Cell-Free Circulating DNA: Diagnostic Value in Patients With Testicular Germ Cell Cancer

Cell-Free Circulating DNA: Diagnostic Value in Patients With Testicular Germ Cell Cancer Jörg Ellinger,* Volker Wittkamp, Peter Albers, Frank G. E. Perabo, Stefan C. Mueller, Alexander von Ruecker and Patrick J. Bastian From the Klinik und Poliklinik für Urologie (JE, VW, FGEP, SCM) and Institut für Pathologie (AVR), Universitätsklinikum Bonn, Rheinische Friedrich-Wilhelms-Universität Bonn, Bonn, Klinik für Urologie, Klinikum Kassel (PA), Kassel and Urologische Klinik und Poliklinik, Universitätsklinikum Grosshadern, Ludwig-Maximilians-Universität München (PJB), Munich, Germany

Purpose: Increased levels of cell-free circulating DNA have been described in various malignancies as a diagnostic and prognostic biomarker. We analyzed the significance of cell-free DNA in patients with testicular cancer. Materials and Methods: Cell-free DNA was isolated from the serum of 74 patients with testicular cancer, including 39 with seminoma and 35 with nonseminoma, and 35 healthy individuals. Real-time polymerase chain reaction was used to quantify a 106, a 193 and a 384 actin-␤ DNA fragment. DNA integrity is expressed as the ratio of large (193 or 384 bp) to short (106 bp) DNA fragments. Results: Actin-␤-106/193/384 fragment levels were significantly increased in patients with cancer compared to those in healthy individuals (each p ⬍0.001). DNA integrity was significantly decreased in patients with cancer (p ⬍0.001). Cell-free DNA fragment levels were not different when comparing patients with nonseminoma and seminoma (p ⬎0.24). ROC analysis demonstrated that cell-free DNA levels distinguished patients with cancer from healthy individuals with 87% sensitivity and 97% specificity. Even in 31 patients in whom the established serum tumor markers ␣-fetoprotein, human chorionic gonadotropin, placental alkaline phosphatase and lactate dehydrogenase were normal cell-free DNA levels allowed us to distinguish between patients with cancer and healthy individuals with 84% sensitivity and 97% specificity. Cell-free DNA levels were more frequently increased in patients with clinical stage 3 than in patients with stage 1 or 2 disease (p ⬍0.046). Conclusions: Cell-free DNA levels are increased in patients with testicular cancer and they allow the accurate discrimination of healthy individuals. The high sensitivity of cell-free DNA could facilitate the management of testicular cancer, especially in patients with conventional tumor markers that are not increased.

Abbreviations and Acronyms ACTB ⫽ ␤-actin AFP ⫽ ␣-fetoprotein HCG ⫽ human chorionic gonadotropin LDH ⫽ lactate dehydrogenase PCR ⫽ polymerase chain reaction PLAP ⫽ placental alkaline phosphatase Submitted for publication March 13, 2008. Supported by research grants from BONFOR (JE and PJB), the North-Rhine Westphalian Association of Urology (JE) and Reinhard-Nagel foundation (PJB). * Correspondence: Klinik und Poliklinik für Urologie, Universitätsklinikum Bonn, SigmundFreud-Strasse 25, 53105 Bonn, Germany (telephone: ⫹49 228 28715109; FAX: ⫹49 228 28712609; e-mail: [email protected]).

Key Words: testis; testicular neoplasms; cell-free system; biological markers; neoplasms, germ cell and embryonal TESTICULAR germ cell cancer represents approximately 1% of the malignant neoplasms found in the male population.1 The incidence of testicular cancer increased during the last 30 years in Western industrialized countries.2 Cure rates are currently in the order of 95% for low stage dis-

ease. Even in patients with metastatic germ cell cancer the 5-year survival rate is between 91% and 48% depending on disease stage.3 Testicular cancer appears most often as a painless, intrascrotal mass. The serum tumor markers AFP, HCG, LDH and PLAP are assessed in the diagno-

