- Email: [email protected]
Cell-mediated immune response in swine infected with Mycobacterium avium subsp. avium
Veterinary Immunology and Immunopathology 142 (2011) 107–112
Contents lists available at ScienceDirect
Veterinary Immunology and Immunopathology journal homepage: www.elsevier.com/locate/vetimm
Short communication
Cell-mediated immune response in swine infected with Mycobacterium avium subsp. avium Hana Stepanova, Barbora Pavlova, Nikola Stromerova, Jan Matiasovic, Marija Kaevska, Ivo Pavlik, Martin Faldyna ∗ Veterinary Research Institute, Hudcova 70, 621 00 Brno, Czech Republic
a r t i c l e
i n f o
Article history: Received 1 August 2010 Received in revised form 15 March 2011 Accepted 6 April 2011 Keywords: Pig Avian tuberculosis Interferon-␥ CD4+ CD8+ T cell
a b s t r a c t The zoonotic characteristic of Mycobacterium avium subsp. avium (MAA) represents a veterinary and economic problem in infected pigs. In this study, we analysed cell-mediated immunity six months after experimental infection by measuring interferon-␥ (IFN-␥) production and by performing lymphocyte transformation tests after in vitro re-stimulation with the MAA-derived antigen. At the same time, IFN-␥-producing cells were characterised by flow cytometry. In MAA-infected animals, the production of IFN-␥ increased in response to the MAA antigen in the blood, spleen and mesenteric lymph nodes. Similarly, a positive antigen-driven response was detected by the proliferation assay. In contrast, IFN-␥ production and proliferation was undetectable after stimulation with the MAA antigen in uninfected control animals. These results indicate that both methods can be used for the identification of individual MAA-infected pigs. Using flow cytometry, we found that doublepositive CD4+ CD8+ lymphocytes were the major T lymphocyte subset producing IFN-␥ after in vitro re-stimulation. © 2011 Elsevier B.V. All rights reserved.
1. Introduction Mycobacterium avium subsp. avium (MAA) is a member of the Mycobacterium avium complex, which is characterised by the presence of the insertion sequences IS901 and IS1245. Mycobacterium avium subsp. avium is a primary pathogen that causes avian tuberculosis, which is commonly distributed throughout the environment (for review, see Biet et al., 2005). The infection has a zoonotic characteristic and represents a veterinary and economic problem. Contaminated raw pork meat represents a potential source of the bacteria for humans (Möbius et al., 2006). In this case, meat from infected pigs is considered inappropriate for consumption (Pavlik et al., 2003).
∗ Corresponding author. Tel.: +420 533331301; fax: +420 541211229. E-mail address: [email protected] (M. Faldyna). 0165-2427/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.vetimm.2011.04.005
The standard diagnostic procedure is a skin test; however, this has some shortages including low sensitivity (Monaghan et al., 1994). Methods based on the cell-mediated immunity could be valid tools for the identification of MAA-infected pigs. The IFN-␥ release assay is one of the potential candidates. In the veterinary field, this assay is successfully used to identify M. bovis infected cattle (Gormley et al., 2006), although it has not yet been tested in the case of MAA infection in pigs. However, porcine CD4+ and ␥␦TCR+ cells proliferate and are the principal sources of IFN-␥ early after vaccination with Mycobacterium bovis bacillus Calmette-Guérin (Lee et al., 2004). In this study, we focused on proving the specific cellmediated immunity in pigs six months after MAA infection. Cell-mediated immunity was assessed by measuring MAA antigen-driven IFN-␥ production (IFN-␥ release assay) and by performing a lymphocyte proliferation assay. The IFN␥-producing lymphocytes were also characterised by flow cytometry.
108
H. Stepanova et al. / Veterinary Immunology and Immunopathology 142 (2011) 107–112
2. Materials and methods 2.1. Experimental infection of pigs Six clinically healthy 28-day-old piglets from a farm with a good epidemiological situation were used in this study. Three animals (designated Su1–3) were experimentally infected with MAA serotype 2 (strain 5889 from the Collection of Animal Pathogenic Microorganisms, Veterinary Research Institute, Brno, Czech Republic), grown in continuously stirred Middlebrook 7H9 (Difco, USA) with Middlebrook AODC Enrichment (Difco) for three weeks. The pigs were infected by placing some of the bacterial culture onto their scratched tonsils at a dose of 1 × 108 . The remaining three animals (designated Su4–6) were left as uninfected controls. The MAA-infected animals had no clinical signs. The course of infection was monitored via bacteriological examinations of the faeces, using a culture method, until the end of the experiment (Fischer et al., 2001). Infected animals shed the bacteria for five days. Six months after infection, all animals were euthanized and subjected to necropsy. Typical mycobacterial lesions were found in the mesenteric lymph nodes (MLN) of the infected animals. The presence of DNA from MAA was evaluated by quantitative real-time RT-PCR (qRT-PCR) in different tissues (Slana et al., 2010). Positive results were obtained in submandibular lymph nodes and MLN. The results of the culture method were negative. The animals were used in this study under the agreement of the Branch Commission for Animal Welfare of the Ministry of Agriculture of the Czech Republic. 