Cellular colocalization of dopamine D1 mRNA and D2 receptor in rat brain using a D2 dopamine receptor specific polyclonal antibody

Bog.

Nemo-Psychophmmacol.

& Wol. Psychiat. 2000, Vol. 24, pp. 1127-l Copynght 8 2000 Elswier Saence Printed

in the USA.

0278.5846/00/Ssee

149 Inc.

Au rights reserved front matter

PII: 80278-5846(00)00125-l

CELLULAR COLOCALIZATION OF DOPAMINE Dl mRNA AND D2 RECEPTOR IN RAT BRAIN USING A D2 DOPAMINE RECEPTOR SPECIFIC POLYCLONAL ANTIBODY

STEPHANE

MALTAIS’,

STEPHANE

C8TE1,

GUY DROLET2

AND PIERRE

FALARDEAU’

Centre Hospitalier Universitaire

de Quebec, Pavillon CHUL, Unite de Neuroscience, tFacultC de Pharmacie and 2Faculte de MMecine, Universite Lava], Ste-Foy, Quebec, Canada

(Final form, September 2000)

Abstract Maltais, Stephane, Stephane C&e, Guy Drolet and Pierre Falardeau: Cellular colocalization of dopamine Dl mRNA and D2 receptor in rat brain using a D2 dopamine receptor specific polyclonal antibody. Pvog. Neuro-Psychoph~mt~co~. Viol. P~ychiuZ., 2OOO,a, pp. 1127-I 149.02000 Elsevier Science Inc. The main objective of this work was to investigate the extent of cellular colocalization

of dopamine Dl and D2 receptors in the rat brain. A double labeling technique, that combined immunocytochemical labeling of the D2 receptor using polyclonal antibodies raised against the third intracellular loop of the short isoform of the human D2 receptor in combination with in situ hybridization detecting Dl mRNA expression, was designed to accomplish this goal. The specificity of the antisera obtained was confirmed by immunoprecipitation assay, Western blot analysis, and immunocytochemistry on D2R transfected cells and murine brain tissue. Western blot using the D2 receptor antibody revealed a specific broad band centered at 67 kDa in transfected cells and a major protein of 88 kDa corresponding to D2R expressed in the caudate-putamen, to a lesser extent in the cortex, and not at all detected in the hypothalamic region. The content of neurons double-labeled for Dln>2 receptors was observed at in differing intensities in the dorsal endopiroform nucleus, the intercalated nucleus of amygdala, the anterior part of the cortical nucleus amygdala, the nucleus of the lateral olfactory tract, the piriform cortex, the parabrachial nucleus, the supraoptic nucleus and the parabigeminal nucleus. All other regions of the brain revealed neurons expressing either Dl or D2 dopamine receptors but not both at that same time. These results clearly demonstrated that specific neurons expressed both receptors Dl and D2, and that this colocalization was restricted to particular regions of the rat brain.

Keywords: antibody, colocalization, D2, Dl, hybridization, immunocytochemistry, in situ Abbreviations: 2,2’-azino-di-(ethyl-benzthiazoline) sulphonic acid (ABTS), apparent molecular weight (AMW), 5% (wt/vol) skimmed milk powder (BLOTTO), bovine serum albumin (BSA), Dl, D2 or D3 dopamine receptor (DlR, D2R, D3R), Ltk- fibroblasts cells expressing the Dl receptor (DlR-Ltk-), Ltkfibroblasts cells expressing the D2 receptor (D2R-Ltk-), fetal calf serum (FCS), fluorescein isothiocyanate (FITC), isopropyl thiogalactoside (IPTG), immunoreactivity (IR), in situ hybridization histochemistry (ISHH), Luria Broth with ampicilin (LB-amp), L-M(TK-) cells (Ltk-), sodium deoxycholate (NaDOC), ethylphenolpoly (ethyleneglycolether), (Nonidet P40), optic density (O.D.), phosphate buffered saline (PBS), 3% (wt/vol) bovine serum albumin in PBS (PBS-BSA), phenylmethylsulfonyl fluoride (PMSF), 1127

1128

S. Maltais et al.

sodium dodecylsulphate (SDS), SDS-polyacrylamide gel electrophoresis (SDS-PAGE), tris buffered saline (TBS), TBS-TIFCS, TBS/triton X-lOO/FCS, TBS containing 0.1% (vol/vol) Tween-20 (TBS-T).

Introduction

Dopamine and dopamine receptors are involved in the etiology and/or the development diseases

such as schizophrenia,

Parkinson’s

of human brain

disease (Seeman and Niznik, 1990), Huntington’s

chorea

(Seeman et al., 1987; Seeman et al., 1989), and tardive diskinesia (Seeman, 1988). Initially, two subtypes of dopaminergic

receptors

pharmacological techniques,

have been

identified

and distinguished

on

the basis

of

biochemical

and

criteria, then called Dl (DlR) and D2 (D2R). With the application of molecular biology

five genes coding for dopamine

receptor subtypes

were identified

and grouped

into two

subfamilies: The Dl-like receptors, including the Dl and the D5, and the D2-like receptors, which include the two isoforms

of D2R (D2s and D~L), D3 and D4 (Niznik and Van Tol, 1992; Sibley and Monsma,

1992). Among the 5 subtypes, DIR and D2R are the most prevalent in the central nervous system and are responsible for many important dopamine functions.

A specific antibody against D2R is an essential

tool for studying

receptor and for delineating its specific localization. proven difficult, dopaminergic

mainly because

these membrane

the regulating

However, the development proteins

mechanisms

of the

of such antibodies

occur in minute quantities.

Secondly,

has the

DZR amino acid sequence is highly conserved throughout the mammals species which makes

them somewhat

weakly antigenetic

in rabbits. The dopamine

receptors, have seven putative transmembrane

the deduced amino acid sequence of dopaminergic occurs within these putative transmembrane

receptors,

like other G-protein

coupled

regions that form three intracellular loops. A comparison

of

receptor subtypes indicates that the greatest homology

domains, while the hydrophilic

(Jarvie and Caron, 1993). This divergence is especially pronounced D2R subtype. Therefore, the third intracellular loop constitutes

regions

are less conserved

for the third intracellular loop of the the best target for the development

of

specific D2R antibodies.

Different types of antigen have been used for the production of receptor antibodies including the purified receptor (Caron et al., 1979), fusion proteins (Boundy et al., 1993; Levey et al., 1993) and synthetic peptides (Boundy et al., 1993; Guillaume et al., 1994; Mestikawy et al., 1990), the latter being the most used method to date. However, the ease of synthesis of relatively large quantity of a fusion protein containing a large part of the target region of the receptor and the good immunogenic potential of these proteins, fusion proteins are an interesting alternative to synthetic peptides. Although several antibodies have been developed, it has still not been possible to obtain a D2 receptor antibody that can specifically label the receptor in rat brain tissue, in Western blot and immunoprecipitation

procedures.

Since high specificity and avidity are required of the

primary antibody for these methods to work well, we needed to develop a new antibody that would meet our requirements.

Colocalkation of D 1 and D2 receptors

using D2 antibody

1129

Over the past decade, it has been widely accepted that Dl and D2 receptor subtypes independently

but rather interact critically in the regulation of multiple DA-mediated

nature of the response Whether

to a dopamine

this integration

signal depends upon the integration of DlR

occurs only through neuronal circuitry interactions

do not usually act

processes.

Hence, the

and D2R signaling.

or also at the cellular level

remains uncertain. Indeed, an interaction at a cellular level would imply that both receptors are expressed the same neuron.

Although

many groups have used different

neurons of the striatum express Lester et al., 1993; Robertson

both Dl and D2 receptors

techniques

to establish

wheteher

in

certain

(Gerfen, 1992; Le Moine and Bloch, 1995;

et al., 1992; Shetreat et al., 1996; Surmeier et al., 1993), there is still no

consensus on the matter. Therefore, given that many other brain regions contain both Dl and D2, it would be very informative to know if some neurons within these regions express both Dl and D2 receptors, hence that cellular colocalization exists outside the caudate-putamen.

The aims of the present study were i) to develop and characterize specific antibodies using a fusion peptide corresponding secondly

ii) to combine

to the ammo acid sequence of the putative third intracellular loop and

in situ hybridization

labeling of the D2R for identification

against the D2R

histochemistry

for DlR

mRNA and immunocytochemical

of doubly DIR mRNA/D2R labeled cells.

