band was appeared in the PVDF membrane (Fig.1e), suggesting that the prepared anti-Src64B-like pAb can be used for subsequent study.

2.6. Real-time PCR For real-time PCR, the cDNAs was used as the template, B. mori actin A3 was normalized as the internal control gene and the program was set as: Pre-denaturation at 95℃ for 1 min, followed by 40 cycles of denaturation at 95℃ for 5 s and annealing together with extension at 60℃ for 30 s. The primer pairs of target gene that Actin 3, BmSrc64B-like and VP1, as listed in Table 2, were used for real-time PCR separately. Each sample was run with three repeats. The result data was analyzed using the method 2−△△Ct [42].

2.4. Western blot 2.7. Blocking of Src64B-like in BmN cells

To identify the expression of Src64B-like in E. coli or BmN cells, the induced bacteria cells or transfected cells were collected, centrifuged and incubated with 2 × SDS loading buffer (0.1 M Tris-Cl, 0.2 Mdithiothreitol, 4% w/v SDS, 20% v/v glycerol, 0.2% w/v bromophenol blue, 4% w/v dithiothreitol) in 100℃ for 10 min. After centrifugation, 12% acrylamide gel was used to separate the supernatant. When the electrophoresis was finished, the gel was stained by Coomassie Brilliant Blue R-250 or used for western blot. For western blot, the proteins in the gel were transferred into a polyvinylidene fluoride (PVDF) transmembrane at 100 V for 1 h. The membrane was washed with TBST (50 mM Tris-HCl, pH 7.6, 150 mM NaCl, 0.1% Tween-20) for 3 times per 10 min, followed by blocked with 4% bovine serum albumin (BSA) in TBST overnight at 4℃ and washed with TBST for 3 times per 5 min. Subsequently, the membrane was incubated with the primary anti-his tag antibody mouse monoclonal (AmyJet Scientific Inc, Wuhan, China) at 37℃ for 2 h, washed with TBST for 3 times per 5 min and then incubated with secondary antibody HRP-labeled goat anti-mouse IgG (AmyJet Scientific Inc, Wuhan, China) at 37℃ for 1 h. After the membrane was washed with TBST, the antibodies conjugated to HRP were detected using Clarity™ Western ECL Blotting Substrate (Bio-Rad, California, USA) according to the manufacturer’s protocol and visualized using Bio-Rad ChemiDoc XRS + system.

After incubated with different final concentrations of anti-Src64Blike pAbs (50, 100, 200 μg/mL) or unimmuned mouse serum (as a negative control) for 1 h, the culturing BmN cells in 6-well plate were washed with PBS, followed by being infected with 10 μL of 2 × 105 lysed polyhedra/mL. At 48 h post-infection, the cells were washed with PBS, and the total RNA were extracted and subjected to reverse transcription. The expression level of BmCPV viral structure protein VP1 gene was determined by real-time PCR.

2.8. Overexpression of Src64B-like in BmN cells In order to construct the recombinant pIZT/V5-His-Src64B-like, PCR was conducted by using the midgut cDNA as the template and the primers Src64b-1 and Src64B-XB (TCTAGACAATCGTGTACCTCCTTGT ACGG, the underline was XbaI site) to amplify Src64B-like gene. The PCR product was cloned into T vector, after confirmation by sequencing, and the Src64B-like gene was ligated to insect expression vector pIZT/V5-His (Invitrogen, Carlsbad, USA) so as to obtain recombinant plasmid pIZT/V5-His-Src64B-like, which was identified by digestion with EcoRI/XbaI. As shown in Fig. 1b, a specific DNA band representing src64B-like gene could be found after the pIZT/V5/His-Src64B-like was digested with EcoRI/XbaI, suggesting that the recombinant vector was constructed successfully. The recombinant plasmid was subsequently transfected into BmN cells using Cellfectin® II Reagent (Invitrogen, Carlsbad, USA) according to the manufacture’s instruction. The transfected cells were screened with Zeocin™ Selection Reagent (Invitrogen, Carlsbad, USA) at the final concentration of 300 μg/mL to establish a stably Src64B-like expressed cell line. The expression of Src64B-like was analyzed by western blot.