2.2. Preparation of the MAA antigen for in vitro immunological methods A mycobacterial culture (MAA strain 5889, used for the experimental infection) grown on Herrold’s egg yolk medium (HEYM) was repeatedly freeze-thawed and the homogenate was prepared by ultrasound treatment for two successive 10 min runs 10 min apart. Then, the suspension was centrifuged at 10,000 × g for 10 min. The supernatant was collected and stored at −18 ◦ C. The antigen was partly characterised by total protein content quantitation (BCATM Protein Assay Kit, Pierce, France; used according to the manufacturer’s recommendations) and SDS–PAGE (Laemmli, 1970). The gels were stained with silver (Rabilloud et al., 1988). Using the BCATM kit, the total protein content was found to be 0.52 mg/ml. The antigen was separated by electrophoresis into at least 11 bands of molecular weight ranging from 25 to 130 kDa, with the major bands ranging from 39 to 79 kDa. The optimal final protein concentration of the MAA antigen used for the in vitro stimulation was 0.3 g/ml. 2.3. Sample collection and cell isolation Blood samples were immediately heparinised (20 i.u./ml). During necropsy, samples of the spleen and MLN were stored in sterile RPMI-1640 medium (Sigma–Aldrich, USA). Peripheral blood mononuclear cells (PBMC) were obtained by gradient centrifugation
(Histopaque-1077, Sigma–Aldrich). Cells from the spleen and MLN were isolated by tissue homogenisation in RPMI1640 medium, followed by two washes in this medium (Stepanova et al., 2007). 2.4. Lymphocyte transformation test The PBMC and cells isolated from the spleen and MLN (200,000 cells in 200 l of RPMI-1640 medium supplemented with 10% of autologous serum, 100 IU/ml penicillin, 100 g/ml streptomycin and 4 g/ml gentamicin) were incubated with the optimal concentration of the specific MAA antigen (0.3 g/ml) for five days at 37 ◦ C in 5% CO2 . Negative controls were incubated with RPMI-1640 medium only. All samples were evaluated in triplicate. 3 H-thymidine was added on the last day of cultivation. Subsequently, the cells were harvested (FilterMate Harvestor, Packard Bioscience Company, USA), and 3 H-thymidine incorporation was measured by a microplate scintillation and luminescence counter (TopCount NXTTM , Packard Bioscience Company) in counts per minute (CPM). The results were expressed in terms of stimulation indexes (SI), which were calculated as the ratio of CPM in stimulated samples versus CPM in non-stimulated controls (Faldyna et al., 2007). 2.5. ELISA for IFN- detection The samples of whole blood (1 ml) or cells isolated from the spleen and MLN (4 × 106 in 1 ml of RPMI-1640 medium with 10% of autologous serum, 100 IU/ml penicillin, 100 g/ml streptomycin and 4 g/ml gentamicin) were cultured with and without the optimal concentration of the MAA antigen (0.3 g/ml) for 18 h at 37 ◦ C in 5% CO2 . Supernatants from the samples were frozen at −18 ◦ C. The quantity of IFN-␥ was measured using a commercial ELISA kit according to the manufacturer’s recommendations (BioSource International, Inc., USA). Absorbance was read on a multi-detection microplate reader SynergyTM 2 (BioTek Instruments, USA). 2.6. IFN- mRNA detection by qRT-PCR The PBMC and cells isolated from the spleen and MLN were cultivated in vitro with or without the MAA antigen as described previously for the detection of IFN␥ by ELISA. Afterwards, the cells were centrifuged and lysed in RLT buffer (RNeasy Mini Kit, Qiagen, Germany). The methods of RNA isolation, reverse transcription and qRT-PCR were described previously (Pavlova et al., 2008). Briefly, total RNA was isolated using an RNeasy Mini Kit (Qiagen). The RNA was then reverse transcribed with M-MLV reverse transcriptase (Invitrogen, USA) using oligo-dT primers (Qiagen). Measurements were performed using the LightCycler 1.2 (Roche, USA), with a QuantiTect SYBR Green PCR Kit (Qiagen). Primers were purchased from Generi Biotech (Czech Republic). The primers for IFN-␥ (forward 5 –3 : CCATTCAAAGGAGCATGGAT; reverse 5 –3 : GAGTTCACTGATGGCTTTGC) were designed using the freely available Primer3 software (http://fokker.wi.mit.edu/primer3/input.htm). The
H. Stepanova et al. / Veterinary Immunology and Immunopathology 142 (2011) 107–112
109
Table 1 IFN-␥ mRNA detection by qRT-PCR after in vitro re-stimulation with the MAA antigen.
PBMC
Spleen
MLN
MAA-infected (Su1)
48.00
77.44
6.06
MAA-infected (Su2)
388.88
135.29
16.44
MAA-infected (Su3)
173.23
39.53
9.64
Control (Su4)
4.47
3.01
1.95
Control (Su5)
3.32
2.75
1.02
Control (Su6)
6.41
3.08
4.48
Note: The data are shown as the relative expression ratio of a cytokine gene calculated according to the 2−CT method. Significant results between MAAinfected pigs and uninfected control pigs are marked by grey boxes (p ≤ 0.05, Mann–Whitney test).
relative expression ratio of a cytokine gene was calculated according to 2−CT (Livak and Schmittgen, 2001) using hypoxanthine phosphoribosyltransferase (HPRT) mRNA as a reference (Nygard et al., 2007). The primers for HPRT were adopted from Volf et al. (2007). 2.7. Characterisation of IFN--producing cells by flow cytometry Whole blood (0.5 ml) from MAA-infected pigs was diluted in a proportion of 1:1 with RPMI-1640 medium and stimulated with the MAA antigen (concentration
0.3 g/ml) for 18 h. Four hours before the end of cultivation, the inhibitor of protein transport Brefeldin A (10 g/ml, Sigma–Aldrich) was added. Thereafter, the cells were stained with primary antibodies for the following surface markers: CD4 (10.2H2, Dr. J.K. Lunney, Animal Parasitology Institute, Beltsville, MO, USA) and CD8␣:PECy5 (76-2-11, SouthernBiotech, USA). The FITC-conjugated mouse isotype-specific goat antiserum (SouthernBiotech) was used for CD4 visualisation. After surface marker staining, the samples were fixed and permeabilised using an Intrastain kit (Dako). During the permeabilisation step, anti-IFN-␥:PE-conjugated antibody (CC302, AbD Serotec,
Fig. 1. Responses of cells isolated from the blood, spleen and MLN after re-stimulation with the MAA antigen. The cell-mediated immune response was measured by the MAA antigen-driven lymphocyte transformation test as the proliferation assay (left Y-axis) and by ELISA detection of IFN-␥ in the supernatant from MAA antigen-stimulated samples as the IFN-␥ release assay (right Y-axis).
