Cells with dendritic cell morphology and immunophenotype, binuclear morphology, and immunosuppressive function in dendritic cell cultures

Cellular Immunology 272 (2011) 1–10

Contents lists available at SciVerse ScienceDirect

Cellular Immunology journal homepage: www.elsevier.com/locate/ycimm

Cells with dendritic cell morphology and immunophenotype, binuclear morphology, and immunosuppressive function in dendritic cell cultures Rong Dong a, Dale Moulding b, Nourredine Himoudi a, Stuart Adams c, Gerben Bouma b, Ayad Eddaoudi b,d, B. Piku Basu a, Sophie Derniame b, Prabhjoat Chana b,d, Andrew Duncan e, John Anderson a,f,⇑ a

Unit of Molecular Haematology and Cancer Biology, UCL Institute of Child Health, London, UK Unit of Molecular Immunology, UCL Institute of Child Health, London, UK Department of Haematology, Great Ormond Street Hospital, London, UK d Flow Cytometry Core Facility, Institute of Child Health, London, UK e Unit of Clinical and Molecular Genetics, UCL Institute of Child Health, London, UK f Department of Paediatric Oncology, Great Ormond Street Hospital, London, UK b c

a r t i c l e

i n f o

Article history: Received 23 July 2011 Accepted 22 September 2011 Available online 8 October 2011 Keywords: Dendritic cell Fusion Multiple nuclear Binuclear Tolerogenic

a b s t r a c t Culturing of human peripheral blood CD14 positive monocytes is a method for generation of dendritic cells (DCs) for experimental purposes or for use in clinical grade vaccines. When culturing human DCs in this manner for clinical vaccine production, we noticed that 5–10% of cells within the bulk culture were binuclear or multiple nuclear, but had typical dendritic cell morphology and immunophenotype. We refer to the cells as binuclear cells in dendritic cell cultures (BNiDCs). By using single cell PCR analysis of mitochondrial DNA polymorphisms we demonstrated that approximately 20–25% of cells in DC culture undergo a fusion event. Flow sorted BNiDC express low HLA-DR and IL-12p70, but high levels of IL-10. In mixed lymphocyte reactions, purified BNiDC suppressed lymphocyte proliferation. Blockade of dendritic cell-specific transmembrane protein (DC-STAMP) decreased the number of binuclear cells in DC cultures. BNiDC represent a potentially tolerogenic population within DC preparations for clinical use. Ó 2011 Elsevier Inc. All rights reserved.

1. Introduction Balancing immunity and tolerance to improve therapy for cancer, infection, autoimmune diseases, and transplantation has become a core task for immunologists. Dendritic cells (DCs) are not only crucial for the induction of primary immune responses, but also for establishing tolerance. Since the development of technologies to culture DCs in vitro, the possibility of exploiting these cells in a number of immunotherapeutic strategies has become a reality. Due to low concentrations of DCs in peripheral blood, a common method for large clinical-grade production of highly pure DCs commonly involves the harvesting of blood monocytes, and ex vivo cul-

Abbreviations: CD, cluster designation; CFSE, carboxyfluorescein diacetate succinimidyl ester; CMV, cytomegalovirus; DC, dendritic cell; DC-STAMP, dendritic cell specific transmembrane protein; GM-CSF, granulocyte–macrophage colony stimulating factor; HLA, human leukocyte antigen; IL, interleukin; MLR, mixed lymphocyte reaction; BNiDC, binuclear dendritic cell; PCR, polymerase chain reaction. ⇑ Corresponding author at: Unit of Molecular Haematology and Cancer Biology, University College London Institute of Child Health, 30 Guilford Street, London WC1N 1EH, UK. Fax: +44 207 813 8100. E-mail address: [email protected] (J. Anderson). 0008-8749/$ - see front matter Ó 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.cellimm.2011.09.012

turing in the presence of IL-4 and GM-CSF to generate immature DC [1,2]. Many clinical protocols involve the immunomagnetic positive selection of CD14 cells to isolate pure monocyte populations for DC culturing. Generating effective vaccines based on culturing dendritic cells continues to be an area of active research [3]. However, dendritic cells are heterogeneous in phenotype and function, and the relationship of artificially cultured DCs with naturally occurring cells is not completely understood [4–8]. Moreover, optimal conditions for differentiation and maturation of ex vivo generated DC to elicit desirable therapeutic immune responses, have not been well characterized [9]. For example, distinguishing between protocols that preferentially induce Th1 inducing IL-12 DC versus more tolerogenic IL-10 producing DC, is a critical question in DC vaccine immunotherapy [10,11]. Here we identify a previously undescribed population within human DC preparations derived in vitro from positively selected CD14 purified monocytes. The cells have characteristic appearances and we name them binuclear cells in DC culture (BNiDC) formed by cell fusion. BNiDC are immunophenotyped as CD11c+CD14 CD86+HLA-DRlo. BNiDC populations expressed higher levels of IL-10 following maturation stimuli, and suppressed

