Changes in Cyclin Dependent Kinase Expression and Activity Accompanying Lens Fiber Cell Differentiation

Exp. Eye Res. (1999) 69, 695–703 Article No. exer.1999.0749, available online at http:}}www.idealibrary.com on

Changes in Cyclin Dependent Kinase Expression and Activity Accompanying Lens Fiber Cell Differentiation C H U N Y. G A O, A N U R A D H A M. R A M P A L L I, H U I-C O N G C A I, H A I-Y I N G H E    P E G G Y S. Z E L E N K A* Laboratory of Molecular and Developmental Biology, NEI/NIH, Bethesda, MD 20892-2730, U.S.A. (Received Rochester 7 June 1999 and accepted in revised form 11 August 1999) Previous studies from this laboratory have shown that differentiating lens fiber cells contain two active cyclin dependent kinases (Cdks), Cdk1 and Cdk5. The present study was undertaken to explore the expression and regulation of six additional members of the Cdk family (Cdk2, Cdk3, Cdk4, Cdk6, Cdk7 and Cdk8) during lens differentiation. Differentiating lens fiber cells were separated from lens epithelial cells by microdissection of developing rat lenses [embryonic day 16 (E16) to postnatal day 8 (P8)] and Cdk expression was assessed by RT-PCR and immunoblotting. Two Cdks (Cdk3 and Cdk6) were not expressed in lens fiber cells or epithelial cells during this developmental period. In the lens epithelium, we detected proteins and mRNAs corresponding to all other Cdks examined (Cdk2, Cdk4, Cdk7, Cdk8) throughout this developmental period. Epithelial cells showed significant Cdk2 activity, which decreased with developmental age, but no significant activity was detected for Cdk4, Cdk7, or Cdk8. Fiber cells contained all four Cdk proteins and the corresponding Cdk mRNAs except for Cdk2 mRNA. None of the Cdks examined showed significant kinase activity in fiber cells. Immunoprecipitates of Cdk2 and Cdk4 from fiber cells contained p57kip#, supporting the view that this Cdk inhibitor blocks the activity of these Cdks in lens fibers. In contrast, p57kip# did not co-immunoprecipitate with Cdk5 from lens fibers. These findings suggest that the differential affinity of p57kip# for members of the Cdk family may provide a mechanism for specific regulation of individual Cdks during fiber cell differentiation. # 1999 Academic Press Key words : cyclin dependent kinases (Cdk) ; differentiation ; rat lens ; development ; p57kip#.

1. Introduction Cyclin-dependent kinases (Cdks) are a family of serine}threonine protein kinases that are essential for cell cycle progression (Nurse, 1994). The kinase activity of each Cdk is controlled, in part, by a specific regulatory subunit, usually a member of the cyclin family. Different Cdk}cyclin pairs catalyse distinct cell cycle events. For instance, Cdk4}Cyclin D and Cdk2}Cyclin E regulate G1 progression and the G1}S transition (Sherr, 1993 ; Quelle et al., 1993 ; Resnitzky et al., 1994 ; Resnitzky and Reed, 1995), while Cdk1}Cyclin A and Cdk1}Cyclin B catalyse entry into mitosis (Nurse, 1994). The sequential activation and inactivation of Cdks directs the orderly progression of the cell cycle. In some cases specific members of the Cdk family are expressed in active form in terminally differentiated cells. For example, active Cdk1 (also called Cdc2) and Cdk5 are expressed in terminally differentiating fiber cells of the embryonic lens (Gao et al., 1995, 1997 ; He et al., 1998). Active Cdk5 is also present in central nervous system neurons, where it seems to be essential for maintaining the neuronal cytoarchitechture (Nikolic et al., 1996). Active Cdks have also been observed in certain differentiating cell lines. For * Address correspondence to : Peggy S. Zelenka, NIH}NEI}LMDB, Building 6, Room 214, 6 Center Dr MSC 2730, Bethesda, MD 20892-2730, U.S.A.