110
H. Stepanova et al. / Veterinary Immunology and Immunopathology 142 (2011) 107–112
Fig. 2. Flow cytometric analyses of IFN-␥-producing blood cells in MAA-infected pigs. Representative picture from three MAA-infected pigs. Dot plots and the percentage of IFN-␥-producing cells from lymphocytes (A); Dot plots and the percentage of IFN-␥-producing T lymphocyte subsets based on the three-colour staining of CD4/CD8/IFN-␥. The percentage of IFN-␥-positive cell accounts from each gated subpopulation (B).
H. Stepanova et al. / Veterinary Immunology and Immunopathology 142 (2011) 107–112
UK) or the isotype control (mouse IgG1 negative control:PE; AbD Serotec) was added (Zelnickova et al., 2007). Data were acquired on a standard FACSCaliburTM (Becton-Dickinson, USA) flow cytometer. The lymphocytes were gated based on their forward and side scatter characteristics for data analyses. 2.8. Statistical analyses The Mann–Whitney non-parametric test was used for a statistical comparison of MAA-infected and uninfected control pigs. Spearman’s rank correlation was used to test for a correlation between IFN-␥ detection and the cellular proliferation assay. Values of p ≤ 0.05 were considered statistically significant. All calculations were performed using GraphPad Prism® version 3.03 software (GraphPad Software, USA). 3. Results and discussion Our results confirmed cell-mediated immunity in MAAinfected pigs and also suggest possibilities for the intravital diagnosis of mycobacterial infections by analysing cellmediated immunity. Interferon-␥ production and cellular proliferation after specific in vitro re-stimulation was detectable in the lymphocytes isolated from the blood, spleen and MLN from MAA-infected animals (Fig. 1). In the uninfected animals, the levels of IFN-␥ in all MAA antigen-stimulated samples were below 18 pg/ml, and the SI in the MAA-driven lymphocyte transformation test were <2.0. Significance differences in the SI between the MAA-infected and uninfected pigs were observed in the blood and spleen (p ≤ 0.05, Mann–Whitney test). A statistical analysis of the IFN-␥ levels was impracticable because the values from all of the uninfected pigs were below the detection limit. The levels of IFN-␥ in the non-stimulated samples from both MAAinfected and uninfected pigs were also below 18 pg/ml (data not shown). Based on the current data, the detection of a cellmediated immune response is a valid tool for identifying MAA-infected pigs. The results of both methods (IFN-␥ release assay and the proliferation assay) were negative in uninfected control pigs. The difference between antigenstimulated and non-stimulated samples was crucial for the evaluation of both assays. In the uninfected animals, the level of IFN-␥ and SI was comparable in both stimulated and non-stimulated samples. This indicates that the MAA lysate is a functional usable antigen for the stimulation of cell-mediated immunity in MAA-infected pigs without any unspecific stimulatory effects. The induction of IFN-␥ in MAA-infected pigs was confirmed by qRT-PCR (Table 1). In agreement with the results from the ELISA, there was significantly higher IFN␥ mRNA expression in the antigen-stimulated samples in MAA-infected pigs in comparison with the uninfected control animals (p ≤ 0.05, Mann–Whitney test). Therefore, the detection of IFN-␥ mRNA by qRT-PCR is a valid tool for evaluating the IFN-␥ release assay, in addition to measuring the protein by ELISA. For example, it could be used in animal species for which ELISA is not available.
111
When IFN-␥ production and the proliferation assays were compared, a significantly positive correlation between both methods was found in the blood and spleen (both p = 0.0167; r = 0.9411, Spearman’s test), but not for the cells from the MLN (p = 0.2972; r = 0.5161, Spearman’s test). This discrepancy could be explained by the presence of two memory Th cells which were described in human and mice: effectors and central memory cells (Sallusto et al., 1999). The presence of these functionally different memory Th subsets was also recently confirmed in cattle. Central memory cells are characterised by a high proliferative capacity and a low IFN-␥ production, together with the expression of the lymph node-associated homing receptor CCR7 (Totté et al., 2010). We can speculate that MAA infection in pigs induced central memory cells in the MLN where a high proliferative capacity but a low IFN-␥ production was detected after specific in vitro re-stimulation. The phenotype of IFN-␥-producing cells in MAAinfected pigs was detected by the intracellular staining of IFN-␥ in combination with surface markers and a flow cytometric analysis. The results showed that double-positive CD4+ CD8+ cells were the main T lymphocyte sources of IFN␥ after specific stimulation in MAA-infected pigs (Fig. 2). There was 5.31 ± 1.77% (mean ± SD, n = 3) CD4+ CD8+ IFN-␥+ cells from all CD4+ CD8+ cells. The CD4− CD8hi IFN-␥+ population accounted for 0.97 ± 0.46% of all CD4− CD8hi cells. The CD4+ CD8− population was almost negative for IFN-␥ (0.23 ± 0.22% of CD4+ CD8− IFN-␥+ from all CD4+ CD8− cells). To the best of our knowledge, this is the first study to report the capability of porcine double-positive CD4+ CD8+ cells to produce IFN-␥ in antimycobacterial immunity. This porcine subset with a memory capacity has been described as being involved in antiviral immunity (Summerfield et al., 1996). We can speculate that this unique lymphocyte subset is involved in long-term immunity in MAA-infected pigs, but future experiments are needed to evaluate the actual role of CD4+ CD8+ cells in the antimycobacterial immune response. In conclusion, we suggest that the porcine immune system shows cell-mediated immunity for at least six months after infection with MAA. Interferon-␥ detection and the lymphocyte transformation test, after re-stimulation with the MAA antigen, represent specific methods for the identification of individual MAA-infected pigs. A more detailed study is necessary to confirm and develop the practical applications of both methodological approaches. Additionally, we identified double-positive CD4+ CD8+ cells as a major T lymphocyte population producing IFN-␥ after specific in vitro re-stimulation. Acknowledgements The work was supported by the Ministry of Agriculture of the Czech Republic (1B53009 and MZE0002716202) and Ministry of Education, Youth and Sports of the Czech Republic (project AdmireVet, CZ.1.05/2.1.00/01.0006, ED0006/01/01). The authors wish to thank Mr. Paul Veater (Bristol, United Kingdom) for proofreading the manuscript and Assoc. Prof. Jan Novak (Dept. of Microbiology, The University of Alabama at Birmingham) for critical reading.
