- Email: [email protected]
cfMSP-1, an extremely acidic matrix protein involved in shell formation of the scallop Chlamys farreri
CBB-09876; No of Pages 8 Comparative Biochemistry and Physiology, Part B xxx (2015) xxx–xxx
Contents lists available at ScienceDirect
Comparative Biochemistry and Physiology, Part B journal homepage: www.elsevier.com/locate/cbpb
3Q4
Ganchu Jia a, Jian Liang a, Jun Xie a, Jun Wang a, Zhenmin Bao c, Liping Xie a,b,⁎, Rongqing Zhang a,b,⁎
O
F
2
cfMSP-1, an extremely acidic matrix protein involved in shell formation of the scallop Chlamys farreri
4 5 6
a
7
a r t i c l e
8 9 10 11 12
Article history: Received 8 November 2014 Received in revised form 9 March 2015 Accepted 22 March 2015 Available online xxxx
13 14 25 15 16 17
Keywords: cfMSP-1 Shell Biomineralization Chlamys farreri
i n f o
R O
Institute of Marine Biotechnology, School of Life Sciences, Tsinghua University, Beijing 100084, China Protein Science Laboratory of the Ministry of Education, Tsinghua University, Beijing 100084, China Key Laboratory of Marine Genetics and Breeding (MGB), Ministry of Education, College of Marine Life Sciences, Ocean University of China, Qingdao, China
a b s t r a c t
Matrix proteins play an important role in biomineralization by mollusks. In this study, we cloned and characterized an acidic protein (pI = 3.36) homolog of cfMSP-1 that is highly expressed in the mantle transcriptome of the scallop Chlamys farreri. RT-PCR and in situ hybridization showed that cfMSP-1 is specifically expressed in the outer fold of the mantle edge and pallial part. The expression level of cfMSP-1 remarkably increased and then reduced gradually to a value that is ~2-fold higher than basal levels after shell notching. Knock-down expression of cfMSP-1 in adults via dsRNA injection gave a disordered folia surface. Both shell notching and RNAi experiments indicated that cfMSP-1 plays an essential role in the formation of the folia of C. farreri. © 2015 Published by Elsevier Inc.
D
29 27 26
C
28
1. Introduction
31 32
Biomineralization is a widely existing phenomenon found in nature. Biomineralization is the process where minerals locate to form biominerals, and such structures have particular properties and are regulated by organic molecules from the organism (Travis, 1960; Weiner, 1979). The key point of this process is that all these inorganic minerals are under the control of the regulation of organic molecules (Hichens and Odgers, 1912; Lowenstam, 1981). Biomineralization products are used to build various organs, including bones, teeth, skeletons and mollusk shells, and biominerals are produced by various organisms from unicellular animals to mammals (Lowenstam and Weiner, 1989). For studying the biomineralization process, mollusk shells that consist of CaCO− 3 crystals and organic matrices (proteins, polysaccharides and lipids) are well studied (Lowenstam, 1981; Lowenstam and Weiner, 1989). Aragonite and calcite are the two major polymorphs of CaCO3 in mollusk shells (Addadi and Weiner, 1992; Schein et al., 1991), and these crystal units are usually arranged in an ordered fashion to form a special structure (Kobayashi and Samata, 2006). In the biomineralization process, the ‘organic-matrix-mediated’ process is well accepted. This process involves ions being introduced into the organic framework in an orderly fashion under the control of some key organic proteins (Lowenstam and Weiner, 1989). These
39 40 41 42 43 44 45 46 47 48 49 50 51
R
R
N C O
37 38
U
35 36
E
30
33 34
18 19 20 21 22 23 24
T
c
E
b
P
1Q3
⁎ Corresponding authors at: School of Life Sciences, Tsinghua University, Beijing, China. Tel./fax: +86 10 62772899. E-mail addresses: [email protected] (L. Xie), [email protected] (R. Zhang).
proteins are considered to control the location of nucleation, the speed of growth and the direction of growth (Jackson et al., 1988; Reilly and Burstein, 1974). Acidic proteins that are always found in the hard tissue fabricated by controlled biomineralization (Weiner and Addadi, 1991) are proposed to play key roles in the induction of oriented nucleation or inhibition of crystal growth through specific interactions with crystal surfaces. The majority of the acidic protein sequences have been obtained through molecular cloning and only a few by direct protein sequencing (Marin et al., 2007). Currently, 50 shell proteins have been identified and studied in the mollusk, Chlamys farreri (C. farreri) which is known as the Zhikong scallop and is widely distributed in the northern coastal provinces of China (Beninger et al., 1991). C. farreri is a very important economical oyster in China and the formation of the shell is closely linked to their growth. Therefore, studying the mechanism of C. farreri shell formation is important and of economic benefit. To better understand the shell formation process in C. farreri, our group has sequenced the transcriptome of the mantle, which is directly responsible for shell formation in mollusks (Shi et al., 2013). Using the reported matrix proteins as queries to interrogate the C. farreri mantle transcriptome datasets via tBLASTn, we have identified an unusually highly expressed DNA fragment homologous to MSP-1 (short for molluscan shell protein 1). MSP-1, an Asp-rich protein, is an acidic glycoprotein in molluscs that was initially isolated from the foliated calcite shell layer of the scallop Patinopecten yessoensis (Sarashina and Endo, 1998). The primary structure of MSP-1 in P. yessoensis was reported and is composed of 829 amino acids (Sarashina and Endo, 2001). The 323-amino acid MSP-2, which exhibits 91% identity with MSP-1, was found in the scallop P. yessoensis, and may be the shortened variant of
http://dx.doi.org/10.1016/j.cbpb.2015.03.004 1096-4959/© 2015 Published by Elsevier Inc.
Please cite this article as: Jia, G., et al., cfMSP-1, an extremely acidic matrix protein involved in shell formation of the scallop Chlamys farreri, Comp. Biochem. Physiol. B (2015), http://dx.doi.org/10.1016/j.cbpb.2015.03.004
52 53 54 55 Q5 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 Q6 76 77 78 79
103
2.1. Extraction of total RNA
104 105 Q7 106
Total RNA from the mantle tissue of C. farreri was extracted by using the TRIzol reagent (Life Technologies, California, USA, catalog number: 15596-026) according to the manufacturer's instructions.
107
2.2. Get the complete sequence of cfMSP-1
108 109
113 114
Three different primers were designed to get the open reading frame of cfMSP-1, based on the sequence of homologous unigenes of MSP-1. A SMARTer™ RACE cDNA amplification kit (Clontech) was used to rapidly amplify cDNA ends after getting the main sequence of cfMSP-1. RACE3′ and RACE5′ primers were used with the primers supplied with the 3′-and 5′-RACE kits respectively. And the primers Full1, Full2, Full3, Full4, and Full5 (Table 1, three PCR with different primers were used
t1:1 t1:2
Table 1 The sequences of the primers.
99 100
110 111 Q8 112
Name
Sequence
t1:4 t1:5 t1:6 t1:7 t1:8 t1:9 t1:10 t1:11 t1:12 t1:13 t1:14 t1:15 t1:16 t1:17 t1:18 t1:19 t1:20 t1:21 t1:22 t1:23 t1:24 t1:25 t1:26 t1:27
MSP1-5-1 MSP1-3-1 MSP1-5-2 MSP1-5-3 MSP1-3-3 RACE-3′-a RACE-3′-b RACE-5′-a RACE-5′-b Full1 Full2 Full3 Full4 Full5 β-actin-f β-actin-r qMSP-1-f qMSP-1-r RNAi-MSP-1-f RNAi-MSP-1-r RNAi-GFP-f RNAi-GFP-r MSP-I1-f MSP-I1-r
TCTCACTTTCGGCTGTACTGCTC TGCCTCCCTTACTACCTCCCTTA GTAACGGACTTTAGCAAACGAGAA TTTATGCTTCCTCCTCTGA GATGCCGATTCTGGTTCT ACTCTGCGTTGATACCACTGCTT TAGCAGTTCTGGCTCCTCTGGTGGT CTGGAGTCACCCTCTTCTTCATCAC GCACCACCGCCATCTTCAGC AACTTTTCTCTCACTTTCGGCTGTA CTCGTGGCATTAGCCGTTTCT CCTTGCCTCCCTTTCCTCCT ACTGGAAGAGGAGTCAGCGTCA AATGCCCAGTCCAGTTTCAAGA TTCTTGGGAATGGAATCTGC TCTGCGATACCTGGGAACAT GGTAACGGACTTTAGCAAACGAG CACCACCGCCATCTTCAGC GCGTAATACGACTCACTATAGGGAGAAATTCCGATGAATCTGGTGC GCGTAATACGACTCACTATAGGGAGACCATCGTTGGATGAGGAGTT CCGCTCGAGTTACTGTCGCCTACTTTGGATGTCT CCGCTCGAGTTATATTTTACATATGTAACCATAAGAGG GCGTAATACGACTCACTATAGGGAGAAATTCCGATGAATCTGGTGC GCGTAATACGACTCACTATAGGGAGACCATCGTTGGATGAGGAGTT
N
C
t1:3
U
The entire nucleotide sequence was analyzed by the BLAST program available from the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). The ORF Finder (http://www.ncbi. nlm.mih.gov/gorf/gorf.html) was used to deduce the amino sequence of cfMSP-1 and the signal peptide was predicted using SignalP 3.0. The secondary structure was predicted by Phyre2.
