Cell surface expression of channel catfish leukocyte immune-type receptors (IpLITRs) and recruitment of both Src homology 2 domain-containing protein tyrosine phosphatase (SHP)-1 and SHP-2

Developmental and Comparative Immunology 33 (2009) 570–582

Contents lists available at ScienceDirect

Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci

Cell surface expression of channel catfish leukocyte immune-type receptors (IpLITRs) and recruitment of both Src homology 2 domain-containing protein tyrosine phosphatase (SHP)-1 and SHP-2 Benjamin C.S. Montgomery a, Jacqueline Mewes a, Chelsea Davidson b, Deborah N. Burshtyn b, James L. Stafford a,* a b

Department of Biological Sciences, University of Alberta, Edmonton, Alberta, Canada Department of Medical Microbiology and Immunology, University of Alberta, Edmonton, Alberta, Canada

A R T I C L E I N F O

A B S T R A C T

Article history: Received 17 September 2008 Received in revised form 8 October 2008 Accepted 13 October 2008 Available online 12 November 2008

Channel catfish leukocyte immune-type receptors (IpLITRs) are immunoglobulin superfamily (IgSF) members believed to play a role in the control and coordination of cellular immune responses in teleost. Putative stimulatory and inhibitory IpLITRs are co-expressed by different types of catfish immune cells (e.g. NK cells, T cells, B cells, and macrophages) but their signaling potential has not been determined. Following cationic polymer-mediated transfections into human cell lines we examined the surface expression, tyrosine phosphorylation, and phosphatase recruitment potential of two types of putative inhibitory IpLITRs using ‘chimeric’ expression constructs and an epitope-tagged ‘native’ IpLITR. We also cloned and expressed the teleost Src homology 2 domain-containing protein tyrosine phosphatases (SHP)-1 and SHP-2 and examined their expression in adult tissues and developing zebrafish embryos. Coimmunoprecipitation experiments support the inhibitory signaling potential of distinct IpLITR-types that bound both SHP-1 and SHP-2 following the phosphorylation of tyrosine residues within their cytoplasmic tail (CYT) regions. Phosphatase recruitment by IpLITRs represents an important first step in understanding their influence on immune cell effector functions and suggests that certain inhibitory signaling pathways are conserved among vertebrates. ß 2008 Elsevier Ltd. All rights reserved.

Keywords: Innate immunity Immunoglobulin superfamily Receptors Signaling Natural killer cells Tyrosine phosphorylation Cellular inhibition Phosphatases

1. Introduction The concomitant expression of activating and inhibitory immune receptors form elaborate regulatory networks capable of coordinating cellular responses during infection and terminating these responses to prevent or minimize inappropriate damage to the host. In mammals, Fc receptors (FcR) as well as those found within the leukocyte receptor complex (LRC) such as killer Ig-like receptors (KIRs) represent prototypic innate immunoregulatory receptors with dual signaling capabilities [1–5]. These proteins

* Corresponding author. Tel.: +1 780 492 9258; fax: +1 780 492 9234. E-mail address: [email protected] (J.L. Stafford). Abbreviations: IgSF, immunoglobulin superfamily; IpLITR, channel catfish leukocyte immune-type receptors; ED, extracellular domain; NK, natural killer; SHP, Src homology 2 domain-containing protein tyrosine phosphatase; CYT, cytoplasmic tail; FcR, Fc receptor; LRC, leukocyte receptor complex; KIR, killer Ig-like receptor; TM, transmembrane; ITAM, immunoreceptor tyrosine-based activation motifs; ITIM, immunoreceptor tyrosine-based inhibition motifs; IP, immunoprecipitation; mAb, monoclonal antibody; D, domain. 0145-305X/$ – see front matter ß 2008 Elsevier Ltd. All rights reserved. doi:10.1016/j.dci.2008.10.006

belong to the immunoglobulin superfamily (IgSF) and encode type I transmembrane proteins containing one or more extracellular Iglike domains, a transmembrane (TM) segment and a cytoplasmic tail (CYT) region that may contain tyrosine residues. Recently, the existence of several families of IgSF-like genes in humans, birds, amphibians, and fish has been reported [6–15]. These discoveries underline the complexity of immune system regulation and point to the evolutionary relationships that provide valuable insights into the origins of vertebrate innate immune receptor networks. However, many of these ‘novel’ IgSF receptors remain to be functionally characterized as to their signaling potential and ultimately their contribution to the control and coordination of immune cell effector functions. IgSF members often share a common mode of intracellular signaling through distinct stimulatory and inhibitory pathways [2,16,17]. These basic features are similar for several mammalian innate immune receptors and are likely conserved in nonmammalian vertebrates [6,12,14,18]. In general, stimulatory innate immune receptors have short CYT regions devoid of signaling motifs but encode a positively charged TM segment that

B.C.S. Montgomery et al. / Developmental and Comparative Immunology 33 (2009) 570–582

571

streptomycin (Gibco), 1 mM sodium pyruvate (Gibco), 1% MEM non-essential amino acid solution (Gibco), and 10% heat-inactivated fetal bovine serum (characterized; Hyclone). Prior to use, culture media was filter sterilized using 0.22 mm filter units (Corning).

facilitates association with the negative charged TM of adaptor signaling molecules possessing cytoplasmic immunoreceptor tyrosine-based activation motifs (ITAM) [19–21]. These motifs are phosphorylated upon receptor–ligand engagement and recruit stimulatory kinases that in turn activate various cellular activation pathways [22]. In contrast, inhibitory signaling receptors have long CYT regions that contain one or more immunoreceptor tyrosine-based inhibition motifs (ITIM), which are also tyrosine phosphorylated upon receptor engagement [23,24]. The phosphorylated tyrosine(s) within the ITIMs subsequently recruit Src homology 2 (SH2) domain-containing cytoplasmic phosphatases (i.e. SHP-1 and SHP-2), which dephosphorylate activation pathway signaling intermediates [16,25–28]. The balancing of signals derived from stimulatory and inhibitory innate immune receptors is required for the finetuning of cellular effector functions including natural killer (NK) cell-mediated cytotoxicity [2]. Channel catfish NK-like cells recognize allogeneic targets (e.g. irradiated B cells) and kill them by a calcium dependent induction of apoptosis [29]. However, unlike mammalian NK cells, the receptors responsible for regulation of these responses are not known. One candidate family of proteins that may play a part in the regulation of catfish cytotoxic lymphocytes is the recently identified channel catfish leukocyte immune-type receptors (IpLITRs) [12]. These polymorphic proteins belong to the IgSF and consist of putative inhibitory and stimulatory forms coexpressed in hematopoietic tissues and in various catfish myeloid and lymphoid cell lines. Catfish LITR mRNA levels were also preferentially upregulated in cytotoxic lymphocytes following alloantigen stimulation and detailed sequence analysis of these expressed cDNAs indicated an unexpectedly large array of coexpressed inhibitory and stimulatory forms [30]. All of these cloned receptors share similar membrane distal domains (i.e. D1 and D2) suggesting that these proteins bind a common type of ligand. Comparative homology modeling and residue mapping onto the predicted 3D structures suggested that major histocompatibility class I proteins may be recognized by some of these receptors [30]. Although IpLITR ligand(s) remain to be identified, we propose that upon engagement with their binding partner(s), putative inhibitory catfish LITRs become tyrosine phosphorylated and recruit inhibitory phosphatases that may down regulate cellular effector functions. In this study we determined the expression and inhibitory signaling potential of catfish LITRs following cationic polymermediated transfections into HEK 293T cells and HeLa cells. We fused the extracellular domain (ED) and TM segments of human NK cell receptor KIR2DL3 to the tyrosine-containing CYT regions of selected IpLITRs. In addition, an epitope-tagged ‘native’ IpLITR construct was also developed and tested for expression using flow cytometry, microscopy, and immunoprecipitation. Candidate inhibitory phosphatases SHP-1 and SHP-2 were then cloned from the zebrafish genomic database and their expression in developing embryos and adult zebrafish tissues examined. Our results suggest that putative inhibitory IpLITRs are cell surface-expressed immune receptors that upon tyrosine phosphorylation are likely involved in the attenuation of cellular immune responses (i.e. cytotoxicity) due to their ability to recruit the inhibitory phosphatases, SHP-1 and SHP-2.