112
H. Stepanova et al. / Veterinary Immunology and Immunopathology 142 (2011) 107–112
References Biet, F., Boschiroli, M.L., Thorel, M.F., Guilloteau, L.A., 2005. Zoonotic aspects of Mycobacterium bovis and Mycobacterium avium-intracellular complex (MAC). Vet. Res. 36, 411–436. Faldyna, M., Oborilova, E., Krejci, J., Tesarik, R., Krejci, E., Pavlova, B., Rybnikar, A., 2007. A correlation of in vitro tests for the immune response detection: a bovine trichophytosis model. Vaccine 25, 7948–7954. Fischer, O., Matlova, L., Dvorska, L., Svastova, P., Bartl, J., Melicharek, I., Weston, R.T., Pavlik, I., 2001. Diptera as vectors of mycobacterial infections in cattle and pigs. Med. Vet. Entomol. 15, 208–211. Gormley, E., Doyle, M.B., Fitzsimons, T., McGill, K., Collins, J.D., 2006. Diagnosis of Mycobacterium bovis infection in cattle by use of the gamma-interferon (Bovigam) assay. Vet. Microbiol. 112, 171–179. Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680–685. Lee, J., Choi, K., Olin, M.R., Cho, S.N., Molitor, T.W., 2004. Gammadelta T cells in immunity induced by Mycobacterium bovis bacillus CalmetteGuérin vaccination. Infect. Immun. 72, 1504–1511. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−CT method. Methods 25, 402–408. Möbius, P., Lentzsch, P., Moser, I., Naumann, L., Martin, G., Köhler, H., 2006. Comparative macrorestriction and RFLP analysis of Mycobacterium avium subsp. avium and Mycobacterium avium subsp. hominissuis isolates from man, pig, and cattle. Vet. Microbiol. 117, 284–291. Monaghan, M.L., Doherty, J.D., Collin, J.F., Kazda, P.J., Quinn, 1994. The tuberculin test. Vet. Microbiol. 40, 111–124. Nygard, A.B., Jørgensen, C.B., Cirera, S., Fredholm, M., 2007. Selection of reference genes for gene expression studies in pig tissues using SYBR green qPCR. BMC Mol. Biol., 8. Pavlik, I., Matlova, L., Dvorska, L., Bartl, J., Oktabcova, L., Docekal, J., 2003. Tuberculous lesions in pigs in the Czech Republic during 1990–1999:
occurrence, causal factors and economic losses. Vet. Med. Czech. 48, 113–125. Pavlova, B., Volf, J., Alexa, P., Rychlik, I., Matiasovic, J., Faldyna, M., 2008. Cytokine mRNA expression in porcine cell lines stimulated by enterotoxigenic Escherichia coli. Vet. Microbiol. 132, 105–110. Rabilloud, T., Carpentier, G., Tarronx, P., 1988. Improvement and simplification of low-background silver staining of proteins by using podium dithionite. Electrophoresis 9, 288–291. Sallusto, F., Lenig, D., Förster, R., Lipp, M., Lanzavecchia, A., 1999. Two subsets of memory T lymphocytes with distinct homing potentials and effector functions. Nature 401, 708–712. Slana, I., Kaevska, M., Kralik, P., Horvathova, A., Pavlik, I., 2010. Distribution of Mycobacterium avium subsp. avium and M. a. hominissuis in artificially infected pigs studied by culture and IS901 and IS1245 quantitative real time PCR. Vet. Microbiol., doi:10.1016/j.vetmic.2010.02.024. Stepanova, H., Samankova, P., Leva, L., Sinkora, J., Faldyna, M., 2007. Early postnatal development of the immune system in piglets: the redistribution of T lymphocyte subsets. Cell. Immunol. 249, 73–79. Summerfield, A., Rziha, H.J., Saalmuller, A., 1996. Functional characterization of porcine CD4+CD8+ extrathymic T lymphocytes. Cell. Immunol. 168, 291–296. Totté, P., Duperray, C., Dedieu, L., 2010. CD62L defines a subset of pathogen-specific bovine CD4 with central memory cell characteristics. Dev. Comp. Immunol. 34, 177–182. Volf, J., Boyen, F., Faldyna, M., Pavlova, B., Navratilova, J., Rychlik, I., 2007. Cytokine response of porcine cell lines to Salmonella enterica serovar typhimurium and its hilA and ssrA mutants. Zoonoses Public Health 54, 286–293. Zelnickova, P., Faldyna, M., Stepanova, H., Ondracek, J., Kovaru, F., 2007. Intracellular cytokine detection by flow cytometry in pigs: fixation, permeabilization and cell surface staining. J. Immunol. Methods 327, 18–29.