2

R. Dong et al. / Cellular Immunology 272 (2011) 1–10

proliferation in mixed lymphocyte reaction. They therefore represent a potentially tolerogenic population within clinical DC preparations. 2. Materials and methods 2.1. DC culture Human peripheral blood mononuclear cells (PBMCs) were isolated from buffy coat samples (National Blood Service Centre London). CD14+ cells were selected using human CD14 magnetic MicroBeads (Miltenyi Biotec). 2  106/ml fresh CD14+ cells were resuspended in X-VIVO-15 medium (BD Bioscience) containing 2–10% human AB serum, 1% penicillin–streptomycin, 2 mM L-glutamine, and supplemented with 20 ng/ml recombinant interleukin-4 (IL-4) (eBioscience) and 10 ng/ml granulocyte–macrophage colony-stimulating factor (GM-CSF) (Novartis). Immature DCs (imDCs) were used after 4 days in culture. In order to facilitate adherence to slides for microscopy, DCs were treated with 20 ng/ ml of tumor necrosis factor-a (TNF-a) (Sigma–Aldrich) for 1–5 h. 2.2. Immunocytochemistry DCs cultured for 4 or 8 days were fixed with 4% paraformaldehyde and stained with 50 lg/ml FITC–conjugated phalloidin (Sigma–Aldrich). Day 8 matured DCs were stained with CD11c, CD14, HLA-DR (BD Biosciences), and IL-10-FITC anti-human monoclonal antibodies (Bender MedSystems), then mounted following addition of DAPI stain (Vector Laboratories Ltd.). 2.3. Staining with PKH2 green and PKH26 red fluorescent markers Day 3 differentiated cells were labeled with either PKH2 green or PKH26 red fluorescent membrane stains (Sigma–Aldrich) according to the manufacturer’s instructions. Efficient labeling was confirmed by flow cytometry. PHK2 stained (green), PHK26 stained (red), and 1:1 green:red mixed cells were grown at 1  106 cells/ml in DC medium. Cells were cultured overnight in 24 well plates with glass coverslips and fixed with 4% paraformaldehyde. 2.4. SYTO-red and Hoechst 33342 nuclear stains Day 3 differentiated DCs were labeled with either Hoechst 33342 (Sigma–Aldrich) (20 lg/ml) or SYTO-Red dye (1 lM) (Molecular Probes). After 60 min of incubation at 37 °C, cells were washed and 1  106/ml of each labeled population were mixed in 1:1 proportion and cultured for an additional 20 h in 24 well plates on a glass cover slip. Slides were stained with FITC–conjugated phalloidin after fixing cells with 4% paraformaldehyde, then mounted with ProlongGold (InVitrogen) without DAPI. Images were captured using LSM 510 confocal microscopy (Zeiss) with Leica confocal software. 2.5. Combination of fluorescent in situ hybridization (FISH) with immunocytochemistry Genomic DNA was extracted from male and female PBMCs and diluted to 0.5 ng/ll. Fluorescent labeled PCR products were genotyped using an AB3130 Genetic Analyzer with Genemapper v.4 software (Applied Biosystems, Warrington, UK). 1  106 each of male and female CD14+ cells were mix-cultured in 1 ml X-VIVO15 with 10% AB serum. After 4 days, the cells were fixed with 3:1 methanol: acetic acid solution for 2 h. Following a wash with PBS, the slides were firstly stained with 50 lg/ml FITC–conjugated phalloidin for 60 min at 25 °C, then Fluorescence in situ hybridiza-

tion (FISH) was performed using a CEP X/Y DNA probe containing a Y-specific probe labeled with a green fluorochrome and an X-specific probe labeled with an orange fluorochrome in accordance with the manufacturer’s protocol (Vysis, Abbott Molecular). Briefly, 10 ll of probe was added to the centre of each slide, and a coverslip was added. The slides were denatured on a hotplate for 1 min at 77 °C and hybridized at 42 °C for 30 min. After hybridization, the slides were washed with 2XSSC/ 0.05% (v/v) Tween-20 for 20 s. When the slides were completely dry, 25 ll DAPI and a coverslip were added. Cells were analyzed using a Zeiss fluorescence microscope, and images were captured using Quips software (Vysis).

2.6. Single cell PCR and mitochondrial DNA typing Sequence variation of mitochondrial DNA was identified using PCR and sequencing of the Control region of the mitochondrial genome. The PCR primers used were forward AACACATCTCTGCCAAACC and reverse GGATGCTTGCATGTGTAATC (336–706 bp). Products were sequenced using Big Dye v3.1 kit, run on an AB3130 Genetic Analyzer, and analyzed using Sequencing Analysis v5.2 (Applied Biosystems). CD14+ cells with (CA)4 or (CA)5 sequences were co-cultured in equal proportion. Single cells at days 4 or 8 were flow sorted into 10 ll water in the wells of an optical 96-well plate. The control group contained separately cultured cells with (CA)4 or (CA)5 and were mixed together immediately before sorting. Single cell PCR for mtDNA was carried out incorporating a 6-carboxy-fluorescine labeled forward primer. HotStarTaq DNA Polymerase was used following the guidelines for single-cell PCR given in the HotStarTaq PCR Handbook (Qiagen). Briefly, the PCR mix was prepared in a final volume of 30 ll containing 1 PCR buffer, 3.0 U HotStarTaq polymerase, 200 lM of each dNTP, 0.2 lM of each primer, and a final MgCl2 concentration of 2.5 mM. PCR was performed using an initial preheating step of 5 min at 95 °C followed by two cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s, two cycles at 95 °C for 30 s, 58 °C for 30 s, and 72 °C for 30 s, 36 cycles at 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 30 s, with a final extension at 72 °C for 10 min. Fluorescently labeled PCR products were diluted 1:10 with water and 1 ll was added to a loading mix containing 7.75 ll hi-di formamide and 0.25 ll GeneScan-500 ROX size standard (both Applied Biosystems). PCR products were run on an AB3130 Genetic Analyzer and analyzed using Genemapper v.4 software (Applied Biosystems).

2.7. Flow cytometry analysis and sorting Day8 matured DCs were detached by gentle scraping and washing, and stained with monoclonal human antibodies (mAbs) to CD11c-PE, CD14-FITC, CD1a-FITC, CD1c-FITC, CD11b-FITC, CD303FITC, CD44-FITC, CD47-FITC, HLA-DR-FITC, CD83-FITC (BD Biosciences), CD86-PE (eBioscience), and DC-STAMP (Aviva Systems Biology). The appropriate isotypes were used in controls. For DNA content, cell pellets were collected by centrifugation and fixed in ethanol for 1 h at 4 °C, then stained with 5 lg/ml of propidium iodide (PI) for 15 min at 4 °C after treating with 100 lg/ml RNase A. DNA content was measured using peak verses area plots in the 557 nm fluorescence Channel using a CyAn Flow cytometer (Beckman Coulter). The expression of HLA-DR and IL-10 in multinuclear cells was measured based on gating populations of propidium iodide defined DNA content using a LSRII analyser flow cytometer (Becton Dickinson). Data was analyzed using Flowjo software (Tree Star). For sorting of binuclear DCs, day 6 matured DCs were stained with 5 l/ml Hoechst 33342 and were sorted using a MOFLO XDP (Beckman Coulter) with SUMMIT software.