118 119
2.4. Real time quantitative PCR
124
120 121 122 123
Quantitative RT-PCR (RT-PCR) was used to quantify the expression levels of gene, using β-actin (primers are shown in Table 1) as an internal reference. Mx3000P™ (Stratagene) with an SYBRH Premix Ex Taq™ II kit (Takara) was used to finish the quantitative PCR and performed according to the manufacturer's instructions (primers for cfMSP-1 are shown in Table 1). The cycling parameters were as follows: 95 °C for 30 s (1 cycle), 95 °C for 5 s, 55 °C for 30 s and 72 °C for 45 s (40 cycles). The relative expression of specific gene was calculated through the 2−ΔΔT method (Livak and Schmittgen, 2001) and the expression level of phosphate buffered saline was normalized to a relative value of 1 as control. The experiment was repeated for three times, with the data showed as mean ± standard deviation. Significant difference between different groups was determined by Paired-samples T test (SPSS 19.0).
125
2.5. Gene expression analysis by RT-PCR
139
Using the methods above, total RNA was isolated from the mantle edge, mantle pallial, gonad, foot, gill, visceral mass and adductor muscles of adult individual scallops. Five individual scallops were taken for every sample. Equal quantities (1 μg) of total RNA from the different tissues were reverse-transcribed into cDNA according to the manufacturer's instructions. Quantitative RT-PCR was conducted using the primer pairs Actin-1/2 and qMSP-1/2 to amplify β-actin and cfMSP-1 gene fragments, respectively. Three replicates were performed for each sample.
140
2.6. In situ hybridization
149
To exactly localize the expression of cfMSP-1 in the mantle of the scallop, two specific primers MSP-I1-f and MSP-I1-r were designed (Table 1) for the amplification of the specific sequence of the coding region of cfMSP-1 following a normal PCR procedure. A 342-bp cpMSP-1 specific sequence was obtained. Digoxigenin-labeled RNA probes were synthesized from the linearized plasmid with the fragment encoding cfMSP-1 using the DIG RNA Labeling mix (Roche, Germany), T7 and SP6 RNA polymerase (Promega, USA). The mantle from the scallop was removed and immediately placed into 4% paraformaldehyde containing 0.1% DEPC, and left overnight. The Enhanced Sensible ISH Detection Kit II (AP) (Boster, China) was used to perform the in situ hybridization of cfMSP-1 mRNA on the frozen sections of the mantle at a temperature of 37 °C, the procedure was as follows: The frozen sections were post-fixed in 4% paraformaldehyde/0.1 M PBS (pH 7.2–7.3) for 30 min at room temperature, rinsed in distillation water for 5 min × 3. 3% citric acid diluted pepsin (adding two drops of pepsin in 1 ml 3% citric acid) was added to the frozen sections, staying for 120 s, and then rinsed in 0.5 M TBS for 5 min × 3 and distillation water for 5 min. A 20 μl prehybridization solution was added to every frozen section, staying for 4 h at 37 °C, and then removed by a pipette. The hybridization buffer containing a cfMSP-1 probe (2.0 μg/ml) was applied to the appropriate sections and hybridization was conducted in a sealed humid box at 37 °C for 12 h. The sections were washed in 2 × SSC at 37 °C for
150 151
D
97 98
117
T
95 96
C
93 94
E
91 92
R
89 90
R
87 88
O
86
2.3. Bioinformatic analysis
F
2. Materials and methods
84 85
O
102
82 83
to make three nested reaction, due to high repeatability of the 115 sequence) were used to confirm the full-length sequence. 116
P
101
MSP-1 (Hasegawa and Uchiyama, 2005). MSP-1 was found to be located in the mantle tissues through Northern Blot analysis, indicating that MSP-1 may be involved in shell formation (Sarashina and Endo, 2001). There are no other studies on the function and characterization of MSP-1. In this study, firstly we found 4 homologous unigenes of MSP-1, showing extremely high expression level in the mantle transcriptome data (Shi et al., 2013). Based on the transcriptome data, we designed three different pairs of primers to get the ORF of the homologous MSP-1 DNA fragment (named cfMSP-1 as below). Rapid amplification of the cDNA ends was performed to obtain the complete sequence of the cfMSP-1 in C. farreri. We analyzed the amino sequence and structural features of cfMSP-1 using bioinformatics tools. We also detected gene expression by real time-PCR in different tissues, and used in situ hybridization to determine the accurate location of cfMSP-1 expression. We used RNAi experiments and shell notching experiments to further study the bio-function of cfMSP-1. This is the first time the exact location of cfMSP-1 in mantle tissue has been presented and is also the first in vivo study of the function of cfMSP-1. Our study on cfMSP-1 provides a better understanding of the sophisticated process of biomineralization in C. farreri, and also provides future research directions to further study the biomineral process in C. farreri.
E
80 81
G. Jia et al. / Comparative Biochemistry and Physiology, Part B xxx (2015) xxx–xxx
R O
2
Please cite this article as: Jia, G., et al., cfMSP-1, an extremely acidic matrix protein involved in shell formation of the scallop Chlamys farreri, Comp. Biochem. Physiol. B (2015), http://dx.doi.org/10.1016/j.cbpb.2015.03.004
126 127 128 129 130 131 132 133 134 135 136 137 Q9 138
141 142 143 144 145 146 147 148
152 153 154 Q10 155 156 157 158 159 160 161 162 163 Q11 164 Q12 165 166 167 Q13 168 169 170 171 172
G. Jia et al. / Comparative Biochemistry and Physiology, Part B xxx (2015) xxx–xxx
173 174
2.7. Shell notching
185 186
The shell notching experiments were performed according to the method described in Mount et al. (2004) with some modifications. A 4–8 mm flat notch was cut on the shell margin of adult individuals
2.8. Silencing of MSP-1
198
RNAi assays were performed as described by Suzuki et al. (2009) with some modifications and scallop primers (RNAi-MSP-1-f and RNAi-MSP-1-r) (Table 1) were used to amplify specific sequences from the cfMSP-1 coding region. For GFP dsRNA synthesis, pEGFP-C1
199
U
N C O
R
R
E
C
T
E
D
P
R O
187
188 189
O
184
and then the shell-injured scallops were randomly divided into seven groups, with each group containing three individuals. The seven groups were returned to seawater tanks in an aquarium at 20 °C for 0, 6, 12, 24, 36, 48, 72 and 96 h. Then these adult individuals were sacrificed and the entire mantle tissues extracted from the same group pooled and stored in liquid nitrogen. Total RNA of the mantle tissue of the same group was extracted and then reverse transcribed into cDNA, as described above. Quantitative RT-PCR was performed to quantify the expression level of cfMSP-1 at different time points following shell injury, with β-actin expression as the internal reference.
F
5 min × 2, in 0.5× SSC at 37 °C at 37 °C for 15 min, and in 0.2× SSC at 37 °C for 15 min. Blocking solution was added to the sections, staying 175 Q14 at 37 °C for 30 min. After that, the blocking solution was shaken off. 176 Then the sections were incubated in biotin-labeled goat anti-mouse an177 tibody at 37 °C for 1 h, rinsed in 0.5 M × TBS for 5 min × 4 times, and in178 cubated in SABC-AP at 37 °C for 30 min, rinsed in 0.5 M × TBS for 179 5 min × 4 times. The sections were incubated with the complex solution 180 of NBT and BCIP for 5–10 min to conduct the alkaline phosphatase reac181 tion .0.5 mol/l TBS was used to stop the reaction. These sections were 182 mounted on water-soluble closure reagent. The negative controls 183 were conducted as above but in the absence of a labeled probe.
3
Q2 Q1
Fig. 1. cDNA sequence and deduced amino acid sequence of MSP-1 from the scallop C. farreri (GenBank accession No. KM67324). The start codon and the stop codon are boxed.
Please cite this article as: Jia, G., et al., cfMSP-1, an extremely acidic matrix protein involved in shell formation of the scallop Chlamys farreri, Comp. Biochem. Physiol. B (2015), http://dx.doi.org/10.1016/j.cbpb.2015.03.004
190 191 192 193 194 195 196 197
200 201 202
G. Jia et al. / Comparative Biochemistry and Physiology, Part B xxx (2015) xxx–xxx
T
E
D
P
R O
O
F
4
production system (T7) kit (Promega) was used to synthesize the 206 dsRNA of cfMSP-1 and GFP. A NanoDrop 2000 UV–Vis Spectrophotom- 207 eter was used to detect the purity and concentration of the dsRNA. 208
C
O
R
R
E
(Clontech) was used as the template, and RNAi-GFP-f and RNAi-GFP-r were used as primers (Table 1). PCR products were purified by the TIANgel Midi Purification kit. The RiboMAX™ large scale RNA
N
204 205
U
203
C
Fig. 2. The analysis of the amino sequence of MSP-1. (A) Schematic showing the deduced domain architecture of MSP-1. The numbers represent the position of the amino acids, S, signal peptide; N, N-terminus; B, basic domain; SGD, SGD domain; Repeat, repeat modules; C, C-terminus. (B) Shows the domain modules of the highly conserved repeat modules. (C) Shows the amino sequence of the domains in the highly conserved repeat modules 1 (repeat 1), as an example. (D) The amino sequences of the four D domains in the four highly conserved repeats.
Fig. 3. The comparison of the amino acid sequences between Patinopecten yessoensis and Chlamys farreri. The upper amino acid sequence is from Chlamys farreri, the lower amino acid sequence is from Patinopecten yessoensis. The number in the right side is amino acid number. The yellow part is the same sequence part they shared.