Contents lists available at ScienceDirect
Veterinary Immunology and Immunopathology journal homepage: www.elsevier.com/locate/vetimm
Short communication
Cell-mediated immune response in swine infected with Mycobacterium avium subsp. avium Hana Stepanova, Barbora Pavlova, Nikola Stromerova, Jan Matiasovic, Marija Kaevska, Ivo Pavlik, Martin Faldyna ∗ Veterinary Research Institute, Hudcova 70, 621 00 Brno, Czech Republic
a r t i c l e
i n f o
Article history: Received 1 August 2010 Received in revised form 15 March 2011 Accepted 6 April 2011 Keywords: Pig Avian tuberculosis Interferon-␥ CD4+ CD8+ T cell
a b s t r a c t The zoonotic characteristic of Mycobacterium avium subsp. avium (MAA) represents a veterinary and economic problem in infected pigs. In this study, we analysed cell-mediated immunity six months after experimental infection by measuring interferon-␥ (IFN-␥) production and by performing lymphocyte transformation tests after in vitro re-stimulation with the MAA-derived antigen. At the same time, IFN-␥-producing cells were characterised by flow cytometry. In MAA-infected animals, the production of IFN-␥ increased in response to the MAA antigen in the blood, spleen and mesenteric lymph nodes. Similarly, a positive antigen-driven response was detected by the proliferation assay. In contrast, IFN-␥ production and proliferation was undetectable after stimulation with the MAA antigen in uninfected control animals. These results indicate that both methods can be used for the identification of individual MAA-infected pigs. Using flow cytometry, we found that doublepositive CD4+ CD8+ lymphocytes were the major T lymphocyte subset producing IFN-␥ after in vitro re-stimulation. © 2011 Elsevier B.V. All rights reserved.
1. Introduction Mycobacterium avium subsp. avium (MAA) is a member of the Mycobacterium avium complex, which is characterised by the presence of the insertion sequences IS901 and IS1245. Mycobacterium avium subsp. avium is a primary pathogen that causes avian tuberculosis, which is commonly distributed throughout the environment (for review, see Biet et al., 2005). The infection has a zoonotic characteristic and represents a veterinary and economic problem. Contaminated raw pork meat represents a potential source of the bacteria for humans (Möbius et al., 2006). In this case, meat from infected pigs is considered inappropriate for consumption (Pavlik et al., 2003).
∗ Corresponding author. Tel.: +420 533331301; fax: +420 541211229. E-mail address: [email protected] (M. Faldyna). 0165-2427/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.vetimm.2011.04.005
The standard diagnostic procedure is a skin test; however, this has some shortages including low sensitivity (Monaghan et al., 1994). Methods based on the cell-mediated immunity could be valid tools for the identification of MAA-infected pigs. The IFN-␥ release assay is one of the potential candidates. In the veterinary field, this assay is successfully used to identify M. bovis infected cattle (Gormley et al., 2006), although it has not yet been tested in the case of MAA infection in pigs. However, porcine CD4+ and ␥␦TCR+ cells proliferate and are the principal sources of IFN-␥ early after vaccination with Mycobacterium bovis bacillus Calmette-Guérin (Lee et al., 2004). In this study, we focused on proving the specific cellmediated immunity in pigs six months after MAA infection. Cell-mediated immunity was assessed by measuring MAA antigen-driven IFN-␥ production (IFN-␥ release assay) and by performing a lymphocyte proliferation assay. The IFN␥-producing lymphocytes were also characterised by flow cytometry.
108
H. Stepanova et al. / Veterinary Immunology and Immunopathology 142 (2011) 107–112
2. Materials and methods 2.1. Experimental infection of pigs Six clinically healthy 28-day-old piglets from a farm with a good epidemiological situation were used in this study. Three animals (designated Su1–3) were experimentally infected with MAA serotype 2 (strain 5889 from the Collection of Animal Pathogenic Microorganisms, Veterinary Research Institute, Brno, Czech Republic), grown in continuously stirred Middlebrook 7H9 (Difco, USA) with Middlebrook AODC Enrichment (Difco) for three weeks. The pigs were infected by placing some of the bacterial culture onto their scratched tonsils at a dose of 1 × 108 . The remaining three animals (designated Su4–6) were left as uninfected controls. The MAA-infected animals had no clinical signs. The course of infection was monitored via bacteriological examinations of the faeces, using a culture method, until the end of the experiment (Fischer et al., 2001). Infected animals shed the bacteria for five days. Six months after infection, all animals were euthanized and subjected to necropsy. Typical mycobacterial lesions were found in the mesenteric lymph nodes (MLN) of the infected animals. The presence of DNA from MAA was evaluated by quantitative real-time RT-PCR (qRT-PCR) in different tissues (Slana et al., 2010). Positive results were obtained in submandibular lymph nodes and MLN. The results of the culture method were negative. The animals were used in this study under the agreement of the Branch Commission for Animal Welfare of the Ministry of Agriculture of the Czech Republic. 2.2. Preparation of the MAA antigen for in vitro immunological methods A mycobacterial culture (MAA strain 5889, used for the experimental infection) grown on Herrold’s egg yolk medium (HEYM) was repeatedly freeze-thawed and the homogenate was prepared by ultrasound treatment for two successive 10 min runs 10 min apart. Then, the suspension was centrifuged at 10,000 × g for 10 min. The supernatant was collected and stored at −18 ◦ C. The antigen was partly characterised by total protein content quantitation (BCATM Protein Assay Kit, Pierce, France; used according to the manufacturer’s recommendations) and SDS–PAGE (Laemmli, 1970). The gels were stained with silver (Rabilloud et al., 1988). Using the BCATM kit, the total protein content was found to be 0.52 mg/ml. The antigen was separated by electrophoresis into at least 11 bands of molecular weight ranging from 25 to 130 kDa, with the major bands ranging from 39 to 79 kDa. The optimal final protein concentration of the MAA antigen used for the in vitro stimulation was 0.3 g/ml. 2.3. Sample collection and cell isolation Blood samples were immediately heparinised (20 i.u./ml). During necropsy, samples of the spleen and MLN were stored in sterile RPMI-1640 medium (Sigma–Aldrich, USA). Peripheral blood mononuclear cells (PBMC) were obtained by gradient centrifugation