2.5. RNA interference Src64B-like-specific small interfering RNAs (siRNAs) (SRC-67, SRC540, SRC-898) and siRNA GFP-274, as the control, were synthesized by Shanghai Integrated Biotech Solutions Co., Ltd. in China. The sequence of these siRNAs are listed in Table 1. In vitro, when the confluence reach to 70%–80%, BmN cells cultured in 6-well plate were transfected with 1 μg siRNA per well. After 48 h, Table 1 The sequences of siRNAs. siRNA

Positive-sense strand sequence (5'-3')

antisense strand sequence (5'-3')

SRC-67 SRC-540 SRC-898 GFP-274

CGAGGAAGACCCUAGACAAUU CGAUAAGAUCUACGGUAAAUC CGCUGUGUGUACUCUUGAAGA GGCUACGUCCAGGAGCGCACC

UUGUCUAGGGUCUUCCUCGUG UUUACCGUAGAUCUUAUCGGA UUCAAGAGUACACACAGCGUA UGCGCUCCUGGACGUAGCCUU

3

Enzyme and Microbial Technology 121 (2019) 1–7

Y. Zhang et al.

Table 2 Primers for real-time PCR. Target gene

Forward primer sequence (5'-3')

Reverse primer sequence (5'-3')

Actin 3 BmSrc64B-like VP1

AACACCCCGTCCTGCTCACTG GTTTTTCATAGCCCGACGCAC GGTCTCGACGTGAATACCGA

GGGCGAGACGTGTGATTTCCT GGATTTGAGAGTTTTCGCCGC TCGTCTGCTTCACTAGCACG

3.2. Reduction of BmCPV infection were not found in the treated cells with Src64B-like antibody

2.9. Labeling BmCPV virions with Alexa Fluor 546 BmCPV virions were labeled with Alexa Fluor 546 as described by Mainou and Dermody [43]. Briefly, fifty BmCPV-infected midguts of silkworms were ground and centrifuged at 3000×g for 5 min. After the supernatant was centrifuged at 60,000×g for 3 h at 4 ℃, the pellet was dissolved in 3 mL of 0.05 M sodium bicarbonate (pH8.5), incubated with Alexa Fluor 546 (Beyotime, Shanghai, China) (dissolved in dimethylformamide) at the final concentration of 100 μM at room temperature for 90 min and then dialyzed using 1 × PBS (pH7.4) at 4℃. The BmCPV virions conjugated with Alexa Fluor 546 were stored at 4℃ for use.

c-Src has been found to combine to the inner side of the cytoplasmic membrane through a myristic acid [44]. So immunofluorescence was performed in order to authenticate if antibody could enter into BmN cells spontaneously. As shown in Fig. 3a, FITC labeled antibodies were found in BmN cells, which demonstrated that the anti-Src64B-like antibody could enter into BmN cells and thereby used to block endogenous Src64B-like of BmN cells. After incubated with different concentrations of anti-Src64B-like pAbs and infected with BmCPV, the cells were collected and the relative expression level of VP1 in the cells was detected by real-time PCR. There was no significant change in the expression of BmCPV VP1 in the virus-infected cells compared with the control cells (Fig. 3b). It has been shown that SFKs are involved in natural immune antiviral response by interacting with the pattern-recognition receptors (PRRS) such as intracellular RIG-1-like receptors and membranal Tolllike receptors (TLRs) [45–47]. Blocking the Src64B-like in BmN cells using anti-Src64B-like pAbs did not significantly impact the infection of BmCPV, suggesting that the function of Src64B-like could not be completely blocked. Our previous studies implied that integrin beta might mediate the cell entry of BmCPV through integrin-RACK1-Src axis [36]. Integrin might be a bridge between the virus and Src during the cell entry. Different subcellular localization of SFKs allows it to participate in the adjustment of different intracellular activities, such as mitosis, occurrence of the cell cycle, rearrangement of the cytoskeleton, exchange of transmembrane material, change of the cell adhesion, etc [48]. We speculated that virus-elicited Src activation causes rearrangement of the cytoskeleton which allows the internalization of BmCPV.