0022-5347/09/1811-0363/0 THE JOURNAL OF UROLOGY® Copyright © 2009 by AMERICAN UROLOGICAL ASSOCIATION

Vol. 181, 363-371, January 2009 Printed in U.S.A. DOI:10.1016/j.juro.2008.08.118

www.jurology.com

363

364

CELL-FREE CIRCULATING DNA AND TESTICULAR GERM CELL CANCER

sis, prognosis and surveillance of patients with testicular cancer. However, these markers are increased in only about 60% of patients with testicular cancer.4 Therefore, additional serum markers would facilitate clinical treatment in these patients. Cell-free DNA represents an interesting universal tumor marker. Increased levels of cell-free DNA were described in 1977 in the plasma of various patients with cancer5 but the origin of circulating DNA still remains largely unknown. Although circulating tumor specific DNA is present in many patients with cancer, it accounts for only less than 5% of total DNA.6,7 Therefore, it was hypothesized that indirect mechanisms induce apoptotic and/or necrotic death in surrounding and peripheral healthy cells.6 – 8 The development of PCR based methods facilitated the quantification of cell-free DNA and today numerous studies have described increased levels in patients with cancer compared to those in healthy individuals and patients with nonmalignant disease.7,9,10 Some studies have demonstrated qualitative differences, ie DNA integrity, between patients with cancer and controls. For instance, an increase in large DNA fragments, ie more than 300 bp, was reported in patients with breast,11 colon12 and ovarian cancer,12 whereas mostly quantitative differences have been reported in prostate and bladder cancer, in which increased levels of small DNA fragments are observed.7,8 To our knowledge cell-free DNA levels in patients with testicular cancer have not been analyzed to date. To analyze whether cell-free DNA could be a useful biomarker for testicular cancer we isolated cell-free DNA from patients with testicular cancer and compared DNA levels as well as fragmentation patterns with those in healthy individuals.

MATERIALS AND METHODS Patients, Sample Collection and DNA Isolation Patients with a suspicion of testicular cancer were recruited into this study. Seminoma was diagnosed in 39 patients and nonseminoma was diagnosed in 35, including embryonal carcinoma in 3, yolk sac tumor in 1, immature teratoma in 2 and nonseminoma with mixed components in 29. Additionally, we analyzed 35 healthy volunteers without signs of malignancy. Table 1 lists clinicopathological parameters. Consecutive serum samples from patients who underwent inguinal orchiectomy at the Department of Urology, University of Bonn between 1996 and 2004 were selected for study. All blood samples were collected in serum S-Monovette Gel tubes (Sarstedt, Nürnbrecht, Germany) before surgery. Serum sample clotting was allowed for at least 60 minutes before centrifugation at 1,800 ⫻ gravity for 10 minutes and supernatants were stored at – 80C. All patients had provided written informed consent for the collection and analysis of serum samples. Cell-free DNA was isolated from 1 ml serum

Table 1. Clinicopathological parameters in patients with testicular germ cell cancer and healthy controls Seminoma No. pts Age: Mean Median Range No. increased serum tumor markers (%): AFP HCG PLAP LDH None No. pathological tumor stage (%): pT1 pT2 pT3 No. clinical stage (%): I IIA–C IIIA–C Not available No. International Germ Cell Ca Collaborative Group prognosis (%): Good Intermediate Poor

Nonseminoma

Controls

39

35

35

36.2 35.0 21–59

31.31 32.0 14–50

27.86 26.0 18–49

3 8 10 4 22

(7.7) (20.5) (25.6) (10.3) (56.4)

15 24 3 12 9

(42.9) (68.6) (8.6) (34.3) (25.7)

31 (79.5) 6 (15.4) 2 (5.1)

26 7 1

(74.3) (20.0) (2.9)

28 (71.8) 7 (17.9) 3 (7.7) 1 (2.6)

18 13 4 0

(51.4) (37.1) (11.4)

6 1 1

(17.1) (2.9) (2.9)

3 1 0

(7.7) (2.6)

using a ChargeSwitch® gDNA Kit according to the manufacturer protocol.