(Histopaque-1077, Sigma–Aldrich). Cells from the spleen and MLN were isolated by tissue homogenisation in RPMI1640 medium, followed by two washes in this medium (Stepanova et al., 2007). 2.4. Lymphocyte transformation test The PBMC and cells isolated from the spleen and MLN (200,000 cells in 200 l of RPMI-1640 medium supplemented with 10% of autologous serum, 100 IU/ml penicillin, 100 g/ml streptomycin and 4 g/ml gentamicin) were incubated with the optimal concentration of the specific MAA antigen (0.3 g/ml) for five days at 37 ◦ C in 5% CO2 . Negative controls were incubated with RPMI-1640 medium only. All samples were evaluated in triplicate. 3 H-thymidine was added on the last day of cultivation. Subsequently, the cells were harvested (FilterMate Harvestor, Packard Bioscience Company, USA), and 3 H-thymidine incorporation was measured by a microplate scintillation and luminescence counter (TopCount NXTTM , Packard Bioscience Company) in counts per minute (CPM). The results were expressed in terms of stimulation indexes (SI), which were calculated as the ratio of CPM in stimulated samples versus CPM in non-stimulated controls (Faldyna et al., 2007). 2.5. ELISA for IFN- detection The samples of whole blood (1 ml) or cells isolated from the spleen and MLN (4 × 106 in 1 ml of RPMI-1640 medium with 10% of autologous serum, 100 IU/ml penicillin, 100 g/ml streptomycin and 4 g/ml gentamicin) were cultured with and without the optimal concentration of the MAA antigen (0.3 g/ml) for 18 h at 37 ◦ C in 5% CO2 . Supernatants from the samples were frozen at −18 ◦ C. The quantity of IFN-␥ was measured using a commercial ELISA kit according to the manufacturer’s recommendations (BioSource International, Inc., USA). Absorbance was read on a multi-detection microplate reader SynergyTM 2 (BioTek Instruments, USA). 2.6. IFN- mRNA detection by qRT-PCR The PBMC and cells isolated from the spleen and MLN were cultivated in vitro with or without the MAA antigen as described previously for the detection of IFN␥ by ELISA. Afterwards, the cells were centrifuged and lysed in RLT buffer (RNeasy Mini Kit, Qiagen, Germany). The methods of RNA isolation, reverse transcription and qRT-PCR were described previously (Pavlova et al., 2008). Briefly, total RNA was isolated using an RNeasy Mini Kit (Qiagen). The RNA was then reverse transcribed with M-MLV reverse transcriptase (Invitrogen, USA) using oligo-dT primers (Qiagen). Measurements were performed using the LightCycler 1.2 (Roche, USA), with a QuantiTect SYBR Green PCR Kit (Qiagen). Primers were purchased from Generi Biotech (Czech Republic). The primers for IFN-␥ (forward 5 –3 : CCATTCAAAGGAGCATGGAT; reverse 5 –3 : GAGTTCACTGATGGCTTTGC) were designed using the freely available Primer3 software (http://fokker.wi.mit.edu/primer3/input.htm). The
H. Stepanova et al. / Veterinary Immunology and Immunopathology 142 (2011) 107–112
109
Table 1 IFN-␥ mRNA detection by qRT-PCR after in vitro re-stimulation with the MAA antigen.
PBMC
Spleen
MLN
MAA-infected (Su1)
48.00
77.44
6.06
MAA-infected (Su2)
388.88
135.29
16.44
MAA-infected (Su3)
173.23
39.53
9.64
Control (Su4)
4.47
3.01
1.95
Control (Su5)
3.32
2.75
1.02
Control (Su6)
6.41
3.08
4.48
Note: The data are shown as the relative expression ratio of a cytokine gene calculated according to the 2−CT method. Significant results between MAAinfected pigs and uninfected control pigs are marked by grey boxes (p ≤ 0.05, Mann–Whitney test).
relative expression ratio of a cytokine gene was calculated according to 2−CT (Livak and Schmittgen, 2001) using hypoxanthine phosphoribosyltransferase (HPRT) mRNA as a reference (Nygard et al., 2007). The primers for HPRT were adopted from Volf et al. (2007). 2.7. Characterisation of IFN--producing cells by flow cytometry Whole blood (0.5 ml) from MAA-infected pigs was diluted in a proportion of 1:1 with RPMI-1640 medium and stimulated with the MAA antigen (concentration
0.3 g/ml) for 18 h. Four hours before the end of cultivation, the inhibitor of protein transport Brefeldin A (10 g/ml, Sigma–Aldrich) was added. Thereafter, the cells were stained with primary antibodies for the following surface markers: CD4 (10.2H2, Dr. J.K. Lunney, Animal Parasitology Institute, Beltsville, MO, USA) and CD8␣:PECy5 (76-2-11, SouthernBiotech, USA). The FITC-conjugated mouse isotype-specific goat antiserum (SouthernBiotech) was used for CD4 visualisation. After surface marker staining, the samples were fixed and permeabilised using an Intrastain kit (Dako). During the permeabilisation step, anti-IFN-␥:PE-conjugated antibody (CC302, AbD Serotec,
Fig. 1. Responses of cells isolated from the blood, spleen and MLN after re-stimulation with the MAA antigen. The cell-mediated immune response was measured by the MAA antigen-driven lymphocyte transformation test as the proliferation assay (left Y-axis) and by ELISA detection of IFN-␥ in the supernatant from MAA antigen-stimulated samples as the IFN-␥ release assay (right Y-axis).