2.10. Immunofluorescence When the cell confluence reached to 70%–80%, the cultured BmN cells in the 6-well plate were inoculated with 10 μL Alexa Fluor 546labeled virions or stained with 1,1′-dioctadecyl-3,3,3′,3′-tetramethylindocarbocyanine (Dil) (Beyotime, Shanghai, China) according to the manufacture instruction and incubated with anti-Src64B-like pAb at final concentration of 50 μg/mL. At 20 min post-infection, the cells were washed with 1 × PBS for two times, fixed with 4% paraformaldehyde for 15 min, washed with PBS for 3 × 3 min, permeated with 0.5% Triton X-100 (attenuated by PBS) for 20 min, washed with PBS for 3 × 3 min and blocked with goat serum for 30 min. Subsequently, the cells were incubated with the primary anti-Src64Blike pAb overnight at 4℃, washed with 1‰ Tween in PBS (PBST) for 3 × 3 min, followed by incubation with the secondary antibody FITC Conjugated Goat Anti-Mouse IgG (AmyJet Scientific Inc, Wuhan, China) in dark at 37℃ for 1 h and washed with PBST for 3 × 3 min. Finally, the nuclei were re-dyed by incubating the cells with 4′, 6-diamidino-2phenylindole (DAPI) at room temperature for 5 min. The images were taken by using an Olympus FV1200-IX83 confocal microscope (Olympus, Tokyo, Japan).

3.3. Overexpression of Src64B-like facilitate infection of BmCPV Recently, more and more researches imply that SFKs-mediated signaling is related to virus-host interaction. For instance, the SFKsdependent endocytic pathway is required for the host cell entry of coxsackievirus [32,49]. SFKs also promote the assembly and maturation of dengue virus and HIV-1 [50,51]. In this study, to assess the effect of overexpression of Src64B-like on BmCPV infection, the recombined plasmid pIZT/V5/His-Src64B-like and negative control plasmid pIZT/ V5-His were transfected into BmN cells, respectively. After screened with antibiotic, green fluorescent protein (GFP) expressed cells were up to 50%–60% (Fig. 4a). The analysis result of western blot showed that the expression level of Src64B-like was higher than that in control cells (Fig. 4b), suggesting that the Src64B-like was overexpressed successfully in the pIZT/V5/His-Src64B-like-transformed BmN cells. At 48 h postinfection of BmCPV, the infected cells were collected to extract total RNA for determination of VP1 gene expression level; the results showed that the relative expression level of VP1 was significantly increased by 83.83% in the pIZT/V5/His-Src64B-lik-transformated cells compared with pIZT/V5-His transformated cells (Fig.4c). The results indicated that the overexpression of Src64B-like facilitate infection of BmCPV, and Src64B-like might play an important role during the cell entry of BmCPV. SFKs can be activated when a cell divides or continues to be stimulated by abnormal signals such as viruses and cancerization. The

3. Results and discussion 3.1. Silencing BmSrc64B-like gene can reduce the BmCPV infection Our previous study predicted that the cell entry of BmCPV is associated with integrin-RACK1-Src axis [36]. In the present study, in order to ascertain the function of Src64B-like in the cell entry of BmCPV, the siRNA was used to silence the expression of Src64B-like in BmN cells or silkworms. As a result, Src64B-like-specific siRNA SRC-898 had the best inhibition effect on Src64B-like gene expression (Fig.2a) in BmN cells, Src64B-like gene expression level also decreased in the silkworm midgut by RNAi with siRNA SRC-898 (Fig.2b) and siRNA SRC-898 was therefore used to inhibit the expression of Src64B-like in BmN cells and silkworm larvae. After treated with Src64B-like-specific siRNA, BmN cells or silkworms were infected with BmCPV. As shown in Fig. 2c and d, the relative expression level of VP1 was decreased by 59.48% ± 2.18% and 92.22% ± 1.12% in BmN cells and midguts individually comparing with the control, which indicated that silencing BmSrc64B-like gene can reduce the BmCPV infection both in vitro and in vivo. 4