Please cite this article as: Jia, G., et al., cfMSP-1, an extremely acidic matrix protein involved in shell formation of the scallop Chlamys farreri, Comp. Biochem. Physiol. B (2015), http://dx.doi.org/10.1016/j.cbpb.2015.03.004
5
O
F
G. Jia et al. / Comparative Biochemistry and Physiology, Part B xxx (2015) xxx–xxx
Fig. 6. Real time PCR analysis of MSP-1 expression after shell notching. The β-actin housekeeping gene was used as an internal reference. The first group represents the normal expression level of MSP-1 in the scallop and represents the control group. The other groups are the expression level of MSP-1 following shell notching.
217 218 219
2.9. Microstructure changes in the shell by SEM after gene silencing
221
The microstructure of the control group and the shells from the dsRNA injected groups were observed by scanning electron microscopy (SEM), the 10 shells of each treatment were observed. First, the internal face of the shell was cleaned, and naturally dried after washing thoroughly with distilled water. The shell was cut into pieces of less than 3 mm, and these pieces were coated with gold–palladium using an ion
R
R
N C O
225 226
P
3.1. cDNA cloning and sequence analysis of cfMSP-1 Based on the MSP-1 DNA fragment identified from the results of tBLASTn between the P. yessoensis MSP-1 sequence and C. farreri mantle transcriptome datasets, and with several rounds of PCR, 5′ RACE and 3′ RACE reactions, we finally obtained a 2912-bp product that included a 74-bp 5′-untranslated region, a 2406-bp open reading frame and a 432-bp 3′-untranslated region. This product showed 85% identity with the gene sequence of MSP-1 from P. yessoensis. The cDNA sequence of cfMSP-1 was submitted to the GenBank with the accession No. KM67324. The open reading frame of the cDNA encodes a protein of 801 amino acid residues, and the first 20 amino acids are predicted to comprise a signal peptide that is processed in the endoplasmic reticulum and subsequently the protein is secreted from the cell. The calculated mass of cfMSP-1, assuming no posttranslational modifications, is 71.3 kDa. The
U
223 224
E
220
222
D
215 216
3. Results and discussion
E
213 214
sputtering system. The microstructures of samples were observed by 227 SEM (FEI Quanta 200). 228
T
211 212
The dsRNA product with an OD260/OD280 value between 1.8 and 2.0 was reserved and then diluted to 40 μg/100 μl or 80 μg/100 μl using PBS. 100 μl (40 μg/100 μl) and 100 μl (80 μg/100 μl) cfMSP-1 dsRNA were injected into the adductor muscle of adult individuals with a shell length of 45–55 mm. Five individuals were used for each treatment. Total RNA from the mantle tissue of each treatment was pooled and extracted six days after injection and then reverse transcribed into cDNA, as described above. Quantitative RT-PCR was used to quantify the expression levels of cfMSP-1 after silencing, where β-actin was used as an internal reference. The quantitative PCR was performed as stated above.
C
209 210
R O
Fig. 4. Tissue-specific gene expression of MSP-1 by RT-PCR analysis. Total RNA extracted from foot (Foot), visceral mass (Vis), gill (Gill), gonad (Gon), adductor (Add), mantle pallial and mantle edge was used for RT-PCR. The housekeeping gene β-actin was used as the positive control.
Fig. 5. Detection of MSP-1 mRNA in the mantle of scallop by in situ hybridization. (A) Hybridization signals (dark purple) in the outer fold and pallial part are indicated by arrowheads. OF, outer fold; MF, middle fold; IF, inner fold. Bar = 200 μm. (B) Enlargement of box in A and experimental section stained with MSP-1 mRNA probe is marked by arrowheads. Bar = 100 μm. (C) Control section stained with a sense probe, Bar = 200 μm. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
Please cite this article as: Jia, G., et al., cfMSP-1, an extremely acidic matrix protein involved in shell formation of the scallop Chlamys farreri, Comp. Biochem. Physiol. B (2015), http://dx.doi.org/10.1016/j.cbpb.2015.03.004
229 230 231 232 233 234 235 236 237 238 239 Q15 240 241 242 243 244
G. Jia et al. / Comparative Biochemistry and Physiology, Part B xxx (2015) xxx–xxx
U
N
C
O
R
R
E
C
T
E
D
P
R O
O
F
6
Please cite this article as: Jia, G., et al., cfMSP-1, an extremely acidic matrix protein involved in shell formation of the scallop Chlamys farreri, Comp. Biochem. Physiol. B (2015), http://dx.doi.org/10.1016/j.cbpb.2015.03.004
G. Jia et al. / Comparative Biochemistry and Physiology, Part B xxx (2015) xxx–xxx
245 246
isoelectric point of the deduced amino acid sequence of cfMSP-1 is 3.36; thus the protein is an acidic protein. The deduced amino acid sequence 247 shares 88.3% similarity with P. yessoensis MSP-1, which was found in the 248 shell (Sarashina and Endo, 1998) in amino acid sequence. And cfMSP-1 249 contains a high proportion of Ser (33.8%), Gly (22.6%) and Asp (21.5%) 250 amino acids. The serine residues are putatively phosphorylated and 251 the phosphorylated protein could coordinate calcium ions more easily 252 (George and Veis, 2008). Bioinformatic analysis revealed a highly mod253 ular structure. All these are typical characteristics for matrix proteins in 254 the mollusk. Based on these, we predicted that MSP-1 was a matrix pro255 Q16 tein and occurred in the shell (Fig. 1). 3.2. Modular structure of cfMSP-1
3.3. Identification of cfMSP-1 in the scallop mantle
297 298
To examine the mRNA expression pattern of cfMSP-1 in the adult C. farreri, we used quantitative RT-PCR to detect the expression pattern of cfMSP-1 in eight different tissues. The RT-PCR results showed that cfMSP-1 was specifically expressed at the edge of the mantle (Fig. 4). Combined with the results of the signal peptide prediction, the results
299 300 301
3.4. cfMSP-1 expression after shell notching
309
We noted the expression level of cfMSP-1 at every time point after shell notching by making a small cut into the shell to check the response of cfMSP-1 in the shell regeneration process. As shown in Fig. 6, it was clearly seen that the expression level increased following shell notching and reached the highest level of expression (~5-fold above the normal level) after 12 h following the cut into the shell. The expression level then decreased gradually to a stable level that is ~ 2-fold higher than the normal level. In conclusion, the expression level of cfMSP-1 increased rapidly when shell regeneration began, and reached the highest level after 12 h. The cfMSP-1 level stayed above the basal level during the regeneration process. This result indicated that cfMSP-1 may be essential during shell regeneration, and may play a key role in the formation of the shell.
310
R O
P
304 305 306 307 308
311 312 313 314 315 316 317 318 319 320 321 322 323
RNAi is a powerful reverse genetic tool that has been used widely to silence gene expression in mollusks (Suzuki et al., 2009). An RNAi assay was used to further understand the role of cfMSP-1 in shell formation in vivo. Using the PBS-injected group and EGFP-injected group as the control groups, the expression levels of cfMSP-1 were found to decrease by ~33.5% for the 40 μg MSP-1-injected groups and 35.5% for the 80 μg cfMSP-1-injected groups 6 days after treatment (Fig. 7). The normal shell of C. farreri consists of two kinds of microstructures: the inner surface corresponding to the adductor has a prismatic structure, whereas the other part of the shell has a foliated structure (Lin et al., 2014). The SEM results showed obvious morphology changes on the inner surface of the foliated layer for the two different dosagecfMSP-1 dsRNA-injected groups when compared with the morphology of the shell for the control group. Fig. 7B and C shows the inner surface of a normal shell: blade-like elongated parallel laths were arranged side-to-side, forming overlapping sheets. The terminal end of the lath showed a well-formed rhombohedral appearance (Fig. 7C). In contrast, in the cfMSP-1 dsRNA low dosage-injected group (40 μg) there is no typical foliated structure growth pattern on the inner surface of the shell (Fig. 7D, E). This abnormal phenomenon was also obvious in the high dosage (80 μg) dsRNA-injected group. The morphology of the other parts of the shell, including the aragonite prismatic layer, was not affected by the cfMSP-1 dsRNA-injection (data not shown), indicating that cfMSP-1 plays a key function in the formation of the foliated layer in C. farreri.
324
4. Conclusions
349
cfMSP-1 is an acidic protein which has a high proportion of Ser, Gly and Asp and expressed in the mantle specifically. It also shares 85% identity in gene sequence and 88.3% identity in amino acid sequence with MSP-1, which was found in the shell. The alignment between the domains of these two showed that they share major identity in the domains. Based on this, we predicted that MSP-1 was a matrix protein and occurred in the shell. With shell notching and in vivo silencing
350 351 Q19
D
3.5. Microstructure changes in the shell after in vivo silencing of cfMSP-1
E
T
C
E
R
R
N C O
U
296
302 303
O
257
Analysis of the predicted amino acid sequence showed that cfMSP-1 258 has a special repeated modular structure (Fig. 2A), in which four 259 very similar modules are arranged and a highly conserved unit is re260 peated in the central part of each module (Fig. 2B), while MSP-1 in 261 P. yessoensis has a similar modular structure (Fig. 3). 262 The amino-terminal domain of cfMSP-1 is 46-aa in length, and the 263 Q17 predicted secondary structure by the Chou and Fasman (1978) method 264 indicated that α-helices were only found in this domain. The N-terminal 265 domain is followed by a basic domain, which has a high amount of Lys 266 residues as KXXX. Following the basic domain there is a 17-aa SGD 267 domain that has a high content of serine, glycine and aspartic acid 268 residues. 269 Here, four highly similar modules are in tandem and a highly con270 served unit is repeated in the central part of every module (Fig. 2B). 271 Each module contains three domains called the “SG”, “D”, and “K” do272 mains (Sarashina and Endo, 1998) (Fig. 2B). The SG domains of the 4 re273 peated units are ~40 residues in length, and are almost solely composed 274 of serine and glycine residues. As we all know, flexible linkers, which are 275 always present between adjacent domains, are generally composed of 276 small, non-polar (e.g., Gly) or polar (e.g., Ser or Thr) amino acids 277 (Argos, 1990). As a result, we inferred that the SG domains function as 278 flexible linkers to aid the function of the D domain. 279 By analyzing the amino acids of these four D domains, it is clear that 280 these domains have a high-percentage of Asp residues (38.95%) and 281 they have the same amino acid sequence. Asp-rich domains in shell 282 proteins presumably play an essential role as templates on which epi283 taxial growth of the mineral phase takes place (Weiner and Hood, 284 1975). Moreover, each D domain contains two S-D-E motifs (Fig. 2D). 285 Fam20C phosphorylated secretory pathway proteins with S-x-E motifs, 286 such as caseins and several secreted proteins, have been reported to be 287 implicated in biomineralization (Tagliabracci et al., 2012). Fam20C ho288 mologs were found in the mantle transcriptome of C. farreri (Shi et al., 289 2013). Based on all of these observations, we inferred that cfMSP-1 290 Q18 may be phosphorylated by a homologous Fam20C through some specif291 ic mechanism, and such phosphorylation may be crucial for cfMSP-1 ac292 tivity in biomineralization of C. farreri. However, further studies on the 293 interactions between cfMSP-1 and a Fam20C homolog are required to 294 understand the importance of the possible phosphorylation process in 295 cfMSP-1 activity.