R. Dong et al. / Cellular Immunology 272 (2011) 1–10

2.8. CFSE proliferation assay Allogenic CD14 negative cells were obtained as the negative fraction from CD14 magnetic bead purification (Miltenyi) and labeled with 5-(and 6-) carboxyfluorescein diacetate succinimidyl ester (CFSE; Molecular Probes, Invitrogen Ltd) at a concentration of 5 mM for 10 min in 1% BSA containing PBS at 37 °C. The cells were washed several times with serum containing media, and then tested for cell viability by Trypan blue staining. 1  106 CFSE-labeled CD14 negative cells were cultured alone, or co-cultured with 1  105 sorted DCs in 1 ml supplemented RPMI media for 3–6 days. Control groups were sorted single nucleus DCs. In 6 day cultures, 50 iU/ml IL2 was added on day 3. 2.9. CMV specific interferon gamma secretion assay Virus specific CTL were generated from a CMV positive donor using a CMV lysate as antigen (CMV lysate for complement fixation test, Siemens, using the manufacturer’s recommended dilutions). Stimulation for 1 week to generate the CTL line was performed as previously described [12]. Autologous DC were generated as above and pulsed with CMV lysate prior to FACS sorting for conventional DC and BNiDC as described above. Pulsed DC were added to CMV T cells for 7 h prior to measurement of CMV specific interferon gamma staining, determined by flow cytometry as previously described [13]. 2.10. Cytokine detection RayBio Human Cytokine Antibody Array 3Map (RayBiotech Inc) contains antibodies to 42 human cytokines, each spotted in duplicate. The supernatants of cell culture were collected and applied onto membranes at 4 °C for 16 h. Following binding, the membranes were washed and incubated with biotin-conjugated anticytokine antibodies then with horseradish peroxidise-conjugated streptavidin according to the manufacturer’s instructions. IL-10 and IL-12 production were quantified in culture supernatant using a Quantakine ELISA kit (R&D Systems, Minneapolis). Interactions were performed in duplicate wells, and triplicate readings of each supernatant were made. The Interferon gamma values were obtained by densitometric analysis of autoradiographs with subtraction of background. 2.11. Fusion inhibition Cultured cells were treated with 5 lg/ml anti-human DCSTAMP polyclonal antibody (AVIVA) on days 3 and 5. Control groups were rabbit polyclonal IgG. DNA content was measured by propidium iodide staining and flow cytometry. 2.12. Statistical analyses Data were summarized as means ± SD and compared by the two-tailed t-test. Differences with a p value of <0.05 were considered statistically significant. 3. Results and discussion 3.1. Dendritic cells derived in culture from human blood CD14 cells contain a binuclear population When generating clinical grade DC from CD14 purified peripheral blood monocytes we noted a consistent decrease in the number of dendritic cells compared with the initial monocyte numbers, despite relative absence of cell death throughout standard 7 day

3

culturing (range 4–14% annexin V positive; data not shown). We hypothesized that cell fusion might be occurring during monocyte to dendritic cell differentiation to account for this finding. To test this fusion hypothesis we analyzed DC cultures by confocal microscopy. DC were generated following CD14 antibody coated magnetic bead selection, and we observed consistently greater than 95% purity for CD14 in cells coming off the column, whilst cultured DC were greater than 95% positive for CD11c (Supplementary Fig. 1A). Following phalloidin stain to detect F-Actin, we observed cells containing between 2 and 7 nuclei, which represented between 5% and 10% of the total population, and had typical dendritic morphology. Detailed analysis of the confocal images revealed three different abnormal appearances. One population showed a bilobed nucleus in which the two lobes were connected by a thin strand of DAPI positive nuclear material (Fig. 1A). A second appearance was of single cells with two nuclei of normal size and morphology (Fig. 1B and C and corresponding supplementary rotational images on line). We term these cells binuclear cells in dendritic cell cultures (BNiDC). Finally, occasional rare cells had typical dendritic appearances but contained three or more normal sized nuclei; we term these multinuclear cells (Fig. 1D). The BNiDC cells, which were observed at up to 13 days in culture, stained with CD11c with the same intensity as mononuclear DC by confocal microscopy (Fig. 1E) and were negative for CD14 (Fig. 1F). Moreover flow cytometric analysis of the bulk cultures demonstrated uniform positive staining with CD11c as well as a marker of mature DC (CD86), and negative staining for CD14 (a phenotype of CD11c+CD86+HLA-DRloCD14 Supplementary Fig. 1B). The bulk cultures stained homogeneously positively for CD1c and showed no staining for CD1a, CD11b, or CD303 (data not shown). Time course experiments showed stable appearance of the DC phenotype and complete loss of CD14 staining by day 2 in culture (data not shown). Interestingly, binuclear cells were also seen within CD11c staining DC cultures at day 6 in the absence of IL-4 and/or GM-CSF (Supplementary Fig. 1C). Therefore the binuclear cells expressed markers characteristic of dendritic cells, existed within DC cultures and we refer to them as binuclear cells in dendritic cell culture (BNiDC). To enumerate the BNiDC, we stained DC cultures at different time points with propidium iodide and gated on individual mononuclear populations as defined by the linear versus area profile (Fig. 1G). We confirmed the validity of using propidium iodide staining to delineate the populations by flow sorting the single nuclear population (approximately 100 cells counted and were all single nuclear or had bilobed single nuclei as shown in Fig. 1A) and the multiple nuclear population (4 out of 4 cells in a cytospin were multiple nuclear). Summing of several independent experiments demonstrated that BNiDC start to appear within the first day of culture and peak by day 4 at between 5% and 10% of the total population (Fig. 1H). There were approximately five times as many binuclear cells compared with cells with three or more nuclei. 3.2. Binuclear cells in DC culture arise by a cell fusion event, which can be associated with subsequent nuclear extrusion We hypothesized that the binuclear appearance could be caused by cell fusion or by phagocytosis of apoptotic cells, or be associated with cell division. To investigate the latter possibility we stained DC cultures with BrdU but saw no evidence of cell division compared with a control T cell line (Supplementary Fig. 2). Moreover the Propidium iodide linear plots showed no evidence for single nuclei with diploid DNA content (Fig. 1G). We looked for evidence of apoptosis or necrosis during DC culture, but only low levels of annexin V staining were seen (mean percent positivity between days 2 and 7 in culture of 4.9 with SD 2.9). Moreover, there are structural differences between cell–cell fusion and