Several putative inhibitory IpLITRs have been cloned from alloantigen-stimulated catfish cytotoxic T lymphocytes [30]. These cDNAs were cloned into the pCR4-TOPO vector (Invitrogen) and provided as a kind gift from Dr. Norman Miller (Univ. Mississippi Medical Center) as templates for generating an epitope-tagged receptor. Ten nanograms of the pCR4-TOPO vector containing the sequence for TS32.17 L1.1b (NCBI accession number: ABI16050) was amplified with pDISPLAY L1.1b/SmaI Fwd and pDISPLAY L1.1b/SalI Rvs primers (Table 1) using 0.4 U of Phusion HighFidelity DNA polymerase (Finnzymes) in 20 mL reactions according to manufacturer’s recommended instructions. Cycling parameters were as follows; 40 s at 98 8C, 30 cycles of 98 8C for 20 s, 64 8C for 25 s, 72 8C for 30 s, and a final extension step for 7 min at 72 8C. Note: The generation of all expression constructs in this study were performed using Phusion High-Fidelity polymerase. Reactions were then separated on a 1.0% TAE-agarose gel, and visualized by staining with ethidium bromide solution (50 mg/L), and the PCR product (1500 bp) was excised, gel purified (Qiagen Gel Extraction Kit) and cloned into pJET1.2/blunt using the bluntend protocol (Fermentas). Cloning reactions were then transformed into NEB 10-beta E. coli (New England BioLabs) and positive clones identified by performing colony PCR with the pJET1.2 Fwd and Rvs sequencing primers (Table 1). A randomly selected positive colony was grown overnight in 8 mL of LB-ampicillin (100 mg/mL) and the plasmid isolated using the Qiagen miniprep kit according to manufacturer’s instructions. Two micrograms of the purified plasmid was double digested for 2 h with 10 U of SmaI/ SalI and the insert isolated and then ligated into the pDISPLAY vector (Invitrogen) using T4 DNA ligase (Fermentas) and a 2.5 h incubation at 25 8C followed by an overnight incubation alternating between 4 8C and 16 8C every 45 min. Positive pDISPLAY-IpLITR TS32.17 L1.1b clones were identified by restriction digestion and purified plasmids were sequenced to verify the cDNA sequence and to ensure that the construct was in-frame without any base pair changes. All sequencing was performed at the molecular biology services unit in the Department of Biological Sciences, University of Alberta, on an ABI 3730 DNA sequencer.

2. Materials and methods

2.4. KIRED-LITRCYT chimeric constructs

2.1. Cell culture

To characterize the signaling potential of putative inhibitory catfish LITRs we constructed ‘chimeric’ expression constructs consisting of the ED and TM segment of human KIR2DL3 fused to the tyrosine-containing CYT region of two different IpLITR receptors (Fig. 1). Briefly, the full-length cDNA for KIR2DL3 (NCBI

HeLa and HEK 293T cells were grown at 37 8C and 5% CO2 in DMEM/High Glucose (HyClone) supplemented with 2 mM Lglutamine (Gibco), 100 Units/mL penicillin (Gibco), 100 mg/mL

2.2. Antibodies The following antibodies were used in this study; anti-HA mAb clone HA.C5 (Cedarlane Laboratories Ltd.), HRP-conjugated goat anti-HA polyclonal antibody (GenScript Corp.), anti-phosphotyrosine mAb 2C8 (Santa Cruz Biotechnology, Inc.), biotin-conjugated anti-phosphotyrosine mAb 4G10 (Upstate), anti-FLAG mAb M2 (Stratagene), anti-FLAG M2 mAb peroxidase conjugated (Sigma– Aldrich), goat anti-mouse IgG (H + L)-FITC (Cedarlane Laboratories Ltd.), goat anti-mouse IgG (H + L)-PE (Beckman Coulter), anti-KIR mAb (LIG-1) [31], and anti-KIR mAb (DX27) [32]. 2.3. Generation of ‘native’ epitope-tagged IpLITR

B.C.S. Montgomery et al. / Developmental and Comparative Immunology 33 (2009) 570–582

572 Table 1 Primers used in this study.

Primer sequence 50 to 30

Primer name a

pSPORT-KIR2DL3TM Rvs pSPORT-KpnI Fwdb CONSTRUCT 1.0 Fwdc CONSTRUCT 1.0 KpnI/Rvsc CONSTRUCT 2.0/3.0 Fwdc CONSTRUCT 2.0 KpnI/Rvsc CONSTRUCT 3.0 KpnI/Rvsc KIRED-LITRCYT pBABE SalI/Fwdd KIRED-LITRCYT pBABE NotI/Rvsd pDISPLAY L1.1b/SmaI Fwde pDISPLAY L1.1b/SalI Rvse pJET1.2 Fwd sequencingf pJET1.2 Rvs sequencingf ZfSHP-1 Fwd expressiong ZfSHP-1 Rvs expressiong ZfSHP-2 Fwd expressiong ZfSHP-2 Rvs expressiong ZfSHP-1 p3XFLAG EcoRI/Fwdh ZfSHP-1 p3XFLAG XbaI/Rvsh ZfSHP-2 p3XFLAG EcoRI/Fwdh ZfSHP-2 p3XFLAG XbaI/Rvsh

AAGGAGAAAGAAGAGGAGGAGGATGAAGAGGATGATGACC ATACTAGGTACCTCTAGAGGATCCAAGCTTACGTACGC P-CGTTGGTGGCACAAATCCAAC ATACTAGGTACCCTATGTGTTCTGCTTCAGCTGTGAGT P-CACAAATCCAACAAAGGAAAGGAC ATACTAGGTACCCTATTTATTCTTGTATGACTCCTT ATACTAGGTACCCTATGTGTTCTGCTTCAGCTGTGA ATACTAGTCGACGCACCATGTCGCTCATGGTCGTCAGCA ATACTAGCGGCCGCCGCGTACGTAAGCTTGGATCCTCT CCCGGGGTTCTGTCTGTGGAGCCG GTCGACCTATGTGTTCTGCTTCAGCTG CGACTCACTATAGGGAGAGCGGC AAGAACATCGATTTTCCATGGCAG CCTGTATGGTGGGGAGAAGTTTGCC ACGGTGTAGCGGTCATTATTGC CAGCGAAGGCAAACCCAAAGTCACA TGATCAGGCCAGGCACGGAAATG GAATTCATGGTTCGGTGGTTTCACAGA TCTAGATCGTTTCCTAACAGATCC GAATTCATGACATCCCGAAGGTGGT TCTAGATCTGTGACTCTTCTGCTGCTG

a Primer used for amplification in the reverse direction around the pSPORT-1/KIR2DL3 plasmid starting immediately after the TM sequence of KIR2DL3 (i.e. bp position 795). b Primer used for the amplification in the forward direction around the pSPORT-1/KIR2DL3 plasmid and introduction of a KpnI site immediately after the TM sequence of KIR2DL3 (i.e. bp position 795). c Amplification of the CYT regions of LITRs for cloning into the pSPORT-1/KIR2DL3 plasmid prepared with pSPORT-KIR2DL3TM Rvsa and pSPORT-KpnI Fwdb. d Amplification of KIRED-LITRTM from pSPORT-1 and cloning into pBABE. e Amplification of TS32.17 L1.1b (NCBI accession number: ABI16050) from pCR4-TOPO and cloning into pDISPLAY. f Colony PCR primers. g RT-PCR primers. h Amplification of zebrafish SHP-1/SHP-2 and cloning into p3XFLAG-CMV-14.

accession number: U24074) in the pSC65 vector was subcloned into pSPORT-1 using SalI and NotI digests. pSPORT-1/KIR2DL3 was then amplified with forward and reverse primers (Table 1) designed to amplify around the vector in order to introduce a KpnI restriction site just after the TM segment of KIR2DL3 (i.e. bp position 795 of the open reading frame). This strategy allowed for the direct fusion of the CYT regions of IpLITR cDNAs directly after the ED and TM segment of KIR2DL3. Catfish LITRs used for the CYT amplifications (NCBI accession numbers: ABI16050 and ABI16051) were previously cloned into pCR4-TOPO [30]. The IpLITR CYT regions were amplified using specific forward primers (Table 1) with a 50 phosphate (to facilitate fusion immediately after the 795 bp of KIR2DL3) and a reverse primer (Table 1) that introduced a KpnI restriction site immediately following the native IpLITR CYT ‘stop codon; TAG’. Products were gel purified, digested with KpnI and then ligated into the pSPORT-1/KIR2DL3 to create a chimeric cDNA construct [KIR2DL3ED/TM/LITRCYT]. Three different constructs were generated designated as 1.0, 2.0, and 3.0 (Fig. 1). Construct 1.0 contains the entire CYT region of ABI16051 (i.e. 1170–1326 bp; amino acid 391–441), construct 2.0 contains a truncated region of the CYT of NCBI accession number: ABI16050 (i.e. 1167–1398 bp; amino acid 389–466) and construct 3.0 contains the entire CYT region of ABI16050 (i.e. 1167–1533 bp; amino acid 389–511). During the sequencing of construct 3.0, a frame-shift mutation was identified in one of the clones that introduced premature stop codon resulting in a mutated receptor that was devoid of any tyrosine residues in its short 28 amino acid CYT. Consequently, this construct was chosen as a negative control termed 3 (Fig. 1). All chimeric constructs were then amplified with PCR primers (Table 1) to facilitate SalI/NotI restriction cloning into the final destination vector pBABE [33], which is a retroviral expression plasmid that facilitates stable expression of proteins in NK tumor cell lines such as human YTS cells and transient expression in HeLa and HEK 293T cells as described below. Prior to cellular