0014–4835}99}120695­09 $30.00}0

example, active Cdk4 has been observed during differentiation of HL60 promyelocytic leukemia cells (Wang et al., 1997) and PC12 pheochromocytoma cells (Dobashi et al., 1996), while Cdk2 activity has been observed during differentiation of C2C12 myocytes (Jahn et al., 1994). These examples illustrate that cell cycle arrest and terminal differentiation are not necessarily incompatible with Cdk activity and raise the possibility that Cdks may have other functions in differentiated cells (Gao and Zelenka, 1997). These may include both cell type specific functions and general effects, such as metabolic regulation (Kaffman et al., 1994), basal transcription (Roy et al., 1994 ; Rickert et al., 1996), and apoptosis (Lahti et al., 1995 ; Shi et al., 1994 ; Zhang et al., 1997b). The presence of active Cdks in terminally differentiated cells such as neurons and lens fibers is particularly interesting, because differentiation is associated with cell cycle arrest. Since G1 progression is regulated by the coordinated activity of several Cdks, down-regulation or inactivation of these Cdks is generally an important aspect of differentiation. Inactivation or downregulation of Cdks involved in the G1}S phase transition seems to be a general feature of cell differentiation (Gao and Zelenka, 1997), although some exceptions have been reported (Wang et al., 1997 ; Dobashi et al., 1996 ; Jahn et al., 1994). Cdk activity may be prevented by down-regulation of these enzymes or their cyclin partners, or by expression of # 1999 Academic Press

696

specific Cdk inhibitors (Kranenburg et al., 1995 ; Matsuoka et al., 1995). In the lens, cell cycle arrest seems to be brought about by the inhibitor, p57kip# (Matsuoka et al., 1995 ; Zhang et al., 1997a, 1998 ; Gomez Lahoz E et al., 1999). Interestingly, in vitro binding studies indicate that Cdk inhibitors preferentially bind to Cdks that are involved in the G1}S transition (Chan et al., 1995 ; Harper et al., 1995 ; Hirai et al., 1995 ; Lee et al., 1996). The low affinity of Cdk inhibitors for other members of the Cdk family might provide a mechanism for differential regulation in vivo. To provide a foundation for further studies of Cdk regulation during fiber cell differentiation, we examined the developmental expression and enzymatic activity of six Cdks (Cdk2, Cdk3, Cdk4, Cdk6, Cdk7 and Cdk8) in the developing rat lens from E16 to P8. Four of these (Cdk2, Cdk3, Cdk4 and Cdk6) are thought to regulate the G1}S transition. Cdk7 is a dual function enzyme, which activates other Cdks (Poon et al., 1993 ; Fesquet, 1993) and regulates transcriptional initiation through phosphorylation of RNA polymerase II (Rearson et al., 1996 ; Roy et al., 1994). Cdk8 has also been reported to phosphorylate RNA polymerase II (Rickert et al., 1996). During the developmental period examined, the lens fibers in the most central region of the lens (‘ primary fiber cells ’) lose their nuclei and other intracellular organelles (Modak and Perdue, 1970 ; Bassnett and Beebe, 1992 ; Sanwal et al., 1986 ; He et al., 1998). By P2, denucleation of these cells is completed (He et al., 1998) and a wave of denucleation begins to spread outward through the ‘ secondary ’ fibers that surround the central core (Modak and Perdue, 1970 ; Bassnett and Beebe, 1992 ; Sanwal et al., 1986). Since there may be some differences in the biochemical events leading to differentiation of primary and secondary fiber cells (He et al., 1998 ; Vrensen et al., 1991), we have chosen a developmental period that encompasses the terminal differentiation of both populations to explore the expression and activity of Cdks.

2. Materials and Methods Isolation of Rat Lens Epithelia and Fiber Cells All animal studies were performed in accordance with the NIH Guidelines for Care and Use of Laboratory Animals. Timed pregnant Wistar rats were obtained from Charles River Farms (CRF, Charles River, MA, U.S.A.). Embryonic day 1(E1) was defined as the day of conception, established by the presence of a vaginal plug. Pregnant rats were killed by 95 % carbon dioxide and embryos (E16 and E18) were euthanized by decapitation after being removed from the uterus individually by section. Postnatal rats at day 2 and day 8 (P2 and P8) were euthanized by 95 % carbon dioxide. Lenses were carefully removed from rat embryos or postnatal rats and placed in F10 medium