Materials and Methods

Construction

of the Recombinant

Exuression

Plasmids

and Production

of 133aa/378aa D2R-i3

Fusion

Proteins

The cDNA corresponding fragment corresponding plasmid (Novagen).

to the short form of human dopaminergic

to nucleotides

633 to 929 subcloned

Clones of pET3c-D2R-i3

D2R was cut with Bgl II and the

into Bam HI restricted pET3c or pET3xc

(coding for a 133aa fusion protein) or pET3xc-D2R-i3

(coding for a 378 aa fusion protein) in the appropriate orientation were selected and used for all subsequent studies.

escherichia

Typically,

coli BL21(hDE3)

transformed

with the pET3c(or pET3xc)-D2R-i3

construction

was grown in Luria Broth containing 50 pglml ampicilin (LB-amp) at 37”C, until the optic density (O.D.) at 550 nm reached 0.4-0.6. Isopropyl continued

thiogalactoside

(IPTG, 0.4 mM) was added and incubation

for additional 2h. The bacterial pellet was harvested by centrifugation

resuspended

and soaked

was

at 8,OOOg,

in Laemmli sample buffer (Laemmli, 1970) and put over a 3 mm preparative 8%T, 3.3%C

SDS-polyacrylamide

overexpressed

1.5 minutes

gel for electrophoresis.

The gel was then thoroughly

10 min in ice cold 0.25 M KCl, ImM DlT.

washed with demineralized

The maJor bands, corresponding

water to the

fusion protein with apparent molecular weight (AMW) of 17 kDa or 45 kDa for pET3c or

pET3xc fusion proteins respectively, were cut and electroeluted out of the gel using Schleicher

& Schuell

Elutrap system (Jacobs and Clad, 1986). Purity and amino acid content of the purified protein were verified

1130

S. Maltais et al.

by hydroxylamine,

cyanogen bromide, partial acid hydrolysis, and chemotrypsin

analysis of the fragments obtained on tricine-SDS-PAGE

cleavage, followed by the

(Schagger and Jagow, 1987).

Immunization of the Rabbits and Affinitv Purification of the Antisera

Two female New Zealand white rabbits were first immunized using 400 pg of purified fusion protein emulsified

in complete Freud’s adjuvant, injected intradermaly

133aa D2R-i3

in four locations.

immune bleeding was performed to establish control antibody titers. Subsequent

A pre-

booster injections with the

antigen mixed with incomplete Freud’s adjuvant were given every six weeks. Blood (45 ml) was collected 10 days after the injection. Serum was separated by centrifugation

and stored at -20°C until needed. The titer

level after each boost was determined by ELISA using the purified 378aa D2R-i3 fusion protein as antigen.

The serum obtained was purified by immunoaffinity

on a 378aa D2R-i3 fusion protein antigen column

(Harlow and Lane, 1988). The antigen was covalently attached to agarose beads support bromide-activation antibodies

by cyanogen

(Kohn and Wilcheck, 1984). Eluted fractions (1 ml each containing anti-D2R-i3

(as assessed

by O.D. at 280 nm and SDS-PAGE)

were pooled, dialyzed

specific

16 hours against

phosphate buffered saline (PBS), 0.02% (wt/vol) sodium azide, aliquoted and frozen at -20°C until used.

Cells Lines and Cultures

D2R expressing

cells (D2R-Ltk-)

Culture Collection) using a Cap04

were obtained by transfecting

L-M(TK-)

cells (Ltk-, American Type

method with a 2.3 Kb fragment of human retinal short D2R

cDNA

(from nucleotide -99 of the starting codon to codon 2191, restricted with Hind III - Xho I) cloned into the Hind III and Xho I sites of pCMV5 plasrnid (Dearry et al., 1991). This was cotransfected a ratio of 100: 1 (D2R:Neo) expressing

to allow selection with the neomycin

1 and 2 pmoVmg as assessed

by [3H]-spiroperidol

with pRSVneo in

analog G418 (Gibco). Clonal cell lines (Dupon NEN) binding were selected for

subsequent studies. A clonal cell line expressing about 2 pmol/mg of D2R (defined as clone D2R-Ltk-#7.2) were used as D2R expressing

cells for all studies unless otherwise

indicated.

The histidine-tagged

D2

receptor was obtained by amplification of a part of the human retinal D2 short receptor cDNA cloned in pCMV5

(described

above)

using

polymerase

chain

reaction

(PCR)

with

the

following

primers:

CTCAGAATTCACCATGCGGGGCTCCCATCCCATCATCATCATCATGGCTCTGTGGATGAGATGGATCC ACTGAATCTGTCC

(5’ primer) and GCCAACCAGAGAAGAAT

(3’ PRIMER).

The 5’ primer comprises

from 5’ to 3’ respectively, an Eco RI restriction site, a sequence coding for 6 consecutive histidine residues and the first seven amino acid of the D2 N-terminal end. The amplified D2 fragment was restricted with Eco RI and Xba I, and subcloned with the missing 3’ D2 fragment

restricted with Xba I and Kpn I into a

Eco RYKpn I restricted pCMV 5 plasmid. This recombinant plasmid was transfected into Ltk cells using the same conditions [HisleD

receptor/mg

as those described

above. Clonal cell lines ([His]eD2Ltk-)

as assessed by [3H]-spiroperidol

expressing

2 pmol of

binding were selected for subsequent studies. D 1R-

Ltk- fibroblasts clonal cell line expressing 0.8 pmol of receptor/mg protein (DlR-Ltk-)

were established

as

Colocalization of D 1 and D2 receptors previously described

(Dearry et al., 1990). A CHO cell-line expressing

kindly provided by Dr. Pierre Sokoloff

1131

using D2 antibody

(Unite de Neurobiologie

0.8 pmol/mg of D3 receptors

et Pharmacologic

(U.109), INSERM,

Centre Paul Broca, France) (Sokoloff et al., 1992). All cells were grown at 37°C in a humidified of 5% CO2,95% air in Dulbecco’s modified Eagle’s medium (Gibco) supplemented

was

atmosphere

with 10% (voVvo1) fetal

bovine serum.

Immunonrecinitation

From Diaitonin

of D2R

Solubilised

Recentor.

Cells (3 preconfluent

170 cm2 plates of D2R-Ltk-

washed twice with PBS, scraped in lysis buffer (20 mM tris pH 7.4, 10 mM Na2HP04, n&I EGTA, and protease inhibitors (Boehringer inhibitor, leupeptine benzamidine)

and pepstatine

conditions.

measured by Bradford method (Bradford,

The pellet was resuspended

10 mM EDTA, 5

Mannheim) containing 5 pg/ml of each soybean

A, and 100 mM of phenylmethylsulfonyl

and spun 20 minutes at 39 000 g, 4°C. The pellet was resuspended

protein concentration

cells) were

fluoride

trypsin

(PMSF)

and

in lysis buffer and total

1976) before pelleted again in the same

in digitonin buffer (1% (wtivol) digitonin, 300 mM NaCl, 50 mM

Tris pH 7.5, 5 mM EDTA and protease inhibitors) at 0.7 ml!mg of protein, incubated 1 hour in rotation at 4°C. The soluble fraction (500 pl) was then separated by centrifugation

30 minutes at 2000 000 rpm in ‘IL

100.1 rotor at 4°C then incubated 16 hours at 4°C with 20 ~1 of protein A-agarose (Boehringer precoupled to different amount of antibody. The soluble binding assay was performed

Mannheim)

on the centrifuged

supernatant as follows: 100 pL of supernatant was incubated at room temperature for 2 hours in triplicate in presence of 1 nM [3H]-spiperone volume of 500 1.11.Non-specific Biochemicals

International).

ml of sephadex concentration

(19.0 Ci/mmole) in 50 mM Tris-HCl pH 7.2, 100 m&I NaCl in a final binding

was evaluated with 1 PM (+)-butaclamol

from

(Research

Bound [3H]-spiperone was separated from free ligand by filtration through 3.5

G-50 (fine) in a 6 mm column and counted with a liquid scintillation

counter.

Protein

was estimated by Bradford method (Bradford, 1976) using bovine serum albumin as standard,

From RIPA Buffer Solubilize Recentor. Native or (His&tagged

D2R Ltk- cells (3~10~) were detached

with 4 mM EDTA I I-IBS buffer, washed twice with PBS and solubilized in RIPA buffer (10 mM Tris pH 7.4, 10 mh4 EDTA, 500 mM NaCl, 1% (voVvo1) ethylphenolpoly 0.1% SDS, 0.5% (wt/vol) sodium deoxycholate

(Nonidet

(NaDOC) and a cocktail of protease inhibitors)

at 4°C. The soluble fraction separated by centrifugation 1 pg of affinity-purified

(ethyleneglycolether),

P40),

for 2 hours

at 200 OOOgfor 15 minutes was then incubated with

D2R antibody and 20 pl of protein A-agarose beads (Boehringer

Mannheim),

were

centrifuged at 1OOOOgfor 30 seconds in a microfuge and washed twice with 10 mM Tris pH 7.4, 10 mM EDTA. Laemmli sample buffer without reducing agent was added to the beads, the sample was heated at 85°C for 2 minutes nitrocellulose

then loaded

onto a 8%T, 3.3%C

SDS-PAGE

membrane. The Western blot was performed as described

tissues using a commercial (His&-tagged HRP-conjugated

slab, and then transferred

to a

(see below) for the mouse brain

specific monoclonal antibody (Qiagen) as primary antibody and

goat anti-mouse (Amersham) as the secondary antibody.