transfections all KIRED-LITRCYT were sequenced to verify the cDNA sequence and to ensure that the constructs were in-frame without any base pair changes. Several of the tyrosine residues found in the IpLITR CYT regions are encoded within ITIM or ITIM-like motifs [12,30]. KIRED-LITRCYT construct 1.0 encodes one ITIM and one ITIM-like motif. Tyrosine residues identified in such motifs are indicated as hatched boxes (Fig. 1). Construct 3.0 was designed to test the full CYT of the receptor TS32.15 L1.1b, which to date encodes the longest CYT region of all IpLITRs identified containing six tyrosine residues. As shown in Fig. 1, the C-terminal end of this CYT contains an arrangement of tyrosines embedded in motifs that are similar to the shorter CYT of TS32.15 L1.2a (i.e. Construct 1.0). However, preceding this region are three membrane proximal tyrosine residues that are not present within a consensus ITIM, which is indicated by a white box (Fig. 1). We also constructed a truncated version of the TS32.17 L1.1b CYT that only included these residues designated as construct 2.0. 2.5. Cellular transfections Transfections were performed using cells (e.g. HeLa and HEK 293T) seeded in 6-well tissue culture plates (Costar) or 60 mm tissue culture dishes (Costar). For 6-well plates, 5  105 cells were seeded in 2 mL DMEM/10% FBS per well and incubated overnight prior to transfection with 1 mg of plasmid DNA. For each expression construct, DNA was first diluted in 190 mL of serumfree DMEM and then 4 mL of TurboFect in vitro transfection reagent (Fermentas) was added. Samples were gently mixed and incubated for 20 min at room temperature. The DMEM-plasmid-TurboFect solution was then evenly layered onto the cells, which were then incubated for 24–48 h at 37 8C to allow for protein production. Cotransfections with different expression constructs were performed as described for single transfections except 1 mg of each plasmid

B.C.S. Montgomery et al. / Developmental and Comparative Immunology 33 (2009) 570–582

573

Fig. 1. KIRED-LITRCYT chimeric expression constructs in pBABE. The extracellular region and transmembrane segment of human KIR2DL3 (NCBI accession number: U24074) were fused to the full-length cytoplasmic regions of the catfish LITR TS32.17 L1.1b, construct 3.0 (NCBI accession number: ABI16050) and TS32.17 L1.2a, construct 1.0 (NCBI accession number: ABI16051). A truncated CYT region of IpLITR TS32.17 L1.1b was also generated and designated as construct 2.0. Tyrosine (Y) residues within each of the CYT region are shown and those present within ITIM-like motifs are indicated as hatched boxes. Tyrosine residues not within ITIM-like motifs are drawn as a white box. KIREDLITRCYT construct 3X contains 28 amino acid residues (X28) within its CYT region and is devoid of tyrosines. All constructs were fully sequenced prior to performing experiments.

were both diluted in 190 mL of serum-free DMEM. For transfections in 60 mm dishes, the same procedure for 6-well plates was followed except initial seeding, volume of medium, amount of plasmid, and amount of TurboFect were all doubled. Prior to seeding cells for transfection experiments, cell viability was examined using Trypan blue staining to ensure that cultures had >95% viable cells prior to seeding. 2.6. Flow cytometry and microscopy Flow cytometry for the detection of KIRED-LITRCYT and HAtagged ‘native’ IpLITR surface expression was performed using transfected HEK 293T cells. After 48 h post-transfection, DMEM/ transfection solution was removed from each well and the cells were gently washed with 2 mL of sterile Dulbecco’s PBS (D-PBS) containing 2 mM of EDTA. PBS was removed and 500 ml of 0.25% Trypsin-EDTA (Gibco) was added to each well and the plate gently agitated until cells detached. Two milliliters of DMEM-10% FBS was added and aliquots of 2  105 cells placed in 1.5 mL Eppendorf tubes. Cells were centrifuged at 4 8C (400  g for 8 min), supernatants aspirated and 1.4 mL of ice-cold antibody staining buffer ASB (D-PBS, 0.05% NaN3, 1% bovine serum albumin) added. Prior to addition of primary antibody, cells were centrifuged once more

and ASB aspirated. Cell pellets were gently disrupted and 1 mg of primary antibody (i.e. anti-DX27 mAb or anti-HA mAb clone HA.C5) diluted in 50 mL of ASB was added. Cells were incubated on ice for 30 min with gentle mixing every 10 min followed by the addition of 1.2 mL ice-cold ASB, centrifugation, and aspiration. Cells pellets were again disrupted and 0.5 mg of goat anti-mouse IgG (H + L)-PE diluted in 50 mL of ASB was added and staining/ washing repeated as above. Cells were then analyzed for fluorescence using a FACS Calibur flow cytometer; Becton Dickinson. To visualize cell surface expression of KIRED-LITRCYT constructs and HA-tagged ‘native’ LITR, HeLa cells were seeded at 5  104 cells in 35 mm glass bottom dishes (MatTek), transfected and then antibody stained as described above for flow cytometry. After the final wash cells were fixed with formalin for 10 min at room temperature, rinsed with D-PBS and then analyzed using a Zeiss Axiovert 2500 M fluorescence microscope. 2.7. Immunoprecipitation and Western blotting Forty-eight hours after transfection, HEK 293T cells (1  106) were washed with 2 mL D-PBS/EDTA then treated with 1 mL D-PBS containing 10 mM H2O2 and 0.1 mM sodium pervanadate

574

B.C.S. Montgomery et al. / Developmental and Comparative Immunology 33 (2009) 570–582

(Na3VO4) for 10 min at 37 8C. Pervanadate solution was then aspirated following centrifugation of the cells at 4 8C. Cell pellets were then lysed for 10 min with 500 ml of ice-cold immunoprecipitation (IP) buffer (50 mM Tris–HCl, 150 mM NaCl, 1% Triton X100, supplemented with complete mini EDTA-free protease inhibitor and phosphatase inhibitor cocktail tablets; Roche). Following the removal of cellular debris by centrifugation at 16,000  g, cellular lysates were incubated with 1 mg of either anti-KIR mAb (DX27), anti-HA mAb clone HA.C5, or anti-FLAG M2 mAb for 14–16 h at 4 8C on a rotary mixer. Fifty microliters of prewashed (with IP buffer) protein G Sepharose beads (GE Healthcare) were then added to the samples and incubated for a further 2 h at 4 8C on a rotary mixer. Beads were washed three times with 1 mL of IP buffer followed by the addition of 100 ml of 2 SDS-PAGE reducing buffer. Samples were then boiled for 10 min at 100 8C and stored at 20 8C prior to analysis. Twenty microliters samples (equivalent to 0.25  106 lysed cells) were electrophoresed on 10% SDS-PAGE gels, transferred to 0.2 mm nitrocellulose membranes (BioRad) and then stained with Ponceau S (Sigma–Aldrich) to ensure successful transfer and equivalent loading of samples. Blots were then incubated in Trisbuffered saline supplemented with 0.1% Tween 20 and 5% skim milk (TTBS-SKIM) for 30 min at room temperature. Membranes were then incubated 14–16 h at 4 8C with anti-phosphotyrosine mAb, anti-KIR mAb (LIG-1), anti-HA-HRP, or anti-FLAG-HRP in TTBS-SKIM for the detection of immunoprecipitated proteins. If the primary antibody was not conjugated with HRP, the membranes were washed 3 with TTBS and incubated for 1 h at room temperature with 1:5000 (v/v) of goat anti-mouse IgG (H + L)-HRP diluted in TTBS-SKIM for detection of anti-KIR mAb (LIG-1) reactive proteins or 1:5000 (v/v) of streptavidin-HRP for detection of anti-phosphotyrosine-biotin reactive proteins. After a final wash in TTBS, immunoreactive bands were detected using the SuperSignal West Pico Chemiluminescent Substrate kit (Pierce Biotechnology). 2.8. Identification and expression of zebrafish SHP-1 and SHP-2 Zebrafish SHP-1 and SHP-2 cDNAs were identified by tBLASTn searches of the zebrafish database (http://compbio.dfci.harvard.edu/tgi/cgi-bin/tgi/Blast/index.cgi) using human SHP-1 and SHP2 protein sequences as queries (NCBI accession numbers: AAA36610 and BAA02740) and default settings. The top match for human SHP-1 was zebrafish TC304017, which was then translated into a protein sequence using the ExPASy Proteomics Sever Translate Tool (http://ca.expasy.org/). This predicted protein was then used to search NCBI’s non-redundant database for a match resulting in the identification of a 589 amino acid protein (NCBI accession number NP956254). A similar strategy was used to search for zebrafish SHP-2, leading to the identification of zebrafish TC304103 from the tBLASTn search, which was then translated and used to search NCBI’s non-redundant database to identify the top match that was a 594 amino acid protein (NCBI accession number NP956140). Predicted protein structure of the zebrafish phosphatases and identification of the SH2-domains and protein tyrosine phosphatase catalytic (PTPc) domains were also obtained from BLAST analyses and amino acid alignments were performed using the MegAlign program of the DNASTAR Lasergene 7 software. Zebrafish embryos collected after 2 h, 12 h, 24 h, 48 h, and 72 h post-fertilization were pooled for each time point and total RNA was isolated using TriZol reagent (Invitrogen) according to manufacturer’s instructions. Tissues (kidney, spleen, liver, and gill) were also removed from 10 individual zebrafish and each organ was pooled together and total RNA isolated. Expression analysis of ZfSHP-1 and ZfSHP-2 mRNA was then performed by RT-