110
H. Stepanova et al. / Veterinary Immunology and Immunopathology 142 (2011) 107–112
Fig. 2. Flow cytometric analyses of IFN-␥-producing blood cells in MAA-infected pigs. Representative picture from three MAA-infected pigs. Dot plots and the percentage of IFN-␥-producing cells from lymphocytes (A); Dot plots and the percentage of IFN-␥-producing T lymphocyte subsets based on the three-colour staining of CD4/CD8/IFN-␥. The percentage of IFN-␥-positive cell accounts from each gated subpopulation (B).
H. Stepanova et al. / Veterinary Immunology and Immunopathology 142 (2011) 107–112
UK) or the isotype control (mouse IgG1 negative control:PE; AbD Serotec) was added (Zelnickova et al., 2007). Data were acquired on a standard FACSCaliburTM (Becton-Dickinson, USA) flow cytometer. The lymphocytes were gated based on their forward and side scatter characteristics for data analyses. 2.8. Statistical analyses The Mann–Whitney non-parametric test was used for a statistical comparison of MAA-infected and uninfected control pigs. Spearman’s rank correlation was used to test for a correlation between IFN-␥ detection and the cellular proliferation assay. Values of p ≤ 0.05 were considered statistically significant. All calculations were performed using GraphPad Prism® version 3.03 software (GraphPad Software, USA). 3. Results and discussion Our results confirmed cell-mediated immunity in MAAinfected pigs and also suggest possibilities for the intravital diagnosis of mycobacterial infections by analysing cellmediated immunity. Interferon-␥ production and cellular proliferation after specific in vitro re-stimulation was detectable in the lymphocytes isolated from the blood, spleen and MLN from MAA-infected animals (Fig. 1). In the uninfected animals, the levels of IFN-␥ in all MAA antigen-stimulated samples were below 18 pg/ml, and the SI in the MAA-driven lymphocyte transformation test were <2.0. Significance differences in the SI between the MAA-infected and uninfected pigs were observed in the blood and spleen (p ≤ 0.05, Mann–Whitney test). A statistical analysis of the IFN-␥ levels was impracticable because the values from all of the uninfected pigs were below the detection limit. The levels of IFN-␥ in the non-stimulated samples from both MAAinfected and uninfected pigs were also below 18 pg/ml (data not shown). Based on the current data, the detection of a cellmediated immune response is a valid tool for identifying MAA-infected pigs. The results of both methods (IFN-␥ release assay and the proliferation assay) were negative in uninfected control pigs. The difference between antigenstimulated and non-stimulated samples was crucial for the evaluation of both assays. In the uninfected animals, the level of IFN-␥ and SI was comparable in both stimulated and non-stimulated samples. This indicates that the MAA lysate is a functional usable antigen for the stimulation of cell-mediated immunity in MAA-infected pigs without any unspecific stimulatory effects. The induction of IFN-␥ in MAA-infected pigs was confirmed by qRT-PCR (Table 1). In agreement with the results from the ELISA, there was significantly higher IFN␥ mRNA expression in the antigen-stimulated samples in MAA-infected pigs in comparison with the uninfected control animals (p ≤ 0.05, Mann–Whitney test). Therefore, the detection of IFN-␥ mRNA by qRT-PCR is a valid tool for evaluating the IFN-␥ release assay, in addition to measuring the protein by ELISA. For example, it could be used in animal species for which ELISA is not available.
111
When IFN-␥ production and the proliferation assays were compared, a significantly positive correlation between both methods was found in the blood and spleen (both p = 0.0167; r = 0.9411, Spearman’s test), but not for the cells from the MLN (p = 0.2972; r = 0.5161, Spearman’s test). This discrepancy could be explained by the presence of two memory Th cells which were described in human and mice: effectors and central memory cells (Sallusto et al., 1999). The presence of these functionally different memory Th subsets was also recently confirmed in cattle. Central memory cells are characterised by a high proliferative capacity and a low IFN-␥ production, together with the expression of the lymph node-associated homing receptor CCR7 (Totté et al., 2010). We can speculate that MAA infection in pigs induced central memory cells in the MLN where a high proliferative capacity but a low IFN-␥ production was detected after specific in vitro re-stimulation. The phenotype of IFN-␥-producing cells in MAAinfected pigs was detected by the intracellular staining of IFN-␥ in combination with surface markers and a flow cytometric analysis. The results showed that double-positive CD4+ CD8+ cells were the main T lymphocyte sources of IFN␥ after specific stimulation in MAA-infected pigs (Fig. 2). There was 5.31 ± 1.77% (mean ± SD, n = 3) CD4+ CD8+ IFN-␥+ cells from all CD4+ CD8+ cells. The CD4− CD8hi IFN-␥+ population accounted for 0.97 ± 0.46% of all CD4− CD8hi cells. The CD4+ CD8− population was almost negative for IFN-␥ (0.23 ± 0.22% of CD4+ CD8− IFN-␥+ from all CD4+ CD8− cells). To the best of our knowledge, this is the first study to report the capability of porcine double-positive CD4+ CD8+ cells to produce IFN-␥ in antimycobacterial immunity. This porcine subset with a memory capacity has been described as being involved in antiviral immunity (Summerfield et al., 1996). We can speculate that this unique lymphocyte subset is involved in long-term immunity in MAA-infected pigs, but future experiments are needed to evaluate the actual role of CD4+ CD8+ cells in the antimycobacterial immune response. In conclusion, we suggest that the porcine immune system shows cell-mediated immunity for at least six months after infection with MAA. Interferon-␥ detection and the lymphocyte transformation test, after re-stimulation with the MAA antigen, represent specific methods for the identification of individual MAA-infected pigs. A more detailed study is necessary to confirm and develop the practical applications of both methodological approaches. Additionally, we identified double-positive CD4+ CD8+ cells as a major T lymphocyte population producing IFN-␥ after specific in vitro re-stimulation. Acknowledgements The work was supported by the Ministry of Agriculture of the Czech Republic (1B53009 and MZE0002716202) and Ministry of Education, Youth and Sports of the Czech Republic (project AdmireVet, CZ.1.05/2.1.00/01.0006, ED0006/01/01). The authors wish to thank Mr. Paul Veater (Bristol, United Kingdom) for proofreading the manuscript and Assoc. Prof. Jan Novak (Dept. of Microbiology, The University of Alabama at Birmingham) for critical reading.