4

R. Dong et al. / Cellular Immunology 272 (2011) 1–10

Fig. 1. Dendritic cells derived from human blood CD14+ cells contain a multinuclear population. (A–D) Representative confocal microscopy images of bulk culture day 4 immature dendritic cells stained with phalloidin (F-Actin) and DAPI. In A–C, confocal images rotated through 90° and Z-sections at 0.4 lm intervals are shown to the right of the main image. (A) Example of bilobed single nucleus; (B and C) examples of binuclear cell; (D) examples of multiple nuclear cells. (E) Anti-human CD11c and DAPI stains. (F) Anti-human CD14 and DAPI stain: CD14 positive cells were rare (less than 1%) and were always single nuclear (scale bar in A–F = 20 lm). Images in figures A–F are representative of approximately ten independent experiments from different donors. (G) Representative flow cytometry analysis using propidium iodide area and linear plots, of days 0 and 4 IL-4/GM-CSF dendritic cell cultures from CD14 positive monocytes showing the emergence of cells with increased DNA content. 2N represents a diploid nucleus, 2  2N depicts a cell with apparent normal peak DNA signal but doubled nuclear area consistent with double nuclear content. Percentages of putative multiple nuclear cells are shown in the lower image. (H) Summary of data from five independent experiments from different donors. Percentage multinuclear cells were calculated by subtracting the background staining at 0 h, from each gate. There was no significant difference from 8 h to day 7. Error bars = mean ± SD.

phagocytosis of apoptotic cells; specifically we did not observe the small high density irregular nucleus of apoptotic cells within the BNiDC, which all had uniformly sized nuclei, and the F-Actin stain did not demonstrate any characteristic packaging envelope around apoptotic fragments. Evidence in favor of the fusion hypothesis was obtained by differentially labeling, with distinguishable fluorescent dyes, the nucleus or cell membrane of day 3 DC cultures from a single donor, then mixing cells prior to culturing. Membrane staining patterns after 24 h co-culture disclosed single cells with 2 nuclei and a mixed red and green cytoplasmic appearance (Fig. 2A). Similarly, differential labeling of nuclei of cells from a single donor, with Hoechst 33342 (blue) or SYTORed (which labels both DNA and RNA with a red color) showed individual cells containing nuclei from both labeled populations (Fig. 2B). Further evidence of fusion was seen with allogeneic monocytes from male and female donors, where fluorescent in situ hybridisation (FISH) showed both male and female intact nuclei within the same cell (Fig. 2C). In order both to provide further evidence of cell fusion, and to calculate the number of cells that had undergone fusion, we made use of mitochondrial DNA polymorphism analysis. Here the principle is that cytoplasmic mixing following fusion will result in mix-

ing of mitochondria from two separate donors, within a single fused cell. We mixed together CD14 purified monocytes from two donors informative for a CA repeat mitochondrial polymorphism. From days 4 and 8 DC cultures of this mixed population, we sorted single cells by flow cytometry. Single cell PCR to amplify the polymorphic region was successfully performed on 74 sorted single cells derived from separate DC cultures from the two mitochondrial DNA-typed donors, which had been mixed together immediately prior to sorting. All 74 of these control PCR reactions showed a single polymorphic variant demonstrating that there had been accurate single cell sorting, no cell fusions, and no clumping of cells. However, in the co-cultures analyzed, on both days 4 and 8, approximately 15% of mixed cultured cells showed both polymorphic variants in approximately equal proportion, consistent with cell fusion (Fig. 2D). Taken together, the data is most consistent with cell fusion occurring in a significant proportion of dendritic cells in IL4+ GM-CSF culture conditions. Based on this incidence of heteroplasmy, and assuming that fusion events between allogeneic cells and autologous cells occur at the same rate in an allogeneic culture, we estimate that the true number of cells having undergone fusion is in the order of 25%. As this is somewhat higher than the proportion of binuclear or

5

R. Dong et al. / Cellular Immunology 272 (2011) 1–10

D

G

4xCA

G 4xCA

A

5xCA G

G

5xCA

Heteroplasmy

Day 4

B

Day 8

Control

4xCA

38

41

38

5xCA

31

35

36

Heteroplasmy

13 (15.9%)

13 (14.6%)

0 (0%)

E

F

C G

Fig. 2. Multinuclear dendritic cells arise from a cell–cell fusion event. (A) An example of a binuclear cell observed in co-culture of DCs differentially labeled by PKH26 (red) or PKH2 (green) cell membrane stains. Nuclear stain is DAPI. (B) An example of a multiple nuclear cell observed in a co-culture of cells with the differential nuclear stains Hoechst (blue) and SytoRed. Green depicts phalloidin F-Actin staining. (C) An example of a binuclear cell in DC culture containing both a male and a female nucleus following co-culture of male and female CD14+ cells, shown by FISH. X chromosome probe shown in red, Y in blue. Phalloidin is staining F-Actin. (D) The measurement of percentage of binuclear cells by mitochondrial DNA polymorphism analysis in flow sorted single cells. Left: sequence of mtDNA polymorphism region of two informative homoplasmic donors. Right: typical appearance of mitochondrial DNA heteroplasmy in a fusion cell. The table shows total number of homoplasmic and heteroplasmic cells in co-cultures and control cultures. (E–G) Representative appearances consistent with nuclear loss in fusion cells. In (E) the tail of one DC had fused with the body of another DC but leading heads remain separated. The cell contained one nucleus but showed an area of reduced phalloidin stain consistent with previous nuclear extrusion. In (F), an extracytoplasmic nucleus in shown with additional images rotated through 90° and Z-sections at 0.4 lm intervals shown. (G) Representative appearances of fused cells following co-culture of cells with Hoechst or SYTORed staining. Extracellular nucleus (arrowed) and intracellular SYTORed RNA were seen. In all images the size marker is 20 lm. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

multinuclear cells demonstrated by PI staining (5–10% Fig. 1H), we reasoned that fusion might be a dynamic process involving fused binuclear cells either undergoing further fusion to become giant cells, or losing nuclei. This concept was supported by observation, by confocal microscopy, of occasional cells showing regions of cytoplasm deficient in F-Actin, with or without a nearby extracellular nucleus, consistent with a nuclear loss (Fig. 2E and F and corresponding rotational images of Fig. 2F online). This could be confirmed as loss of an intact nucleus by differentially labeling a population of CD14 monocytes with SYTORed or Hoechst prior to culturing. Interestingly we observed, on occasion, a Hoechst stained nucleus and a region of red RNA stain, and associated with an extruded red nucleus (Fig. 2G). Therefore there is confocal microscopic evidence of extrusion of nuclei from a proportion of cells in DC cultures. Normal somatic cell fusion is a rare event, and the function of fusion cells is not clear. For example, macrophages, which are involved in both clearance of foreign invaders and antigen presentation, can form multinuclear giant cells, which most commonly appear in chronic infection but are of uncertain functional significance. Although fusion of tissue DC to generate multinucleate giant

cells has previously been described [14], to our knowledge this is the first description of fusion of cells differentiating from monocytes in DC culture. Monocytes are capable of differentiating into macrophages, osteoclasts and dendritic cells [15,16]. Osteoclasts have a characteristic multinuclear morphology, and macrophages undergo fusion, for example in regions of chronic inflammation, to produce multinucleate giant cells. However, the culture conditions required to generate osteoclasts in vitro (M-CSF plus IL-4 [16] or M-CSF plus RANKL [17,18]), or to generate macrophages in vitro (M-CSF alone) [16] are different to the standard DC conditions we used (GM-CSF and IL-4). Nevertheless, we cannot exclude the possibility that the rare multinucleate cells observed represent macrophage-like multinucleate giant cells. 3.3. Binuclear cells in DC cultures express IL-10 and low levels of HLADR When immunophenotyping the bulk DC preparations by flow cytometry, following TNF-a maturation, we noticed that, whereas there was consistently uniform staining of CD11c and CD86, there was a somewhat more heterogeneous HLA-DR staining pattern

6

R. Dong et al. / Cellular Immunology 272 (2011) 1–10

(Supplementary Fig. 1B). Interestingly, by confocal microscopy we observed that binuclear cells typically had weak HLA-DR staining. In contrast, only about 20% of conventional DC showed weak HLADR staining (Fig. 3A left panel). We confirmed this finding at the population level by flow cytometry by gating on the binuclear population following PI staining (Fig. 3A right panel). In contrast, CD11c and CD86 expression appeared identical in the PI gated BNiDC and conventional DC populations (Supplementary Fig. 3). We next considered whether the BNiDC, in common with other HLA-DRlo populations, might have an immunosuppressive phenotype. TH-1-polarizing mature DC secrete IL-12p70, whereas tolerogenic immature DC are characterized by IL-10 secretion [19–21]. We therefore analyzed IL-10 production in BNiDC within bulk DC cultures following addition of TNF-a, by confocal microscopy using an antibody detecting intracellular IL-10. We noted bright IL-10 staining in about 40% of the binuclear cells compared with weak/ background staining in the majority of DC (Fig. 3B left panel). It is known that IL-10 can stimulate further IL-10 production in

A

immature DC by signaling through the IL-10 receptor in an autocrine or paracrine mechanism [21]. Consistent with this model, in bulk DC cultures about 40% of BNiDC were IL-10 positive but we also noted regions of more IL-10 positive cells with an immature DC phenotype and an over-representation of BNiDCs within these regions (Fig. 3C). Similarly by combining IL-10 antibody and PI staining of DC in culture we showed a significantly higher IL-10 expression in the binuclear compared with the single nuclear gated population (Fig. 3B right panels). We also compared IL-10 production in flow-sorted HLA-DRhi and HLA-DRlo populations to which TNF-a was added for 4 h. Whereas the HLA-DRhi cells produced undetectable IL-10 alone or in co-culture with allogeneic T cells, the HLA-DRlo population, enriched for BNiDC (20%), secreted significantly more IL-10 (Fig. 3D). Taken together these data point to the failure of upregulation of HLA-DR and continued production of IL-10 in BNiDC, and suggest that these cells, contaminating IL4+ GM-CSF CD14-derived DC preparations, might confer a suppressor phenotype.

BNiDC

HLA-DR

HLA-DR. p=0.02 BNiDC

6

PI Linear

gating

B

Ratio of means

DC

SNDC

HLA-DR

3

0 SN

BNiDC

PI Area

IL-10

BNDC

IL10. p=0.031 2.4 BNiDC

Ratio of means

DC

gating DC

1.6

0.8

0

D IL-10

F

DRhi 0% BNiDC Sort

DR lo 20% BNiDC

HLA-DR lo

BNiDC

IL-10

IL10 secretion (pg/ml)

C

DC

***P =0.001 50

***P =0.002

40 30 20 10 0

DC

WT

Allo T cells

-

DRHI

DRLO

-

-

WT

DRHI

+

+

DRLO +

Fig. 3. BNiDC are HLA-DR and express interleukin 10. (A and B) Demonstration of HLA-DR (A) and IL-10 (B) expression in BNiDC by confocal microcopy (left) and flow cytometry (right). Confocal staining is with FITC directly conjugated HLA-DR (A) and IL-10 (B) antibodies and DAPI nuclear stain. Representative HLA-DRlo double nuclear cells are arrowed in (A). All size markers are 20 lm. The gating strategy of BNiDC and conventional DC is shown. In the histograms the dotted line represents an isototpe control antibody. A small subpopulation of bright IL-10 staining cells was found only in the BNiDC gate (arrowed). (C) Confocal microscopy with DAPI stain and an intracellular IL-10 staining antibody to demonstrate a region of high IL-10 expressing cells in a DC bulk culture. Several double nuclear cells (arrowed) were seen within the island of bright IL-10 staining. (D) Gating strategy for sorting HLA-DR high and low expressing cells, and representative confocal images of the HLA-DRhi and HLA-DRlo sorted populations with enumeration of relative numbers of BNiDC. Right panel: allogeneic MLR in which allogeneic T cells were added or not to sorted DRhi and DRlo, respectively. Scale bars for all confocal images = 20 lm.

7

R. Dong et al. / Cellular Immunology 272 (2011) 1–10

3.4. Binuclear cells in DC cultures are functionally immunosuppressive To perform functional studies on BNiDC we had first to validate a method for the purification of viable cells, based on nuclear content. We made use of Hoechst dye that stains viable cells without the need for membrane permeabilisation, and assessed whether the linear versus area plots could accurately identify single and multiple nuclear populations, for separation by flow sorting. Morphological analysis of cytospins of sorted cells showed 76% (13/17) of cells in the BNiDC gate to have multiple-nuclear morphology whereas 100% (20/20) of cells within the single-nucleus gate showed single nuclear morphology (Fig. 4A). Therefore, flow sorting based on distribution, in linear versus area plots of Hoechst stained cells, is able to enrich for the BNiDC population. We next analyzed the cytokine profile of mixed lymphocyte reaction cultures in which allogeneic CD14-negative cells were co-cultured with flow sorted BNiDC or conventional DC. High levels of IL-12 were observed in the co-culture with DC, but with BNiDC no increase in IL-12 was observed compared with PBMC alone (Fig. 4B). Moreover, whereas DC did not produce greater than background IL-10 when added to the MLR, significantly greater amounts were produced in the BNiDC MLR (Fig. 4C). We measured relative interferon gamma secretion in the respective MLRs using a chemokine antibody array and found approximately 6-fold reduced secretion in the BNiDC containing MLR (Fig. 4D). We went on to analyse, by CFSE dilution assay, the differential ability of DC populations enriched for or deficient in BNiDC by flow sorting, to stimulate allogeneic T cell proliferation. We performed a 6 day proliferation assay adding low dose IL-2 to promote

lymphocyte survival and induce moderate proliferation. We titrated increasing amounts of sorted DC enriched for BNiDC into a mixed lymphocyte culture containing constant amounts of flow sorted pure single nuclear DC. Whereas sorted conventional DC stimulated the proliferation of lymphocytes to the same degree as unsorted dendritic cells, addition of increasing numbers of the BNiDC enriched population inhibited the proliferation. Indeed mixing equal numbers of BNiDC and conventional DC resulted in the basal levels of proliferation seen with no DC (Fig. 5A). Further evidence of this suppressor effect was obtained in an independent experiment by titrating increasing numbers of either the FACS enriched populations of BNiDC or single nuclear DC with allogeneic responder PBMC in low dose IL-2. Whereas adding conventional DC stimulated PBMC proliferation, increasing numbers of DC enriched for BNiDC completely suppressed the low level basal proliferation induced by IL-2 (Fig. 5B). Therefore enriching standard DC cultures for BNiDC isolates a population capable of inhibiting an allogeneic mixed lymphocyte reaction. We also investigated the effect of BNiDC on an autologous antigen specific T cell response by analysing the differential effect of FACS sorted BNiDC and conventional DC on a 1 week culture of CMV specific T cells. By pulsing DC with the same CMV lysate used to generate the T cell line we were able to show that whereas conventional DC could stimulate a robust interferon gamma response (0.89%), antigen pulsed BNiDC only marginally increased interferon gamma response above background (Supplementary Fig. 4). We hypothesize that fusion might be a mechanism of functional transformation of monocytes to a DC subtype with a distinct function. In support of this hypothesis, we have demonstrated that

CD11c stain

A 76% binuclear 24% single nucleus

BNDC

Sort DC

Hoechst Linear

SS FS

Hoechst Area

C IL10 pg/ml

18 0

D

80

P=0.007

40 0

PBMC alone

PBMC + DC

PBMC + BNiDC

P=0.031

PBMC alone

PBMC + DC

PBMC + BNiDC

Interferon gamma Relative expression

B 36 IL12 pg/ml

100% single nucleus

P=0.005

PBMC + DC

PBMC + BNiDC

Fig. 4. Sorted multiple nuclear dendritic cells induce immunosuppressive cytokines. (A) Gating strategy for isolation of viable BNiDC on the basis of Hoechst staining. 76% of cells in the BNiDC gate were multiple nuclear morphologically but there were no multiple nuclear cells seen in the conventional DC gate. (B and C) ELISA to measure IL12 and IL-10, respectively in the supernatants of allogeneic MLRs using either sorted conventional DC or sorted enriched BNiDC. (D) Interferon gamma measured in supernatant of MLRs from B and C, measured by cytokine antibody array. Error bars = mean ± SD of triplicate estimates.

8

R. Dong et al. / Cellular Immunology 272 (2011) 1–10

Fig. 5. Multiple nuclear dendritic cells are functionally immunosuppressive. (A) 6 day allogeneic MLR in the presence of low dose IL2 (50 iU/ml) which promoted T cell survival and induced a degree of non-specific T cell proliferation. 1  106 CFSE positive allogeneic PBMC were added to each well, and the indicated numbers of DC were added. (B) 6 day allogeneic MLR in the presence of 50 iU/ml IL-2. Populations of DC either enriched for BNiDC or depleted for BNiDC were added to allogeneic CFSE labeled allogeneic PBMC in the indicated ratios. The range of percentages in the proliferation gate is derived from two independent analyses of the same experiment.

BNiDC express IL-10 and fail to upregulate HLA-DR surface expression following TNF-a maturation typical of conventional mature dendritic cells. Moreover, in vitro BNiDC are dominantly immunosuppressive in mixed lymphocyte reaction. The question of whether fusion is a cause or effect of the suppressor phenotype is fundamental. The observation that BNiDC are observed within a few hours of culture suggests that cell fusion might be integral to DC differentiation from monocytes at least in a subpopulation of nascent DCs. Hence identifying the molecules that control fusion in BNiDC generation will be important for determining whether the monocytes or early DCs express the fusogenic molecules. 3.5. DC-STAMP is involved in cell fusion events during in vitro dendritic cell differentiation Tissue macrophages, derived from bone marrow, are known to form multinuclear giant cells in health and disease. Both CD44 and CD47 have been implicated in macrophage fusion [22–24]. In differentiating DC cultures, both CD44 and CD47 showed heterogeneity in staining, and the staining pattern in BNiDC did not differ from single nuclear DC (data not shown). We therefore considered it less likely that CD44 or CD47 played a functional role in the fusion process during DC culture, and decided to investigate instead DC-STAMP. DC-STAMP has been implicated in the fusion of osteoclasts and foreign body giant cells [25,26], and mice deficient for