1132

S. Maltais et

Photoaffinitv

Labeling and Immunoprecipitation.

al.

Cells (pre-confluent

170 cm2 plates of DZR-Ltk- and

untransfected Ltk- fibroblasts) were washed twice with cold PBS, scraped into 20 ml of ice-cold lysis buffer (20 mM Tris pH 7.4, 10 mM EDTA, 10 mM EGTA and protease inhibitors), and homogenized potter. Protein concentration

with a glass

was estimated by the Bradford method (Bradford, 1976), aliquoted at I mg of

membrane per centrifuge tube (2 tubes per cell type), pelleted 20 min. at 39 000 g and resuspended

in 40 ml

of 50 mM Tris pH 7.4, 100 mM NaCl, 2 mM EDTA, 2 mM MgCl2 (buffer B) and [1251]N3-NAPS (Amlaiky and Caron, 1985; Amlaiky et al., 1984) was added at a final concentration incubated in the dark, at room temperature for 1 hour. Non-specific butaclamol (Research Biochemicals centrifugation

of 0.6 nM and was

binding was estimated with 1 PM (+)-

International). The suspension was pelleted 20 min. at 39 OOOgwash by

(20min. at 39 000 g) with cold buffer B containing 0.1% (wt/vol) BSA, resuspended

in 8 ml

of 50 mM Tris-HCI pH 7.5, 100 mM NaCl and photolysed with ultraviolet light (short) for 90 seconds at 8 cm in a 75 cm2 petri dish. The volume of the suspension

was then completed to 35 ml with 50 mM Tris-

HCI pH 7.5, 100 mM NaCl. A 5 ml aliquot was taken and centrifuged centrifugation

(20 min. at 39 000 g)

along with the remainder for 20 min at 39 000 g, and the aliquot pellet resuspended

in 100 pl of Laemmli

sample buffer.

The main pellet was resuspended Nonidet P40,0.5%

in 1 ml of RIPA buffer: 50 mM Tris pH 7.4, 150 mM NaCl, 1% (vol/vol)

(wt/vol) NaDOC, 0.1% (wt/vol) SDS, 1mM EGTA and a cocktail of protease inhibitors.

The solubilized material was diluted by the addition of 5 ml of detergent-free hours (4’C) with 1:500 dilution of affinity-purified

RIPA buffer, incubated for 2

immune antibodies, and incubated for an additional hour

(4°C) with 100 ~1 of protein A-agarose, centrifuged, at 10 OOOgfor 30 seconds in a microfuge, and washed twice with RIPA buffer. Laemmli sample buffer was added to the beads, loaded on a 8%T, 3.3%C SDSPAGE after boiling the samples for 2 minutes, and the dried gel exposed to Kodak X-OMAT AR Film for 2 days at -80°C with an intensifying screen.

Samole Prenaration. From Cell Culture: Subconfluent cells were rinsed twice with PBS buffer, scraped in lysis buffer (10 mM Tris pH 7.5, 5 mM EDTA), spun at 40 OOOg for 20 min. and resuspended buffer. Total protein was estimated by Bradford assay, membranes spun again and resuspended

in lysis

in Laemmli

sample buffer.

From Brain Tissue. Anaesthetized

male mice (Charles River, St-Constant,

QuCbec) were decapitated, then

their brains quickly removed and dissected to obtain tissue from different brain regions. Tissue was gently dispersed in 50mM Tris pH 6.8 using a potter homogenizer

and the homogenate

was added to nonreducing

Laemmli sample buffer.

Western

Procedure.

concentration

The sample was resuspended

in nonreducing

Laemmli sample buffer, to obtain a

of protein of 1 pg/pl. Protein (30 pg) was loaded onto 8%T, 3.3%C SDS-PAGE

slab and

1133

Colocalization of D 1 and D2 receptors using D2 antibody electrophoresed

according to Laemmli (Laernmli, 1970). Proteins were transferred

the Trans-Blot SD semi-dry cell (BioRad) in Bjerrum and Schafer-Nielsen

onto nitrocellulose

transfer buffer (48 m.M Tris, 39

mM glycine, 20% (voVvo1) methanol, 1.3 mM SDS, pH 9.2) (Bjerrum and Schafer-Nielsen, hours at 200 mA. Nitrocellulose

using

1986) for 1

membranes were saturated with skimmed milk, rinsed twice (10 min each)

in TBS-T and incubated 2 hours at room temperature with purified antibody diluted 1: 1000 (0.1 pg/ml) in 1% blotto-TBS-T. temperature

After several washes with TBS-T, membranes

with HRP-conjugated

skimmed milmBS-T

goat-anti

rabbit antibody

were incubated

(Amersham)

for 1 hour at room

diluted to 1:1500 into 5%

(blotto), washed five times with TBS-T and revealed 1 minutes with Renaissance

Western blot Chemiluminescence

Reagent (DuPont NEN), and exposed for 30 seconds to 2 minutes to X-

OMAT AR Film.

Immunocvtochemistry

Cells at 50 % confluence

were washed twice with PBS and fixed/permeabilized

for 20 minutes at -20°C

with chilled methanol. After 4 washes with TBS, cells were then incubated for 16 hours at 4°C with the primary antibodies diluted 1:lOO (@g/ml) in TBS containing with cold TBS and postincubated

1% (vol/vol) Triton X-100, washed 3 times

for 1 hour with fluorescein isothiocyanate-conjugated

(FITC) goat anti-

rabbit antibodies (1:50) in TBS buffer containing 1% (voVvo1) Triton X-100 and 10% (wtivol) blotto in the dark at room temperature. Cells were then washed 4 times with TBS, mounted in 0.1% (wt/vol) p-phenylene diamine, 90% (vol/vol) glycerol in PBS and the immunofluorescence microscope equipped with epifluorescence

To evaluate the extent of DIR immunohistochemistry

mRNA/D2R

housed in standard conditions, hydrochloride

(80 mgikg)

a combination

(ISHH) for DlR (D2R-ir) and DlR

mRNA.

with an intraperitoneally

QuCbec),

injected mixture of ketamine

(10 mg/kg), and transcardially

(pH 9.2). The brains was quickly removed, postfixed

of This

mRNA in the

Adult male rats (n=6) (Charles River, St-Constant,

were anesthetized

and xylazine

using a Zeiss Axiophot

the authors performed

histochemistry

visualization of D2R-immunoreactivity

same tissue section at cellular resolution.

paraformaldehyde

colocalization,

for D2R with in situ hybridization

procedure enabled simultaneous

observed

optics.

perfused

with 4%

(vol/vol)

in the same fixing solution for 48

hours and in the same fixative containing 20% (wt/vol) sucrose for another 24 hours. Brains were then cut at 30 pm using a sliding microtome.

The immunohistochemistry Briefly, free-floating

reaction was performed

sections

first in RNAse-free

conditions

were washed in sterile diethyl pyrocarbonate

followed by ISHH.

treated 0.05M

potassium-

buffered saline &PBS) and incubated at 4°C with the D2R antibody mixed in sterile KPBS, 0.4% (vol/vol) Triton X- 100, 1% (wt/vol) heparin sodium salt, and 1% (wt/vol) bovine serum albumin (fraction V). After 18 h of incubation with the D2R antibody, brain sections were rinsed in sterile KPBS and incubated with a mixture of KPBS-heparine

and biotinylated secondary antibody (1:1500) for 120 min. The sections were

S. Maltais et al.

1134

then rinsed with KPBS, incubated at room temperature for 60 min with an avidin-biotin-peroxidase (Vectastain Elite) and developed with the chromagen mg/ml), and 0.003% (voYvo1) hydrogen

3,3’-diaminobenzidine

tetrahydrocbloride

peroxide after several rinses in sterile KPBS.

sections were mounted on poly-L-lysine-coated

slides and hybridization

histochemicaf

complex (DAB, 0.5

Thereafter, brain

localization of D 1R

mRNA was carried out using a [35S]-labeled DlR cRNA probe (pBlueSK+ plasmid containing a 1.2-kb of rat DlR

cDNA

autoradiographic

(Dean-y

et

al.,

1990)).

Protocols

for

riboprobe

synthesis,

hybridization,

localization of mRNA signal were adapted from Simmons et al. (Simmons

and

et al., 1989).