Measurement of Cell-Free DNA Levels To assess the amount as well as the degree of fragmentation of cell-free DNA we used 3 primer sets, including the 106 bp ACTB DNA fragment ACTB-103, representing total cell-free DNA, and the primer sets ACTB-193 (193 bp fragment) and ACTB-384 (384 bp fragment), which were used to determine the level of larger DNA fragments derived from nonapoptotic cells. The DNA integrity of ACTB 193 and 384 was calculated as the ratio of large to short DNA fragments, including integrity-193 as ACTB-193/103 and integrity-384 as ACTB-384/103, respectively. The annealing sites of the shorter DNA fragments are within the larger fragment and, thus, DNA integrity is 1 when template DNA is not truncated, and less than 1 when template DNA is truncated into fragments smaller than the large fragment. Primer sequences were ACTB-106 and 193 forward TCGTGCGTGACATTAAGGAG, ACTB-106 reverse GGCAGCTCGTAGCTCTTCTC, ACTB-193 reverse AGTCTCCACTCACCCAGGAA, ACTB-384 forward GCTATCCCTGTACGCCTCTG and ACTB-384 reverse AGGAAGGAAGGCTGGAAGAG. Real-time PCR was performed in triplicate on an ABI Prism® 7900HT. Each 10 ␮l reaction consisted of 1 ⫻ SYBR® GreenER™ quantitative PCR SuperMix, 0.2 ␮mol/l forward and reverse primers, and 1 ␮l DNA sample. PCR was done at 90C for 10 minutes, followed by 40 cycles at 95C for 15 seconds and 60C for 60 seconds. Melting curve analysis was performed to confirm PCR product specificity. Each run included serial dilutions of an external standard and water blanks.

CELL-FREE CIRCULATING DNA AND TESTICULAR GERM CELL CANCER

365

tests, as appropriate. ROC analysis was done to determine the AUC, sensitivity and specificity of cell-free DNA fragment levels. Correlations between clinicopathological parameters and cell-free DNA fragment levels were performed using the Mann-Whitney and Kruskal-Wallis-tests, as appropriate. Statistical analysis was performed using SPSS® 11.

RESULTS

Figure 1. Genomic DNA was sheared into random fragments. Longer shearing process resulted in more DNA fragmented.

Assessment of DNA fragmentation Leukocyte DNA from a healthy volunteer was isolated using a PureLink™ DNA Purification Kit. Genomic DNA (10 ␮g) was sheared for 5, 7, 9, 11, 13, 15 or 20 minutes using a Bioruptor™ 200 according to manufacturer recommendations. The sonication process causes random DNA fragmentation. DNA fragmentation was visually assessed by agarose gel electrophoresis using 1% agarose, staining with ethidium bromide (Invitrogen™), and 100 bp and 1 kB Plus DNA Ladder™. Fragmentation was determined using quantitative real-time PCR with the primer sets for ACTB-106, 193 and 384, as described.

Statistical Analysis Differences in cell-free DNA fragment levels between healthy individuals and patients with testicular cancer were analyzed using the Mann-Whitney and Kruskal-Wallis

ACTB Primer Sets Differentiated DNA Fragmentation Leukocyte genomic DNA was sonicated to induce DNA fragmentation. Figures 1 to 3 show the fragmentation pattern of sheared DNA. Integrity-384 of DNA sheared to 500 to 3,000 bp was approximately 0.75 (ACTB-394/106). DNA of 100 to 1,000 bp had an integrity-384 of approximately 0.2. In contrast, DNA integrity-193 (ACTB-193/106) was only marginally decreased at approximately 0.9 in all samples. Cell-Free Serum DNA Levels and DNA Integrity in Patients With Testicular Cancer and Healthy Individuals Median ACTB-106 and 193 serum DNA levels were approximately 9-fold higher in patients with testicular cancer than in healthy individuals (p ⬍0.001). Median ACTB-106 levels were 8.20 and 0.89 ng/ml in patients with cancer and healthy individuals, respectively. Likewise ACTB-193 levels were increased in patients with testicular cancer compared to those in healthy individuals (8.09 vs 0.82 ng/ml, respectively). Relative to ACTB-106 and 193, the median DNA levels of ACTB-384 were lower in the serum of patients with cancer but still distinctly higher than in the control group (2.35 vs 0.71 ng/ml, p ⬍0.001),