PCR using freshly isolated RNA (1 mg) converted into cDNA using Oligo(dT)18 primer and 40 U of M-MuLV reverse transciptase (Fermentas). Amplification was then performed in 20 ml reactions with 0.5 U Taq DNA polymerase (Fermentas) and 1 mM of primers specific for ZfSHP-1 and ZfSHP-2 (Table 1) according to manufacturer’s instructions. Cycling parameters were as follows; 2 min and 30 s at 94 8C, 35 cycles of 94 8C for 30 s, 64 8C for 30 s, 72 8C for 30 s, and a final extension step for 7 min at 72 8C. Reactions were separated on a 1.0% TAE-agarose gel, and visualized by staining with ethidium bromide solution (50 mg/mL). To generate C-terminal FLAG-tagged ZfSHP-1 and ZfSHP-2, the full-length cDNAs were cloned into the p3XFLAG-CMV-14 expression vector (Sigma–Aldrich). Zebrafish kidney cDNA was amplified with ZfSHP p3XFLAG EcoRI/Fwd and ZfSHP p3XFLAG XbaI/Rvs primers (Table 1) using the same cycling parameters for ZfSHP expression analysis. The PCR products were then excised, purified and subcloned into pJET1.2/blunt, then restriction digested with EcoRI and XbaI and the inserts T4 ligase-mediated cloned into the p3XFLAG-CMV-14 expression vector and the constructs sequenced prior to use in transfection studies. 3. Results 3.1. Surface expression and immunoprecipitation of KIRED-LITRCYT constructs Following transfection in HEK 293T cells, the expression of KIRED-LITRCYT was determined by flow cytometry and microscopy (Fig. 2). Compared with mock-transfected cells (i.e. transfection reagent alone) constructs 1.0, 2.0, 3.0, and 3X exhibited a significant increase in staining (>80%) with the anti-KIR mAb (DX27) indicating that all chimeric receptors were expressed on the cell surface (Fig. 2A). Cells stained with secondary antibody alone (i.e. goat anti-mouse IgG-PE) or with an isotype control for DX27 (IgG2a) followed by secondary antibody staining had a similar staining pattern as the mock-transfected cells (data not shown). To visualize the cell surface staining of each construct, microscopy was performed on HeLa cells transfected with each of the constructs followed by staining with anti-KIR (DX27) and discrete KIRED-LITRCYT staining localized to the cell surface for all four of the chimeric constructs (Fig. 2B). No staining was observed with mock-transfected cells, cells stained with secondary antibody alone, or isotype control staining. We then performed immunoprecipitation with the anti-KIR mAb (DX27) from cells transfected with each construct. Pervanadate-treated HEK 293T cells transfected with KIRED-LITRCYT chimeric constructs resulted in the immunoprecipitation of tyrosine-phosphorylated immune receptors (Fig. 3A). For example, DX27-immunoprecipation from cells transfected with constructs 1.0, 2.0, or 3.0 exhibited two distinct staining patterns when blotted with a biotinylated anti-phosphotyrosine antibody (Fig. 3A). A discrete phosphoprotein (50 kDa; indicated by arrow) as well as a diffuse stained band (60–70 kDa; indicated by an asterisk) was detected from cells transfected with KIREDLITRCYT construct 3.0. The same pattern was also observed for construct 2.0 but the relative sizes of the discrete and diffuse staining bands were smaller than those observed for construct 3.0 (i.e. 45 kDa and 55–60 kDa, respectively). Construct 1.0-transfected cells immunoprecipitated with DX27 resulted in the detection of a discrete band at 37.5 kDa (indicated by arrow) and a diffuse staining band of 40–50 kDa (indicated by an asterisk). In comparison, mock-transfected cells and cells transfected with construct 3X devoid of cytoplasmic tyrosines did not result in the detection of any tyrosinephosphorylated proteins (Fig. 3B). Furthermore, cells transfected

B.C.S. Montgomery et al. / Developmental and Comparative Immunology 33 (2009) 570–582

575

Fig. 2. Surface expression of KIRED-LITRCYT constructs. To determine if each KIRED-LITRCYT was expressed as a surface protein on mammalian cells, staining with anti-KIR mAb was performed. (A) Flow cytometry analysis of HEK 293T cells individually transfected with KIRED-LITRCYT constructs 1.0, 2.0, 3.0, or 3X followed by staining with DX27 mAb and a goat anti-mouse IgG coupled to PE. Open histogram indicates mock-transfected cells and shaded histograms represent HEK 293T cells transiently transfected with each construct. Percent values indicate the amount of staining within the M1 region. Note: For mock-transfected cells (and isotype-stained cells) M1 staining was <10%. (B) Microscope analysis of HeLa cells individually transfected with KIRED-LITRCYT constructs 1.0, 2.0, 3.0, or 3X followed by staining with DX27 mAb and a goat anti-mouse IgG coupled to PE. Results in (A) are representative of three individual experiments that were performed demonstrating similar surface expression of all constructs. Results in (B) are a representative of two independent experiments.

Fig. 3. Immunoprecipitation of tyrosine-phosphorylated KIRED-LITRCYT constructs following pervanadate stimulation. HEK 293T cells were transiently transfected with each construct (i.e. 1.0, 2.0, 3.0, or 3X) and after 48 h the cells were treated for 10 min with pervanadate, lysed and then immunoprecipitated with DX27. Samples were separated on a 10% SDS-PAGE gel under reducing conditions, transferred to nitrocellulose and duplicate blots were probed with either a biotin-conjugated anti-phosphotyrosine mAb (A) or with the anti-KIR mAb (B). Two major phosphoprotein stained bands were observed for constructs 1.0, 2.0, and 3.0, which are indicated by an arrow (smaller band) and an asterisk (larger diffuse staining band) in (A). Note: Mock-transfected cells and those transfected with construct 3X did not demonstrate any phosphotyrosine staining after pervanadate treatment. A similar staining pattern for each construct was observed in (B) with the addition of some non-specific bands as indicated in the mock lane. Results are representative of two independent experiments.

with the various constructs without pervanadate treatment then immunoprecipitated with DX27 did not result in the detection of tyrosine-phosphorylated proteins (data not shown). We also blotted a second membrane with the anti-KIR mAb (LIG-1) and as shown in Fig. 3B a similar pattern of staining was observed as with the anti-phosphotyrosine stained blot. Constructs 3.0, 2.0, and 1.0 all demonstrated discrete (50 kDa, 45 kDa, and 37.5 kDa, respectively; indicate by arrow) and diffuse staining bands (60–70 kDa, 55–60 kDa, and 40– 50 kDa, respectively; indicated by an asterisk). For construct 3X a prominent band (35 kDa; indicated by arrow) and some diffuse staining (45 kDa; indicated by an asterisk) were also observed.

The diffuse staining for this construct was difficult to resolve due to the prominent cross-reacting protein (50 kDa) that was detected with the goat anti-mouse IgG-HRP antibody (Fig. 3B). The larger diffuse staining is predicted to be due to the variable glycosylation of the extracellular region of KIR2DL3 that contains four N-linked glycosylation sites, which has previously been demonstrated by others [34,35]. The smaller more discrete bands likely represent non-glycosylated forms of the KIRED-LITRCYT chimeric proteins that may or may not be expressed on the cell surface (i.e. these may represent immature glycoforms). For mock-transfected cells, at least five non-specific protein bands were observed.