Enzyme and Microbial Technology 121 (2019) 1–7

Y. Zhang et al.

Fig. 2. Effect of siRNAs on relative expression level of BmSrc64B-like and VP1 genes by RNA interference. a. Detection of gene silencing of BmSrc64B-like in BmN cells. After transfected with the siRNAs SRC-67, SRC-540, and SRC898 for 48 h, the BmN cells were collected and the relative expression level of BmSrc64B-like was detected by real-time PCR. b. Detection of gene silencing of BmSrc64B-like in midguts of fourth-instar silkworms. After treated with the siRNAs SRC-898 for 48 h, midguts of the silkworms were collected and the relative expression level of BmSrc64B-like was detected by real-time PCR. c and d. Effect of gene silencing of BmSrc64B-like on BmCPV infection. After treated with the siRNAs SRC-898 for 48 h, the BmN cells or silkworms were infected with BmCPV, and the relative expression level of BmCPV VP1 gene in the BmN cells (c) or midguts (d) was detected by real-time PCR.

Fig. 3. Blocking BmSrc64B-like in BmN cell by anti-Src64B-like pAb. a. Immunofluorescence to verify anti-Src64B-like pAb can enters into BmN cells. The cells membrane was stained with red fluorescent dyes “Dil”, and then subjected to immunofluorescence with antiSrc64B-like pAb as the primary antibody and FITC- conjugated goat anti-mouse IgG as the secondary antibody. Finally the cell nuclei were stained with DAPI. b. Detection of relative expression level of BmCPV VP1 gene in the treated BmN cells with anti-Src64B-like pAb. The BmN cells were incubated with antiSrc64B-like pAb (50, 100 or 200 μg/mL at the final concentration) for 2 h. At 48 h post infection with BmCPV, the cells were collected and the relative expression level of BmCPV VP1 gene was examined by real-time PCR (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article).

could be suggested that the kinase activity of Src64B is required for BmCPV cell entry. Whether they are involved in the Src activation or the virus-elicited signaling pathway needs further research to verify.

activated SFKs promotes the transfer of phosphoric acid from adenosine triphosphate (ATP) to the tyrosine residues of the corresponding target protein, so that the target protein is activated and the signal is further transmitted [52]. It is proved that SFKs can be activated by multiple signaling pathways, including growth factor receptors, G protein coupled receptors, superoxide, ultraviolet ray, integrin-mediated signaling pathway, etc. [53]. Growth factor receptors and G protein coupled receptors were also listed in our previous identified result [36]. Src kinase has been shown to be a crucial regulator of signaling events that modulate the appropriate sorting of reovirus in the process of endocytosis for disassembly and cell entry [30]. Our previous study had also indicated that BmCPV enters cells via endocytosis [35,36], so it

3.4. Src64B-like was not co-located with BmCPV virion in BmN cells Following infection with BmCPV labeled with Alexa Fluor 546, the BmN cells were used for immunofluorescence in order to detect the colocation of Src64B-like and BmCPV virion in BmN cells. Src has been identified to co-localize with reoviruses during cell entry [30]. However, in our present study, the result showed that Src64B-like proteins were mainly distributed in cytoplasm and BmCPV virions were also 5

Enzyme and Microbial Technology 121 (2019) 1–7

Y. Zhang et al.

Fig. 4. Effects of overexpression of Src64B-like on BmCPV infection. a. Fluorescence observation of pIZT/V5-His-Src64B-like- (upper) or pIZT/V5-His (lower)transformed cells. Light shows the cells observed in light field, and GFP shows the cells with green fluorescence observed in the dark field but with about 500 nm wavelength of exciting light; b. Western blot analysis of the expression level of Src64B-like in transformed cells. Lane 1: pIZT/V5-His-Src64B-like transformed cells. Lane 2: pIZT/V5-His transformed cells; c. Effects of overexpression of Src64B-like in BmN cells on the relative expression level of VP1 gene by real-time PCR. Lane M: DNA or protein ladders. ** p < 0.01 (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article).

Fig. 5. Co-localization of Src64B-like and BmCPV virions in BmN cells. Blue stands for the cell nuclei labeled with DAPI; Red stands for BmCPV virions labeled with Alexa Fluor 546; Green stands for Src64B-like protein labeled with FITC conjugated goat anti-mouse IgG (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article).

Fig. 6. Relative expression level of BmSrc64B-like in diverse tissues of Bombyx mori. HD: head, MG: midgut, FB: fat body, MT: malpighian tubule, HE: hemolymph, MSG: middle silkgland, PSG: post silkgland, TR: trachea.