Figure 2. Calculated relative PCR efficiency of ACTB-106, 193 and 384 primer sets in terms of DNA length

366

CELL-FREE CIRCULATING DNA AND TESTICULAR GERM CELL CANCER

Figure 3. Quantitative real-time PCR was performed as described using primer sets for 106, 193 and 384 bp fragments of ACTB gene. DNA integrity was calculated as ratio of large to short DNA fragments. DNA integrity-384, ie ACTB-384/106, was distinctly decreased in highly fragmented DNA.

which indicated that cell-free serum DNA was fragmented to a higher degree in patients with cancer. Also, the fragmentation pattern of serum DNA in testicular cancer and controls was distinctly different. This was underlined by the fact that cell-free DNA was moderately fragmented in the control group with an integrity-193 of 0.859 and an integrity384 of 0.681, whereas significantly increased DNA fragmentation was observed in patients with testicular cancer, in whom integrity-193 was 0.984 and integrity-384 was 0.348 (p ⫽ 0.038 and ⬍0.001, respectively, table 2, and figs. 4 and 5). Furthermore, patients with nonseminoma testicular cancer had moderately increased ACTB-106 and 193 fragment levels (10.68 and 9.81 ng/ml) compared to those in patients with seminoma (7.47 and 6.88 ng/ml, respectively). However, these differences did not attain significance (p ⫽ 0.240 and p ⫽ 0.277). On the other hand, median ACTB-384 levels were similar in seminoma and nonseminoma cases (2.21 and 2.44 ng/ml, respectively, p ⫽ 0.333). Interestingly DNA integrity indexes were similar in the integrity-193 (0.985 vs 0.965) and integrity-384 (0.338 vs 0.371) subgroups, suggesting that the fragmentation processes were similar. Diagnostic Information on Cell-Free DNA Levels ROC analysis revealed that cell-free DNA levels accurately distinguished patients with testicular can-

cer from healthy controls. The primer sets amplifying short DNA fragments especially allowed the discrimination of patients with testicular cancer and healthy controls. The ACTB-193 primer set was most accurate. We determined a 87.8% sensitivity and 97.1% specificity at a threshold of 2.56 ng/ml (AUC 0.920, 95% CI 0.866 – 0.974, figs. 4 and 5). Diagnostic accuracy for discriminating healthy individuals and patients with seminoma/nonseminoma testicular cancer was always the same (table 3). Finally, we noted that cell-free DNA was helpful for diagnostic purposes in a subgroup of 31 patients with testicular cancer and negative assessment of conventional laboratory/tumor markers, including 22 with seminoma and 9 with nonseminoma, ie AFP, HCG, PLAP and LDH were not increased preoperatively. In this subgroup the detection of ACTB-193 fragments provided 83.9% sensitivity and 97.1% specificity at the 2.56 ng/ml threshold level, similar to those in patients with cancer who had a positive assessment of conventional laboratory/tumor markers (AUC 0.922, 95% CI 0.842–1.000, ROC not shown). Correlation of Cell-Free DNA Levels and Clinicopathological Parameters Seven patients with clinical stage III testicular cancer had increased levels of cell-free serum DNA compared to patients with stages I and II disease. A significant difference was observed using the ACTB-

CELL-FREE CIRCULATING DNA AND TESTICULAR GERM CELL CANCER

367

Table 2. Circulating serum DNA fragments in patients with testicular cancer and healthy controls Seminoma No. pts ACTB-106 (ng/ml):* Mean 95% CI Range Median ACTB-193 (ng/ml):* Mean 95% CI Range Median ACTB-384 (ng/ml):* Mean 95% CI Range Median DNA integrity-193 (ACTB-193/106): Mean 95% CI Range Median p value* (mann-Whitney test) DNA integrity-384 (ACTB-384/-106): Mean 95% CI Range Median p value* (Mann-Whitney test)