of the PCR analysis suggest that cfMSP-1 was synthesized in the mantle and then secreted for function. For obtaining an accurate location of cfMSP-1, in situ hybridization was used to find the specific location in the mantle edge. From the results (Fig. 5), it is clearly observed that cfMSP-l is specifically expressed in the outer fold of the mantle edge and pallial, marked with arrowheads in Fig. 5.
F
256
7
Fig. 7. Real time PCR analysis and the SEM result of in vivo silencing of MSP-1. (A) Expression levels of MSP-1 were found to decrease by MSP-1 RNAi. As a control, the expression level of the PBS-injected group stayed relatively constant. The SEM of MSP-1 silencing on shell formation. (B) Inner surface of the normal shell; (D) inner surface of the shells for the 40 μg MSP-1 dsRNA-injected group; and (F) inner surface of the shells from the 80 μg MSP-1 dsRNA-injected group. (C), (E) and (G) are enlargements of the box shown in (B), (D) and (F), respectively.
Please cite this article as: Jia, G., et al., cfMSP-1, an extremely acidic matrix protein involved in shell formation of the scallop Chlamys farreri, Comp. Biochem. Physiol. B (2015), http://dx.doi.org/10.1016/j.cbpb.2015.03.004
325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348
352 353 354 355 356
8
363 Q20 5. Uncited references
F
367 368
Kong et al., 2009 Sudo et al., 1997 Tsukamoto et al., 2004 Yan et al., 2007 Yano et al., 2006 Acknowledgments
370
373
This study was funded by the National High Technology Research and Development Program of China (863 Program, 2012AA092204) and National Basic Research Program of China (973 Program, 2010CB126405).
374
References
375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393
Addadi, L., Weiner, S., 1992. Control and design principles in biological mineralization. Angew. Chem. Int. Ed. Engl. 31, 153–169. Argos, P., 1990. An investigation of oligopeptides linking domains in protein tertiary structures and possible candidates for general gene fusion. J. Mol. Biol. 211, 943–958. Beninger, P., Le Pennec, M., Shumway, S., 1991. Scallops: biology, ecology and aquaculture. Scallops: Biology, Ecology and Aquaculture. Dev. Aquacult. Fish. Sci. 21. George, A., Veis, A., 2008. Phosphorylated proteins and control over apatite nucleation, crystal growth, and inhibition. Chem. Rev. 108, 4670–4693. Hasegawa, Y., Uchiyama, K., 2005. cDNA clonings of shell matrix proteins from scallop shell. Fish. Sci. 71, 1174–1178. Hichens, P.S., Odgers, N., 1912. A case of vegetable gastrolith. Br. Med. J. 1, 606. Jackson, A., Vincent, J., Turner, R., 1988. The mechanical design of nacre. Proc. R. Soc. Lond. Ser. B Biol. Sci. 234, 415–440. Kobayashi, I., Samata, T., 2006. Bivalve shell structure and organic matrix. Mater. Sci. Eng. C 26, 692–698. Kong, Y., Jing, G., Yan, Z., Li, C., Gong, N., Zhu, F., Li, D., Zhang, Y., Zheng, G., Wang, H., 2009. Cloning and characterization of Prisilkin-39, a novel matrix protein serving a dual role in the prismatic layer formation from the oyster Pinctada fucata. J. Biol. Chem. 284, 10841–10854.
C
E
R R O C N U
371 372
T
369
O
365 366
R O
364
P
361 362
Lin, Y., Jia, G., Xu, G., Su, J., Xie, L., Hu, X., Zhang, R., 2014. Cloning and characterization of the shell matrix protein Shematrin in scallop Chlamys farreri. Acta Biochim. Biophys. Sin. (gmu054). Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCT method. Methods 25, 402–408. Lowenstam, H.A., 1981. Minerals formed by organisms. Science 211, 1126–1131. Lowenstam, H.A., Weiner, S., 1989. On Biomineralization. Oxford University Press. Marin, F., Luquet, G., Marie, B., Medakovic, D., 2007. Molluscan shell proteins: primary structure, origin, and evolution. Curr. Top. Dev. Biol. 80, 209–276. Mount, A.S., Wheeler, A., Paradkar, R.P., Snider, D., 2004. Hemocyte-mediated shell mineralization in the eastern oyster. Science 304, 297–300. Reilly, D.T., Burstein, A.H., 1974. The mechanical properties of cortical bone. J. Bone Joint Surg. 56, 1001–1022. Sarashina, I., Endo, K., 1998. Primary structure of a soluble matrix protein of scallop shell: implications for calcium carbonate biomineralization. Am. Mineral. 83, 1510–1515. Sarashina, I., Endo, K., 2001. The complete primary structure of molluscan shell protein 1 (MSP-1), an acidic glycoprotein in the shell matrix of the scallop Patinopecten yessoensis. Mar. Biotechnol. 3, 362–369. Schein, E., Roux, M., Barbin, V., Chiesi, F., Renard, M., Rio, M., 1991. Ecological parameters recorded by bivalve shell — pluridisciplinary approach. Bull. Soc. Geol. Fr. 162, 687–698. Shi, M., Lin, Y., Xu, G., Xie, L., Hu, X., Bao, Z., Zhang, R., 2013. Characterization of the Zhikong scallop (Chlamys farreri) mantle transcriptome and identification of biomineralization-related genes. Mar. Biotechnol. 15, 706–715. Sudo, S., Fujikawa, T., Nagakura, T., Ohkubo, T., Sakaguchi, K., Tanaka, M., Nakashima, K., Takahashi, T., 1997. Structures of mollusc shell framework proteins. Nature 387, 563–564. Suzuki, M., Saruwatari, K., Kogure, T., Yamamoto, Y., Nishimura, T., Kato, T., Nagasawa, H., 2009. An acidic matrix protein, Pif, is a key macromolecule for nacre formation. Science 325, 1388–1390. Tagliabracci, V.S., Engel, J.L., Wen, J., Wiley, S.E., Worby, C.A., Kinch, L.N., Xiao, J., Grishin, N.V., Dixon, J.E., 2012. Secreted kinase phosphorylates extracellular proteins that regulate biomineralization. Science 336, 1150–1153. Travis, D.F., 1960. The deposition of skeletal structures in the Crustacea. I. The histology of the gastrolith skeletal tissue complex and the gastrolith in the crayfish, Orconectes (Cambarus) virilis Hagen — Decapoda. Biol. Bull. 118, 137–149. Tsukamoto, D., Sarashina, I., Endo, K., 2004. Structure and expression of an unusually acidic matrix protein of pearl oyster shells. Biochem. Biophys. Res. Commun. 320, 1175–1180. Weiner, S., 1979. Aspartic acid-rich proteins: major components of the soluble organic matrix of mollusk shells. Calcif. Tissue Int. 29, 163–167. Weiner, S., Hood, L., 1975. Soluble protein of the organic matrix of mollusk shells: a potential template for shell formation. Science 190, 987–989. Yan, Z., Jing, G., Gong, N., Li, C., Zhou, Y., Xie, L., Zhang, R., 2007. N40, a novel nonacidic matrix protein from pearl oyster nacre, facilitates nucleation of aragonite in vitro. Biomacromolecules 8, 3597–3601. Yano, M., Nagai, K., Morimoto, K., Miyamoto, H., 2006. Shematrin: a family of glycine-rich structural proteins in the shell of the pearl oyster Pinctada fucata. Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 144, 254–262.
D
359 360
experiments, cfMSP-1 was found to play a key function in the formation of the foliated layer in C. farreri. The analysis of amino acid sequence revealed that cfMSP-1 may be phosphorylated through an S-D-E motif by a Fam20C homolog to regulate the formation of the folia shell. However, more related studies are required to understand the specific mechanism of cfMSP-1 on shell formation.