576

B.C.S. Montgomery et al. / Developmental and Comparative Immunology 33 (2009) 570–582

3.2. Cloning and expression of zebrafish SHP-1 and SHP-2 Although SHP-1 and SHP-2 are conserved among endothermic vertebrates (i.e. mammals and birds), invertebrates only have a single SHP-2 orthologue termed Corkscrew [36] and no information about the roles of these proteins in ectothermic vertebrates is available. Therefore, we wanted to determine if there were SHP homologues in fish and if the ITIM motifs in putative inhibitory IpLITRs are able to bind these proteins for initiation of signaling pathways. To determine the SHP-recruitment capabilities of the different KIRED-LITRCYT phosphoproteins, we cloned zebrafish SHP-1 and SHP-2 (see Section 2). Zebrafish SHP-1 (589 amino acids) is located on chromosome 16 and SHP-2 (594 amino acids) is located on chromosome 10. Both phosphatases encode N- and C-terminal SH2-domains as well as a protein tyrosine phosphatase catalytic domain (Fig. 4A). Expression analysis revealed that in adult tissues (e.g. kidney, spleen, liver, and gill) both phosphatases were expressed but in zebrafish embryos, SHP-1 and SHP-2 expression was not observed until 48 h post fertilization (Fig. 4B). We then generated C-terminal 3XFLAG fusion proteins in HEK 293T cells and following immunoprecipitation with the anti-FLAG M2 mAb observed that recombinant zebrafish SHP-1 and SHP-2 were produced as 65 kDa proteins (Fig. 4C). When compared with human and mouse SHP-1 and SHP-2 amino acid sequences, the teleost proteins are 67% identical (78% similar) and 91% identical (94% similar), respectively (Fig. 5). The N- and C-terminal SH2-domains are also highly conserved between teleost and vertebrate SHPs and the PTP signature motif (HCxAGxGRS/T) is identical between these proteins in mammals and fish (Fig. 5). 3.3. KIRED-LITRCYT constructs 1.0 and 3.0 recruit both SHP-1 and SHP2 following pervanadate-induced tyrosine phosphorylation Individual KIRED-LITRCYT chimeric constructs (1.0, 2.0, 3.0, and 3X) were transiently co-transfected with either 3XFLAG zebrafish

SHP-1 or 3XFLAG zebrafish SHP-2 for 48 h, then treated with pervanadate and immunoprecipitated with the anti-KIR mAb (DX27). Blots were then probed with an anti-FLAG HRP-conjugated mAb to determine whether zebrafish SHP-1 and/or SHP-2 bound to the phosphotyrosines within the IpLITRCYT region of each construct. As predicted (see Supplementary figure), both KIREDLITRCYT constructs 1.0 and 3.0 recruited SHP-1 (Fig. 6A) and SHP-2 (Fig. 6B) following pervanadate stimulation. Conversely, construct 2.0 did not appear to recruit SHP-1 (Fig. 6A) but a faint band for SHP-2 was observed that was much weaker than the SHP-2 bands that co-immunoprecipitated with constructs 1.0 and 3.0 (Fig. 6B). This does not appear to be due to lower levels of available SHP-2 in the co-transfected cells since relatively equal amounts of SHP-2 fusion proteins were immunoprecipitated from all samples (Fig. 6B). However, there was a noticeable reduced amount of SHP-1 protein that co-immunoprecipitated with constructs 1.0 and 3.0 when compared with SHP-2 (Fig. 6). This could in part be due to the reduced amount of available SHP-1 proteins as observed following immunoprecipitation with anti-FLAG mAb (Fig. 6A). Finally, construct 3X, which is devoid of tyrosine residues and does not generate a phosphoprotein following treatment with pevanadate did not recruit zebrafish SHP-1 nor SHP-2 although both of the fusion proteins were present (Fig. 6). Without pervanadate treatment no SHP recruitment was detected and KIRED-LITRCYT chimeric constructs were not phosphorylated (data not shown). 3.4. ‘Native’ epitope-tagged IpLITR 32.17 L1.1b is a surface-expressed protein that following tyrosine phosphorylation recruits SHP-1 and SHP-2 To confirm the findings obtained with the chimeric proteins and to demonstrate that constructs encoding the ED, TM segment, and CYT region of a putative inhibitory IpLITR are expressed on the cell surface, we generated an N-terminal HA-tagged recombinant fusion protein encoding the TS32.17 L1.1b (NCBI accession

Fig. 4. Identification and characterization of zebrafish SHP-1 and SHP-2. Zebrafish SHP-1 and SHP-2 cDNAs were identified by BLAST searches using mammalian phosphatase protein sequences as queries. (A) Zebrafish SHP-1 and SHP-2 are 589 and 594 amino acid proteins, respectively and both encode two N-terminal Src homology 2 (SH2) domains and a protein tyrosine phosphatase (PTP) catalytic domain. (B) RT-PCR analysis of SHP-1 and SHP-2 expression in developing zebrafish embryos (2–72 h post fertilization) and in adult tissues relative to the template control gene, b-actin. Tissues examined were kidney (K), spleen (S), liver (L), and gill (G). (C) Western blot detection of zebrafish SHP-1 and SHP-2 fusion protein constructs containing a C-terminal 3XFLAG epitope tag in the cellular lysates of HEK 293T transiently transfected with zebrafish SHP-1 (lane 1) and zebrafish SHP-2 (lane 2) and then immunoprecipitated with the anti-FLAG mAb M2. Blots were then probed with an anti-FLAG conjugated with HRP.

B.C.S. Montgomery et al. / Developmental and Comparative Immunology 33 (2009) 570–582

577

Fig. 5. Amino acid alignments of human (Hu), mouse (Mo), and zebrafish (Zf) SHP-1 (A) and SHP-2 (B). The dark grey shaded residues represent those that do not match the consensus sequence. The beginning of the N- and C-terminal SH2-domains is indicated with an arrowhead and the entire domains are shaded with light grey on the alignment. The PTP signature motif (HCSAGAGRT) [37] is also indicated on both alignments as a light shaded area surrounded by double lines.

number: ABI16050) cDNA fused with the mouse Ig k-chain secretion signal (Fig. 7). This construct was designated as clone H and encoded four extracellular Ig-like domains a TM segment and a CYT region that is exactly the same as KIRED-LITRCYT construct 3.0 (Fig. 7A). In addition, no N-linked glycosylation sites are encoded within the ED region of this receptor. While sequencing this

construct we discovered that one of the clones had a ‘frame-shift’ mutation due to the deletion of a G base pair at position 566 (position 1–3 are the start ATG of the mouse Ig k-chain secretion signal encoded by the pDISPLAY vector). This resulted in a truncated receptor due to an in frame STOP codon (i.e. TGA) at amino acid position 216 located at the C-terminal end of the

578

B.C.S. Montgomery et al. / Developmental and Comparative Immunology 33 (2009) 570–582

Fig. 6. KIRED-LITRCYT constructs 1.0 and 3.0 recruit zebrafish SHP-1 and SHP-2 following pervanadate-induced tyrosine phosphorylation. HEK 293T cells were transfected with KIRED-LITRCYT constructs 1.0, 2.0, 3.0, or 3X and then co-transfected with the C-terminal 3XFLAG zebrafish SHP-1 (A) or SHP-2 (B) fusion proteins. Forty-eight hours after transfection the cells were pervanadate treated, lysed, and then immunoprecipitated with the anti-KIR mAb DX27 or anti-FLAG mAb. Samples were separated on a 10% SDSPAGE gel under reducing conditions, transferred to nitrocellulose and duplicate blots were probed with an anti-FLAG antibody conjugated to HRP for the detection of zebrafish SHP-1 (A) or zebrafish SHP-2 (B) fusion proteins. The protein bands corresponding to the predicted sizes of zebrafish SHPs (65 kDa) are indicated with an arrow. Additional higher and lower molecular weight bands were also observed in some of the lanes and are indicated as (?). The larger protein (75 kDa) may represent a phosphorylated form of the recruited zebrafish phosphatases. Results are representative of three independent experiments performed.

second Ig-like domain (Fig. 7A). This truncated receptor was therefore missing Ig-like domains D3 and D4, the TM segment, and the entire CYT region. We designated this as clone J and used this construct as a negative control for our expression, phosphorylation, and SHP recruitment experiments. Following transfection in HEK 293T cells, the expression of epitope-tagged TS32.17 L1.1b (clone H) was determined by flow cytometry and microscopy (Fig. 7B). Compared with mocktransfected cells (i.e. transfection reagent alone) or cells transfected with clone J, a significant increase in anti-HA mAb staining (>70%) was observed when the cells were transfected with clone H (Fig. 7B; left panel). Cells stained with secondary antibody alone (i.e. goat anti-mouse IgG-PE) or with an isotype control for the antiHA mAb (IgG3) followed by secondary antibody staining had a similar staining pattern as the mock-transfected cells (data not shown). To visualize the cell surface staining of TS32.17 L1.1b

(clone H), microscopy was also performed followed by staining with anti-HA mAb. Cells transfected with clone H demonstrated a discrete pattern of cell surface staining (Fig. 7B; right panel), which was not observed with mock-transfected cells, cells stained with secondary antibody alone, isotype control stained cells, and cells transfected with clone J (data not shown). HEK 293T cells transiently transfected with TS32.17 L1.1b (clone H and clone J) were then co-transfected with 3XFLAG zebrafish SHP1 or 3XFLAG zebrafish SHP-2 for 48 h, treated with pervanadate, and immunoprecipitated with the anti-HA mAb (HA.C5). Blots were then probed with an anti-phosphotyrosine mAb (to detect the phosphorylated IpLITR) or an anti-FLAG HRP-conjugated mAb to determine if zebrafish SHP-1 and/or SHP-2 bound to the phosphotyrosines with the CYT of TS32.17 L1.1b. Lysates immunoprecipitated with anti-HA mAb from cells transfected with clone H after pervanadate treatment resulted in the detection of a 70 kDa

B.C.S. Montgomery et al. / Developmental and Comparative Immunology 33 (2009) 570–582