DC-STAMP develop autoimmune diseases suggesting a functional role of both DC-STAMP and cell fusion in development of tolerance [27]. We therefore considered the possibility that DC-STAMP might promote fusion of dendritic cells during differentiation from monocytes, and we hypothesized that the relative absence of tolerogenic fused DC could contribute to the autoimmunity seen in DCSTAMP deficient mice [27]. To test this, we stained DCs with an anti-human DC-STAMP antibody and showed preferential maintenance of expression in days 4 and 8 BNiDC in contrast with single nuclear cells, which lost DC-STAMP expression during culture (Fig. 6A). To test for function we added a DC-STAMP neutralizing antibody on days 3 and 5 of culture and counted the percentage of binuclear cells on subsequent days by PI staining. Whereas the proportion of binuclear cells rose in control cultures, DC-STAMP blockade resulted in a significant reduction of binuclear cells (Fig. 6B). DC-STAMP blockade did not however significantly alter the immunophenotype of the bulk DC culture (Fig. 6C). Therefore DC-STAMP appears to play a functional role in cell fusion during human DC differentiation and might be important in maintaining tolerogenic DC. Hence, of candidate molecules for regulators of the fusion mechanism we have shown that DC-STAMP plays a significant functional role, and the preferential expression of DC-STAMP in BNiDC compared with conventional DC in day 4 and 8 cultures is consistent with fusion occurring in the DC-STAMP population of

9

R. Dong et al. / Cellular Immunology 272 (2011) 1–10

A

B 14

Percentage BNiDC

ISO (n = 4)

*P =0.042

*P =0.031

*P =0.046

DC-STAMP (n = 4)

7

Relative expression (MFI)

C 300 Normal DC-STAMP

200

Iso

100

0 CD11c

CD14

CD86

HLA-DR

0

D3

D4

D5

D6

D7

Fig. 6. DC-STAMP is involved in cell fusion events during in vitro dendritic cell differentiation. (A) Confocal image of bulk DC culture stained with an antibody specific for DCSTAMP and showing bright staining in a representative multiple nuclear cell. Scale bar is 20 lm. (B) Representation of percentage BNiDC as determined by propidium iodide staining and flow cytometry, in bulk DC cultures grown in the presence or absence of a DC-STAMP specific antagonistic antibody. Data are the means of three independent experiments. Error bar = mean ± SEM. (C) Immunophenotype of bulk DC cultures grown in the presence of DC-STAMP blocking antibody or isotype control. Data are derived from one representative experiment.

monocytes. This finding is also consistent with the previously identified role for DC-STAMP in the generation of immuno-regulatory cells that suppress autoimmune disease. However further work to assess the functional involvement of other candidate fusogenic molecules (CD44, CD47, thrombospondin) is essential to dissect the pathways. It will be interesting to determine whether BNiDC can be found in naturally occurring blood borne or tissue dendritic cell populations, and whether naturally occurring BNiDC contribute significantly to the regulatory DC compartment in physiology or disease. Irrespective of an in vivo role, the presence of BNiDC within cultured DC preparations, and their high level of IL-10 expression, has implications for assessment of quality and function of DC based vaccines. It will be important to determine whether BNiDC have antigen presenting functions in their own right, and then to test the hypothesis that they represent a form of regulatory DC capable of inhibiting antigen stimulation by conventional DC within the DC preparation. It will be important to demonstrate whether inhibiting fusion results in a more immunostimulatory DC preparation. This could be achieved through use of inhibitors of fusion, or comparison of different cytokine cocktails. Greater understanding of the processes resulting in generation of BNiDC in DC preparations will first be required. Many questions are posed by the discovery of BNiDC within these DC cultures. It will be important to confirm the incidence of true fusion cells in the absence of IL-4 and/or GM-CSF in the monocyte culture conditions, and to determine whether these cells have a dendritic cell phenotype. Also important will be to determine the mechanism of functional immunosuppression of binuclear or multinuclear cells by analyzing other candidate suppressive mechanisms (TGF-b, IDO), to determine whether direct cell contact is required for inhibition of lymphocyte proliferation, and whether inhibition is secondary to the induction of other regulatory cells such as FOXP3+CD25+CD4+ T cells. Conflict of interest The authors declare no financial or commercial conflict of interest.

Acknowledgments Grant support from Cancer Research UK C7262/A7910 and with additional Grant support from Research in Childhood Cancer (RICC). RD planned and executed experiments and wrote the manuscript, SA and SD designed and performed the single cell PCR, DM, and GB performed confocal microscopy, AE and PC did flow sorting, SD analyzed CMV responses, NH and PB performed MLR on sorted cells, JA devised experiments and wrote the manuscript. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.cellimm.2011.09.012. References [1] R.M. Steinman, J. Banchereau, Taking dendritic cells into medicine, Nature 449 (2007) 419–426. [2] F.O. Nestle, S. Alijagic, M. Gilliet, Y. Sun, S. Grabbe, R. Dummer, G. Burg, D. Schadendorf, Vaccination of melanoma patients with peptide- or tumor lysatepulsed dendritic cells, Nat. Med. 4 (1998) 328–332. [3] C.J. Melief, Cancer immunotherapy by dendritic cells, Immunity 29 (2008) 372–383. [4] K.P. MacDonald, D.J. Munster, G.J. Clark, A. Dzionek, J. Schmitz, D.N. Hart, Characterization of human blood dendritic cell subsets, Blood 100 (2002) 4512–4520. [5] M. Cella, D. Jarrossay, F. Facchetti, O. Alebardi, H. Nakajima, A. Lanzavecchia, M. Colonna, Plasmacytoid monocytes migrate to inflamed lymph nodes and produce large amounts of type I interferon, Nat. Med. 5 (1999) 919–923. [6] A. Dzionek, A. Fuchs, P. Schmidt, S. Cremer, M. Zysk, S. Miltenyi, D.W. Buck, J. Schmitz, BDCA-2, BDCA-3, and BDCA-4: three markers for distinct subsets of dendritic cells in human peripheral blood, J. Immunol. 165 (2000) 6037–6046. [7] Q. Huang, D. Liu, P. Majewski, L.C. Schulte, J.M. Korn, R.A. Young, E.S. Lander, N. Hacohen, The plasticity of dendritic cell responses to pathogens and their components, Science 294 (2001) 870–875. [8] Y.J. Liu, H. Kanzler, V. Soumelis, M. Gilliet, Dendritic cell lineage, plasticity and cross-regulation, Nat. Immunol. 2 (2001) 585–589. [9] C.G. Figdor, I.J de Vries, W.J. Lesterhuis, C.J. Melief, Dendritic cell immunotherapy: mapping the way, Nat. Med. 10 (2004) 475–480. [10] R.M. Steinman, D. Hawiger, M.C. Nussenzweig, Tolerogenic dendritic cells, Annu. Rev. Immunol. 21 (2003) 685–711. [11] M.O. Li, R.A. Flavell, Contextual regulation of inflammation: a duet by transforming growth factor-beta and interleukin-10, Immunity 28 (2008) 468–476.