E
357 358
G. Jia et al. / Comparative Biochemistry and Physiology, Part B xxx (2015) xxx–xxx
Please cite this article as: Jia, G., et al., cfMSP-1, an extremely acidic matrix protein involved in shell formation of the scallop Chlamys farreri, Comp. Biochem. Physiol. B (2015), http://dx.doi.org/10.1016/j.cbpb.2015.03.004
394 395 396 Q21 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441
Contents lists available at ScienceDirect
Comparative Biochemistry and Physiology, Part B journal homepage: www.elsevier.com/locate/cbpb
3Q4
Ganchu Jia a, Jian Liang a, Jun Xie a, Jun Wang a, Zhenmin Bao c, Liping Xie a,b,⁎, Rongqing Zhang a,b,⁎
O
F
2
cfMSP-1, an extremely acidic matrix protein involved in shell formation of the scallop Chlamys farreri
4 5 6
a
7
a r t i c l e
8 9 10 11 12
Article history: Received 8 November 2014 Received in revised form 9 March 2015 Accepted 22 March 2015 Available online xxxx
13 14 25 15 16 17
Keywords: cfMSP-1 Shell Biomineralization Chlamys farreri
i n f o
R O
Institute of Marine Biotechnology, School of Life Sciences, Tsinghua University, Beijing 100084, China Protein Science Laboratory of the Ministry of Education, Tsinghua University, Beijing 100084, China Key Laboratory of Marine Genetics and Breeding (MGB), Ministry of Education, College of Marine Life Sciences, Ocean University of China, Qingdao, China
a b s t r a c t
Matrix proteins play an important role in biomineralization by mollusks. In this study, we cloned and characterized an acidic protein (pI = 3.36) homolog of cfMSP-1 that is highly expressed in the mantle transcriptome of the scallop Chlamys farreri. RT-PCR and in situ hybridization showed that cfMSP-1 is specifically expressed in the outer fold of the mantle edge and pallial part. The expression level of cfMSP-1 remarkably increased and then reduced gradually to a value that is ~2-fold higher than basal levels after shell notching. Knock-down expression of cfMSP-1 in adults via dsRNA injection gave a disordered folia surface. Both shell notching and RNAi experiments indicated that cfMSP-1 plays an essential role in the formation of the folia of C. farreri. © 2015 Published by Elsevier Inc.
D
29 27 26
C
28
1. Introduction
31 32
Biomineralization is a widely existing phenomenon found in nature. Biomineralization is the process where minerals locate to form biominerals, and such structures have particular properties and are regulated by organic molecules from the organism (Travis, 1960; Weiner, 1979). The key point of this process is that all these inorganic minerals are under the control of the regulation of organic molecules (Hichens and Odgers, 1912; Lowenstam, 1981). Biomineralization products are used to build various organs, including bones, teeth, skeletons and mollusk shells, and biominerals are produced by various organisms from unicellular animals to mammals (Lowenstam and Weiner, 1989). For studying the biomineralization process, mollusk shells that consist of CaCO− 3 crystals and organic matrices (proteins, polysaccharides and lipids) are well studied (Lowenstam, 1981; Lowenstam and Weiner, 1989). Aragonite and calcite are the two major polymorphs of CaCO3 in mollusk shells (Addadi and Weiner, 1992; Schein et al., 1991), and these crystal units are usually arranged in an ordered fashion to form a special structure (Kobayashi and Samata, 2006). In the biomineralization process, the ‘organic-matrix-mediated’ process is well accepted. This process involves ions being introduced into the organic framework in an orderly fashion under the control of some key organic proteins (Lowenstam and Weiner, 1989). These
39 40 41 42 43 44 45 46 47 48 49 50 51
R
R
N C O
37 38
U
35 36
E
30
33 34
18 19 20 21 22 23 24
T
c
E
b
P
1Q3
⁎ Corresponding authors at: School of Life Sciences, Tsinghua University, Beijing, China. Tel./fax: +86 10 62772899. E-mail addresses: [email protected] (L. Xie), [email protected] (R. Zhang).
proteins are considered to control the location of nucleation, the speed of growth and the direction of growth (Jackson et al., 1988; Reilly and Burstein, 1974). Acidic proteins that are always found in the hard tissue fabricated by controlled biomineralization (Weiner and Addadi, 1991) are proposed to play key roles in the induction of oriented nucleation or inhibition of crystal growth through specific interactions with crystal surfaces. The majority of the acidic protein sequences have been obtained through molecular cloning and only a few by direct protein sequencing (Marin et al., 2007). Currently, 50 shell proteins have been identified and studied in the mollusk, Chlamys farreri (C. farreri) which is known as the Zhikong scallop and is widely distributed in the northern coastal provinces of China (Beninger et al., 1991). C. farreri is a very important economical oyster in China and the formation of the shell is closely linked to their growth. Therefore, studying the mechanism of C. farreri shell formation is important and of economic benefit. To better understand the shell formation process in C. farreri, our group has sequenced the transcriptome of the mantle, which is directly responsible for shell formation in mollusks (Shi et al., 2013). Using the reported matrix proteins as queries to interrogate the C. farreri mantle transcriptome datasets via tBLASTn, we have identified an unusually highly expressed DNA fragment homologous to MSP-1 (short for molluscan shell protein 1). MSP-1, an Asp-rich protein, is an acidic glycoprotein in molluscs that was initially isolated from the foliated calcite shell layer of the scallop Patinopecten yessoensis (Sarashina and Endo, 1998). The primary structure of MSP-1 in P. yessoensis was reported and is composed of 829 amino acids (Sarashina and Endo, 2001). The 323-amino acid MSP-2, which exhibits 91% identity with MSP-1, was found in the scallop P. yessoensis, and may be the shortened variant of
http://dx.doi.org/10.1016/j.cbpb.2015.03.004 1096-4959/© 2015 Published by Elsevier Inc.
Please cite this article as: Jia, G., et al., cfMSP-1, an extremely acidic matrix protein involved in shell formation of the scallop Chlamys farreri, Comp. Biochem. Physiol. B (2015), http://dx.doi.org/10.1016/j.cbpb.2015.03.004
52 53 54 55 Q5 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 Q6 76 77 78 79
103
2.1. Extraction of total RNA
104 105 Q7 106
Total RNA from the mantle tissue of C. farreri was extracted by using the TRIzol reagent (Life Technologies, California, USA, catalog number: 15596-026) according to the manufacturer's instructions.
107
2.2. Get the complete sequence of cfMSP-1
108 109
113 114
Three different primers were designed to get the open reading frame of cfMSP-1, based on the sequence of homologous unigenes of MSP-1. A SMARTer™ RACE cDNA amplification kit (Clontech) was used to rapidly amplify cDNA ends after getting the main sequence of cfMSP-1. RACE3′ and RACE5′ primers were used with the primers supplied with the 3′-and 5′-RACE kits respectively. And the primers Full1, Full2, Full3, Full4, and Full5 (Table 1, three PCR with different primers were used
t1:1 t1:2
Table 1 The sequences of the primers.
99 100
110 111 Q8 112
Name
Sequence
t1:4 t1:5 t1:6 t1:7 t1:8 t1:9 t1:10 t1:11 t1:12 t1:13 t1:14 t1:15 t1:16 t1:17 t1:18 t1:19 t1:20 t1:21 t1:22 t1:23 t1:24 t1:25 t1:26 t1:27
MSP1-5-1 MSP1-3-1 MSP1-5-2 MSP1-5-3 MSP1-3-3 RACE-3′-a RACE-3′-b RACE-5′-a RACE-5′-b Full1 Full2 Full3 Full4 Full5 β-actin-f β-actin-r qMSP-1-f qMSP-1-r RNAi-MSP-1-f RNAi-MSP-1-r RNAi-GFP-f RNAi-GFP-r MSP-I1-f MSP-I1-r
TCTCACTTTCGGCTGTACTGCTC TGCCTCCCTTACTACCTCCCTTA GTAACGGACTTTAGCAAACGAGAA TTTATGCTTCCTCCTCTGA GATGCCGATTCTGGTTCT ACTCTGCGTTGATACCACTGCTT TAGCAGTTCTGGCTCCTCTGGTGGT CTGGAGTCACCCTCTTCTTCATCAC GCACCACCGCCATCTTCAGC AACTTTTCTCTCACTTTCGGCTGTA CTCGTGGCATTAGCCGTTTCT CCTTGCCTCCCTTTCCTCCT ACTGGAAGAGGAGTCAGCGTCA AATGCCCAGTCCAGTTTCAAGA TTCTTGGGAATGGAATCTGC TCTGCGATACCTGGGAACAT GGTAACGGACTTTAGCAAACGAG CACCACCGCCATCTTCAGC GCGTAATACGACTCACTATAGGGAGAAATTCCGATGAATCTGGTGC GCGTAATACGACTCACTATAGGGAGACCATCGTTGGATGAGGAGTT CCGCTCGAGTTACTGTCGCCTACTTTGGATGTCT CCGCTCGAGTTATATTTTACATATGTAACCATAAGAGG GCGTAATACGACTCACTATAGGGAGAAATTCCGATGAATCTGGTGC GCGTAATACGACTCACTATAGGGAGACCATCGTTGGATGAGGAGTT
N
C
t1:3
U
The entire nucleotide sequence was analyzed by the BLAST program available from the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). The ORF Finder (http://www.ncbi. nlm.mih.gov/gorf/gorf.html) was used to deduce the amino sequence of cfMSP-1 and the signal peptide was predicted using SignalP 3.0. The secondary structure was predicted by Phyre2.