4. Conclusion distributed in cytoplasm (Fig. 5), but they are independent from each other and there was no intersection for them, which indicated that BmCPV didn’t interact with Src64B-like protein directly in the process of cell infection. It has been suggested that viral genome dsRNAs are injected into cell through the protuberance of virions, leaving empty capsid outside of the cell after the BmCPV virion bind itself to cellular surface [5]. In the present study, we found a lot of red fluorescent particles in the infected cell with Alexa-labelled-BmCPV, suggesting that intact virions were internalized into cells which was consistent with the result reported by Sun et al. [9].

Our study revealed that the inhibition of Src64B-like expression reduced functional infection of BmCPV either in vitro or in vivo, and that overexpressing Src64B-like increased infection of BmCPV, indicating that BmSrc64B-like might facilitate the valid infection of BmCPV and plays an important role in the virus sorting after internalization. However, there was no direct contact with between BmCPV virion and Src64B-like during the process of virus infection. The tissue-specific infection of BmCPV to midgut has not business with the tissue-specific expression of Src64B-like in midgut, and there may be other decisive factor.

3.5. Src64B-like were not the conclusive factors for tissue-specific infection of BmCPV

Conflict of interest The authors declare that they have no competing interests.

The reason for why BmCPV can specially infect the midgut tissue rather than others has not been known. In order to identify that tissuespecific infection of BmCPV to midgut was due to the tissue-specific expression of Src64B-like in midgut, expression profile of Src64B-like in different tissues of B. mori was analyzed by real-time PCR using cDNA from different tissues of B. mori as the template. It was found that the Src64B-like was expressed with the highest level in trachea rather than in midgut (Fig.6). The result implied that the tissue-specific infection of BmCPV to midgut was not related to the tissue-specific expression of Src64B-like in midgut, and there may be other decisive factor.

Ethical approval All procedures on the animals, including mice and silkworms, were approved by the Ethic Committee of Experimental Animals of Soochow University and were carried out in accordance with the Guide of the Care and Use of Laboratory Animals. Acknowledgements We are very grateful to the National Natural Science Foundation of China (31872424, 31272500 and 31602007), National Basic Research 6

Enzyme and Microbial Technology 121 (2019) 1–7

Y. Zhang et al.

Program of China (973 Program, 2012CB114600), Natural Science Foundation of Jiangsu Province (SBK2016042171) and Priority Academic Program of Development of Jiangsu Higher Education Institutions for their financial and moral support.

[27]

References

[28]