39

Nonseminoma 35

Ca 74

Controls 35

8.923 6.259–11.588 0.187–43.777 7.471

11.221 7.990–14.451 0.012–46.428 10.683

10.009 7.968–12.052 0.012–46.428 8.201

1.251 0.840–1.663 0.003–6.164 0.893

8.084 6.027–10.141 0.329–31.946 6.875

10.079 7.397–12.762 0.045–39.666 9.807

9.028 7.384–10.672 0.045–39.666 8.092

1.008 0.757–1.259 0.000–3.334 0.817

2.932 2.031–3.833 0.112–13.146 2.210

4.234 2.714–5.754 0.000–17.953 2.435

3.547 2.694–4.401 0.000–17.953 2.352

0.870 0.637–1.103 0.005–2.962 0.709

1.141 0.968–1.315 0.643–3.553 0.985 0.040

1.290 0.695–1.885 0.656–11.122 0.965 0.124

1.211 0.923–1.500 0.643–11.122 0.984 0.038

0.894 0.764–1.023 0.000–1.691 0.859

0.405 0.329–0.481 0.143–1.341 0.338 0.001

0.414 0.294–0.535 0.000–2.052 0.371 0.001

0.410 0.431–0.478 0.000–2.052 0.348 ⬍0.001

0.980 0.566–1.394 0.012–6.680 0.681

* Vs controls Mann-Whitney test p ⬍0.001.

193 and 384 primer sets (p ⬍0.046 and ⬍0.016), whereas ACTB-106 levels failed to attain significance marginally (p ⫽ 0.059 and 0.078, respectively). ROC analysis showed that the detection of ACTB-384 and 193 DNA levels represented a sensitive test for identifying patients with advanced disease (AUC 0.805 and 0.745, respectively, figs. 6 to 8). We did not observe a significant correlation of cell-free DNA levels (ACTB-106, 193 and 384) with pT or pN stage, vascular invasion, the International Germ Cell Cancer Collaborative Group classification or any serum tumor markers, that is AFP, HCG, LDH or PLAP (p ⬎0.05). Followup information was available on 53 patients and mean followup was 82.5 months (median 87, range 2 to 130). One of these patients patient died of pneumonia 45 months after diagnosis without signs of recurrence. Another patient experienced recurrent relapses of the teratoma component 2, 11, 21 and 45 months following initial diagnosis with an ACTB-106, 193 and 384 of 10.25, 10.08 and 2.53 ng/ml, respectively.

DISCUSSION Measurement of AFP, HCG and LDH provides valuable diagnostic and prognostic information. However, these markers are increased in only approximately

60% of patients.4 The development of additional markers would facilitate clinical management for testicular cancer. Cell-free DNA is probably a ubiquitous tumor marker and previous studies have demonstrated that cell-free DNA levels are increased up to 10-fold in patients with various malignancies, allowing the accurate discrimination of patients with cancer and healthy controls.8 –10,13 Cell-free DNA levels do not enable us to differentiate among various cancer entities but this is not necessarily a drawback because serum tumor markers are most important for surveillance and prognosis in patients with testicular cancer. We observed that cell-free DNA levels were approximately 9-fold higher in patients with testicular cancer compared to those in healthy controls. We observed 85% sensitivity and 97% specificity (AUC 0.92) for the ACTB-193 primer set on ROC analysis. Cell-free DNA levels were not related to patient age, serum tumor marker levels or histological subtype, suggesting that cell-free DNA is a useful biomarker in all patients with testicular cancer. As a matter of particular interest, analysis of ACTB-193 fragments also allowed us to identify patients with testicular cancer who had positive and negative tumor marker findings, that is no increase in ACP, HCG, LDH or PLAP, with similar sensitivity and specificity. Conventional tumor markers are within normal ranges

368

CELL-FREE CIRCULATING DNA AND TESTICULAR GERM CELL CANCER

Figure 4. Cell-free DNA levels in patients with testicular cancer with seminoma and nonseminoma, and healthy individuals. Levels of ACTB-106 (A) and 193 (B) fragments were significantly increased in patients with testicular cancer compared to those in healthy individuals (each p ⬍0.0001).