118 119
2.4. Real time quantitative PCR
124
120 121 122 123
Quantitative RT-PCR (RT-PCR) was used to quantify the expression levels of gene, using β-actin (primers are shown in Table 1) as an internal reference. Mx3000P™ (Stratagene) with an SYBRH Premix Ex Taq™ II kit (Takara) was used to finish the quantitative PCR and performed according to the manufacturer's instructions (primers for cfMSP-1 are shown in Table 1). The cycling parameters were as follows: 95 °C for 30 s (1 cycle), 95 °C for 5 s, 55 °C for 30 s and 72 °C for 45 s (40 cycles). The relative expression of specific gene was calculated through the 2−ΔΔT method (Livak and Schmittgen, 2001) and the expression level of phosphate buffered saline was normalized to a relative value of 1 as control. The experiment was repeated for three times, with the data showed as mean ± standard deviation. Significant difference between different groups was determined by Paired-samples T test (SPSS 19.0).
125
2.5. Gene expression analysis by RT-PCR
139
Using the methods above, total RNA was isolated from the mantle edge, mantle pallial, gonad, foot, gill, visceral mass and adductor muscles of adult individual scallops. Five individual scallops were taken for every sample. Equal quantities (1 μg) of total RNA from the different tissues were reverse-transcribed into cDNA according to the manufacturer's instructions. Quantitative RT-PCR was conducted using the primer pairs Actin-1/2 and qMSP-1/2 to amplify β-actin and cfMSP-1 gene fragments, respectively. Three replicates were performed for each sample.
140
2.6. In situ hybridization
149
To exactly localize the expression of cfMSP-1 in the mantle of the scallop, two specific primers MSP-I1-f and MSP-I1-r were designed (Table 1) for the amplification of the specific sequence of the coding region of cfMSP-1 following a normal PCR procedure. A 342-bp cpMSP-1 specific sequence was obtained. Digoxigenin-labeled RNA probes were synthesized from the linearized plasmid with the fragment encoding cfMSP-1 using the DIG RNA Labeling mix (Roche, Germany), T7 and SP6 RNA polymerase (Promega, USA). The mantle from the scallop was removed and immediately placed into 4% paraformaldehyde containing 0.1% DEPC, and left overnight. The Enhanced Sensible ISH Detection Kit II (AP) (Boster, China) was used to perform the in situ hybridization of cfMSP-1 mRNA on the frozen sections of the mantle at a temperature of 37 °C, the procedure was as follows: The frozen sections were post-fixed in 4% paraformaldehyde/0.1 M PBS (pH 7.2–7.3) for 30 min at room temperature, rinsed in distillation water for 5 min × 3. 3% citric acid diluted pepsin (adding two drops of pepsin in 1 ml 3% citric acid) was added to the frozen sections, staying for 120 s, and then rinsed in 0.5 M TBS for 5 min × 3 and distillation water for 5 min. A 20 μl prehybridization solution was added to every frozen section, staying for 4 h at 37 °C, and then removed by a pipette. The hybridization buffer containing a cfMSP-1 probe (2.0 μg/ml) was applied to the appropriate sections and hybridization was conducted in a sealed humid box at 37 °C for 12 h. The sections were washed in 2 × SSC at 37 °C for
150 151
D
97 98
117
T
95 96
C
93 94
E
91 92
R
89 90
R
87 88
O
86
2.3. Bioinformatic analysis
F
2. Materials and methods
84 85
O
102
82 83
to make three nested reaction, due to high repeatability of the 115 sequence) were used to confirm the full-length sequence. 116
P
101
MSP-1 (Hasegawa and Uchiyama, 2005). MSP-1 was found to be located in the mantle tissues through Northern Blot analysis, indicating that MSP-1 may be involved in shell formation (Sarashina and Endo, 2001). There are no other studies on the function and characterization of MSP-1. In this study, firstly we found 4 homologous unigenes of MSP-1, showing extremely high expression level in the mantle transcriptome data (Shi et al., 2013). Based on the transcriptome data, we designed three different pairs of primers to get the ORF of the homologous MSP-1 DNA fragment (named cfMSP-1 as below). Rapid amplification of the cDNA ends was performed to obtain the complete sequence of the cfMSP-1 in C. farreri. We analyzed the amino sequence and structural features of cfMSP-1 using bioinformatics tools. We also detected gene expression by real time-PCR in different tissues, and used in situ hybridization to determine the accurate location of cfMSP-1 expression. We used RNAi experiments and shell notching experiments to further study the bio-function of cfMSP-1. This is the first time the exact location of cfMSP-1 in mantle tissue has been presented and is also the first in vivo study of the function of cfMSP-1. Our study on cfMSP-1 provides a better understanding of the sophisticated process of biomineralization in C. farreri, and also provides future research directions to further study the biomineral process in C. farreri.
E
80 81
G. Jia et al. / Comparative Biochemistry and Physiology, Part B xxx (2015) xxx–xxx
R O
2
Please cite this article as: Jia, G., et al., cfMSP-1, an extremely acidic matrix protein involved in shell formation of the scallop Chlamys farreri, Comp. Biochem. Physiol. B (2015), http://dx.doi.org/10.1016/j.cbpb.2015.03.004
126 127 128 129 130 131 132 133 134 135 136 137 Q9 138
141 142 143 144 145 146 147 148
152 153 154 Q10 155 156 157 158 159 160 161 162 163 Q11 164 Q12 165 166 167 Q13 168 169 170 171 172
G. Jia et al. / Comparative Biochemistry and Physiology, Part B xxx (2015) xxx–xxx
173 174
2.7. Shell notching
185 186
The shell notching experiments were performed according to the method described in Mount et al. (2004) with some modifications. A 4–8 mm flat notch was cut on the shell margin of adult individuals
2.8. Silencing of MSP-1
198
RNAi assays were performed as described by Suzuki et al. (2009) with some modifications and scallop primers (RNAi-MSP-1-f and RNAi-MSP-1-r) (Table 1) were used to amplify specific sequences from the cfMSP-1 coding region. For GFP dsRNA synthesis, pEGFP-C1
199
U
N C O
R
R
E
C
T
E
D
P
R O
187
188 189
O
184
and then the shell-injured scallops were randomly divided into seven groups, with each group containing three individuals. The seven groups were returned to seawater tanks in an aquarium at 20 °C for 0, 6, 12, 24, 36, 48, 72 and 96 h. Then these adult individuals were sacrificed and the entire mantle tissues extracted from the same group pooled and stored in liquid nitrogen. Total RNA of the mantle tissue of the same group was extracted and then reverse transcribed into cDNA, as described above. Quantitative RT-PCR was performed to quantify the expression level of cfMSP-1 at different time points following shell injury, with β-actin expression as the internal reference.
F
5 min × 2, in 0.5× SSC at 37 °C at 37 °C for 15 min, and in 0.2× SSC at 37 °C for 15 min. Blocking solution was added to the sections, staying 175 Q14 at 37 °C for 30 min. After that, the blocking solution was shaken off. 176 Then the sections were incubated in biotin-labeled goat anti-mouse an177 tibody at 37 °C for 1 h, rinsed in 0.5 M × TBS for 5 min × 4 times, and in178 cubated in SABC-AP at 37 °C for 30 min, rinsed in 0.5 M × TBS for 179 5 min × 4 times. The sections were incubated with the complex solution 180 of NBT and BCIP for 5–10 min to conduct the alkaline phosphatase reac181 tion .0.5 mol/l TBS was used to stop the reaction. These sections were 182 mounted on water-soluble closure reagent. The negative controls 183 were conducted as above but in the absence of a labeled probe.
3
Q2 Q1
Fig. 1. cDNA sequence and deduced amino acid sequence of MSP-1 from the scallop C. farreri (GenBank accession No. KM67324). The start codon and the stop codon are boxed.
Please cite this article as: Jia, G., et al., cfMSP-1, an extremely acidic matrix protein involved in shell formation of the scallop Chlamys farreri, Comp. Biochem. Physiol. B (2015), http://dx.doi.org/10.1016/j.cbpb.2015.03.004
190 191 192 193 194 195 196 197
200 201 202
G. Jia et al. / Comparative Biochemistry and Physiology, Part B xxx (2015) xxx–xxx
T
E
D
P
R O
O
F
4
production system (T7) kit (Promega) was used to synthesize the 206 dsRNA of cfMSP-1 and GFP. A NanoDrop 2000 UV–Vis Spectrophotom- 207 eter was used to detect the purity and concentration of the dsRNA. 208
C
O
R
R
E
(Clontech) was used as the template, and RNAi-GFP-f and RNAi-GFP-r were used as primers (Table 1). PCR products were purified by the TIANgel Midi Purification kit. The RiboMAX™ large scale RNA
N
204 205
U
203
C
Fig. 2. The analysis of the amino sequence of MSP-1. (A) Schematic showing the deduced domain architecture of MSP-1. The numbers represent the position of the amino acids, S, signal peptide; N, N-terminus; B, basic domain; SGD, SGD domain; Repeat, repeat modules; C, C-terminus. (B) Shows the domain modules of the highly conserved repeat modules. (C) Shows the amino sequence of the domains in the highly conserved repeat modules 1 (repeat 1), as an example. (D) The amino sequences of the four D domains in the four highly conserved repeats.
Fig. 3. The comparison of the amino acid sequences between Patinopecten yessoensis and Chlamys farreri. The upper amino acid sequence is from Chlamys farreri, the lower amino acid sequence is from Patinopecten yessoensis. The number in the right side is amino acid number. The yellow part is the same sequence part they shared.
Please cite this article as: Jia, G., et al., cfMSP-1, an extremely acidic matrix protein involved in shell formation of the scallop Chlamys farreri, Comp. Biochem. Physiol. B (2015), http://dx.doi.org/10.1016/j.cbpb.2015.03.004
5
O
F
G. Jia et al. / Comparative Biochemistry and Physiology, Part B xxx (2015) xxx–xxx
Fig. 6. Real time PCR analysis of MSP-1 expression after shell notching. The β-actin housekeeping gene was used as an internal reference. The first group represents the normal expression level of MSP-1 in the scallop and represents the control group. The other groups are the expression level of MSP-1 following shell notching.