Mounted brain sections were desiccated under vacuum overnight, fixed in 4% (vol/vol) pamformaldehyde for 30 min, and digested by proteinase K (10 pg/ml in 100 mM tris HCl, pH 8.0,50 mM EDTA, at 37°C for 25 min). Sections were then rinsed in sterile diethyl pyrocarbonate water followed by a solution of 100 mM triethanolamine

(TEA, pH 8.0), acetylated in 0.25% (vol/vol)

dehydrated through graded concentrations

of alcohol (50,70,95,

acetic anhydride

in 100 mM TEA, and

and 100% (voVvo1)). After vacuum drying

for a minimum of 2 h, 90 pl of hybridization mixture (107 cpm/ml) was dropped on each slide, sealed under a coverslip, and incubated at 58°C overnight (-15-20

h) on a slide warmer. Coverslips were then removed

and the slides were rinsed in 4x standard saline citrate (SSC) at room temperature. Sections were digested by RNAse A (20 @ml,

37°C 60 min), rinsed in decreasing

concentrations

of SSC (2x, lx, 0.5x SSC),

washed in 0.1x SSC for 30 mm at 60°C (lx SSC: 150 mM NaCl, 15 mM trisodium citrate buffer, pH 7.0), and dehydrated

through graded concentrations

of alcohol. After being dried for 2 h under vacuum, the

sections were defatted in xylene, and dipped in NTB2 nuclear emulsion (Kodak)

diluted 1: 1 with distilled

water. Slides were exposed for 7 to 12 days, developed in D19 developer (Kodak) for 3.5 min at 14-15°C and fixed in rapid fixer for 5 min. Thereafter, tissues were rinsed in running distilled water for 1 to 2 h dehydrated through graded concentrations

of alcohol, cleared in xylene, and coverslipped with DPX.

Data Analvsis The data analysis was done for the immunoprecipitation

of digitonin-solubilized

D2Ltk- using the D2R antiserum from the third immunization remaining [3H]spiperone

binding in the supernatant after the immunoprecipitation

percent of the non-immunoprecipitated

D2R binding sites from

(Fig. 1). The columns show the amount of procedure expressed in

soluble fraction. The amounts of serum indicated have been used

for 500 ul of soluble fraction. Controls include immunoprecipitation

procedure in presence of 50 ug of D2

fusion peptide, using 10 ul of preimmune serum and solubilised DlLtk- membranes.

Data are means f SD

(n=3) and are expressed as percent of binding from soluble fraction without antibody.

Results

Develoument and Characterization

of Antisera

Two fusion proteins were produced

by inserting

a dopaminergic

D2R cDNA corresponding

to 100

ammo acids of the third intracellular loop following a leader sequence of 13 or 258 amino acids from the gene 10 of the I7 bacteriophage

using pET3c or pET3xc expression

plasmids,

respectively.

The short

Colocalization

of D 1 and D2 receptors

fusion protein was used for the immunization

using

D2 antibody

1135

and boosters into two rabbits, whereas the long one was used

to affinity purify the serum displaying the best antibody titer obtained after the third boost. The antiserum reacted strongly and specifically with the D2R-i3 fusion peptide in enzyme-linked

immunosorbent

assay

(ELBA) up to a dilution of 1:30000 while only a weak reaction was observed using an unrelated peptide as antigen or with the preimmune serum (data not shown).

To assess

the ability of the affinity-purified

immunoprecipitation

was performed

relation was established [3H]-spiperone

binding that could

on digitonin-solubilized

immunoprecipitation expressing

(Fig.

D2R-Ltk-

immunoprecipitate

the D2R,

cells. In these experiments,

be obtained. Maximal immunoprecipitation Immunoprecipitation

fusion peptide, whereas no immunoprecipitation DlR

to specifically

between the amount of antibody used and the level of immunoprecipitation

serum in 500 pi of soluble fraction).

solubilized

antibodies

1).

The

of a six histidine-tagged

D2R

the tagged receptor followed by Western

of the

was achieved with 2 pl of

was inhibited in presence of competitive D2R-i3

was observed

immunoprecipitated

a

with preimmune

receptor from

RIPA

could buffer

also

serum or on digitoninbe

solubilized

blot analysis using a monoclonal

visualized

after

cell membranes anti-histidine

tag

antibody or the D2R antibody (Fig. 2, panel D).

Controls

160

i

t

140 120 100 80 60 40 20 0

Without Ab

0.5 pl

1 PI

2 cl1

50 vi + preimune D2 fusion serum peptide

Dl + 2 ~1

Fig. 1. Immunoprecipitation of digitomn-solubilized D2R binding sites from D2Ltk- using the D2R antiserum from the third immumzation. Columns show the amount of remaining [‘H]spiperone binding in the supernatant after the immunopreclpitation procedure expressed in percent of the non-immunoprecipitated soluble fraction. The amounts of serum uxhcated have been used for 500 ~1 of soluble fraction. Controls include immunoprecipitation in presence of 5Opg of D2 fusion peptide, usmgl0 pl of preimmune serum and lmmunoprecipltation on solubihsed DlLtk- membranes. (Ab, antibody)

Western blot using the D2R antibody on total protein extract from D2R-Ltk- cells produced a major and specific broad band centered at 67 kDa, two specific bands at 38 and 45 kDa and two higher bands that

1136

S. Maltais

et al.

migrated at 115and 180 kDa (Fig. 2, panel A). No immunoreactivity

1

was observed with untransfected

cells,

23456

kDa

kDa

66.2-

66.2 -

31 -

C kDa

D 1

2

3

E

4

1

z

kDa 97.4 97.466.2 -

+

66.2 -

45 -

66.245 -

31 31 Fig. 2. A Western blot usmg the purified antibody on membrane preparation from natrve Ltk- cells (lane l), expressmg the DIR (lane 2) D3R (lane 3) or the D2R (lane 4) on D2R cell membranes preparation using the preimmune serum as primary antibody (lane 5) or after incubation of the D2R antibody with the PET-3xc-i3D2R fusron protein (lane 6). Arrows indicate the specific bands of lane 4 corresponding to different forms of the D2 receptor at 67,45 and 38 kDa. B Western blot using purified antibodies on mouse brain tissue: cortex (lane l), hypothalamic regron (lane 2) and striatum (lane 3). The solid arrow shows the D2R at 88 kDa and the open arrow show a weaker specific band in lane 1 and 3. The same amount of total protein homogenate has been loaded on each lane. C) Autoradiograph showing photoaffinity labeling of D2R-Ltk- cells membrane with irreversible radioionated D2 antagonist [‘*‘I]N3-NAPS (lane 2) and immunoprecipitation of the photolabeled D2R with the purified D2R antibody (lane 4). No labeling occurred in native fibroblast cells (lane 1) or in D2R-Ltk- cells in presence of (+)-butaclamol as a competitor for D2R binding sate (lane 3). Arrows show three bands corresponding to the labeled D2R. D) Western blot using a (His)6-tag monoclonal antrbody on immunopreciprtated

D2R from (His)D2Ltk- ceils using the purified

D2R antrbody (lane 2). Lane 1 is the result of the same procedure conducted on native Ltk- cells, E) Western blot usmg purified antibody showing D2R-CHO cells (lane 1) and the deglycosylated D2R from cells treated 48 h with 0.3 @I of tunicamycin (lane 2).

Colocalization with cells expressing

of D 1 and D2 receptors

D2 antibody

1137

either DlR or D3R, with D2R-Ltk‘ cells when D2R antibody was pre-incubated

D2R-i3 fusion peptide, or when using the preimmune homogenates

using

of mouse brain sections displayed

present in the caudate-putamen

serum as the primary antibody.

Western

a specific doublet at 88 kDa corresponding

with

blot on to D2Rs

extract, which are not in the cortex or the midbrain (Fig. 2, panel B). Two

other faint specific bands were observed at 69 and 225 kDa. The 225 kDa band was also weakly detected in the cortex extract. [‘25I]N3-NAPS (an irreversible radioiodinated

D2R antagonist) specifically

labeled D2R

from transfected fibroblasts cells and revealed the 45,67 and 115 kDa bands obtained with the Western blot (Fig. 2, panel C). Those specifically

labeled bands

were also immunoprecipitated

using

the antisera

supporting the idea that the different molecular weight proteins recognized on Western blot by the antibody represent different forms of D2R. Treatment of D2R-CHO protein N-glycosylation,

cells with 0.3 pM hmicamycin, an inhibitor of

resulted in a lighter D2R of 38 and 45 kDa corresponding

D2R (Fig. 2, panel E). These results are representative staining was also observed by fluorescence

of at least 3 independent

immunocytochemistry

to the unglycosylated

experiments.

Specific D2R

using affinity purified antibodies on cells

expressing either 1 or 2 pmollmg and compared with cells expressing other dopaminergic

receptor subtypes

or no receptor (Fig. 3). D2R expressed in fibroblasts cells were revealed as membrane fluorescence

that

1

3

5

Fig 3. Labeling of methanol-fixed cells by fluorescence immunocytochemistry using affinity purified D2R antibody on D2RLtk- cells (I), DlR-Ltk- cells (2), D3R-CHO cells (3) or untransfected cells (4). No lmmunoreactivity was observed on D2RLtk- cells when preimmune serum was used as pnmary antibody (5).