C. Y. G A O E T A L.

at 37°C (GIBCO BRL, Gaithersburg, MD, U.S.A.) for 15 min to 1 hr. Lenses were then cleaned of surrounding tissue and the collagenous lens capsule with the anterior epithelium attached was separated from the fiber mass by microdissection. All tissues were immediately frozen in solid carbon dioxide and stored at ®80°C. Samples were used for kinase assays immediately after immunoprecipitation. RNA Isolation and RT-PCR The epithelial and fiber cell samples were homogenized and extracted with RNAzol (Tel-Test, Inc, Friendswood, TX, U.S.A.) as previously described (Gao et al., 1997). All RNA preparations had an A }A #'! #)! ratio of 1±8 or higher. Two hundred ng of total RNA was reverse transcribed using the downstream PCR oligonucleotides and the products were then amplified by 30 cycles of PCR as described (Harris et al., 1992). The specific oligonucleotide sequences used for PCR are as follows : Cdk2 [Genebank : D17350 (151–580)] (Noguchi et al., 1993) : Upstream : AAGATCGGAGAGGGCACGTACGGAGTGGTG Downstream : AGGCTCTTGCTAGTCCAAAGTCTGCCAACT Cdk3 [GeneBank : X66357 (1–300)] (Meyerson et al., 1992) : Upstream : CCACATGGAAGCTGGAGGAGCAACCGGGAG Downstream : TGCACCACGTCCAGCAGTCGGACGATGTTG Cdk4 [GeneBank : L11007 (121–440)] (Cho et al., 1993) : Upstream : GCTACCACTCGATATGAACCCGTGGCTGAA Downstream : GGTGCTTTGTCCAGGTATGTCCGTAGGTCC Cdk6 [GeneBank : X66365 (622–914)] (Meyerson et al., 1992) : Upstream : ATCTATAGTTTCCAGATGGCTCTAACC Downstream : ACAAACTTCTCAATTGGTTGGGCAGATTT Cdk7 [GeneBank : U11822 (101–400)] : Upstream : ATGAGAAACTGGACTTCCTCGGAGAGGGAC Downstream : ATGGTGTCAGCACAAGGCTGTTATCCTTTA Cdk8 [GeneBank : X85753 (27–296)] (Tassan et al., 1995) : Upstream : ATGGACTATGACTTTAAAGTGAAGCTGAGCAGCGA Downstream : ATCAGCATGAGACAGAAACACCTTTTGAAG Oligonucleotides were synthesized on an Applied Biosystems 380B DNA synthesizer (Foster City, CA,

Cdks D U R I N G L E N S D I F F E R E N T I A T I O N

U.S.A.). The sequences of all double-stranded PCR products were determined by the dideoxy chain termination method (Sanger et al., 1977) using Sequenase 2.0 (United States Biochemical, Cleveland, OH, U.S.A.). For quantitative comparison of the PCR products (Gilliand et al., 1990), DNA internal standards were synthesized using the PCR Mimic technique (Clontech Laboratories, Palo Alto, CA, U.S.A.) to generate 130 bp DNA fragments that could be coamplified by the same pair of primers used to amplify each Cdk mRNA. DNA internal standard (5–10 fg) was included in each PCR reaction as indicated. Controls lacking reverse transcriptase were included in each experiment to ensure that the products were derived from RNA. PCR products were separated on 10 % TBE}polyacrylamide gels (Novex, San Diego, CA, U.S.A.). DNA products were stained with ethidium bromide and photographed with ultraviolet illumination. Immunoprecipitation The method used for the preparation of lens cell extracts was modified from Draetta and Beach (1988) as previously described (Gao et al., 1995). Lens epithelia or fiber samples from E18, P2 and P8 rat lenses were pooled, rinsed briefly with DMEM (Dulbecco’s Modified Eagle Media, GIBCO BRL, Grand Island, NY, U.S.A.) and pelleted by centrifugation at 1000 g. The tissue pellets were homogenized in 300 µl homogenization buffer consisting of 10 m Tris (pH 7±4), 150 m NaCl, 1 m EDTA, 1 m EGTA, 0±5 m DTT, 0±5 m PMSF, 0±1 % NP-40, 10 µg ml−" leupeptin, 10 µg ml−" aprotinin, 5 µg ml−" pepstatin, 10 µg ml−" soybean trypsin inhibitor. Samples were centrifuged for 10 min at 14 000 g at 4°C and the supernatant solution was combined with 1 µg of antibody against (1) Cdk2 C-terminal (aa 283–298), (2) Cdk4 C-terminal (aa 282–303), (3) Cdk7 Nterminal (aa 1–19) (all three antibodies from Santa Cruz Biotechnology, