- Email: [email protected]
Changes in arginase isoenzymes pattern in human hepatocellular carcinoma
Biochemical and Biophysical Research Communications 377 (2008) 337–340
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Changes in arginase isoenzymes pattern in human hepatocellular carcinoma Alicja Chrzanowska a, Marek Krawczyk b, Anna Baran´czyk-Kuz´ma a,* a b
Chair and Department of Biochemistry, Medical University of Warsaw, Warsaw 02-097, Banacha 1a, Poland Department of General, Transplant and Liver Surgery, Medical University of Warsaw, Poland
a r t i c l e
i n f o
Article history: Received 12 September 2008 Available online 1 October 2008
Keywords: Arginase Activity Isoenzymes Expression Hepatocellular Carcinoma
a b s t r a c t Hepatocellular carcinoma (HCC) is one of the most common tumors worldwide affecting preferentially patients with liver cirrhosis. The studies were performed on tissues obtained during surgery from 50 patients with HCC, 40 with liver cirrhosis and 40 control livers. It was found that arginase activity in HCC was nearly 5- and 15-fold lower than in cirrhotic and normal livers, respectively. Isoenzymes AI (so-called liver-type arginase) and AII (extrahepatic arginase) were identified by Western blotting in all studied tissues, however the amount of AI, as well as the expression of AI-mRNA were lower in HCC, in comparison with normal liver, and those of AII were significantly higher. Since HCC is arginine-dependent, and arginine is essential for cells growth, the decrease of AI may preserve this amino acid within tumor cells. Concurrently, the rise of AII can increase the level of polyamines, compounds crucial for cells proliferation. Thus, both arginase isoenzymes seem to participate in liver cancerogenesis. Ó 2008 Elsevier Inc. All rights reserved.
Hepatocellular carcinoma (HCC) is one of the most common fatal malignant neoplasm world-wide. The main risk factors for HCC development are liver cirrhosis (about 80% of all cases) and chronic infection with the hepatitis B and C viruses [1]. In early stages liver cancer usually presents with no symptoms. Most hepatocellular carcinomas are first suspected based on the results of CAT or ultrasound scans. There is lack of highly specific marker for the diagnosis of HCC. At present, the most common is alphafetoprotein, however its level increases only in about 70% of cases [2,3]. The potentially curative treatment for patients with HCC is surgery. Unfortunately only a small number of patients are suitable candidates for either surgical resection or liver transplantation because of tumor extension and/or poor hepatic function [4]. Liver is the most metabolically active organ. In humans, among the crucial pathways localized in liver, there is the urea cycle. The last enzyme of the cycle is arginase (EC 3.5.3.1) that hydrolyzes Larginine to urea and L-ornithine. The presence of two distinct genes for arginase has been established. The gene for arginase AI (socalled liver-type arginase) is assigned to chromosome band 6q23 and arginase AII (so-called extrahepatic arginase) at chromosome 14q24.1-24.3 [5,6]. Arginase AI is a cytosolic enzyme that plays a fundamental role in the urea cycle. Arginase AII is a mitochondrial isoform, and its function is not clear. Among all human tissues, liver expresses the highest arginase activity [7]. Thus, changes in arginase activity and/or in the profile of its isoenzymes may reflect liver disorders including carcinogenesis. As yet there are no studies on arginase in hepatocellular carcinoma in humans. * Corresponding author. Fax: +48 22 5720 679. E-mail address: [email protected] (A. Baran´czyk-Kuz´ma). 0006-291X/$ - see front matter Ó 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2008.09.093
In the current work, we studied arginase activity and the expression of its isoenzymes in tumor tissues obtained from patients with HCC in comparison with cirrhotic and normal liver. We tried to established the possible role of arginase isoenzymes in pathogenesis of this liver-specific tumor. Materials and methods Patients and tissues. The study contained tumor tissues obtained from 50 patients with HCC during surgery, samples of cirrhotic liver obtained during liver transplantation from 40 patients with liver cirrhosis, and 40 histologically normal liver tissues (control) removed 6–7 cm from the border of benign or metastatic tumors of patients with haemangioma (n = 4), adenoma hepatocellular (n = 3), focal nodular hyperplasia (n = 3), and colorectal cancer liver metastases (CRCLM, n = 30). All patients were treated in the Department of General Transplant and Liver Surgery, at the Medical University of Warsaw. The group with HCC contained 18 females and 32 males with a median age of 57.3 ± 9.1 (range 29–73 years) (T1–T4N0M0, T3N1M0). The group with liver cirrhosis contained 16 females and 24 males, age 44.6 ± 7.2 (range 21–59 years), and the control group 22 females and 18 males, age 56.4 ± 9.8 (range 32–76 years. The patients were diagnosed by increased level of plasma a-fetoprotein (patients with HCC), CEA (patients with CRCLM), ultrasound sonography and computed tomography. The studies were approved by the Bioethics Committee of the Medical University of Warsaw, and informed consent was obtained from all patients. Methods. Immediately after surgical removal, the tissues were washed in 0.9% NaCl and frozen at 80 °C. The frozen tissue were cut and homogenized in 10 vol. of 50 mmol/l Tris–HCl buffer, pH
A. Chrzanowska et al. / Biochemical and Biophysical Research Communications 377 (2008) 337–340
7.5 containing 1 mmol/l MnCl2, 0.2 mol/l KCl and 0.1% (v/v) Triton X-100. After extraction, the homogenates were centrifuged at 12,000g for 30 min at 4° C and obtained supernatants were used for arginase activity determination, Western blotting and ion-exchange chromatography. Arginase activity was measured by determining the increase in the amount of ornithine, according to Chinard [8]. One unit (U) of enzymatic activity was defined as 1 lmol of the product formed per minute at 37 °C, and expressed per 1 g of wet tissue. Western blotting was performed after electrophoresis in 14% polyacrylamide gel according to Laemmli [9], with rabbit anti-bovine arginase AI and AII polyclonal antibodies (Res. Diagn. Inc., and Santa Cruz Biotech. Inc., USA). Arginase AI from bovine liver and AII from human kidney were used as standards. Blots were visualized using ECL plus Western Blotting Detection System (Amersham). Ion-exchange chromatography was performed on CM-cellulose to column (10 1,5 cm) equilibrated with 20 mM Tris–HCl buffer, 7.5. The not adsorbed arginase AII (anionic isoform) was eluted with the same buffer, and the adsorbed arginase AI (cationic isoform), with a linear KCl gradient (0.5–1.0 mol/l). Total RNA was isolated from studied tissues by modified method of acid guanidine thiocyanate-phenol-chloroform extraction using TRIzolÒ reagent (Invitrogen), according to manufacturer’s protocol [10]. Expression level of mRNA for arginase AI and AII was defined by reverse transcriptase-polymerase chain reaction (RT-PCR). Specific oligonucleotide primers for arginase isoenzymes were based on nucleotide sequences in NCBI accession nos. for ARGI: NM000045 and for ARGII BC029050, and were as follows: for arginase AI: TGCAACTGCTGTGTTCACTG (forward), TGATGTTG ACGGACTGGACC (reverse), for arginase AII: GTTAGCAGAGCTGTG TCAGA (forward), GGAGTTGTGGTACCTTATCC (reverse). The specific mRNA sequence for b2-microglobulin (housekeeping gene) was amplified as described by Brophy et al.[11], and served as an internal control (forward primer: CCAGCAGAGAATGGAAAGTC, reverse primer: GATGCTGCTTACATGTCTCG). PCR products were separated on 1.5% agarose gel with ethidium bromide. The level of specific mRNA was measured and expressed in semi-quantitative way as the ratio of optical density band of AI and AII to optical density band of b2-microglobulin. The assay was repeated 2 times for each sample and performed in duplicate. System UVI-KS4000, Syngen Biotech. was used for densitometric analysis of Western blotting and RT-PCR results. Results were expressed as means ± SD. Quantitative comparison between studied groups was performed by Student’s t-test using Statistica software (StatSoft 6.1) and non-parametric Mann-Whitney U-test.
160 mean mean±error std mean±SD
140
Arginase activity , U/g tissue
338
120 100 80 60 40 20
I
II
III
Fig. 1. Arginase activity at different clinical stage of hepatocellular carcinoma. Activity was determined in resected tumors obtained from the patients classified according to IUCC. Group I contained 14 patients (T1N0M0), group II 16 patients (T2N0M0), and group III 20 patients (T3,T4N0M0, n = 3; T3N1M0, n = 17).
mean of 1330.7 ± 480.8 U/g. Significant decrease in arginase activity was observed in cirrhotic liver (P < 0.001) with the mean of 520.3 ± 209.2 U/g (range from 147.6 to 888.5 U/g). In HCC arginase activity ranged from 23.2 to 194.6 U/g with the means of 93.4 ± 43.2 U/g (Table 1). The mean activity was nearly 15-fold lower than in control liver and it was independent of the clinical stage of the patients (Fig. 1). Arginase isoenzymes AI and AII were identified by Western blotting in both control liver and HCC (Fig. 2A and B). When separated by ion-exchange chromatography they contained about 90%
A
1
2
3
4
5
6
1
2
3
4
5
6
B
Results Arginase activity in control liver obtained 6–7 cm from border of 10 benign tumors ranged from 978.4 to 2165.7 U/g wet tissue, with a mean of 1364.3 ± 452.8 U/g, and in tissue removed from the border of CRCLM tumors ranged from 860.4 to 2300.0 U/g (means 1305.8 ± 515.2 U/g). Since the differences between the groups were not statistically significant, the activity of both groups were calculated together and used as the control value, with the Table 1 Activity of arginase in normal and pathological liver tissues Tissue
Control liver Cirrhotic liver Hepatocellular carcinoma
Arginase activity, U/g tissue Range
Means ± SD
860.4–2300.0 147.6–888.5 23.2–194.6
1330.7 ± 480.8 520.3 ± 209.2 93.4 ± 43.2
Fig. 2. Western blot analysis of arginase isoenzyme AI (A) and AII (B) in control liver and in hepatocellular carcinoma. Comparable amounts of tissue extract (5 lg of protein) were run in each line, as described in Materials and methods. A: lines 1, 6— standard bovine liver arginase AI; lines 2, 3—arginase AI from control liver removed from the border of benign and metastatic tumors (angioma and CRCLM, respectively); lines 4, 5—arginase AI from hepatocellular carcinomas. B: lines 1 and 6— standard human kidney arginase AII; lines 2, 3—arginase AII from control liver removed from the border of benign and metastatic tumors (angioma and CRCLM); lines 4, 5—arginase AII from hepatocellular carcinomas.
339
A. Chrzanowska et al. / Biochemical and Biophysical Research Communications 377 (2008) 337–340
24
20
Activity (U/min)
16
12
1
8
2
3
4
5
6
7
8
9
10
Fig. 4. Arginase isoenzymes expression on the level of mRNA in liver and in hepatocellular carcinoma. Expression was determined by RT-PCR as described in Materials and methods. Similar amount (12 ll) of PCR product was run in each lane. Line 1—ladder; lines 2, 3, 4—AI, AII, b2-microglobulin from control liver, respectively; lines 5, 8—AI; 6, 9—AII, 7, 10—b2-microglobulin from hepatocellular carcinomas.
4
0
Control liver
Hepatocellular carcinoma
Fig. 3. Distribution of arginase isoenzymes activity in control liver and in hepatocellular carcinoma. Arginase isoenzymes were separated on CM cellulose, as described in Materials and methods. Each bar represents the total activity of either isoform recovered from the column: open bars—the cationic isoform AI; solid bars—the anionic isoform AII. Each date represents the means ± SD.
(AI) and 10% (AII) of the total arginase activity in control liver, and 60% (AI) and 40% (AII) in HCC (Fig. 3). The expression of arginase AI-mRNA in control liver ranged from 1.22 to 1.56 and in HCC from 0.35 to 0.78. The mean value of AI-mRNA expression was significantly lower in HCC (0.56 ± 0.11) than in control liver (1.38 ± 0.10, P < 0.001). The expression of AII-mRNA was significantly higher in neoplasm than in control tissue (P < 0.001). In control liver it was 0.12 ± 0.04 (range from 0.09 to 0.19), whereas in tumor it was 4-fold higher (means 0.50 ± 0.07, range 0.41–0.61) (Table 2, Fig. 4). Discussion The HCC progression is a multistage process with a great proportion of cases involving liver cirrhosis [12]. Early diagnosis of HCC helps in selection of appropriate treatments and improves the disease outcome. However, the diagnosis is difficult since the symptoms are not characteristic and highly sensitive markers are unachievable. As yet, there is lack of information on arginase, its isoenzymes and their function in metabolism of hepatocellular carcinoma in humans. Over-expression of various enzymes has been shown to be associated with carcinogenesis and the development of different tumors [13,14]. It is known that enzymatic differences between cancerous tissues and their normal counterparts may concern the activity and the isoenzyme composition pattern. In our previous studies conducted on a large group of patients with colorectal carcinoma, we showed that arginase activity was much higher in tumor than in normal colorectal tissue [15]. The rise was due to the increased level of cationic, liver-like arginase (AI), which was also present at higher amount in patients’ serum [16]. Increased arginase was also observed in malignant tumors of skin, Table 2 Expression of arginase isoenzymes on the level of mRNA in control liver and hepatocellular carcinoma Tissue
Control liver Hepatocellular carcinoma
AI-mRNA
AII-mRNA
Range
Means ± SD
Range
Means ± SD
1.22–1.56 0.35–0.78
1.38 ± 0.10 0.56 ± 0.10
0.09–0.19 0.41–0.61
0.12 ± 0.04 0.51 ± 0.07
stomach, prostate, mammalian gland indicating its important role in neoplastic tissues metabolism [17–19]. In the current work conducted on 50 patients with hepatocellular carcinoma we showed that arginase activity was nearly 15-fold lower in tumor tissues than in normal liver. The activity was also lower in cirrhotic liver, however the decrease was not so considerable (3-fold when compared with control liver). Arginase isoenzymes AI and AII were identified by Western blotting in both normal liver and HCC, and they were isolated by ion-exchange chromatography. The total activity of arginase AI in cancerous tissue was lower (about 60%) than in normal liver (about 90%), whereas the activity of AII was higher in HCC (about 40%) than in liver (about 10%). The decrease of AI activity in HCC was consequence of almost 3-fold lower AImRNA expression, whereas the changes in AII were accompanied by significant increase of AII-mRNA expression (4-fold when compared with normal liver). In mammalian liver arginase AI plays a key role in ammonia detoxification and together with other urea cycle enzymes is localized in the periportal hepatocytes, whereas arginase AII is localized in the perivenous zone of liver acinus [20,21]. Function of arginase AII in not clear, but most probably it is related to ornithine biosynthesis and subsequently to the compounds produced in its metabolism [7]. Among these compounds there is putrescine, the product of ornithine decarboxylase and substrate for other polyamines (spermine and spermidine)—compounds vital for cell growth and proliferation [22]. Hepatocellular carcinoma is the only known neoplasm in which arginase activity is dramatically decreased, when compared with the tissue of its origin. This phenomenon may be a result of an extremely high arginase activity in normal hepatocytes. Moreover HCC is one of a few arginine-dependent (auxotrophic) malignances [23–25]. Since human HCC cells do not express argininosuccinate synthetase—the enzyme required for arginine biosynthesis—they are not able to synthesize this essential for their growth amino acid [23]. Thus significant decrease of arginase activity, due to decreased AI expression in HCC, can protect arginine against excessive hydrolysis. Human HCC cells do not synthesize arginine, but they overexpress enzymes involved in ornithine catabolism [23,26]. As we have shown, arginase AII expression is also increased in HCC tissue. Thus in HCC the enzymatic profile related to ornithine metabolism is similar to that of perivenous hepatocytes. It indicates that hepatocellular carcinoma develops rather in perivenous than in periportal zone of hepatic acinus. Our results indicate that both arginase isoenzymes seem to participate in liver cancerogenesis but especially interesting is argi-
340
A. Chrzanowska et al. / Biochemical and Biophysical Research Communications 377 (2008) 337–340
nase AII, the isoform not characteristic for the liver and for its basic function in ammonia detoxification. More studies are needed to find out whether determination of arginase AII may be of diagnostic significance. Acknowledgments This study was supported by grants 1WK/WB3/07 from the Medical University of Warsaw, and 2P05B19329 from the Ministry of Science and Information Society Technologies, Poland. References [1] D. Moradpour, H.E. Blum, Pathogenesis of hepatocellular carcinoma, Eur. J. Gastroenterol. Hepatol. 17 (2005) 477–478. [2] J.M. Llovet, J. Bruix, Early diagnosis and treatment of hepatocellular carcinoma, Baillieres Best Pract. Res. Clin. Gastroenterol. 14 (2000) 991–1008. [3] B. Daniele, A. Bencivenga, A.S. Megna, V. Tinessa, a-Fetoprotein and ultrasonography screening for hepatocellular carcinoma, Gastroenterol. 127 (2004) 108–112. [4] H.E. Blum, Hepatocellular carcinoma—therapy and prevention, World J. Gastroenterol. 11 (2005) 7391–7400. [5] R.S. Sparkes, G.J. Dizikes, I. Klisak, W.W. Grody, T. Mohandas, C. Heinzmann, S. Zollman, A.J. Lusis, S.D. Cederbaum, The gene for human liver arginase (ARG1) is assigned to chromosome band 6q23, Am, J. Hum. Genet. 39 (1986) 186–191. [6] J.G. Vockley, C.P. Jenkinson, H. Shukala, R. Kern, W.W. Grody, S.D. Cederbaum, Cloning and characterization of the human type II arginase gene, Genomics 38 (1996) 118–123. [7] S.D. Cederbaum, H. Yu, W.W. Grody, R.M. Kern, P. Yoo, R.K. Iyer, Arginases I and II: do their functions overlap?, Mol Genet. Metab. 8 (2004) S38–44. [8] F.P. Chinard, Photometric estimation of proline and ornithine, J. Biol. Chem. 199 (1952) 91–95. [9] U.K. Laemmli, Cleavage of structural proteins during the assembly of the head of bacteriophage T4, Nature 227 (1970) 680–685. [10] P. Chomczynski, N. Sacchi, Single-step method of RNA isolation by acid guanidium thiocyanate–phenol–chloroform extraction, Anal. Biochem. 162 (1987) 156–159. [11] N.A. Brophy, J.P. Marie, V.A. Rojas, R.A. Warnke, P.J. McFall, S.D. Smith, B.I. Sikic, Mdr1 gene expression in childhood acute lymphoblastic leukemias and lymphomas: a critical evaluation by four techniques, Leukemia 8 (1994) 327–335. [12] G. Ercolani, G.L. Grazi, M. Ravaioli, A. Gardini, M. Cescon, G. Varotti, F. Cetta, A. Cavallari, Liver resection for hepatocellular carcinoma on cirrhosis: univariate
[13]
[14]
[15]
[16]
[17]
[18]
[19]
[20]
[21] [22] [23]
[24]
[25]
[26]
and multivariate analysis of risk factors for intrahepatic recurrence, Ann. Surg. 237 (2003) 536–543. J. Hartwich, S.J. Konturek, P. Pierzchalski, M. Zuchowicz, P.C. Konturek, W. Bielan´ski, K. Marlicz, T. Starzyn´ska, M. Ławniczak, Molecular basis of colorectal cancer—role of gastrin and cyclooxygenase-2, Med. Sci. Monit. 7 (2001) 1171– 1181. M. Biancolella, A. Valentini, D. Minella, L. Vecchione, F. D’Amico, G. Chillemi, P. Gravina, S. Bueno, G. Prosperini, A. Desideri, G. Federici, S. Bernardini, G. Novelli, Effects of dutasteride on the expression of genes related to androgen metabolism and related pathway in human prostate cancer cell lines, Invest. New Drugs 25 (2007) 491–497. Z. Porembska, J. Zabek, W. Grabon, I. Rahden-Staron, A. Baranczyk-Kuzma, Arginase isoforms in human colorectal cancer, Clin. Chim. Acta 305 (2001) 157–165. Z. Porembska, A. Skwarek, M. Mielczarek, A. Baranczyk-Kuzma, Serum arginase activity in postsurgical monitoring of patients with colorectal carcinoma, Cancer 94 (2002) 2930–2934. S.S. Gokmen, A.C. Aygit, M.S. Ayhan, F. Yorulmaz, S. Gulen, Significance of arginase and ornithine in malignant tumors of the human skin, J. Lab. Clin. Med. 137 (2001) 340–344. B.E. Harris, T.P. Pretlow, E.L. Bradley Jr., G.B. Whitehurst, T. Pretlow, Arginase activity in prostatic tissue of patients with benign prostatic hyperplasia and prostatic carcinoma, Cancer Res. 43 (1983) 3008–3012. C.W. Wu, W.W. Chung, C.W. Chi, H.L. Kau, W.Y. Lui, F.K. P‘eng, S.R. Wang, Immunohistochemical study of arginase in cancer of the stomach, Virchows Arch. 428 (1996) 325–331. D. O’sullivan, J.T. Brosnan, M.E. Brosnan, Hepatic zonation of the catabolism of arginine and ornithine in the perfused rat liver, Biochem. J. 330 (1998) 627– 632. N.R. Katz, Metabolic heterogeneity of hepatocytes across the liver acinus, J. Nutr. 122 (1992) 843–849. C. Moinard, L. Cynober, J.P. de Bandt, Polyamines: metabolism and implications in human disease, Clin. Nutr. 24 (2005) 184–197. B.J. Dillon, V.G. Prieto, S.A. Curley, C.M. Ensor, F.W. Holtsberg, J.S. Bomalaski, M.A. Clark, Incidence and distribution of argininosuccinate synthetase deficiency in human cancers: a method for identifying cancers sensitive to arginine deprivation, Cancer 100 (2004) 826–833. C.M. Ensor, F.W. Holtsberg, J.S. Bomalaski, M.A. Clark, Pegylated arginine deiminase (ADI-SS PEG20, 000 mw) inhibits human melanomas and hepatocellular carcinomas in vitro and in vivo, Cancer Res. 62 (2002) 5443– 5450. C.Y. Yoon, Y.J. Shim, E.H. Kim, J.H. Lee, N.H. Won, J.H. Kim, I.S. Park, D.K. Yoon, B.H. Min, Renal cell carcinoma does not express argininosuccinate synthetase and is highly sensitive to arginine deprivation via arginine deiminase, Int. J. Cancer 120 (2007) 897–905. D.N. Wheatley, E. Campbell, Arginine catabolism, liver extracts and cancer, Pathol. Oncol. Res. 8 (2002) 18–25.
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Changes in arginase isoenzymes pattern in human hepatocellular carcinoma Alicja Chrzanowska a, Marek Krawczyk b, Anna Baran´czyk-Kuz´ma a,* a b
Chair and Department of Biochemistry, Medical University of Warsaw, Warsaw 02-097, Banacha 1a, Poland Department of General, Transplant and Liver Surgery, Medical University of Warsaw, Poland
a r t i c l e
i n f o
Article history: Received 12 September 2008 Available online 1 October 2008
Keywords: Arginase Activity Isoenzymes Expression Hepatocellular Carcinoma
a b s t r a c t Hepatocellular carcinoma (HCC) is one of the most common tumors worldwide affecting preferentially patients with liver cirrhosis. The studies were performed on tissues obtained during surgery from 50 patients with HCC, 40 with liver cirrhosis and 40 control livers. It was found that arginase activity in HCC was nearly 5- and 15-fold lower than in cirrhotic and normal livers, respectively. Isoenzymes AI (so-called liver-type arginase) and AII (extrahepatic arginase) were identified by Western blotting in all studied tissues, however the amount of AI, as well as the expression of AI-mRNA were lower in HCC, in comparison with normal liver, and those of AII were significantly higher. Since HCC is arginine-dependent, and arginine is essential for cells growth, the decrease of AI may preserve this amino acid within tumor cells. Concurrently, the rise of AII can increase the level of polyamines, compounds crucial for cells proliferation. Thus, both arginase isoenzymes seem to participate in liver cancerogenesis. Ó 2008 Elsevier Inc. All rights reserved.
Hepatocellular carcinoma (HCC) is one of the most common fatal malignant neoplasm world-wide. The main risk factors for HCC development are liver cirrhosis (about 80% of all cases) and chronic infection with the hepatitis B and C viruses [1]. In early stages liver cancer usually presents with no symptoms. Most hepatocellular carcinomas are first suspected based on the results of CAT or ultrasound scans. There is lack of highly specific marker for the diagnosis of HCC. At present, the most common is alphafetoprotein, however its level increases only in about 70% of cases [2,3]. The potentially curative treatment for patients with HCC is surgery. Unfortunately only a small number of patients are suitable candidates for either surgical resection or liver transplantation because of tumor extension and/or poor hepatic function [4]. Liver is the most metabolically active organ. In humans, among the crucial pathways localized in liver, there is the urea cycle. The last enzyme of the cycle is arginase (EC 3.5.3.1) that hydrolyzes Larginine to urea and L-ornithine. The presence of two distinct genes for arginase has been established. The gene for arginase AI (socalled liver-type arginase) is assigned to chromosome band 6q23 and arginase AII (so-called extrahepatic arginase) at chromosome 14q24.1-24.3 [5,6]. Arginase AI is a cytosolic enzyme that plays a fundamental role in the urea cycle. Arginase AII is a mitochondrial isoform, and its function is not clear. Among all human tissues, liver expresses the highest arginase activity [7]. Thus, changes in arginase activity and/or in the profile of its isoenzymes may reflect liver disorders including carcinogenesis. As yet there are no studies on arginase in hepatocellular carcinoma in humans. * Corresponding author. Fax: +48 22 5720 679. E-mail address: [email protected] (A. Baran´czyk-Kuz´ma). 0006-291X/$ - see front matter Ó 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2008.09.093
In the current work, we studied arginase activity and the expression of its isoenzymes in tumor tissues obtained from patients with HCC in comparison with cirrhotic and normal liver. We tried to established the possible role of arginase isoenzymes in pathogenesis of this liver-specific tumor. Materials and methods Patients and tissues. The study contained tumor tissues obtained from 50 patients with HCC during surgery, samples of cirrhotic liver obtained during liver transplantation from 40 patients with liver cirrhosis, and 40 histologically normal liver tissues (control) removed 6–7 cm from the border of benign or metastatic tumors of patients with haemangioma (n = 4), adenoma hepatocellular (n = 3), focal nodular hyperplasia (n = 3), and colorectal cancer liver metastases (CRCLM, n = 30). All patients were treated in the Department of General Transplant and Liver Surgery, at the Medical University of Warsaw. The group with HCC contained 18 females and 32 males with a median age of 57.3 ± 9.1 (range 29–73 years) (T1–T4N0M0, T3N1M0). The group with liver cirrhosis contained 16 females and 24 males, age 44.6 ± 7.2 (range 21–59 years), and the control group 22 females and 18 males, age 56.4 ± 9.8 (range 32–76 years. The patients were diagnosed by increased level of plasma a-fetoprotein (patients with HCC), CEA (patients with CRCLM), ultrasound sonography and computed tomography. The studies were approved by the Bioethics Committee of the Medical University of Warsaw, and informed consent was obtained from all patients. Methods. Immediately after surgical removal, the tissues were washed in 0.9% NaCl and frozen at 80 °C. The frozen tissue were cut and homogenized in 10 vol. of 50 mmol/l Tris–HCl buffer, pH
A. Chrzanowska et al. / Biochemical and Biophysical Research Communications 377 (2008) 337–340
7.5 containing 1 mmol/l MnCl2, 0.2 mol/l KCl and 0.1% (v/v) Triton X-100. After extraction, the homogenates were centrifuged at 12,000g for 30 min at 4° C and obtained supernatants were used for arginase activity determination, Western blotting and ion-exchange chromatography. Arginase activity was measured by determining the increase in the amount of ornithine, according to Chinard [8]. One unit (U) of enzymatic activity was defined as 1 lmol of the product formed per minute at 37 °C, and expressed per 1 g of wet tissue. Western blotting was performed after electrophoresis in 14% polyacrylamide gel according to Laemmli [9], with rabbit anti-bovine arginase AI and AII polyclonal antibodies (Res. Diagn. Inc., and Santa Cruz Biotech. Inc., USA). Arginase AI from bovine liver and AII from human kidney were used as standards. Blots were visualized using ECL plus Western Blotting Detection System (Amersham). Ion-exchange chromatography was performed on CM-cellulose to column (10 1,5 cm) equilibrated with 20 mM Tris–HCl buffer, 7.5. The not adsorbed arginase AII (anionic isoform) was eluted with the same buffer, and the adsorbed arginase AI (cationic isoform), with a linear KCl gradient (0.5–1.0 mol/l). Total RNA was isolated from studied tissues by modified method of acid guanidine thiocyanate-phenol-chloroform extraction using TRIzolÒ reagent (Invitrogen), according to manufacturer’s protocol [10]. Expression level of mRNA for arginase AI and AII was defined by reverse transcriptase-polymerase chain reaction (RT-PCR). Specific oligonucleotide primers for arginase isoenzymes were based on nucleotide sequences in NCBI accession nos. for ARGI: NM000045 and for ARGII BC029050, and were as follows: for arginase AI: TGCAACTGCTGTGTTCACTG (forward), TGATGTTG ACGGACTGGACC (reverse), for arginase AII: GTTAGCAGAGCTGTG TCAGA (forward), GGAGTTGTGGTACCTTATCC (reverse). The specific mRNA sequence for b2-microglobulin (housekeeping gene) was amplified as described by Brophy et al.[11], and served as an internal control (forward primer: CCAGCAGAGAATGGAAAGTC, reverse primer: GATGCTGCTTACATGTCTCG). PCR products were separated on 1.5% agarose gel with ethidium bromide. The level of specific mRNA was measured and expressed in semi-quantitative way as the ratio of optical density band of AI and AII to optical density band of b2-microglobulin. The assay was repeated 2 times for each sample and performed in duplicate. System UVI-KS4000, Syngen Biotech. was used for densitometric analysis of Western blotting and RT-PCR results. Results were expressed as means ± SD. Quantitative comparison between studied groups was performed by Student’s t-test using Statistica software (StatSoft 6.1) and non-parametric Mann-Whitney U-test.
160 mean mean±error std mean±SD
140
Arginase activity , U/g tissue
338
120 100 80 60 40 20
I
II
III
Fig. 1. Arginase activity at different clinical stage of hepatocellular carcinoma. Activity was determined in resected tumors obtained from the patients classified according to IUCC. Group I contained 14 patients (T1N0M0), group II 16 patients (T2N0M0), and group III 20 patients (T3,T4N0M0, n = 3; T3N1M0, n = 17).
mean of 1330.7 ± 480.8 U/g. Significant decrease in arginase activity was observed in cirrhotic liver (P < 0.001) with the mean of 520.3 ± 209.2 U/g (range from 147.6 to 888.5 U/g). In HCC arginase activity ranged from 23.2 to 194.6 U/g with the means of 93.4 ± 43.2 U/g (Table 1). The mean activity was nearly 15-fold lower than in control liver and it was independent of the clinical stage of the patients (Fig. 1). Arginase isoenzymes AI and AII were identified by Western blotting in both control liver and HCC (Fig. 2A and B). When separated by ion-exchange chromatography they contained about 90%
A
1
2
3
4
5
6
1
2
3
4
5
6
B
Results Arginase activity in control liver obtained 6–7 cm from border of 10 benign tumors ranged from 978.4 to 2165.7 U/g wet tissue, with a mean of 1364.3 ± 452.8 U/g, and in tissue removed from the border of CRCLM tumors ranged from 860.4 to 2300.0 U/g (means 1305.8 ± 515.2 U/g). Since the differences between the groups were not statistically significant, the activity of both groups were calculated together and used as the control value, with the Table 1 Activity of arginase in normal and pathological liver tissues Tissue
Control liver Cirrhotic liver Hepatocellular carcinoma
Arginase activity, U/g tissue Range
Means ± SD
860.4–2300.0 147.6–888.5 23.2–194.6
1330.7 ± 480.8 520.3 ± 209.2 93.4 ± 43.2
Fig. 2. Western blot analysis of arginase isoenzyme AI (A) and AII (B) in control liver and in hepatocellular carcinoma. Comparable amounts of tissue extract (5 lg of protein) were run in each line, as described in Materials and methods. A: lines 1, 6— standard bovine liver arginase AI; lines 2, 3—arginase AI from control liver removed from the border of benign and metastatic tumors (angioma and CRCLM, respectively); lines 4, 5—arginase AI from hepatocellular carcinomas. B: lines 1 and 6— standard human kidney arginase AII; lines 2, 3—arginase AII from control liver removed from the border of benign and metastatic tumors (angioma and CRCLM); lines 4, 5—arginase AII from hepatocellular carcinomas.
339
A. Chrzanowska et al. / Biochemical and Biophysical Research Communications 377 (2008) 337–340
24
20
Activity (U/min)
16
12
1
8
2
3
4
5
6
7
8
9
10
Fig. 4. Arginase isoenzymes expression on the level of mRNA in liver and in hepatocellular carcinoma. Expression was determined by RT-PCR as described in Materials and methods. Similar amount (12 ll) of PCR product was run in each lane. Line 1—ladder; lines 2, 3, 4—AI, AII, b2-microglobulin from control liver, respectively; lines 5, 8—AI; 6, 9—AII, 7, 10—b2-microglobulin from hepatocellular carcinomas.
4
0
Control liver
Hepatocellular carcinoma
Fig. 3. Distribution of arginase isoenzymes activity in control liver and in hepatocellular carcinoma. Arginase isoenzymes were separated on CM cellulose, as described in Materials and methods. Each bar represents the total activity of either isoform recovered from the column: open bars—the cationic isoform AI; solid bars—the anionic isoform AII. Each date represents the means ± SD.
(AI) and 10% (AII) of the total arginase activity in control liver, and 60% (AI) and 40% (AII) in HCC (Fig. 3). The expression of arginase AI-mRNA in control liver ranged from 1.22 to 1.56 and in HCC from 0.35 to 0.78. The mean value of AI-mRNA expression was significantly lower in HCC (0.56 ± 0.11) than in control liver (1.38 ± 0.10, P < 0.001). The expression of AII-mRNA was significantly higher in neoplasm than in control tissue (P < 0.001). In control liver it was 0.12 ± 0.04 (range from 0.09 to 0.19), whereas in tumor it was 4-fold higher (means 0.50 ± 0.07, range 0.41–0.61) (Table 2, Fig. 4). Discussion The HCC progression is a multistage process with a great proportion of cases involving liver cirrhosis [12]. Early diagnosis of HCC helps in selection of appropriate treatments and improves the disease outcome. However, the diagnosis is difficult since the symptoms are not characteristic and highly sensitive markers are unachievable. As yet, there is lack of information on arginase, its isoenzymes and their function in metabolism of hepatocellular carcinoma in humans. Over-expression of various enzymes has been shown to be associated with carcinogenesis and the development of different tumors [13,14]. It is known that enzymatic differences between cancerous tissues and their normal counterparts may concern the activity and the isoenzyme composition pattern. In our previous studies conducted on a large group of patients with colorectal carcinoma, we showed that arginase activity was much higher in tumor than in normal colorectal tissue [15]. The rise was due to the increased level of cationic, liver-like arginase (AI), which was also present at higher amount in patients’ serum [16]. Increased arginase was also observed in malignant tumors of skin, Table 2 Expression of arginase isoenzymes on the level of mRNA in control liver and hepatocellular carcinoma Tissue
Control liver Hepatocellular carcinoma
AI-mRNA
AII-mRNA
Range
Means ± SD
Range
Means ± SD
1.22–1.56 0.35–0.78
1.38 ± 0.10 0.56 ± 0.10
0.09–0.19 0.41–0.61
0.12 ± 0.04 0.51 ± 0.07
stomach, prostate, mammalian gland indicating its important role in neoplastic tissues metabolism [17–19]. In the current work conducted on 50 patients with hepatocellular carcinoma we showed that arginase activity was nearly 15-fold lower in tumor tissues than in normal liver. The activity was also lower in cirrhotic liver, however the decrease was not so considerable (3-fold when compared with control liver). Arginase isoenzymes AI and AII were identified by Western blotting in both normal liver and HCC, and they were isolated by ion-exchange chromatography. The total activity of arginase AI in cancerous tissue was lower (about 60%) than in normal liver (about 90%), whereas the activity of AII was higher in HCC (about 40%) than in liver (about 10%). The decrease of AI activity in HCC was consequence of almost 3-fold lower AImRNA expression, whereas the changes in AII were accompanied by significant increase of AII-mRNA expression (4-fold when compared with normal liver). In mammalian liver arginase AI plays a key role in ammonia detoxification and together with other urea cycle enzymes is localized in the periportal hepatocytes, whereas arginase AII is localized in the perivenous zone of liver acinus [20,21]. Function of arginase AII in not clear, but most probably it is related to ornithine biosynthesis and subsequently to the compounds produced in its metabolism [7]. Among these compounds there is putrescine, the product of ornithine decarboxylase and substrate for other polyamines (spermine and spermidine)—compounds vital for cell growth and proliferation [22]. Hepatocellular carcinoma is the only known neoplasm in which arginase activity is dramatically decreased, when compared with the tissue of its origin. This phenomenon may be a result of an extremely high arginase activity in normal hepatocytes. Moreover HCC is one of a few arginine-dependent (auxotrophic) malignances [23–25]. Since human HCC cells do not express argininosuccinate synthetase—the enzyme required for arginine biosynthesis—they are not able to synthesize this essential for their growth amino acid [23]. Thus significant decrease of arginase activity, due to decreased AI expression in HCC, can protect arginine against excessive hydrolysis. Human HCC cells do not synthesize arginine, but they overexpress enzymes involved in ornithine catabolism [23,26]. As we have shown, arginase AII expression is also increased in HCC tissue. Thus in HCC the enzymatic profile related to ornithine metabolism is similar to that of perivenous hepatocytes. It indicates that hepatocellular carcinoma develops rather in perivenous than in periportal zone of hepatic acinus. Our results indicate that both arginase isoenzymes seem to participate in liver cancerogenesis but especially interesting is argi-
340
A. Chrzanowska et al. / Biochemical and Biophysical Research Communications 377 (2008) 337–340
nase AII, the isoform not characteristic for the liver and for its basic function in ammonia detoxification. More studies are needed to find out whether determination of arginase AII may be of diagnostic significance. Acknowledgments This study was supported by grants 1WK/WB3/07 from the Medical University of Warsaw, and 2P05B19329 from the Ministry of Science and Information Society Technologies, Poland. References [1] D. Moradpour, H.E. Blum, Pathogenesis of hepatocellular carcinoma, Eur. J. Gastroenterol. Hepatol. 17 (2005) 477–478. [2] J.M. Llovet, J. Bruix, Early diagnosis and treatment of hepatocellular carcinoma, Baillieres Best Pract. Res. Clin. Gastroenterol. 14 (2000) 991–1008. [3] B. Daniele, A. Bencivenga, A.S. Megna, V. Tinessa, a-Fetoprotein and ultrasonography screening for hepatocellular carcinoma, Gastroenterol. 127 (2004) 108–112. [4] H.E. Blum, Hepatocellular carcinoma—therapy and prevention, World J. Gastroenterol. 11 (2005) 7391–7400. [5] R.S. Sparkes, G.J. Dizikes, I. Klisak, W.W. Grody, T. Mohandas, C. Heinzmann, S. Zollman, A.J. Lusis, S.D. Cederbaum, The gene for human liver arginase (ARG1) is assigned to chromosome band 6q23, Am, J. Hum. Genet. 39 (1986) 186–191. [6] J.G. Vockley, C.P. Jenkinson, H. Shukala, R. Kern, W.W. Grody, S.D. Cederbaum, Cloning and characterization of the human type II arginase gene, Genomics 38 (1996) 118–123. [7] S.D. Cederbaum, H. Yu, W.W. Grody, R.M. Kern, P. Yoo, R.K. Iyer, Arginases I and II: do their functions overlap?, Mol Genet. Metab. 8 (2004) S38–44. [8] F.P. Chinard, Photometric estimation of proline and ornithine, J. Biol. Chem. 199 (1952) 91–95. [9] U.K. Laemmli, Cleavage of structural proteins during the assembly of the head of bacteriophage T4, Nature 227 (1970) 680–685. [10] P. Chomczynski, N. Sacchi, Single-step method of RNA isolation by acid guanidium thiocyanate–phenol–chloroform extraction, Anal. Biochem. 162 (1987) 156–159. [11] N.A. Brophy, J.P. Marie, V.A. Rojas, R.A. Warnke, P.J. McFall, S.D. Smith, B.I. Sikic, Mdr1 gene expression in childhood acute lymphoblastic leukemias and lymphomas: a critical evaluation by four techniques, Leukemia 8 (1994) 327–335. [12] G. Ercolani, G.L. Grazi, M. Ravaioli, A. Gardini, M. Cescon, G. Varotti, F. Cetta, A. Cavallari, Liver resection for hepatocellular carcinoma on cirrhosis: univariate
[13]
[14]
[15]
[16]
[17]
[18]
[19]
[20]
[21] [22] [23]
[24]
[25]
[26]
and multivariate analysis of risk factors for intrahepatic recurrence, Ann. Surg. 237 (2003) 536–543. J. Hartwich, S.J. Konturek, P. Pierzchalski, M. Zuchowicz, P.C. Konturek, W. Bielan´ski, K. Marlicz, T. Starzyn´ska, M. Ławniczak, Molecular basis of colorectal cancer—role of gastrin and cyclooxygenase-2, Med. Sci. Monit. 7 (2001) 1171– 1181. M. Biancolella, A. Valentini, D. Minella, L. Vecchione, F. D’Amico, G. Chillemi, P. Gravina, S. Bueno, G. Prosperini, A. Desideri, G. Federici, S. Bernardini, G. Novelli, Effects of dutasteride on the expression of genes related to androgen metabolism and related pathway in human prostate cancer cell lines, Invest. New Drugs 25 (2007) 491–497. Z. Porembska, J. Zabek, W. Grabon, I. Rahden-Staron, A. Baranczyk-Kuzma, Arginase isoforms in human colorectal cancer, Clin. Chim. Acta 305 (2001) 157–165. Z. Porembska, A. Skwarek, M. Mielczarek, A. Baranczyk-Kuzma, Serum arginase activity in postsurgical monitoring of patients with colorectal carcinoma, Cancer 94 (2002) 2930–2934. S.S. Gokmen, A.C. Aygit, M.S. Ayhan, F. Yorulmaz, S. Gulen, Significance of arginase and ornithine in malignant tumors of the human skin, J. Lab. Clin. Med. 137 (2001) 340–344. B.E. Harris, T.P. Pretlow, E.L. Bradley Jr., G.B. Whitehurst, T. Pretlow, Arginase activity in prostatic tissue of patients with benign prostatic hyperplasia and prostatic carcinoma, Cancer Res. 43 (1983) 3008–3012. C.W. Wu, W.W. Chung, C.W. Chi, H.L. Kau, W.Y. Lui, F.K. P‘eng, S.R. Wang, Immunohistochemical study of arginase in cancer of the stomach, Virchows Arch. 428 (1996) 325–331. D. O’sullivan, J.T. Brosnan, M.E. Brosnan, Hepatic zonation of the catabolism of arginine and ornithine in the perfused rat liver, Biochem. J. 330 (1998) 627– 632. N.R. Katz, Metabolic heterogeneity of hepatocytes across the liver acinus, J. Nutr. 122 (1992) 843–849. C. Moinard, L. Cynober, J.P. de Bandt, Polyamines: metabolism and implications in human disease, Clin. Nutr. 24 (2005) 184–197. B.J. Dillon, V.G. Prieto, S.A. Curley, C.M. Ensor, F.W. Holtsberg, J.S. Bomalaski, M.A. Clark, Incidence and distribution of argininosuccinate synthetase deficiency in human cancers: a method for identifying cancers sensitive to arginine deprivation, Cancer 100 (2004) 826–833. C.M. Ensor, F.W. Holtsberg, J.S. Bomalaski, M.A. Clark, Pegylated arginine deiminase (ADI-SS PEG20, 000 mw) inhibits human melanomas and hepatocellular carcinomas in vitro and in vivo, Cancer Res. 62 (2002) 5443– 5450. C.Y. Yoon, Y.J. Shim, E.H. Kim, J.H. Lee, N.H. Won, J.H. Kim, I.S. Park, D.K. Yoon, B.H. Min, Renal cell carcinoma does not express argininosuccinate synthetase and is highly sensitive to arginine deprivation via arginine deiminase, Int. J. Cancer 120 (2007) 897–905. D.N. Wheatley, E. Campbell, Arginine catabolism, liver extracts and cancer, Pathol. Oncol. Res. 8 (2002) 18–25.