[1] I. Fujii-Kawata, K.I. Miura, M. Fuke, Segments of genome of viruses containing double-stranded ribonucleic acid, J. Mol. Biol. 51 (2) (1970) 247–253. [2] R.I.B. Francki, C.M. Fauquet, D.L. Knudson, F. Brown, Classification and nomenclature of viruses: Fifth report of the International Committee on Taxonomy of Viruses, Arch. Virol. S. 2, New York, Spinger-Verlag, 1991. [3] I.H. Holmes, G. Boccardo, M.K. Esters, M.K. Furuichi, Y. Hoshino, W.K. Joklik, M. McCrae, P.P.C. Mertens, G. Milne, K.S.K. Samal, E. Shikata, J.R. Winton, I. Uyeda, Family reviridae, in: F.A. Murphy, C.M. Fauquet, D.H.L. Bishop, S.A. Ghabrial, A.W. Jarvis, G.P. Martelli, M.A. Mayo, M.D. Summers (Eds.), In Virus Taxonomy: Sixth Report of the International Committee on Taxonomy of Viruses. Edited by, Springer, New York, USA, 1995, pp. 208–237. [4] P.P.C. Mertens, M. Arella, H. Attoui, Reoviridae, in: M.H.V. Van Regenmortel, C.M. Fauquet, D.H.L. Bishop, E. Carstens, M.K. Estes, S. Lemon, J. Maniloff, M.A. Mayo, D.J. McGeoch, C.R. Pringle, R.B. Wickner (Eds.), In Virus Taxonomy: Seventh Report of the International Committee on Taxonomy of Viruses. Edited by, Academic Press, London, United Kingdom, 2000, pp. 395–480. [5] M. Kobayashi, Penetration of polyhedrosis viruses into the cultured midgut cells of the silkworm, J. Sericult. Sci. Japan. 41 (1) (1972) 1–6. [6] H. Watanabe, Site of viral RNA synthesis within the midgut cells of the silkworm, Bombyx mori, infected with cytoplasmic-polyhedrosis virus, J. Invertebr. Pathol. 9 (4) (1967) 480–487. [7] Y. Hayashi, A. Retnakaran, The site of RNA synthesis of a cytoplasmic-polyhedrosis virus (CPV) in Malacosoma disstria, J. Invertebr. Pathol. 16 (1) (1970) 150. [8] Y.R. Tan, Electron Microscopic Study on the Mechanism of Invasion and Replication of Bombyx mori Cypovirus: [D], China: Sun Yat-sen University, Guangzhou, 2005. [9] J.C. Sun, D.N. Chen, Y.F. Yang, Q. Zhang, P.C. Tan, X.Y. Xu, B.L. Qiu, Penetration and replication of Bombyx mori cytoplasmic polyhedrosis virus in vivo, Acta Scientiarum Naturalium Universitatis Sunyatseni 45 (2) (2006) 78–82. [10] J. Borsa, B.D. Morash, M.D. Sargent, T.P. Copps, P.A. Lievaart, J.G. Szekely, Two modes of entry of reovirus particles into L cells, J. Gen. Virol. 45 (1) (1979) 161–170. [11] J. Borsa, M.D. Sargent, P.A. Lievaart, T.P. Copps, Reovirus: evidence for a second step in the intracellular uncoating and transcriptase activation process, Virology 111 (1) (1981) 191–200. [12] L.J. Sturzenbecker, M. Nibert, D.B. Furlong, B.N. Fields, Intracellular digestion of reovirus particles requires a low pH and is an essential step in the viral infectious cycle, J. Virol. 61 (8) (1987) 2351–2361. [13] D.H. Rubin, D.B. Weiner, C. Dworkin, M.I. Greene, G.G. Maul, W.V. Williams, Receptor utilization by reovirus type 3: distinct binding sites on thymoma and fibroblast cell lines result in differential compartmentalization of virions, Microb. Pathog. 12 (5) (1992) 351–365. [14] M. Ehrlich, W. Boll, A. Van Oijen, R. Hariharan, K. Chandran, M.L. Nibert, T. Kirchhausen, Endocytosis by random initiation and stabilization of clathrincoated pits, Cell 118 (5) (2004) 591–605. [15] M.S. Maginnis, J.C. Forrest, S.A. Kopecky-Bromberg, S.K. Dickeson, S.A. Santoro, M.M. Zutter, G.R. Nemerow, J.M. Bergelson, T.S. Dermody, β1 Integrin mediates internalization of mammalian reovirus, J. Virol. 80 (6) (2006) 2760–2770. [16] M.S. Maginnis, B.A. Mainou, A. Derdowski, E.M. Johnson, R. Zent, T.S. Dermody, NPXY motifs in the beta1 integrin cytoplasmic tail are required for functional reovirus entry, J. Virol. 82 (7) (2008) 3181–3191. [17] R.A. Weiss, P.K. Vogt, 100 years of Rous sarcoma virus, J. Exp. Med. 208 (12) (2011) 2351–2355. [18] R. Jove, H. Hanafusa, Cell transformation by the viral src oncogene, Annu. Rev. Cell Biol. 3 (1) (1987) 31–56. [19] S.M. Thomas, J.S. Brugge, Cellular functions regulated by Src family kinases, Annu. Rev. Cell Dev. Biol. 13 (1997) 513–609. [20] A. Talmor-Cohen, R. Tomashov-Matar, E. Eliyahu, Are Src family kinases involved in cell cycle resumption in rat eggs? Reproduction 127 (4) (2004) 455–463. [21] W.G. Cance, R.J. Craven, M. Bergman, L. Xu, K. Alitalo, E.T. Liu, Rak, a novel nuclear tyrosine kinase expressed in epithelial cells, Cell Growth Differ. 5 (12) (1994) 1347–1355. [22] J. Lee, Z. Wang, S.M. Luoh, W.I. Wood, D.T. Scadden, Cloning of FRK, a novel human intracellular SRC-like tyrosine kinase-encoding gene, Gene 138 (1) (1994) 247–251. [23] C. Oberg-Welsh, M. Welsh, Cloning of BSK, a murine FRK homologue with a specific pattern of tissue distribution, Gene 152 (2) (1995) 239–242. [24] M. Thuveson, D. Albrecht, G. Zürcher, A.C. Andres, A. Ziemiecki, Iyk, a novel intracellular protein tyrosine kinase differentially expressed in the mouse mammary gland and intestine, Biochem. Biophys. Res. Commun. 209 (2) (1995) 582–589. [25] S.K. Mitra, D.D. Schlaepfer, Integrin-regulated FAK-Src signaling in normal and cancer cells, Curr. Opin. Cell Biol. 18 (5) (2006) 516–523. [26] M.V. Veettil, N. Sharma-Walia, S. Sadagopan, H. Raghu, R. Sivakumar,

[29]

[30] [31]

[32] [33]

[34]

[35]

[36]

[37] [38]

[39]

[40]

[41]

[42] [43] [44] [45]

[46]

[47]

[48] [49]

[50] [51]

[52] [53]

7

P.P. Naranatt, B. Chandran, RhoA-GTPase facilitates entry of Kaposi’s sarcoma-associated herpesvirus into adherent target cells in a Src-dependent manner, J. Virol. 80 (23) (2006) 11432–11446. C.M. Yang, C.C. Lin, I.T. Lee, Y.H. Lin, C.M. Yang, W.J. Chen, M.J. Jou, L.D. Hsiao, Japanese encephalitis virus induces matrix metalloproteinase-9 expression via a ROS/c-Src/PDGFR/PI3K/Akt/MAPKs-dependent AP-1 pathway in rat brain astrocytes, J. Neuroinflammation 9 (1) (2012) 12. K. Tokunaga, E. Kiyokawa, M. Nakaya, N. Otsuka, A. Kojima, T. Kurata, M. Matsuda, Inhibition of human immunodeficiency virus type 1 virion entry by dominant-negative Hck, J. Virol. 72 (7) (1998) 6257–6259. C.Y. Cheng, W.R. Huang, P.I. Chi, H.C. Chiu, H.J. Lium, Cell entry of bovine ephemeral fever virus requires activation of Src-JNK-AP1 and PI3K-Akt-NF-B pathways as well as Cox-2-mediated PGE2/EP receptor signalling to enhance clathrin-mediated virus endocytosis, Cell. Microbiol. 17 (7) (2015) 967–987. B.A. Mainou, T.S. Dermody, Src kinase mediates productive endocytic sorting of reovirus during cell entry, J. Virol. 85 (7) (2011) 3203–3213. L. Ping-Yuan, L. Hung-Jen, L. Meng-Jiun, Y. Feng-Ling, H. Hsue-Yin, L. Jeng-Woei, S. Wen-Ling, Avian reovirus activates a novel proapoptotic signal by linking Src to p53, Apoptosis 11 (12) (2006) 2179–2193. C.B. Coyne, J.M. Bergelson, Virus-induced Abl and Fyn kinase signals permit coxsackievirus entry through epithelial tight junctions, Cell 124 (2006) 119–131. C. Ye, X. Han, Z. Yu, E. Zhang, L. Wang, H. Liu, Infectious bursal disease virus activates c-Src to promote α4β1 integrin-dependent viral entry by modulating the downstream Akt-RhoA GTPase-Actin rearrangement cascade, J. Virol. 91 (3) (2017) e01891–16. L. Zhu, X. Hu, D. Kumar, F. Chen, Y. Feng, M. Zhu, Z. Liang, L. Huang, L. Yu, J. Xu, R. Xue, G. Cao, C. Gong, Both ganglioside GM2 and cholesterol in the cell membrane are essential for Bombyx mori cypovirus cell entry, Dev. Comp. Immunol. 88 (2018) 161–168. F. Chen, L. Zhu, Y. Zhang, D. Kumar, G. Cao, X. Hu, Z. Liang, S. Kuang, R. Xue, C. Gong, Clathrin-mediated endocytosis is a candidate entry sorting mechanism for Bombyx mori cypovirus, Sci. Rep. 8 (1) (2018) 7268. Y. Zhang, G. Cao, L. Zhu, F. Chen, M.S. Zar, S. Wang, X. Hu, Y. Wei, R. Xue, C. Gong, Integrin beta and receptor for activated protein kinase C are involved in the cell entry of Bombyx mori cypovirus, Appl. Microbiol. Biotechnol. 