10

R. Dong et al. / Cellular Immunology 272 (2011) 1–10

[12] G. Rauser, H. Einsele, C. Sinzger, D. Wernet, G. Kuntz, M. Assenmacher, J.D. Campbell, M.S. Topp, Rapid generation of combined CMV-specific CD4+ and CD8+ T-cell lines for adoptive transfer into recipients of allogeneic stem cell transplants, Blood 103 (2004) 3565–3572. [13] I. Chatziandreou, K.C. Gilmour, A.M. McNicol, M. Costabile, J. Sinclair, D. Cubitt, J.D. Campbell, C. Kinnon, W. Qasim, H.B. Gaspar, Capture and generation of adenovirus specific T cells for adoptive immunotherapy, Br. J. Haematol. 136 (2007) 117–126. [14] F. Coury, N. Annels, A. Rivollier, S. Olsson, A. Santoro, C. Speziani, O. Azocar, M. Flacher, S. Djebali, J. Tebib, M. Brytting, R.M. Egeler, C. Rabourdin-Combe, J.I. Henter, M. Arico, C. Delprat, Langerhans cell histiocytosis reveals a new IL17A-dependent pathway of dendritic cell fusion, Nat. Med. 14 (2008) 81–87. [15] T. Miyamoto, O. Ohneda, F. Arai, K. Iwamoto, S. Okada, K. Takagi, D.M. Anderson, T. Suda, Bifurcation of osteoclasts and dendritic cells from common progenitors, Blood 98 (2001) 2544–2554. [16] K.S. Akagawa, N. Takasuka, Y. Nozaki, I. Komuro, M. Azuma, M. Ueda, M. Naito, K. Takahashi, Generation of CD1+RelB+ dendritic cells and tartrate-resistant acid phosphatase-positive osteoclast-like multinucleated giant cells from human monocytes, Blood 88 (1996) 4029–4039. [17] Y.Y. Kong, H. Yoshida, I. Sarosi, H.L. Tan, E. Timms, C. Capparelli, S. Morony, A.J. Oliveira-dos-Santos, G. Van, A. Itie, W. Khoo, A. Wakeham, C.R. Dunstan, D.L. Lacey, T.W. Mak, W.J. Boyle, J.M. Penninger, OPGL is a key regulator of osteoclastogenesis, lymphocyte development and lymph-node organogenesis, Nature 397 (1999) 315–323. [18] H. Yasuda, N. Shima, N. Nakagawa, K. Yamaguchi, M. Kinosaki, S. Mochizuki, A. Tomoyasu, K. Yano, M. Goto, A. Murakami, E. Tsuda, T. Morinaga, K. Higashio, N. Udagawa, N. Takahashi, T. Suda, Osteoclast differentiation factor is a ligand for osteoprotegerin/osteoclastogenesis-inhibitory factor and is identical to TRANCE/RANKL, Proc. Natl. Acad. Sci. USA 95 (1998) 3597–3602.

[19] B. Almand, J.R. Resser, B. Lindman, S. Nadaf, J.I. Clark, E.D. Kwon, D.P. Carbone, D.I. Gabrilovich, Clinical significance of defective dendritic cell differentiation in cancer, Clin. Cancer Res. 6 (2000) 1755–1766. [20] S. Rutella, S. Danese, G. Leone, Tolerogenic dendritic cells: cytokine modulation comes of age, Blood 108 (2006) 1435–1440. [21] S. Corinti, C. Albanesi, A. la Sala, S. Pastore, G. Girolomoni, Regulatory activity of autocrine IL-10 on dendritic cell functions, J. Immunol. 166 (2001) 4312– 4318. [22] W. Cui, J.Z. Ke, Q. Zhang, H.Z. Ke, C. Chalouni, A. Vignery, The intracellular domain of CD44 promotes the fusion of macrophages, Blood 107 (2006) 796– 805. [23] X. Han, H. Sterling, Y. Chen, C. Saginario, E.J. Brown, W.A. Frazier, F.P. Lindberg, A. Vignery, CD47, a ligand for the macrophage fusion receptor, participates in macrophage multinucleation, J. Biol. Chem. 275 (2000) 37984–37992. [24] H. Sterling, C. Saginario, A. Vignery, CD44 occupancy prevents macrophage multinucleation, J. Cell Biol. 143 (1998) 837–847. [25] T. Kukita, N. Wada, A. Kukita, T. Kakimoto, F. Sandra, K. Toh, K. Nagata, T. Iijima, M. Horiuchi, H. Matsusaki, K. Hieshima, O. Yoshie, H. Nomiyama, RANKLinduced DC-STAMP is essential for osteoclastogenesis, J. Exp. Med. 200 (2004) 941–946. [26] M. Yagi, T. Miyamoto, Y. Sawatani, K. Iwamoto, N. Hosogane, N. Fujita, K. Morita, K. Ninomiya, T. Suzuki, K. Miyamoto, Y. Oike, M. Takeya, Y. Toyama, T. Suda, DC-STAMP is essential for cell–cell fusion in osteoclasts and foreign body giant cells, J. Exp. Med. 202 (2005) 345–351. [27] Y. Sawatani, T. Miyamoto, S. Nagai, M. Maruya, J. Imai, K. Miyamoto, N. Fujita, K. Ninomiya, T. Suzuki, R. Iwasaki, Y. Toyama, M. Shinohara, S. Koyasu, T. Suda, The role of DC-STAMP in maintenance of immune tolerance through regulation of dendritic cell function, Int. Immunol. 20 (2008) 1259–1268.