217 218 219
2.9. Microstructure changes in the shell by SEM after gene silencing
221
The microstructure of the control group and the shells from the dsRNA injected groups were observed by scanning electron microscopy (SEM), the 10 shells of each treatment were observed. First, the internal face of the shell was cleaned, and naturally dried after washing thoroughly with distilled water. The shell was cut into pieces of less than 3 mm, and these pieces were coated with gold–palladium using an ion
R
R
N C O
225 226
P
3.1. cDNA cloning and sequence analysis of cfMSP-1 Based on the MSP-1 DNA fragment identified from the results of tBLASTn between the P. yessoensis MSP-1 sequence and C. farreri mantle transcriptome datasets, and with several rounds of PCR, 5′ RACE and 3′ RACE reactions, we finally obtained a 2912-bp product that included a 74-bp 5′-untranslated region, a 2406-bp open reading frame and a 432-bp 3′-untranslated region. This product showed 85% identity with the gene sequence of MSP-1 from P. yessoensis. The cDNA sequence of cfMSP-1 was submitted to the GenBank with the accession No. KM67324. The open reading frame of the cDNA encodes a protein of 801 amino acid residues, and the first 20 amino acids are predicted to comprise a signal peptide that is processed in the endoplasmic reticulum and subsequently the protein is secreted from the cell. The calculated mass of cfMSP-1, assuming no posttranslational modifications, is 71.3 kDa. The
U
223 224
E
220
222
D
215 216
3. Results and discussion
E
213 214
sputtering system. The microstructures of samples were observed by 227 SEM (FEI Quanta 200). 228
T
211 212
The dsRNA product with an OD260/OD280 value between 1.8 and 2.0 was reserved and then diluted to 40 μg/100 μl or 80 μg/100 μl using PBS. 100 μl (40 μg/100 μl) and 100 μl (80 μg/100 μl) cfMSP-1 dsRNA were injected into the adductor muscle of adult individuals with a shell length of 45–55 mm. Five individuals were used for each treatment. Total RNA from the mantle tissue of each treatment was pooled and extracted six days after injection and then reverse transcribed into cDNA, as described above. Quantitative RT-PCR was used to quantify the expression levels of cfMSP-1 after silencing, where β-actin was used as an internal reference. The quantitative PCR was performed as stated above.
C
209 210
R O
Fig. 4. Tissue-specific gene expression of MSP-1 by RT-PCR analysis. Total RNA extracted from foot (Foot), visceral mass (Vis), gill (Gill), gonad (Gon), adductor (Add), mantle pallial and mantle edge was used for RT-PCR. The housekeeping gene β-actin was used as the positive control.
Fig. 5. Detection of MSP-1 mRNA in the mantle of scallop by in situ hybridization. (A) Hybridization signals (dark purple) in the outer fold and pallial part are indicated by arrowheads. OF, outer fold; MF, middle fold; IF, inner fold. Bar = 200 μm. (B) Enlargement of box in A and experimental section stained with MSP-1 mRNA probe is marked by arrowheads. Bar = 100 μm. (C) Control section stained with a sense probe, Bar = 200 μm. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
Please cite this article as: Jia, G., et al., cfMSP-1, an extremely acidic matrix protein involved in shell formation of the scallop Chlamys farreri, Comp. Biochem. Physiol. B (2015), http://dx.doi.org/10.1016/j.cbpb.2015.03.004
229 230 231 232 233 234 235 236 237 238 239 Q15 240 241 242 243 244
G. Jia et al. / Comparative Biochemistry and Physiology, Part B xxx (2015) xxx–xxx
U
N
C
O
R
R
E
C
T
E
D
P
R O
O
F
6
Please cite this article as: Jia, G., et al., cfMSP-1, an extremely acidic matrix protein involved in shell formation of the scallop Chlamys farreri, Comp. Biochem. Physiol. B (2015), http://dx.doi.org/10.1016/j.cbpb.2015.03.004
G. Jia et al. / Comparative Biochemistry and Physiology, Part B xxx (2015) xxx–xxx
245 246
isoelectric point of the deduced amino acid sequence of cfMSP-1 is 3.36; thus the protein is an acidic protein. The deduced amino acid sequence 247 shares 88.3% similarity with P. yessoensis MSP-1, which was found in the 248 shell (Sarashina and Endo, 1998) in amino acid sequence. And cfMSP-1 249 contains a high proportion of Ser (33.8%), Gly (22.6%) and Asp (21.5%) 250 amino acids. The serine residues are putatively phosphorylated and 251 the phosphorylated protein could coordinate calcium ions more easily 252 (George and Veis, 2008). Bioinformatic analysis revealed a highly mod253 ular structure. All these are typical characteristics for matrix proteins in 254 the mollusk. Based on these, we predicted that MSP-1 was a matrix pro255 Q16 tein and occurred in the shell (Fig. 1). 3.2. Modular structure of cfMSP-1
3.3. Identification of cfMSP-1 in the scallop mantle
297 298
To examine the mRNA expression pattern of cfMSP-1 in the adult C. farreri, we used quantitative RT-PCR to detect the expression pattern of cfMSP-1 in eight different tissues. The RT-PCR results showed that cfMSP-1 was specifically expressed at the edge of the mantle (Fig. 4). Combined with the results of the signal peptide prediction, the results
299 300 301
3.4. cfMSP-1 expression after shell notching
309
We noted the expression level of cfMSP-1 at every time point after shell notching by making a small cut into the shell to check the response of cfMSP-1 in the shell regeneration process. As shown in Fig. 6, it was clearly seen that the expression level increased following shell notching and reached the highest level of expression (~5-fold above the normal level) after 12 h following the cut into the shell. The expression level then decreased gradually to a stable level that is ~ 2-fold higher than the normal level. In conclusion, the expression level of cfMSP-1 increased rapidly when shell regeneration began, and reached the highest level after 12 h. The cfMSP-1 level stayed above the basal level during the regeneration process. This result indicated that cfMSP-1 may be essential during shell regeneration, and may play a key role in the formation of the shell.
310
R O
P
304 305 306 307 308
311 312 313 314 315 316 317 318 319 320 321 322 323
RNAi is a powerful reverse genetic tool that has been used widely to silence gene expression in mollusks (Suzuki et al., 2009). An RNAi assay was used to further understand the role of cfMSP-1 in shell formation in vivo. Using the PBS-injected group and EGFP-injected group as the control groups, the expression levels of cfMSP-1 were found to decrease by ~33.5% for the 40 μg MSP-1-injected groups and 35.5% for the 80 μg cfMSP-1-injected groups 6 days after treatment (Fig. 7). The normal shell of C. farreri consists of two kinds of microstructures: the inner surface corresponding to the adductor has a prismatic structure, whereas the other part of the shell has a foliated structure (Lin et al., 2014). The SEM results showed obvious morphology changes on the inner surface of the foliated layer for the two different dosagecfMSP-1 dsRNA-injected groups when compared with the morphology of the shell for the control group. Fig. 7B and C shows the inner surface of a normal shell: blade-like elongated parallel laths were arranged side-to-side, forming overlapping sheets. The terminal end of the lath showed a well-formed rhombohedral appearance (Fig. 7C). In contrast, in the cfMSP-1 dsRNA low dosage-injected group (40 μg) there is no typical foliated structure growth pattern on the inner surface of the shell (Fig. 7D, E). This abnormal phenomenon was also obvious in the high dosage (80 μg) dsRNA-injected group. The morphology of the other parts of the shell, including the aragonite prismatic layer, was not affected by the cfMSP-1 dsRNA-injection (data not shown), indicating that cfMSP-1 plays a key function in the formation of the foliated layer in C. farreri.
324
4. Conclusions
349
cfMSP-1 is an acidic protein which has a high proportion of Ser, Gly and Asp and expressed in the mantle specifically. It also shares 85% identity in gene sequence and 88.3% identity in amino acid sequence with MSP-1, which was found in the shell. The alignment between the domains of these two showed that they share major identity in the domains. Based on this, we predicted that MSP-1 was a matrix protein and occurred in the shell. With shell notching and in vivo silencing
350 351 Q19
D
3.5. Microstructure changes in the shell after in vivo silencing of cfMSP-1
E
T
C
E
R
R
N C O
U
296
302 303
O
257
Analysis of the predicted amino acid sequence showed that cfMSP-1 258 has a special repeated modular structure (Fig. 2A), in which four 259 very similar modules are arranged and a highly conserved unit is re260 peated in the central part of each module (Fig. 2B), while MSP-1 in 261 P. yessoensis has a similar modular structure (Fig. 3). 262 The amino-terminal domain of cfMSP-1 is 46-aa in length, and the 263 Q17 predicted secondary structure by the Chou and Fasman (1978) method 264 indicated that α-helices were only found in this domain. The N-terminal 265 domain is followed by a basic domain, which has a high amount of Lys 266 residues as KXXX. Following the basic domain there is a 17-aa SGD 267 domain that has a high content of serine, glycine and aspartic acid 268 residues. 269 Here, four highly similar modules are in tandem and a highly con270 served unit is repeated in the central part of every module (Fig. 2B). 271 Each module contains three domains called the “SG”, “D”, and “K” do272 mains (Sarashina and Endo, 1998) (Fig. 2B). The SG domains of the 4 re273 peated units are ~40 residues in length, and are almost solely composed 274 of serine and glycine residues. As we all know, flexible linkers, which are 275 always present between adjacent domains, are generally composed of 276 small, non-polar (e.g., Gly) or polar (e.g., Ser or Thr) amino acids 277 (Argos, 1990). As a result, we inferred that the SG domains function as 278 flexible linkers to aid the function of the D domain. 279 By analyzing the amino acids of these four D domains, it is clear that 280 these domains have a high-percentage of Asp residues (38.95%) and 281 they have the same amino acid sequence. Asp-rich domains in shell 282 proteins presumably play an essential role as templates on which epi283 taxial growth of the mineral phase takes place (Weiner and Hood, 284 1975). Moreover, each D domain contains two S-D-E motifs (Fig. 2D). 285 Fam20C phosphorylated secretory pathway proteins with S-x-E motifs, 286 such as caseins and several secreted proteins, have been reported to be 287 implicated in biomineralization (Tagliabracci et al., 2012). Fam20C ho288 mologs were found in the mantle transcriptome of C. farreri (Shi et al., 289 2013). Based on all of these observations, we inferred that cfMSP-1 290 Q18 may be phosphorylated by a homologous Fam20C through some specif291 ic mechanism, and such phosphorylation may be crucial for cfMSP-1 ac292 tivity in biomineralization of C. farreri. However, further studies on the 293 interactions between cfMSP-1 and a Fam20C homolog are required to 294 understand the importance of the possible phosphorylation process in 295 cfMSP-1 activity.