S. Maltais et al.

1138 intensified with a higher receptor expression performed

with preimmune

level. No such fluorescence

was observed when staining was

serum, affinity purified immune serum on untransfected

expressing either D 1R or D3R subtypes. The same pattern of D2R immunofluorescence a six histidine-tagged

D2R expressed

cells, or on cells was observed with

in the same cell type, and using Qiagen histidine-tag

commercial

monoclonal antibody as primary antibody (data not shown).

Immunohistochemistrv

and DlR mRNA/D2R Double Labeling;

The distribution of D2R immunoreactivity to the same distribution immunoreactivity

previously

(cell bodies and fibers) in the rat brain corresponded

described

(Mansour

detected was in the caudate-putamen,

and Watson, and displaying

1995). The highest

essentially density

of

a lateral to medial gradient, the

nucleus accumbens, the olfactory turbercle, the substantia nigra pars compacta, the paraventricular nucleus of the hypothalamus

and the endopiriform

cortex (Fig. 4) Moderate immunoreactivity

was also observed in

1

2

3

4

5

Fig. 4. Light microscopic photographs showmg D2R immunoreactivity m rat basal ganglia: Caudoputamen (1). olfactory tuber& (2), substantla mgra pars compacta (3); and m the endopiriform cortex (4) and the paraventncular nucleus hypothalamus (5). CP, caudoputamen; GPI, globus palhdus, lateral segment; OT, olfactory tub&e; PIR2, piriform area, layer 2; PVN, paraventncular nucleus hypothalamus; SNc, substantia nigra. compact part; SNr, substantla nigra, reticular part; V3, third ventricle

Celecakzation some nuclei of the amygdaloid

1139

of D 1 and D2 receptors using D2 antibody

complex (intercalated nuclei, anterior part of the basolateral

anterior part of the cortical nucleus). DlR mRNA showed similar but distinct distribution high level of labeling in the caudate-putamen, girus, the amygdala, particularly

nucleus and

from D2R with

the nucleus accumbens, the olfactory tubercle, the dentate

in the intercalated nucleus, the endopiriform

cortex, the ventromedial

nucleus of thalamus, the lateral parabrachial, and in the granule cell layer of the cerebellum. Numerous brain regions displayed various levels of regional D 1R mRNA/D2R-ir the caudate-putamen,

colocalization

the nucleus accumbens, the olfactory tubercle, the endopiriform

gyms, the claushum, the dorsal part of the endopiriform

including

cortex, the dentate

nucleus, the nucleus of the lateral olfactory tract,

different nuclei of the amygdala (intercalated nuclei and anterior part of the cortical nucleus),

and the

supraoptic nucleus. Some of these regions showed only scattered positive D2R immunoreactive

cells or

weaker D 1R mRNA signal. From

these regions,

many cases of cellular DlR

(Table 1). Cells were considered

mRNAD2R

colocalization

have been

observed

double labeled when the cell body could be clearly identified by silver

grains from DlR in situ hybridization

and the same cell body showed a clearly defined D2 immunoreactive

cell boundary (DAR staining). Levels of double-labeled

neurons are presented using a qualitative 0 to + +

scale. Score 0 is attributed to regions in which neurons express either DlR mRNA or D2R only, + for regions showing essentially segregated receptors but some scattered doubly reactive neurons and ++ when more than 50% of the DlR mRNA or D2R labeled neurons were doubly reactive. Double-labeled

cells were

observed in intercalated nucleus of the amygdala, anterior part of the cortical nucleus amygdala, me

Table 1 Relative Densities of Dopamine DIR mRNA Labeling, D2R Antisera Immunoreactivity of DIR mRNA/D2R Double-Labeled

and Relative Level

Neurons in Areas of the Rat Brain that Show Regional Colocalization.

DIR mRNA

Structure Intercalated nucleus of amygdala Dorsal endopiriform

nucleus

Nucleus of the lateral olfactory tract

D2R

DIR mRNA + DZR

+++

+

+

++

++

++

+

++

++

+++

++

++

Parabrachial nucleus, lateral part

++

+

+

Supraoptic nucleus

++

++

++ +

Cortex pirifoim area

Parabigeminal

nucleus

++

++

Claus&urn

++

+I-

0

cortical nucleus amygdala, ant. part

++

-I-

Basolateral nucleus amygdala

++ +

++ +

++ 0

Medial nucleus amygdala, posteroventral part

0

Levels of double-labeled neurons were scored using a qualitative 0 to ++ scale. 0 1s attributed to regions m which neurons express either DIR mRNA or D2R only, + for regions showing essentially segregated receptors but some scattered double reactive neurons and ++ when more than 50% of the DIR mRNA or D2R-labeled neurons were doubly reactive.

1140

S. Maltais et al.

claustzrum, the endopiriform nucleus, the nucleus of the lateral olfactory tract, 1:he basolateral

,gdala, and

in the piriform cortex (Fig. 5).

Fig. 5. EGUIIplE3 of neurons of rat bram coexpressmg the Dl R mRNA and the D2 receptor area. B : the layer 2 of the nucleus of the lateral olfactory tract and, C: the dorsal part of the arrows identify c oexpression and open arrows identlfy neurons that express either DIR mRN

layer 2 of the A:pil ndopirlform nr or D2 receptor

:OtiX

solid

Colocalieation of D 1 and D2 receptors

The present study describes the development and characterization intracellular loop of the D2R and its use for the determination D2R in the rat brain. The antibody obtained demonstrated

by immunoprecipitation,

strongly

1141

using D2 antibody

of a specific antibody against the third

of neurons expressing

and specifically

both D 1R mRNA and

binds to the D2R subtype

Western blotting, immunocytochemistry

and immunostaining

D2R in the rat brain. The efficacy of the antibody in those different biochemical procedures versatile and can be very useful for studying

the DZR. DlR

mRNAID2R

as

of the

shows that it is

double-labeling

using this

antibody revealed that certain neurons of specific brain regions express both DIR and D2R suggesting

that

those receptors could interact at the level of their signal transduction pathways within a single neuron. These findings make more complex the interpretation of dopaminergic not only between segregated DlR and D2R expressing

signal transduction

since interactions

neurons but also in DlR/D2R

occur

neurons, at the level

of their respective signalisation pathways.

Develoument and Characterization

of Antisera

Other D2R antibodies have been previously developed (Ariano et al., 1993; Boundy et al., 1993; Chazot et al., 1993; David et al., 1991; Farooqui et al., 1991; Johnston et al., 1992; I_evey et al., 1993; McVittie et al., 1991; Plug et al., 1992; Wagner sensibility in the recognition

et al., 1993). In rat brain, those antibodies

of D2R protein in immunohistochemical

distribution (Mansour and Watson,

show good selectivity

1995). However, since the amount of antibody necessary

for extensive

studies of D2R regulation could not be borrowed from other groups and because all the commercial receptor antibodies

tested showed only poor, unspecific

recognition

and

staining and displayed typical D2R

D2

of the D2 receptor, we needed to

develop a new D2R antibody. The antisera obtained exhibits good versatility as it show high specificity and avidity when used in different biochemical and histochemical

techniques

including immunohistochemistry

on transfected cells or on brain tissue, Western blotting, and immunoprecipitation.

The immunization polyclonal

of rabbits with fusion proteins has proven an appropriate method for the production

antibodies

to many G protein-coupled

(Levey et al., 1991) a2-adrenergic hydroxytryptamine

receptors,

receptor (Kurose

including

muscarinic

et al., 1993; Vanscheeuwijck

acetylcholine

of

receptor

et al., 1993) and 5-

receptors (Gerard et al., 1994). Production of fusion protein from cDNA sequence

of

the human D2R provide a rapid means to obtain a large quantity of fusion proteins that contained a specific epitope, that would be needed for immunization and further testing. Fusion protein represents

an interesting

alternative to synthetic peptides, as it allows the use of much bigger protein region for immunization, offering more a larger target epitope for antibodies and would thus be more immunogenic. because of their large size, fusion proteins might adopt a secondary conformation native receptor.

Furthermore,

more closely related to the

1142

S. Maltais et al.

The choice of epitope is important because the proteins of interest exhibit a high degree of sequence identity with the different

species variants of the receptor, with other members

receptor, but more importantly, with other dopaminergic example, the D~L and D3 receptors transmembrane

exhibit 52% homology

of the G protein-coupled

(Jarvie and Caron, 1993). For

overall and 75% homology

domains (Sokoloff et al., 1990). The third intracellular loop, excluding

acids closest to the fifth and sixth transmembrane homology

receptor subtypes

with other members

epitopes for the production

the 8 to 10 amino

domains, is the region of the D2R that displays the least

of the G protein-coupled

of specific

within the

antireceptor

receptor family and therefore

antibodies.

Furthermore,

provides

this hydrophilic

unique

region is

openly exposed into the cytoplasmic region, allowing recognition of the native protein even when inserted into the cytoplasm& membrane.

The cDNA of the short isoform of the D2R was used for the preparation of the fusion protein. Since all the primary structure of the short isoform is included in the long isofotm, the antibody recognize both long and short D2R. Thus, the results presented

represent the colocalisation

between the DIR

and both D2R

isoforms

Although the antibody was raised against the human D2R third intracellular loop, the antibody recognizes, in addition to the human D2R protein expressed in fibroblast cells (Fig. 3, panel l), the rat D2R (Fig. 4) and the mouse D2R (Fig. 2, panel B). In fact, in the D2R protein region used for the production

of the antibody,

the protein sequence of the rat and the mouse D2R are identical and show 9 1% homology

with the human

sequence. This high inter-species

homology

explains the recognition

of the rat and mouse D2R by the

antibody even though it was raised against the human D2R.

Our results have clearly shown the specificity and versatility of the immune serum obtained. It recognizes the denatured or native D2R, as shown by the immunoprecipitation

of the digitonin-solubilized

D2R binding

activity from D2R transfected fibroblasts, the specific labeling of the 67 kDa D2R from transfected Western blot analysis, the immunoprecipitation showing

membrane

immunocytochemistry

fluorescence

only

that demonstrate

cells in

of [ 1251]Ns-NAPS labeled D2R, cell immunocytcchemistry in

fibroblast

cells

expressing

regional rat brain D2R immunostaining

the

D2R,

and

that correlated

brain to the

reported distribution for the D2R (Mansour and Watson, 1995). Taken together, these results clearly show that the antibody is specific for the D2R, that it recognizes

both the native and denatured

receptor, and it can be use in biochemical as well as immunochemical

form of the

procedures.

The molecular weight of 45 kDa deduced from the amino acid sequence of the D2R, was different than the AMW of the receptor reported from different sources. The different states of N-terminal glycosylation

of

the receptor in various tissues could explain these variations (Bates et al., 1990). Western blot analysis on D2R-Ltk- using our antibody (Fig. 2, panel A) and photoaffinity

labeling of the receptor (Fig. 2, panel C)

revealed broad and intense specific labeling at 67 kDa, two weaker bands at 45 and 38 kDa and two bands at 115 and 180 kDa. The 67 kDa band corresponds mouse fibroblasts

to the AMW reported for the receptors

cells (Bates et al., 1990) while the 45 kDa bands correspond

expressed

in

to the unglycosylated

1143

Colocalization of D 1 and D2 receptors using D2 antibody

receptor and the 38 kDa protein is probably a major proteolitic degradation product. The 115 and 180 kDa bands could correspond

to two different-sized

the D2R was demonstrated

oligomers D2R (Ng et al., 1996). The glycoprotein

when tunicamycin-treated

DZR-CHO cells expressed

only the unglycosylated

45 and 38 kDa forms of D2R, while cells grown in conditions allowing glycosylation heavier 67 kDa receptor.

nature of

produced essentially a

Extracts from the mouse striatum on panel B of the Fig. 2, shows expression

major protein at 88 kDa corresponding

to a more extensively

glycosylated

of a

D2R. This AMW varied slightly

from the one reported for the D2R in the rat striatum (Farooqui et al., 1992). The two other weaker bands at 69 and 225 kDA could also correspond

to the 66 kDa and the 220 kDa proteins observe by the same

author.

Immunohistochemistrv

and DlR mRNA/D2R Double Labeling

As stated by Vincent et al. (1995), some dopamine-mediated simultaneous

effects in striatum seem to require the

activation of both the Dl and D2 receptor subtypes (Carlson et al., 1987; Weick and Walters,

1987; White, 1987), even though the activity of these two binding sites seems to be inversely coupled to adenylate cyclase (Stoof and Kebabian,

198 1) and phospholypase

C (Enjalbert et al., 1986; Pizzi et al.,

1988). The question of whether this interaction between Dl and D2 receptors

is a result of integrative

neuronal circuits or if Dl and D2 receptors are colocalized and could interact at their signal transduction pathways D2R at a cellular has been addressed using several techniques 1996), in situ hybridization electrophysiological

including PCR (Surmeier et al.,

for DlR and D2R mRNA on adjacent brain sections (Lester et al., 1993) and

methods (Akaike et al., 1987; Calabresi et al., 1987; Ohno et al., 1987). However, those

methods have lead to contradicting results and do not always reflect the level of expression In this study, we presented

a simple technique that

effectively contains neurons expressing double D2R/DlRmRNA situ hybridization

of each protein.

enables to clearly establish that some brain regions

colocalized Dl and

D2 receptors.

labeling using a combination of immunohistochemistry

The technique

of a

for the D2R protein and in

for DlR mRNA on the same brain section. The main advantage of this technique is that it

allows the direct visualization of the colocalization

of the D2R protein and the DlR mRNA on a single

neuron with a relatively simple procedure. Moreover, this method combined two techniques

that only reveal

relatively high level of receptor or receptor mRNA, reducing the amount of false colocalization more sensitive

consist

methods

such as PCR. Specific

antibodies

can actually distinguish

obtained with

individual

genetic

subtypes at a single cell resolution, which is not possible even with the most selective receptor ligands. However, this technique is also limited since it can reveal the colocalization only at the cell body level and not on the dendritic terminals. Moreover, the detection of DlR mRNA in a specific neuron is not a direct indicator of the amount of DlR protein expressed by this neuron and only direct labeling of the receptor protein by radioactive ligand binding or immunostaining

could establish this relation. However, it has been

shown that there is a good agreement between Dl receptor binding and mRNA in several brain regions (Mansour et al., 1992) and suggested that much of the discordance

between the distributions

is probably

due to the differential localization of Dl receptor mRNA in cell bodies and receptor binding sites on fibers. This supports the conclusion

that neurons doubly reactive for the DIR mRNA and D2R protein contain

colocalized Dl and D2 receptors. Thus, this method provides a useful approach for studying co-expression

1144

S. Maltais et al.

of both receptors by a single neuron, but one should keep in mind that colocalization

observed

is not

exhaustive. The avidity of the antibody allowed us to reveal DIR mRNA/D2R

doublye-labeled

neurons expressing

low levels of D2R. For instance, in the intercalated nuclei of the amygdala the D2R staining was rather weak, even though some neurons were more reactive, while no previous D2R immunostaining

have been reported

in this region (Ciliax et al., 1994; Levey et al., 1993). However, ligand binding autoradiography

studies

showed that a certain low level of D2R is present in this region (Scibilia et al., 1992) suggesting

that the

D2R antisera reactive neurons truly express D2R. This further shows the high specificity and avidity of our antibody.

The efforts to identify possible cellular DlR/D2R caudate-putamen

colocalization

have been mainly concentrated

region given that it is a very important area for dopaminergic

on the

action in the CNS. However,

the methods used in this paper did not allow the evaluation the extent of colocalization

in the caudate-

putamen because of the very high density of D2R staining in this region, so that cell bodies could not be distinguished from axon terminals, or dendritic terminals, even on 10 pm brain section or at lower dilutions of primary antibody.

Dopamine action is largely modulated by the widespread

Dl and D2 dopamine receptor subtypes

interact at different functional levels. While it has been clearly shown interactions occurs via different levels of integrative responses,

that

over the past few years that these

whether interactions exists at the level of a

single neuron remains an unsettled question. This study clearly shows that one single neuron can express both Dl and D2 receptors. Yet, this colocalization is restricted to a few particular regions of the rat brain and appears to be marginal since the large majority of neurons expressing dopaminergic

receptors express either

Dl or D2 receptors and are often segregated in different neurons or nuclei. Although segregation of Dl and D2 receptors

in the rat brain is not absolute, these results suggest that a large majority of Dl and D2

receptors are expressed

in different neurons but that some particular regions contains neurons expressing

both receptors. Those colocalized receptors could critically interact at the level of this neuron, which then would

participate

consequences

in a DlR/D2R

of the DllUD2R

integrated

response

cellular interaction

following

dopamine

remain unknown.

release.

However,

This kind of interaction

the

is better

understood for the DlR and the D3 dopamine receptor (D3R) which are largely colocalized in the islands of Calleja (80%) and in the ventromedial shell of the nucleus accumbens (63%). Some lines of evidence show a variety of consequences

that could result from DlR/D3R

interactions.