579

Fig. 7. Native epitope-tagged IpLITR TS32.17 L1.1b is a surface-expressed protein that following tyrosine phosphorylation recruits SHP-1 and SHP-2. (A) A schematic representation of the expression construct generated after cloning the TS32.17 L1.1b cDNA into the pDISPLAY expression vector. The full-length construct was designated as clone H and a truncated version of this construct due to incorporation of an in frame ‘TGA’ at amino acid position 216 was designated as clone J. (B) Flow cytometry analysis of transfected HEK 293T cells followed by staining with an anti-HA mAb and a goat anti-mouse IgG coupled to PE (left panel). Open histogram indicates clone J-transfected cells and shaded histogram represents HEK 293T cells transiently transfected with construct H. Percent value indicates the amount of staining within the M1 region. Note: For clone J, mock-transfected, and isotype-stained cells M1 was <10%. Microscope analysis of HeLa cells transfected with TS32.17 L1.1b clone H followed by staining with anti-HA mAb and a goat anti-mouse IgG coupled to PE. (C) TS32.17 L1.1b clone H and clone J were co-transfected into HEK 293T cells with the C-terminal 3XFLAG zebrafish SHP-1 or SHP-2 fusion proteins. Forty-eight hrs after transfection the cells were pervanadate treated (+) or incubated with D-PBS (), lysed, and then immunoprecipitated with either anti-HA mAb or anti-FLAG mAb. Samples were separated on a 10% SDS-PAGE gel under reducing conditions, transferred to nitrocellulose and blots were probed with either an anti-phosphotyrosine mAb (to detect tyrosine-phosphorylated TS32.17 L1.1b; left panel) or an anti-FLAG antibody conjugated to HRP for the detection of zebrafish SHP-1 (middle blot) or zebrafish SHP-2 (right blot) fusion proteins. The bands corresponding to the predicted sizes of the zebrafish SHPs (65 kDa) are indicated with arrows. Results are representative of two independent experiments performed.

phosphoprotein (Fig. 7C; left panel) that co-immunoprecipitated with zebrafish SHP-1 (Fig. 7C; middle panel) and zebrafish SHP2 (Fig. 7C; right panel). Conversely, immunoprecipitation with anti-HA mAb from HEK 293T cells transfected with the

truncated receptor (clone J) did not result in the detection of a tyrosine-phosphorylated immune receptor and neither zebrafish SHP-1 nor SHP-2 were co-immunoprecipitated (Fig. 7C). Zebrafish SHP-1 and SHP-2 fusion proteins were produced in all

580

B.C.S. Montgomery et al. / Developmental and Comparative Immunology 33 (2009) 570–582

transfected cells, which was verified by immunoprecipitation with the anti-FLAG M2 mAb (Fig. 7C; middle panel and right panel). As observed in Fig. 6, the relative amounts of zebrafish SHP-1 fusion protein was lower than SHP-2. 4. Discussion Many immune cell functions depend in part on the net outcome of opposing signals delivered by stimulatory and inhibitory immune receptors. The importance of this balance can be appreciated in the context of many immune-related diseases. The loss of an inhibitory signal is often associated with unchecked inflammatory responses resulting in a state of autoimmunity. Human genes located within the LRC (e.g. KIRs and leukocyte Ig-like receptors; LILRs) and on chromosome 1 (i.e. FcRs) have been directly linked with susceptibilities to infectious diseases and autoimmunity [38–43]. The identification of these disease susceptibility genes provides a better understanding of the etiology and pathogenesis of autoimmune diseases and provides clues for the development of immunotherapeutic strategies [38–41,44–46]. Recent studies in birds, amphibians and bony fish indicate that FcR- and LRC-like proteins are conserved across vertebrates [8,9,12,13,18,47]. This provides a unique opportunity to functionally characterize innate immunoregulatory receptor networks that will not only provide information regarding the immune responses of non-mammalian animals but will also serve as important model systems for gaining insights into conserved mechanisms of innate immune receptor-mediated regulation of vertebrate immunity. In xenopus and zebrafish, recent studies have focused on identifying the adaptor molecules that associate with putative stimulatory innate immune receptors belonging to the IgSF. For example, following a description of the structural characteristics of ITAMcontaining adaptor molecules in zebrafish [48] it was demonstrated that the activating novel immune-type receptor (Nitr9) associated and signaled via DAP12 [49]. In addition, two members of the xenopus FcR-like protein family (e.g. XFL1.7 and XFL2) appeared to associate with the ITAM-containing FcR common g chain, which was determined by co-transfection and flow cytometric staining [18]. These studies suggest that common modes of cellular activation pathways are conserved among different vertebrate IgSF members. To date, there are no reports examining the inhibitory signaling potential of ectothermic vertebrate innate immune receptors with ITIM-containing CYT regions. Since several catfish LITRs encode ITIMs within their CYT regions, examination of their inhibitory signaling potential was performed. We fused the tyrosine-containing CYT region of two putative inhibitory IpLITRs with the ED and TM segment of KIR2DL3 due to the availability of the anti-KIR2D mAb DX27, the known ligand for this receptor (i.e. HLA-Cw3), and the ability to retrovirally transfect these receptors into the human NK-like cells (YTS) for future functional studies [32,35]. We also produced a ‘native’ epitope-tagged version of IpLITR TS32.17 L1.1b, which contains the same CYT as construct 3.0. Characterization of the KIRED-LITRCYT and epitope-tagged IpLITR constructs was performed using transient expression experiments in HEK 293T and HeLA cells in order to examine their surface expression, tyrosine phosphorylation, and phosphatase recruitment potential. All constructs with tryrosine-containing IpLITRCYT regions were expressed on the cell surface and these proteins became phosphorylated following pervanadate treatment. This was not observed in mock-transfected control cells or cells transfected with the tyrosine deficient construct 3X. These findings demonstrate that putative inhibitory catfish LITRCYT are specifically phosphorylated at tyrosine residues, which may facilitate their association with phosphatases required for cellular inhibition.

Following immunoprecipitation with the DX27 mAb, two major patterns of staining were observed for all chimeric constructs that likely represent glycosylated and immature glycoforms of the proteins. This pattern was detected when blots were probed with either an anti-phosphotyrosine mAb or a mAb specific for KIR (i.e. LIG-1) and both receptor forms (i.e. glycosylated and nonglycosylated) appeared to be tyrosine phosphorylated following pervanadate stimulation. Cell surface expression of the epitopetagged ‘native’ receptor encoding four extracellular Ig-like domains, a TM segment, and a long tyrosine-containing CYT region, was also demonstrated in this study reinforcing that IpLITRs are indeed cell surface immune receptors. Immunoprecipitation of this receptor with the anti-HA mAb from pervanadatetreated cells resulted in the detection of a phosphoprotein (70 kDa) that corresponds to the predicted size of TS32.17 L1.1b. A mutated version of this receptor designated as clone J (missing the TM and CYT), was not expressed on the surface and was not phosphorylated. After confirming that each construct was expressed on the cell surface and tyrosine phosphorylated, we predicted if they could bind inhibitory phosphatases (i.e. SHP-1 and SHP-2) based on known mammalian SHP-recruitment motifs [37]. The KIRED-LITRCYT constructs 1.0, 2.0, 3.0, and 3X encoded 2, 3, 6, and 0 cytoplasmic tyrosine residues, respectively. Using the consensus sequence (T/V/ I/Y)-X-pY-(A/S/T/V)-X-(I/V/L) [37], where X represents any amino acid and pY is the phosphotyrosine residue at position 0 (p0), we predicted if the pY within each IpLITRCYT could bind the SH2domains of the phosphatases SHP-1 and SHP-2. We then examined residues at positions pY +4 to +6 for the large hydrophobic residues W, Y, M, and F and/or the positively charged residues R, K, and H that greatly enhance pY binding to the SH2-domains of SHP-2 and SHP-1, respectively [37]. According to this analysis, all constructs with the exception of 3X are predicted to recruit both SHP-1 and SHP-2 (Supplementary figure). However, not every tyrosine residue is predicted to contribute to SHP-binding following phosphorylation. Specifically, for construct 1.0, the TS32.17 CYT Y1 has SHP-1 and SHP2 recruitment potential and TS32.17 CYT Y2 is predicted to only bind SHP-1 (Supplementary figure). The truncated TS32.17 L1.1b CYT encoded by construct 2.0 contains three tyrosine residues but only Y2 is predicted to bind SHP-1 and SHP-2. Residues Y1 to Y3 of KIREDLITRCYT construct 3.0 (containing the full-length CYT of TS32.17 L1.1b) are identical to that of construct 2.0 but this CYT has an additional three tyrosines labeled Y4, Y5, and Y6 (Supplementary figure). All of these membrane distal tyrosines are predicted to bind SH2-domains. For example, both Y4 and Y6 most likely bind SHP-1, whereas Y5 likely interacts with SHP-2. Finally, construct 3X is devoid of any tyrosine residues within its CYT region and is not predicted to interact with SH2-domains and consequently should not bind either phosphatase. To support this bioinformatic data we identified and cloned zebrafish SHP-1 and SHP-2 cDNAs from the genomic database and generated C-terminal 3XFLAG-tagged fusion proteins. As in mammals, zebrafish SHP-1 and SHP-2 encode N- and C-terminal SH2-domains required for binding phosphorylated tyrosines and a protein tyrosine phosphatase (PTP) catalytic domain with the PTP signature motif (HC-X-AG-X-GRS/T) [37,50]. We used zebrafish SHP-1 and SHP-2 in our studies due to the availability of the fulllength cDNAs in the genomic database, high amino acid homology with their mammalian counterparts, and conserved structural features for phosphotyrosine binding and phosphatase activity. We have also searched for the catfish SHP-1 and SHP-2 cDNAs and to date obtained a partial 897 bp fragment for SHP-1 that encodes the PTP portion of the protein. We have not yet identified SHP-2 but ongoing studies are underway to clone and characterize these putative catfish phosphatases.