112
H. Stepanova et al. / Veterinary Immunology and Immunopathology 142 (2011) 107–112
References Biet, F., Boschiroli, M.L., Thorel, M.F., Guilloteau, L.A., 2005. Zoonotic aspects of Mycobacterium bovis and Mycobacterium avium-intracellular complex (MAC). Vet. Res. 36, 411–436. Faldyna, M., Oborilova, E., Krejci, J., Tesarik, R., Krejci, E., Pavlova, B., Rybnikar, A., 2007. A correlation of in vitro tests for the immune response detection: a bovine trichophytosis model. Vaccine 25, 7948–7954. Fischer, O., Matlova, L., Dvorska, L., Svastova, P., Bartl, J., Melicharek, I., Weston, R.T., Pavlik, I., 2001. Diptera as vectors of mycobacterial infections in cattle and pigs. Med. Vet. Entomol. 15, 208–211. Gormley, E., Doyle, M.B., Fitzsimons, T., McGill, K., Collins, J.D., 2006. Diagnosis of Mycobacterium bovis infection in cattle by use of the gamma-interferon (Bovigam) assay. Vet. Microbiol. 112, 171–179. Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680–685. Lee, J., Choi, K., Olin, M.R., Cho, S.N., Molitor, T.W., 2004. Gammadelta T cells in immunity induced by Mycobacterium bovis bacillus CalmetteGuérin vaccination. Infect. Immun. 72, 1504–1511. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−CT method. Methods 25, 402–408. Möbius, P., Lentzsch, P., Moser, I., Naumann, L., Martin, G., Köhler, H., 2006. Comparative macrorestriction and RFLP analysis of Mycobacterium avium subsp. avium and Mycobacterium avium subsp. hominissuis isolates from man, pig, and cattle. Vet. Microbiol. 117, 284–291. Monaghan, M.L., Doherty, J.D., Collin, J.F., Kazda, P.J., Quinn, 1994. The tuberculin test. Vet. Microbiol. 40, 111–124. Nygard, A.B., Jørgensen, C.B., Cirera, S., Fredholm, M., 2007. Selection of reference genes for gene expression studies in pig tissues using SYBR green qPCR. BMC Mol. Biol., 8. Pavlik, I., Matlova, L., Dvorska, L., Bartl, J., Oktabcova, L., Docekal, J., 2003. Tuberculous lesions in pigs in the Czech Republic during 1990–1999:
occurrence, causal factors and economic losses. Vet. Med. Czech. 48, 113–125. Pavlova, B., Volf, J., Alexa, P., Rychlik, I., Matiasovic, J., Faldyna, M., 2008. Cytokine mRNA expression in porcine cell lines stimulated by enterotoxigenic Escherichia coli. Vet. Microbiol. 132, 105–110. Rabilloud, T., Carpentier, G., Tarronx, P., 1988. Improvement and simplification of low-background silver staining of proteins by using podium dithionite. Electrophoresis 9, 288–291. Sallusto, F., Lenig, D., Förster, R., Lipp, M., Lanzavecchia, A., 1999. Two subsets of memory T lymphocytes with distinct homing potentials and effector functions. Nature 401, 708–712. Slana, I., Kaevska, M., Kralik, P., Horvathova, A., Pavlik, I., 2010. Distribution of Mycobacterium avium subsp. avium and M. a. hominissuis in artificially infected pigs studied by culture and IS901 and IS1245 quantitative real time PCR. Vet. Microbiol., doi:10.1016/j.vetmic.2010.02.024. Stepanova, H., Samankova, P., Leva, L., Sinkora, J., Faldyna, M., 2007. Early postnatal development of the immune system in piglets: the redistribution of T lymphocyte subsets. Cell. Immunol. 249, 73–79. Summerfield, A., Rziha, H.J., Saalmuller, A., 1996. Functional characterization of porcine CD4+CD8+ extrathymic T lymphocytes. Cell. Immunol. 168, 291–296. Totté, P., Duperray, C., Dedieu, L., 2010. CD62L defines a subset of pathogen-specific bovine CD4 with central memory cell characteristics. Dev. Comp. Immunol. 34, 177–182. Volf, J., Boyen, F., Faldyna, M., Pavlova, B., Navratilova, J., Rychlik, I., 2007. Cytokine response of porcine cell lines to Salmonella enterica serovar typhimurium and its hilA and ssrA mutants. Zoonoses Public Health 54, 286–293. Zelnickova, P., Faldyna, M., Stepanova, H., Ondracek, J., Kovaru, F., 2007. Intracellular cytokine detection by flow cytometry in pigs: fixation, permeabilization and cell surface staining. J. Immunol. Methods 327, 18–29.