For instance,

the individual

stimulation of either DlR or D3R using specific agonists produces opposite effect on c-fos mRNA in the islands of Calleja while their co-stimulation

produces

a synergistic

effect on substance

accumbens shell (Schwartz et al., 1998). It is then concluded that co-stimulation may result in either opposing

or synergistic responses

depending

P mRNA in the

of coexpressed

what kind of response is being considered. Thus, the meaning of the integrative cellular DlR/D2R following dopaminergic

stimulation in neurons coexpressing

interactions will need further investigation.

DlR/D3R

in which type of neuron it occurs and response

the two receptors and the implication of those

Colocalization of D 1 and D2 receptors

using D2 antibody

1145

Conclusion

The present study describes the development

and characterization

intracellular loop of the D2R and its use for the determination

of a specific antibody against the third

of neurons expressing both DlR mRNA and

D2R in the rat brain. The antibody obtained strongly and specifically binds to the D2R subtype as demonstrated by immunoprecipitation,

Western blotting, immunocytochemistry

and immunostaining

of the

D2R in the rat brain. The efficacy of the antibody in those different biochemical procedures shows that it is versatile and can be very useful for studying the D2R. DlR mRNA/D2R double-labeling

using this

antibody revealed that certain neurons of specific brain regions express both DlR and D2R suggesting that those receptors could interact at the level of their signal transduction pathways within a single neuron. These findings make more complex the interpretation of dopaminergic signal transduction since interactions occur not only between segregated DlR and D2R expressing neurons but also in DlR/D2R

neurons, at the level

of their respective signalisation pathways.

Acknowledements

We thanks M. Jean Paul Vallet for his important technical support. Thanks to James Mansi for helpful technical assistance and discussions. We also acknowledge the expert assistance of Sylvie Laforest. Special thanks to Michel Labs% for technical support and Suzanne Richardson.

This research was supported

grant from Medical Research of Canada. Pierre Falardeau and Guy Drolet have a scholarship

by

from Fonds

de Recherche en Santt du QuBbec.

References AKAIKE, A., OHNO, Y., SASA, M., and TAKAORI, S. (1987) Excitatory and inhibitory effects of dopamine on neuronal activity of the caudate nucleus neurons in vitro. Brain Res.418: 262-272. AMLAIKY, N. and CARON M.G. (1985) Photoaffinity labeling of the D2 dopamine receptor using a novel high affinity radioiodinated probe. J. Biol. Chem. 260: 1983-1986. AMLAIKY, N., KILPATRICK, B.F. and CARON, M.G. (1984) A novel radioiodinated high affinity ligand for the D2-dopamine receptor-Characterization of its binding in bovine anterior pituary membranes. FEBS Lett. 176: 436-439. ARIANO, M.A., FISHER, R.S., SMYK-RANDALL, E., SIBLEY, D.R. and LEVINE, M.S. (1993) D2 dopamine receptor distribution in the rodent CNS using anti-peptide antisera. Brain Res. 609: 7 l-80. BATES, M.D., GINGRICH, J.A., BUNZOW, J.R., FALARDEAU, P,, DEARRY, A,, SENOGLES, S.E., CIVELLI, 0. and CARON, M.G. (1990) Molecular characterization of dopamine receptors. Am. J. Hyperten. 2: 29s.33s. BJERRUM, O.J. and SCHAFER-NIELSEN, C. (1986) Buffer systems and transfer parameters for semidry electroblotting with a horizontal apparatus. In: Dunn, Electrophoresis 1986, eds.), pp 315.327, VCH, Weinheim, Germany.

1146

S. Maltais et al.

BOUNDY, V.A., LUEDTKE, R.R. and MOLINOFF, P.B. (1993) Development of polyclonal anti-D2 dopamine receptor antibodies to fusion proteins: Inhibition of D2 receptor-G protein interaction. J. Neurochem.@: 2181-2191. BRADFORD, M,M, (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analy. Biochem. 72: 248-254. CALA BRESI, P., MERCURI, N., STANZIONE, P,, STEFANI, A. and BERNARDI, G. (1987) Intracellular studies on the dopamine-induced firing inhibition of neostriatal neurons in vitro: evidence for Dl receptor involvement. Neurosci. 2_0:757-77 1. CARLSON, J.H., BERGSTROM, D.A. and WALTERS, J.R. (1987) Stimulation of both Dl and D2 dopamine receptors appears necessary for full expression of postsynaptic effects of dopamine agonists: a neurophysiological study. Brain Res. 400: 205-218. CARON, M.G., SRINIVASAN, Y., SNYDERMAN, R. and LEFKOWITZ, R.J. (1979) Antibodies raised against purified beta-adrenergic receptors specifically bind beta-adrenergic ligands. Proc. Nat. Acad. Sci. USA 2_6:2263-2267. CHAZOT, PL., DOHERTY, A.J. and STRANGE, P.G. (1993) Antisera specific for D2 dopamine receptors. Biochem. J. 289: 789-794. CILIAX, B.J., HERSCH, SM. and LEVEY, AI. (1994) Immunocytochemical Localization of Dl and D2 Receptors in Rat Brain. In: Dopamine Receptor and Transporters, Pharmacology, Structure, and Function, HB Niznik (eds.), pp 383-399, Marcel Dekker, New York. DAVID, C., EWERT, M., SEEBURG, P. and FUCHS, S. (1991) Antipeptide antibodies differentiate between long and short isoforms of the D2 dopamine receptor. Biochem. Biophy. Res. Commun. 179: 824-829. DEARRY, A., FALARDEAU, P., SHORES, C. and CARON, M.G. (1991) D2 dopamine receptors in the human retina: cloning of cDNA and localization of mRNA. Cellular and Molecular Neurobiol. u: 437453. DEARRY, A., GINGRICH, J.A., FALARDEAU, P., FREMEAU, R.T., JR., BATES, M.D. and CARON, M.G. (1990) Molecular cloning and expression of the gene for a human Dl dopamine receptor. Nature 347: 72-76. ENJALBERT, A., SLADECZEK, F., GUILLON, G., BERTRAND, P., SHU, C., EPELBAUM, J., GARCIA-SAINZ, A., JARD, S., LOMBARD, C., KORDON, C. and ET AL. (1986) Angiotensin dopamine modulate both CAMP and inositol phosphate productions in anterior pituitary cells. Involvement in prolactin secretion. J. Biol. Chem. 261: 407 l-4075.

II and

FAROOQUI, S., BROCK, J., HAMDI, A. and PRASAD, C. (1991) Antibodies against synthetic peptides predicted from the nucleotide sequence of the D2 receptor recognize native dopamine receptor protein in rat striatum. J. Neurochem. 57: 1363-1369. FAROOQUI, SM., PRASAD, C. and ALI, M. (1992) Production and characterization of a monoclonal antibody to dopamine D2 receptor: comparison with a polyclonal antibody to a different epitope. Biochem. Biophy. Res. Corn. 184: 661-7. GERARD, C., LANGLOIS, X., GINGRICH, J., DOUCET, E., VERGE, D., KIA, H.K., RAISMAN, R., GOZLAN, H., EL MESTIKAWY, S. and HAMON, M. (1994) Production and characterization of polyclonal antibodies recognizing the intracytoplasmic third loop of the 5-hydroxytryptaminelA receptor. Neurosci. 62: 721-739. GERFEN, C.R. (1992) The neostriatal mosaic: multiple levels of compartmental Neurosci. 15: 133-139.

organization. Trends

GUlLLAUME, J.L. PETITJEAN, F., HAASEMANN, M., BIANCHI, C., ESHDAT, Y. and STROSBERG, A.D. (1994) Antibodies for the immunochemistry of the human l33-adrenergic receptor. Eur. J. Biochem. 224: 761-770.

1147

Colocalization of D 1 and D2 receptors using D2 antibody HARLOW, E. and LANE, D. (1988) Antibodies: A laboratory Manual, Cold Spring Harbor Laboratory, New York, pp 726.

JACOBS, E. and CLAD, A. (1986) Electroelution of fixed and stained membrane proteins from preparative sodium dodecyl sulfatepolyacrylamide gels into a membrane trap. Anal. B&hem. m: 583-589. JARVIE, K.R. and CARON, M.G. (1993) Heterogeneity

of dopamine receptors. Adv. Neurol. &I: 325-333.

JOHNSTON, J.M., WOOD, D.F., JAMES, J.D. and JOHNSTON, D.G. (1992) Preparation and characterization of an antibody specific to the rat dopamine D2 receptor. J. Endocrin.134: 227-233. KOHN, J. and WILCHECK, M. (1984) The use of cyanogen bromide and other novel cyanylating for the activation of polysaccharide resins. App. B&hem. Biotechnol. 9: 285-304. KUROSE H, ARRIZA, J.L. and LEFKOWITZ, R.J. (1993) Characterization subtype-specific antibodies. Mol. Pharmacol. 43: 444-450.

agents

of alpha 2-adrenergic receptor

LAEMMLI, U.K. (1970) Cleavage of structural proteins during the assembly of the bacteriophage Nature 227: 680-685.