in approximately 40% of patients at diagnosis and cancer recurrence.4 In our study 31 patients (41%) with testicular cancer presented with normal levels of AFP, HCG, LDH and PLAP. Even in these patients the analysis of ACTB-193 levels provided 84% sensitivity and 97% specificity. Therefore, we assume that the analysis of cell-free DNA levels is helpful for treating patients with testicular cancer. The most interesting role that circulating DNA may have is the identification of stage I cases with occult metastasis and the evaluation of the vitality of residual masses following chemotherapy. Future studies are needed to clarify these important questions. To our knowledge no data exist to date on how long cell-free DNA levels are increased after surgical

intervention. We assume that cell-free DNA levels would attain normal ranges when orchiectomy is performed in patients with localized disease, whereas cellfree DNA levels would remain increased in patients with metastatic disease. This hypothesis is supported by the fact that the half-life of cell-free DNA is approximately 16 minutes in plasma.14 Increases in cell-free DNA levels in patients due to trauma and probably also to surgical trauma was reported to attain normal levels within 2 hours after insult.15 Thus, recurrent or persistent increased cell-free DNA levels following orchiectomy may indicate cancer recurrence or the presence of residual metastatic tumor. We observed that cell-free DNA levels were significantly increased in patients with advanced tes-

CELL-FREE CIRCULATING DNA AND TESTICULAR GERM CELL CANCER

369

Figure 5. Cell-free DNA levels in patients with testicular cancer with seminoma and nonseminoma, and healthy individuals. Levels of ACTB-384 fragments were significantly increased in patients with testicular cancer compared to those in healthy individuals (p ⬍0.0001) (A). DNA integrity-384, ie ratio of ACTB-384/106, was decreased in patients with cancer (p ⬍0.0001). ROC analysis demonstrated that analysis of cell-free DNA fragments allowed accurate discrimination of healthy individuals and patients with cancer (B).

ticular germ cell cancer, ie clinical stage III. Therefore, preoperative measurement of cell-free DNA may provide prognostic as well as diagnostic information. It should be kept in mind that only 7 patients with stage III testicular cancer were included in our study and, thus, statistical power was limited. We could not find a correlation of preoperative cellfree DNA levels and patient outcome due to the limited number of recurrences in our data set. Studies in patients with prostate and lung cancer support our hypothesis that cell-free serum DNA levels are prognostically relevant. Of patients with prostate cancer preoperative cell-free DNA levels in serum were increased in those with PSA recurrence

after prostatectomy.7,10 Of patients with nonsmall cell lung cancer survival was shorter in those with high baseline cell-free DNA levels before therapy.13 A growing number of studies also suggest that qualitative changes in circulating DNA in cancer cases are also important. Jahr et al reported that cell-free DNA originated from apoptotic cells (presence of DNA fragmentation with oligonucleosomal laddering 180 to 200 bp long, presumably fragmented by caspase directed deoxyribonuclease activity) and/or necrotic cells (high molecular DNA greater than 10,000 bp).6 We detected increased DNA fragmentation in patients with testicular cancer compared to that in controls, which was possibly

370

CELL-FREE CIRCULATING DNA AND TESTICULAR GERM CELL CANCER

Table 3. Diagnostic information on cell-free ACTB DNA fragments in patients with testicular cancer

Ca vs Controls ACTB-106: Seminoma Nonseminoma Testicular Ca ACTB-193: Seminoma Nonseminoma Testicular Ca ACTB-384: Seminoma Nonseminoma Testicular Ca DNA integrity384: Seminoma Nonseminoma Testicular Ca

Cutoff (ng/ml)

% Sensitivity

% Specificity

AUC (95% CI)

3.20 3.35 3.20

76.9 82.9 79.7

94.3 94.3 94.3

0.880 (0.795–0.965) 0.904 (0.821–0.988) 0.892 (0.829–0.945)