B.C.S. Montgomery et al. / Developmental and Comparative Immunology 33 (2009) 570–582

In co-transfection experiments both SHP-1 and SHP-2 associated with the phosphorylated CYT regions of IpLITRs. Compared with construct 2.0, SHP-1 and SHP-2-binding was more prominent for constructs 1.0 and 3.0 following tyrosine phosphorylation, which contain cytoplasmic tyrosines embedded within ITIM-like motifs (i.e. Y1 and Y2 for construct 2.0 and Y4, Y5, and Y6 for construct 3.0). Conversely, construct 2.0 has three tyrosine residues and none of them are found within a consensus ITIM or ITIM-like motif. However, at the pY2 +1 to +5 positions of construct 2.0 there are residues that are predicted to facilitate SHPbinding (Supplementary figure). In fact, a weak-staining band for SHP-2 was detected following co-immunoprecipitation with phosphorylated construct 2.0. We predict that although all of the tyrosine residues within the various IpLITRCYT are likely phosphorylated following pervanadate treatment, only those found within construct 1.0 and the C-terminal regions of construct 3.0 (i.e. Y4, Y5, and Y6) are responsible for strong SHP-binding. In some cases when we observed zebrafish SHP-1 and SHP-2 binding to the phosphorylated constructs an additional band (72 kDa) was also detected. This protein may represent a phosphorylated form of the recruited zebrafish phosphatases, which is yet to be confirmed. Finally, co-immunoprecipitation of the epitope-tagged IpLITR TS32.17 L1.1b also demonstrated SHP-1 and SHP-2 binding following tyrosine phosphorylation. Since this construct encoded the same CYT region as construct 3.0, we also predict that the Cterminal tyrosines (i.e. Y4 to Y6) of this receptor are primarily responsible for the phosphatase recruitment. A truncated version of this protein was not expressed on the surface, did not generate a phosphorylated protein, and did recruit neither SHP-1 nor SHP-2. Therefore, our results confirm that like mammalian inhibitory ITIM-containing receptors, IpLITRs recruit SHP-1 and SHP-2 as an initial step required for inhibitory immune receptor-mediated signaling. In combination with site-directed mutagenesis, we are currently designing additional constructs in order to further understand the interactions between the teleost SHPs and specific tyrosine residues encoded by the IpLITR CYT regions. In mammals, SHP-1 and SHP-2 have been identified as key mediators involved in the control of cellular responses. As reviewed by [51], these phosphatases modulate cellular growth and development, inflammatory responses, apoptosis, and widerange of intracellular signaling cascades. Specifically, SHP phosphatases can diminish Toll-like receptor-mediated inflammatory cytokine production [52], inhibit B cell receptor-induced cellular activation [53], inhibit the proliferation, cytotoxicity, and cytokine production of T cells [54], and are key mediators of the inhibitory signals transmitted by KIRs [25,26]. In addition, intracellular parasites such as Leishmania donovani can activate host cell SHP-1 as a survival strategy in order to inhibit the generation of nitric oxide production [55] and SHP manipulation by certain cancers results in the promotion of tumor growth and survival [56–58]. In this study we demonstrated that putative inhibitory IpLITRs recruit SHP-1 and SHP-2 phosphatases following tyrosine phosphorylation of their CYT regions. This is an important first step in the induction of an inhibitory signaling cascade but their influence(s) on cellular effector functions has yet to be examined. Our results set the stage for exploring the functional consequences of phosphatase recruitment by teleost innate immune receptors belonging to the IgSF family and further studies are ongoing to characterize these IpLITR-mediated signaling events. Acknowledgements This work was supported by grants from the Natural Sciences and Engineering Council of Canada (NSERC), Canadian Foundation for Innovation (CFI) Leaders Opportunity Fund, Alberta Advanced

581

Education and Technology, Alberta Heritage Foundation for Medical Research (AHFMR) major equipment grant, and a Faculty of Science Start-up grant to J.L.S. Graduate teaching assistantships awarded by the Department of Biological Sciences, University of Alberta were provided for B.C.S.M and J.M. D.N.B is supported by CIHR and AHFMR.

Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.dci.2008.10.006. References [1] Hsu KC, Chida S, Dupont B, Geraghty DE. The killer cell immunoglobulinlike receptor (KIR) genomic region: gene-order, haplotypes and allelic polymorphism. Immunol Rev 2002;190:40–52. [2] Lanier LL. Up on the tightrope: natural killer cell activation and inhibition. Nat Immunol 2008;9:495–502. [3] Parham P. Killer cell immunoglobulin-like receptor diversity: balancing signals in the natural killer cell response. Immunol Lett 2004;29:11–3. [4] Takai T. Fc receptors and their role in immune regulation and autoimmunity. J Clin Immunol 2005;25:1–18. [5] Wende H, Colonna M, Ziegler A, Volz A. Organization of the leukocyte receptor cluster (LRC) on human chromosome 19q13.4. Mamm Genome 1999;10:154–60. [6] Cannon JP, Haire RN, Mueller MG, Litman RT, Eason DD, Tinnemore D, et al. Ancient divergence of a complex family of immune-type receptor genes. Immunogenetics 2006;58:363–73. [7] Davis RS, Wang YH, Kubagawa H, Cooper MD. Identification of a family of Fc receptor homologs with preferential B cell Expression. Proc Natl Acad Sci USA 2001;98:9772–7. [8] Dennis Jr G, Kubagawa H, Cooper MD. Paired Ig-like receptor homologs in birds and mammals share a common ancestor with mammalian Fc receptors. Proc Natl Acad Sci USA 2000;97:13245–50. [9] Fayngerts SA, Najakshin AM, Taranin AV. Species-specific evolution of the FcR family in endothermic vertebrates. Immunogenetics 2007;59:493–506. [10] Kubagawa H, Burrows PD, Cooper MD. A novel pair of immunoglobulin-like receptors expressed by B cells and myeloid cells. Proc Natl Acad Sci USA 1997; 94:5261–6. [11] Laun K, Coggill P, Palmer S, Sims S, Ning Z, Ragoussis J, et al. The leukocyte receptor complex in chicken is characterized by massive expansion and diversification of immunoglobulin-like loci. PLoS Genet 2006;2:e73. [12] Stafford JL, Bengten E, Du Pasquier L, McIntosh RD, Quiniou SM, Clem LW, et al. A novel family of diversified immunoregulatory receptors in teleosts is homologous to both mammalian Fc receptors and molecules encoded within the leukocyte receptor complex. Immunogenetics 2006;58:758–73. [13] Stafford JL, Wilson M, Nayak D, Quiniou SM, Clem LW, Miller NW, et al. Identification and characterization of a FcR homolog in an ectothermic vertebrate, the channel catfish (Ictalurus punctatus). J Immunol 2006;177:2505–17. [14] Stet RJ, Hermsen T, Westphal AH, Jukes J, Engelsma M, Lidy Verburg-van Kemenade BM, et al. Novel immunoglobulin-like transcripts in teleost fish encode polymorphic receptors with cytoplasmic ITAM or ITIM and a new structural IG domain similar to the natural cytotoxicity receptor NKp44. Immunogenetics 2005;57:77–89. [15] Yoder JA, Litman RT, Mueller MG, Desai S, Dobrinski KP, Montgomery JS, et al. Resolution of the novel immune-type receptor gene cluster in zebrafish. Proc Natl Acad Sci USA 2004;101:15705–11. [16] Long EO. Regulation of immune responses through inhibitory receptors. Annu Rev Immunol 1999;17:875–904. [17] Nimmerjahn F, Ravetch JV. Fc-receptors as regulators of immunity. Adv Immunol 2007;96:179–204. [18] Guselnikov SV, Ramanayake T, Erilova AY, Mechetina LV, Najakshin AM, Robert J, et al. The Xenopus FcR family demonstrates continually high diversification of paired receptors in vertebrate evolution. BMC Evol Biol 2008;8:148. [19] Billadeau DD, Leibson PJ. ITAMs versus ITIMs: striking a balance during cell Regulation. J Clin Invest 2002;109:161–8. [20] Gergely J, Pecht I, Sarmay G. Immunoreceptor tyrosine-based inhibition motifbearing receptors regulate the immunotyrosine-based activation motifinduced activation of immune competent cells. Immunol Lett 1999;68:3–15. [21] Lanier LL, Corliss BC, Wu J, Leong C, Phillips JH. Immunoreceptor DAP12 bearing a tyrosine-based activation motif is involved in activating NK cells. Nature 1998;391:703–7. [22] Underhill DM, Goodridge HS. The many faces of ITAMs. Trends Immunol 2004;28:66–73. [23] Ravetch JV, Lanier LL. Immune inhibitory receptor. Science 2000;290:84–9. [24] Vivier E, Daeron M. Immunoreceptor tyrosine-based inhibition motifs. Immunol Today 1997;18:286–91.