T4.

LE MOINE, C. and BLOCH, B. (1995) Dl and D2 dopamine receptor gene expression in the rat striatum: sensitive cRNA probes demonstrate prominent segregation of Dl and D2 mRNAs in distinct neuronal populations of the dorsal and ventral striatum. J. Compar. Neurol. 355: 418-426. LESTER, J., FINK, S., ARONIN, N. and DIFIGLIA,M. (1993) Colocalization receptor mRNAs in striatal neurons. Brain Res. 621: 106-I IO.

of Dl and D2 dopamine

LEVEY, A.I., HERSCH, SM., RYE, D.B., SUNAHARA, R.K.,NIZNIK, H.B., KI’IT, C.A., PRICE, D.L., MAGGIO, R,., BRANN, M.R. and CILIAX, B.J. (1993) Localization of Dl and D2 dopamine receptor in brain with subtype-specific antibodies. Proc. Nat. Acad. Sci. USAB: 8861-8865. LEVEY, AI., KI’IT, C.A., SIMONDS, W.F., PRICE, D.L. and BRANN, M.R. (1991) Identification and localization of muscarinic acetylcholine receptor proteins in brain with subtype-specific antibodies. J. Neurosci. 11: 3218-3226. MANSOUR, A., MEADOR-WOODRUFF, J.H., ZHOU, Q., CIVELLI, O., AKlL, H. and WATSON, S.J. (1992) A comparison of Dl receptor binding and mRNA in rat brain using receptor autoradiographic and in situ hybridization techniques. Neurosci. 46: 959-7 1. MANSOUR, A. and WATSON, S.J. (1995) Dopamine receptor expression in the central nervous system. In: Psychopharmacology: The fourth generation of progress, F.E. Bloom and D.J. Kupfe, (Eds.), pp 207-219, Raven Press, Ltd. New York. MCVI’ITIE, L.D., ARIANO, M.A. and SIBLEY, D.R. (1991) Ch aracterization of anti-peptide antibodies for the localization of D2 dopamine receptors in rat striatum. Proc. Nat. Acad. Sci. USA@: 1441-1445. MESTIKAWY, SE., RIAD, M., LAPORTE, A.M., VERGE, D., DAVAL, G., GOZLAN, H. and HAMON, M. (1990) Production of specific anti-rat 5HTIA receptor antibodies in rabbits injected with a synthetic peptide. Neurosci. Let. II& 189-92. NG, G.Y., O’DOWD, B.F., LEE, S.P., CHUNG, H.T., BRANN, M.R., SEEMAN, P. and GEORGE, S.R. (1996) Dopamine D2 receptor dimers and receptor-blocking peptides. Bioch. Biophy. Res. Commun. 227: 200-204. NIZNIK, H.B. and VAN TOL, H.H.M. (1992) Dopamine receptor genes: new tools for molecular psychiatry. J. Psychiat. Neurosci. Iz: 158-180. OHNO, Y., SASA, M. and TAKAORI, S. (1987) Coexistence of inhibitory dopamine D-l and excitatory D-2 receptors on the same caudate nucleus neurons. Life Sci. 40: 1937-1945.

1148

S. Maltais et al.

PIZZI, M., DA PRADA, M., VALERIO, A., MEMO, M., SPANO, P.F. and HAEFELY, W.E. (1988) Dopamine D2 receptor stimulation inhibits inositol phosphate generating system in rat striatal slices. Brain Res. 456: 235-40. PLUG, M.J., MOLLER, W. and DIJK, J. (1992) Interactions between the dopamine D2 receptor and GTPbinding proteins. Biochem. Intemat. 2: 21-9. ROBERTSON, G.S., VINCENT, S.R. and FIBIGER, H.C. (1992) Dl and D2 dopamine receptors differentially regulate c-fos expression in striatonigral and striatopallidal neurons. Neurosci. 49: 285-96. SCH&GER, H. and JAGOW, V.V. (1987) Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Anal. Biochem. 166: 368379. SCHWARTZ, J.C., RIDRAY, S., BORDET, R., DIAZ, J. and SOKOLOFF, P. (1998) Dl/D3 receptor relationships in brain coexpression, coactivation, and coregulation. Adv. Pharmacol. 42: 408-I 1. SCIBILIA, R.J., LACHOWICZ, J.E. and KILTS, C.D. (1992) Topographic nonoverlapping distribution of Dl and D2 dopamine receptors in the amygdaloid nuclear complex of the rat brain. Synapsel_l: 146-54. SEEMAN, P. (1988) Tardive dyskinesia, dopamine receptors, and neuroleptic damage to cell membranes. J. Clin. Psychopharmacol. 8: 3S-9s. SEEMAN, P., BZOWEJ, N.H., GUAN, H.C., BERGERON, C. and REYNOLDS, G.P. (1987) Human brain Dl and D2 dopamine receptors in schizophrenia, Alzheimer’s, Parkinson’s, and Huntington’s diseases. Neuropsychopharmacol. 1: S-15. SEEMAN, P. and NIZNIK, H.B. (1990) Dopamine receptors and transporters in Parkinson’s disease and schizophrenia. FASEB 4: 2737-2744. SEEMAN, P., NIZNIK, H.B., GUAN, H.C., BOOTH, G, and ULPIAN, C. (1989) Link between Dl and D2 dopamine receptors is reduce in schizophrenia and Huntington diseased brain. Proc. Nat. Acad. Sci. USA 86: 10156-10160. SHETREAT, M.E., LIN, L., WONG, A.C. and RAYPORT, S. (1996) Visualization of Dl dopamine receptors on living nucleus accumbens neurons and their colocalization with D2 receptors. J. Neurochem. 66: 1475-82. SIBLEY, D.R. and MONSMA, F.J.J. (1992) Molecular biology of dopamine receptors. Trends in Pharmacol. Sci. 13: 61-69. SIMMONS, D.M., ARRIZA, J.L. and SWANSON, L.W. (1989) A complete protocol for in situ hybridization of messenger RNAs in brain and other tissues with radio-labeled single-stranded RNA probes. J. Histotechnol. 1_2: 169-181. SOKOLOFF, P., ANDRIEUX, M., BESANCON, R., PILON, C., MARTRES, M.P., GIROS, B. and SCHWARTZ, J.C. (1992) Pharmacology of human dopamine D3 receptor expressed in a mammalian cell line: Comparison with D2 receptor. Eur. J. Pharmacol. 225: 331-337. SOKOLOFF, P., GIROS, B., MARTRES, M.P., BOUTHENET, M.L. and SCHWARTZ, J.C. (1990) Molecular cloning and characterization of a novel dopamine receptor (D3) as a target for neuroleptics. Naturew: 146-151. STOOF, J.C. and KEBABIAN, J.W. (198 1) Opposing roles for D- 1 and D-2 dopamine receptors in efflux of cyclic AMP from rat neostriatum. Nature 294: 366-8. SURMEIER, D.J., REINER, A., LEVINE, MS. and ARIANO, M.A. (1993) Are neostriatal dopamine receptors co-localized? Trends Neurosci. 1_6:299-305. SURMEIER, D.J., SONG, W.J. and YAN, Z. (1996) Coordinated expression of dopamine receptors in neostriatal medium spiny neurons. J. Neurosci. 1_6:6579-91.

Colocaliition

of D 1 and D2 receptors using D2 antibody

1149

VANSCHEEUWIJCK, P., HUANG, Y., SCHULLERY, D. and REGAN, J.W. (1993) Antibodies to a human alpha 2-Cl0 adrenergic receptor fusion protein confirm the cytoplasmic orientation of the V-VI loop. B&hem. Biophysic. Res. Communic. _@: 340-346. VINCENT, S.L., KHAN, Y. and BENES, F.M. (1995) Cellular colocalization receptors in rat medial prefrontal cortex. Synapse 1_9: 112-20.

of dopamine Dl and D2

WAGNER, H., LUO, B., ARIANO, M., SIBLEY, D. and STELL, W. (1993) Localization of D2 dopamine receptors in vertebrate retinae with anti-peptide antibodies. J. Comp. Neurol. 331: 469-481. WEICK, B.G. and WALTERS, J.R. (1987) Effects of Dl and D2 dopamine receptor stimulation on the activity of substantia nigra pars reticulata neurons in 6-hydroxydopamine lesioned rats: Dl/DZ coactivation induces potentiated responses. Brain Res. 405: 234-46. WHITE, F.J. (1987) D- 1 dopamine receptor stimulation enables the inhibition of nucleus accumbens neurons by a D-2 receptor agonist. Eur. J. Pharmacol. 135: 101-S.

Inquiries and reprint requests should be addressed to:

Dr Guy Drolet Neuroscience

RC-9800, Centre de recherche du CHUL

2705 boulevard Laurier, Sainte-Foy (Quebec) GlV 4G2