101 (9) (2017) 3703–3716. T.D. Grace, Establishment of a line of cells from the silkworm Bombyx mori, Nature 216 (5115) (1967) 613. H. Inoue, K. Taniai, J. Kobayashi, Establishment and characterization of substratedepending cell lines of Bombyx mori, Bull. Natl. Inst. Seric. Entomol. Sci. 1 (1990) 13–25. Y. Cheng, X.Y. Wang, H. Hu, N. Killiny, J.P. Xu, A hypothetical model of crossing Bombyx mori nucleopolyhedrovirus through its host midgut physical barrier, PLoS One 9 (12) (2014) e115032-e115032. G. Cao, X. Meng, R. Xue, Y. Zhu, X. Zhang, Z. Pan, X. Zheng, C. Gong, Characterization of the complete genome segments from BmCPV-SZ, a novel Bombyx mori cypovirus 1 isolate, Can. J. Microbiol. 58 (7) (2012) 872–883. L. Li, D. Lyu, Preparation and characterization of mouse polyclonal antibody against conserved region of human FOXO3, Chin. J. Cell. Mol. Immunol. (Chinese) 33 (6) (2017) 838–844. K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using realtime quantitative PCR and the 2- ΔΔCT method, Methods 25 (4) (2001) 402–408. B.A. Mainou, T.S. Dermody, Transport to late endosomes is required for efficient reovirus infection, J. Virol. 86 (16) (2012) 8346–8358. M.D. Resh, Myristylation and palmitylation of Src family members: the fats of the matter, Cell 76 (3) (1994) 411–413. I.B. Johnsen, T.T. Nguyen, M. Ringdal, A.M. Tryggestad, O. Bakke, E. Lien, T. Espevik, M.W. Anthonsen, Toll-like receptor 3 associates with c-Src tyrosinekinase on endosomes to initiate antiviral signaling, EMBO J. 25 (14) (2006) 3335–3346. I.B. Johnsen, T.T. Nguyen, B. Bergstroem, K.A. Fitzgerald, M.W. Anthonsen, The tyrosine kinase c-Src enhances RIG-I (retinoic acid-inducible gene I)-elicited antiviral signaling, J. Biol. Chem. 284 (28) (2009) 19122–19131. Y.J. Lim, J.E. Koo, E. Hong, Z. Park, K. Lim, O. Bae, J.Y. Lee, A Src-family-tyrosine kinase, Lyn, is required for efficient IFN- b expression in pattern recognition receptor, RIG-I, signal pathway by interacting with IPS-1, Cytokine 72 (1) (2015) 63–70. C.L. Abram, S.A. Courtneidge, Src family tyrosine kianses and growth factor signaling, Exp. Cell Res. 254 (1) (2000) 1–13. E. Delorme-Axford, Y. Sadovsky, C.B. Coyne, Lipid raft- and SRC family kinasedependent entry of coxsackievirus B into human placental trophoblasts, J. Virol. 87 (15) (2013) 8569–8581. J.J.H. Chu, P.L. Yang, c-Src protein kinase inhibitors block assembly and maturation of dengue virus, Proc. Natl. Acad. Sci. U. S. A. 104 (2007) 3520–3525. A.B. Strasner, M. Natarajan, T. Doman, D. Key, A. August, A.J. Henderson, The Src kinase Lck facilitates assembly of HIV-1 at the plasma membrane, J. Immunol. 181 (5) (2008) 3706–3713. G.S. Martin, The hunting of the Src, Nat. Rev. Mol. Cell Biol. 2 (6) (2001) 467–475. K. Sato, T. Iwasaki, S. Hirahara, Y. Nishihira, Y. Fukami, Molecular dissection of egg fertilization signaling with the aid of tyrosine kinase specific inhibitor and activator strategies, Biochim. Biophys. Acta 1697 (1) (2004) 103–121.