582

B.C.S. Montgomery et al. / Developmental and Comparative Immunology 33 (2009) 570–582

[25] Burshtyn DN, Yang W, Yi T, Long EO. A novel phosphotyrosine motif with a critical amino acid at position -2 for the SH2 domain-mediated activation of the tyrosine phosphatase SHP-1. J Biol Chem 1997;272:13066–72. [26] Burshtyn DN, Lam AS, Weston M, Gupta N, Warmerdam PA, Long EO. Conserved residues amino-terminal of cytoplasmic tyrosines contribute to the SHP-1-mediated inhibitory function of killer cell Ig-like receptors. J Immunol 1999;162:897–902. [27] Stebbins CC, Watzl C, Billadeau DD, Leibson PJ, Burshtyn DN, Long EO. Vav1 dephosphorylation by the tyrosine phosphatase SHP-1 as a mechanism for inhibition of cellular cytotoxicity. Mol Cell Biol 2003;23:6291–9. [28] Watzl C, Stebbins CC, Long EO. NK cell inhibitory receptors prevent tyrosine phosphorylation of the activation receptor 2B4 (CD244). J Immunol 2000;165: 3545–8. [29] Shen L, Stuge TB, Bengten E, Wilson M, Chinchar VG, Naftel JP, et al. Identification and characterization of clonal NK-like cells from channel catfish (Ictalurus punctatus). Dev Comp Immunol 2004;28:139–52. [30] Stafford JL, Bengten E, Du Pasquier L, Miller NW, Wilson M. Channel catfish leukocyte immune-type receptors contain a putative MHC class I binding site. Immunogenetics 2007;59:77–91. [31] Watzl C, Peterson M, Long EO. Homogenous expression of killer immunoglobulin-like receptors (KIR) on natural killer cells detected by a monoclonal antibody to KIR2D. Tissue Antigens 2000;56:240–7. [32] Lanier LL, Corliss BC, Phillips JH. Arousal and inhibition of human NK cells. Immunol Rev 1997;155:145–54. [33] Morgenstern JP, Land H. Advanced mammalian gene transfer: high titre retroviral vectors with multiple drug selection markers and a complementary helper-free packaging cell line. Nucleic Acids Res 1990;25:3587–96. [34] Litwin V, Gumperz J, Parham P, Phillips JH, Lanier LL. NKB1: a natural killer cell receptor involved in the recognition of polymorphic HLA-B molecules. J Exp Med 1994;180:537–43. [35] Moretta A, Sivori S, Vitale M, Pende D, Morelli L, Augugliaro R, et al. Existence of both inhibitory (p58) and activatory (p50) receptors for HLA-C molecules in human natural killer cells. J Exp Med 1995;182:875–84. [36] Freeman RM, Plutzky J, Neel BG. Identification of a human src homology 2 containing protein-tyrosine-phosphatase: a putative homolog of Drosophila corkscrew. Proc Natl Acad Sci USA 1992;89:11239–43. [37] Imhof D, Wavreille A-S, May A, Zacharias M, Tridandapani S, Pei D. Sequence specificity of SHP-1 and SHP-2 Src homology 2 domains. Critical roles of residues beyond the pY+3 position. J Biol Chem 2006;281:20271–82. [38] Huynh OA, Hampartzoumian T, Arm JP, Hunt J, Borges L, Ahern M, et al. Downregulation of leukocyte immunoglobulin-like receptor expression in the synovium of rheumatoid arthritis patients after treatment with disease-modifying anti-rheumatic drugs. Rheumatology 2007;46:742–51. [39] Kuroki K, Tsuchiya N, Shiroishi M, Rasubala L, Yamashita Y, Matsuta K, et al. Extensive polymorphisms of LILRB1 (ILT2, LIR1) and their association with HLA-DRB1 shared epitope negative rheumatoid arthritis. Hum Mol Genet 2005;14:2469–80. [40] Moodie SJ, Norman PJ, King AL, Fraser JS, Curtis D, Ellis HJ, et al. Analysis of candidate genes on chromosome 19 in celiac disease: an association study of the KIR and LILR gene clusters. Eur J Immunogenet 2002;29:287–91. [41] Santin I, Castellanos-Rubio A, Perez de Nanclares G, Vitoria JC, Castano L, Bilbao JR. Association of KIR2DL5B gene with coliac disease supports the susceptibility locus on 19q13.4. Genes Immun 2007;8:171–6.

[42] Segal S, Hill AV. Genetic susceptibility to infectious disease. Trends Microbiol 2003;11:445–8. [43] Ward J, Bonaparte M, Sacks J, Guterman J, Fogli M, Mavilio D, et al. HIV modulates the expression of ligands important in triggering natural killer cell cytotoxic responses on infected primary T-cell blasts. Blood 2007;110:1207–14. [44] Tsuchiya N, Kyogoku C, Miyashita R, Kuroki K. Diversity of human immune system multigene families and its implication in the genetic background of rheumatic diseases. Curr Med Chem 2007;4:431–9. [45] Brown D, Trowsdale J, Allen R. The LILR family: modulators of innate and adaptive immune pathways in health and disease. Tissue Antigens 2004;64: 215–25. [46] Brownlie RJ, Lawlor KE, Niederer HA, Cutler AJ, Xiang Z, Clatworthy MR, et al. Distinct cell-specific control of autoimmunity and infection by FcgRIIb. J Exp Med 2008;205:883–95. [47] Viertlboeck BC, Schweinsberg S, Hanczaruk MA, Schmitt R, Du Pasquier L, Herberg FW, et al. The chicken leukocyte receptor complex encodes a primordial, activating, high-affinity IgY Fc receptor. Proc Natl Acad Sci USA 2004;104:11717–23. [48] Yoder JA, Orcutt TM, Traver D, Litman GW. Structural characteristics of adaptor molecules that associate with transmembrane immune receptors. Gene 2007;401:154–64. [49] Wei S, Zhou J-M, Chen X, Shah RN, Liu J, Orcutt TM, et al. The zebrafish activating immune receptor Nitr9 signals via Dap12. Immunogenetics 2007; 59:813–21. [50] Blanchetot C, Chagnon M, Dube N, Halle M, Tremblay ML. Substrate trapping techniques in the identification of cellular PTP targets. Methods 2005;35: 44–53. [51] Chong ZZ, Maiese K. The Src homology 2 domain tyrosine phosphatases SHP[1] and SHP-2: diversified control of cell growth, inflammation, and injury. Histol Histopathol 2007;22:1251–67. [52] An H, Zhao W, Hou J, Zhang Y, Xie Y, Zheng Y, et al. SHP-2 phosphatase negatively regulates TRIF adaptor protein-dependent type I interferon and inflammatory cytokine production. Immunity 2002;25:919–28. [53] Haga CL, Ehrhardt GR, Boohaker RJ, Davis RS, Cooper MD. Fc receptor-like 5 inhibits B cell activation via SHP-1 tyrosine phosphatase recruitment. Proc Natl Acad Sci USA 2007;104:9770–5. [54] Nagaishi T, Pao L, Lin SH, Iijima H, Kaser A, Qiao SW, et al. SHP-1 phosphatasedependent T cell inhibition by CEACAM1 adhesion molecule isoforms. Immunity 2006;25:769–81. [55] Forget G, Gregory DJ, Whitcombe LA, Olivier M. Role of host protein tyrosine phosphatase SHP-1 in Leishmania donovani-induced inhibition of nitric oxide production. Infect Immun 2006;74:6272–9. [56] Tao XH, Shen JG, Pan WL, Dong YE, Meng Q, Honn KV, et al. Significance of SHP1 and SHP-2 expression in human papillomavirus infected condyloma acuminatum and cervical cancer. Pathol Oncol Res, doi:10.1007/s12253-0089065-5, in press. [57] Witkiewicz A, Raghunath P, Wasik A, Junkins-Hopkins JM, Jones D, Zhang Q, et al. Loss of SHP-1 tyrosine phosphatase expression correlates with the advanced stages of cutaneous T-cell lymphoma. Hum Pathol 2007;38:462–7. [58] Zhang Q, Wang HY, Marzec M, Raghunath PN, Nagasawa T, Wasik MA. STAT3DNA methyltransferase 1-mediated epigenetic silencing of SHP-1 tyrosine phosphatase tumor suppressor gene in malignant T lymphocytes. Proc Natl Acad Sci USA 2005;102:6948–53.