of the PCR analysis suggest that cfMSP-1 was synthesized in the mantle and then secreted for function. For obtaining an accurate location of cfMSP-1, in situ hybridization was used to find the specific location in the mantle edge. From the results (Fig. 5), it is clearly observed that cfMSP-l is specifically expressed in the outer fold of the mantle edge and pallial, marked with arrowheads in Fig. 5.
F
256
7
Fig. 7. Real time PCR analysis and the SEM result of in vivo silencing of MSP-1. (A) Expression levels of MSP-1 were found to decrease by MSP-1 RNAi. As a control, the expression level of the PBS-injected group stayed relatively constant. The SEM of MSP-1 silencing on shell formation. (B) Inner surface of the normal shell; (D) inner surface of the shells for the 40 μg MSP-1 dsRNA-injected group; and (F) inner surface of the shells from the 80 μg MSP-1 dsRNA-injected group. (C), (E) and (G) are enlargements of the box shown in (B), (D) and (F), respectively.
Please cite this article as: Jia, G., et al., cfMSP-1, an extremely acidic matrix protein involved in shell formation of the scallop Chlamys farreri, Comp. Biochem. Physiol. B (2015), http://dx.doi.org/10.1016/j.cbpb.2015.03.004
325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348
352 353 354 355 356
8
363 Q20 5. Uncited references
F
367 368
Kong et al., 2009 Sudo et al., 1997 Tsukamoto et al., 2004 Yan et al., 2007 Yano et al., 2006 Acknowledgments
370
373
This study was funded by the National High Technology Research and Development Program of China (863 Program, 2012AA092204) and National Basic Research Program of China (973 Program, 2010CB126405).
374
References
375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393
Addadi, L., Weiner, S., 1992. Control and design principles in biological mineralization. Angew. Chem. Int. Ed. Engl. 31, 153–169. Argos, P., 1990. An investigation of oligopeptides linking domains in protein tertiary structures and possible candidates for general gene fusion. J. Mol. Biol. 211, 943–958. Beninger, P., Le Pennec, M., Shumway, S., 1991. Scallops: biology, ecology and aquaculture. Scallops: Biology, Ecology and Aquaculture. Dev. Aquacult. Fish. Sci. 21. George, A., Veis, A., 2008. Phosphorylated proteins and control over apatite nucleation, crystal growth, and inhibition. Chem. Rev. 108, 4670–4693. Hasegawa, Y., Uchiyama, K., 2005. cDNA clonings of shell matrix proteins from scallop shell. Fish. Sci. 71, 1174–1178. Hichens, P.S., Odgers, N., 1912. A case of vegetable gastrolith. Br. Med. J. 1, 606. Jackson, A., Vincent, J., Turner, R., 1988. The mechanical design of nacre. Proc. R. Soc. Lond. Ser. B Biol. Sci. 234, 415–440. Kobayashi, I., Samata, T., 2006. Bivalve shell structure and organic matrix. Mater. Sci. Eng. C 26, 692–698. Kong, Y., Jing, G., Yan, Z., Li, C., Gong, N., Zhu, F., Li, D., Zhang, Y., Zheng, G., Wang, H., 2009. Cloning and characterization of Prisilkin-39, a novel matrix protein serving a dual role in the prismatic layer formation from the oyster Pinctada fucata. J. Biol. Chem. 284, 10841–10854.
C
E
R R O C N U
371 372
T
369
O
365 366
R O
364
P
361 362
Lin, Y., Jia, G., Xu, G., Su, J., Xie, L., Hu, X., Zhang, R., 2014. Cloning and characterization of the shell matrix protein Shematrin in scallop Chlamys farreri. Acta Biochim. Biophys. Sin. (gmu054). Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCT method. Methods 25, 402–408. Lowenstam, H.A., 1981. Minerals formed by organisms. Science 211, 1126–1131. Lowenstam, H.A., Weiner, S., 1989. On Biomineralization. Oxford University Press. Marin, F., Luquet, G., Marie, B., Medakovic, D., 2007. Molluscan shell proteins: primary structure, origin, and evolution. Curr. Top. Dev. Biol. 80, 209–276. Mount, A.S., Wheeler, A., Paradkar, R.P., Snider, D., 2004. Hemocyte-mediated shell mineralization in the eastern oyster. Science 304, 297–300. Reilly, D.T., Burstein, A.H., 1974. The mechanical properties of cortical bone. J. Bone Joint Surg. 56, 1001–1022. Sarashina, I., Endo, K., 1998. Primary structure of a soluble matrix protein of scallop shell: implications for calcium carbonate biomineralization. Am. Mineral. 83, 1510–1515. Sarashina, I., Endo, K., 2001. The complete primary structure of molluscan shell protein 1 (MSP-1), an acidic glycoprotein in the shell matrix of the scallop Patinopecten yessoensis. Mar. Biotechnol. 3, 362–369. Schein, E., Roux, M., Barbin, V., Chiesi, F., Renard, M., Rio, M., 1991. Ecological parameters recorded by bivalve shell — pluridisciplinary approach. Bull. Soc. Geol. Fr. 162, 687–698. Shi, M., Lin, Y., Xu, G., Xie, L., Hu, X., Bao, Z., Zhang, R., 2013. Characterization of the Zhikong scallop (Chlamys farreri) mantle transcriptome and identification of biomineralization-related genes. Mar. Biotechnol. 15, 706–715. Sudo, S., Fujikawa, T., Nagakura, T., Ohkubo, T., Sakaguchi, K., Tanaka, M., Nakashima, K., Takahashi, T., 1997. Structures of mollusc shell framework proteins. Nature 387, 563–564. Suzuki, M., Saruwatari, K., Kogure, T., Yamamoto, Y., Nishimura, T., Kato, T., Nagasawa, H., 2009. An acidic matrix protein, Pif, is a key macromolecule for nacre formation. Science 325, 1388–1390. Tagliabracci, V.S., Engel, J.L., Wen, J., Wiley, S.E., Worby, C.A., Kinch, L.N., Xiao, J., Grishin, N.V., Dixon, J.E., 2012. Secreted kinase phosphorylates extracellular proteins that regulate biomineralization. Science 336, 1150–1153. Travis, D.F., 1960. The deposition of skeletal structures in the Crustacea. I. The histology of the gastrolith skeletal tissue complex and the gastrolith in the crayfish, Orconectes (Cambarus) virilis Hagen — Decapoda. Biol. Bull. 118, 137–149. Tsukamoto, D., Sarashina, I., Endo, K., 2004. Structure and expression of an unusually acidic matrix protein of pearl oyster shells. Biochem. Biophys. Res. Commun. 320, 1175–1180. Weiner, S., 1979. Aspartic acid-rich proteins: major components of the soluble organic matrix of mollusk shells. Calcif. Tissue Int. 29, 163–167. Weiner, S., Hood, L., 1975. Soluble protein of the organic matrix of mollusk shells: a potential template for shell formation. Science 190, 987–989. Yan, Z., Jing, G., Gong, N., Li, C., Zhou, Y., Xie, L., Zhang, R., 2007. N40, a novel nonacidic matrix protein from pearl oyster nacre, facilitates nucleation of aragonite in vitro. Biomacromolecules 8, 3597–3601. Yano, M., Nagai, K., Morimoto, K., Miyamoto, H., 2006. Shematrin: a family of glycine-rich structural proteins in the shell of the pearl oyster Pinctada fucata. Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 144, 254–262.
D
359 360
experiments, cfMSP-1 was found to play a key function in the formation of the foliated layer in C. farreri. The analysis of amino acid sequence revealed that cfMSP-1 may be phosphorylated through an S-D-E motif by a Fam20C homolog to regulate the formation of the folia shell. However, more related studies are required to understand the specific mechanism of cfMSP-1 on shell formation.
E
357 358
G. Jia et al. / Comparative Biochemistry and Physiology, Part B xxx (2015) xxx–xxx
Please cite this article as: Jia, G., et al., cfMSP-1, an extremely acidic matrix protein involved in shell formation of the scallop Chlamys farreri, Comp. Biochem. Physiol. B (2015), http://dx.doi.org/10.1016/j.cbpb.2015.03.004
394 395 396 Q21 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441