2.56 1.96 2.56

84.6 91.4 87.8

97.1 94.3 97.1

0.919 (0.849–0.989) 0.922 (0.840–1.000) 0.920 (0.866–0.974)

1.54 1.54 1.54

69.2 71.4 70.3

85.7 85.7 85.7

0.804 (0.703–0.906) 0.818 (0.712–0.924) 0.811 (0.731–0.891)

0.64 0.62 0.64

60.0 60.0 57.1

87.2 88.6 89.2

0.744 (0.625–0.864) 0.748 (0.629–0.867) 0.746 (0.635–0857)

induced by increased apoptosis. In the case of apoptosis we expected 200 to 400 bp DNA fragments but our results showed similar DNA levels using the primer sets ACTB-106 and 193, indicating similar mononucleosomal and dinucleosomal fragment levels (200 and 400 bp, respectively). Therefore, we have not yet decided whether this result is caused by an asymmetrical apoptotic fragmentation mecha-

Figure 6. ACTB-193 DNA fragments in patients with stages I, II and III disease. Cell-free DNA levels were significantly increased in stage III cases.

Figure 7. ACTB-384 DNA fragments in patients with stages I, II and III disease. Cell-free DNA levels were significantly increased in stage III cases.

nism or by noncaspase directed, unspecific deoxyribonuclease activity. Recent publications have shown that DNA integrity is increased in the serum of

Figure 8. ROC analysis for discriminating patients with stages I/II vs III.

CELL-FREE CIRCULATING DNA AND TESTICULAR GERM CELL CANCER

patients with breast11 and colon12 cancer, indicating a predominantly necrotic breakdown. On the other hand, in patients with prostate7 and bladder8 cancer mainly apoptotic DNA fragments were detected. Also, the fragmentation patterns were prognostically relevant for prostate,7 bladder8 and breast cancer.11 An increasing number of studies currently describe the diagnostic and prognostic information of cell-free DNA in the serum/plasma of patients with cancer. The quantification of cell-free DNA is highly repeatable.16 Furthermore, cell-free DNA levels are characterized by high stability. Even when blood processing, eg centrifugation, is delayed up to 6 hours after blood withdrawal, cell-free DNA levels in serum and especially in plasma do not change significantly.17 Nevertheless, several methodological aspects make the comparison of these different studies difficult. 1) Serum has approximately 6-fold higher cell-free DNA levels than plasma and for a long time it was assumed that higher levels were due to cell lysis during clotting. However, a recent study showed that higher levels of cell-free DNA in serum are not caused by extraneous contamination.18 Therefore, we used serum in our experi-

371

ments. 2) Using different DNA isolation kits also complicates the comparison of results because the DNA extraction efficiency of these kits is quite variable.16 3) Finally, although real-time PCR is now the gold standard for analyzing cell-free DNA, the use of different primer sets as well as the analysis of genomic,7–10,13,19 retroviral11,12 or mitochondrial DNA19,20 makes comparison difficult. Consequently standardization and prospective, multicenter studies are necessary before cell-free DNA analysis can be implemented in clinical routine investigations.

CONCLUSIONS Cell-free DNA levels are distinctly increased in patients with testicular germ cell cancer and they allow us to accurately discriminate such patients from healthy controls. Even in patients with negative assessment of AFP, HCG, LDH or PLAP cell-free DNA levels are helpful. We assume that the analysis of cell-free DNA could facilitate clinical management for testicular cancer. Future studies are needed to investigate the potential of predict occult metastasis in patients with cN0 disease.

REFERENCES 1. Jemal A, Siegel R, Ward E, Murray T, Xu J and Thun MJ: Cancer statistics, 2007. CA Cancer J Clin 2007; 57: 43. 2. Huyghe E, Matsuda T and Thonneau P: Increasing incidence of testicular cancer worldwide: a review. J Urol 2003; 170: 5. 3. International Germ Cell Consensus Classification: a prognostic factor-based staging system for metastatic germ cell cancers. International Germ Cell Cancer Collaborative Group. J Clin Oncol 1997; 15: 594. 4. Trigo JM, Tabernero JM, Paz-Ares L, GarciaLlano JL, Mora J, Lianes P et al: Tumor markers at the time of recurrence in patients with germ cell tumors. Cancer 2000; 88: 162.

8. Ellinger J, Bastian PJ, Ellinger N, Perabo FG, Buettner R, Mueller SC et al: Apoptotic DNA fragments in serum of patients with muscle invasive bladder cancer: a prognostic entity. Cancer Lett 2008; 264: 274. 9. Chang HW, Lee SM, Goodman SN, Singer G, Cho SK, Sokoll LJ et al: Assessment of plasma DNA levels, allelic imbalance, and CA 125 as diagnostic tests for cancer. J Natl Cancer Inst 2002; 94: 1697. 10. Bastian PJ, Palapattu GS, Yegnasubramanian S, Lin X, Rogers CG, Mangold LA et al: Prognostic value of preoperative serum cell-free circulating DNA in men with prostate cancer undergoing radical prostatectomy. Clin Cancer Res 2007; 13: 5361.

14. Lo YM, Zhang J, Leung TN, Lau TK, Chang AM and Hjelm NM: Rapid clearance of fetal DNA from maternal plasma. Am J Hum Genet 1999; 64: 218. 15. Lam NY, Rainer TH, Chan LY, Joynt GM and Lo YM: Time course of early and late changes in plasma DNA in trauma patients. Clin Chem 2003; 49: 1286. 16. de Kok JB, Hendriks JC, van Solinge WW, Willems HL, Mensink EJ and Swinkels DW: Use of real-time quantitative PCR to compare DNA isolation methods. Clin Chem 1998; 44: 2201. 17. Tsui NB, Ng EK and Lo YM: Stability of endogenous and added RNA in blood specimens, serum, and plasma. Clin Chem 2002; 48: 1647.

5. Leon SA, Shapiro B, Sklaroff DM and Yaros MJ: Free DNA in the serum of cancer patients and the effect of therapy. Cancer Res 1977; 37: 646.

11. Umetani N, Giuliano AE, Hiramatsu SH, Amersi F, Nakagawa T, Martino S et al: Prediction of breast tumor progression by integrity of free circulating DNA in serum. J Clin Oncol 2006; 24: 4270.

18. Umetani N, Hiramatsu S and Hoon DS: Higher amount of free circulating DNA in serum than in plasma is not mainly caused by contaminated extraneous DNA during separation. Ann N Y Acad Sci 2006; 1075: 299.

6. Jahr S, Hentze H, Englisch S, Hardt D, Fackelmayer FO, Hesch RD et al: DNA fragments in the blood plasma of cancer patients: quantitations and evidence for their origin from apoptotic and necrotic cells. Cancer Res 2001; 61: 1659.

12. Umetani N, Kim J, Hiramatsu S, Reber HA, Hines OJ, Bilchik AJ et al: Increased integrity of free circulating DNA in sera of patients with colorectal or periampullary cancer: direct quantitative PCR for ALU repeats. Clin Chem 2006; 52: 1062.

19. Mehra N, Penning M, Maas J, van Daal N, Giles RH and Voest EE: Circulating mitochondrial nucleic acids have prognostic value for survival in patients with advanced prostate cancer. Clin Cancer Res 2007; 13: 421.

7. Ellinger J, Bastian PJ, Haan KI, Heukamp LC, Buettner R, Fimmers R et al: Noncancerous PTGS2 DNA fragments of apoptotic origin in sera of prostate cancer patients qualify as diagnostic and prognostic indicators. Int J Cancer 2008; 122: 138.

13. Gautschi O, Bigosch C, Huegli B, Jermann M, Marx A, Chasse E et al: Circulating deoxyribonucleic acid as prognostic marker in non-small-cell lung cancer patients undergoing chemotherapy. J Clin Oncol 2004; 22: 4157.

20. Ellinger J, Mueller SC, Wernert N, von Ruecker A, and Bastian PJ: Mitochondrial DNA in serum of patients with prostate cancer: a predictor of biochemical recurrence following prostatectomy. BJU Int 2008; 102: 628.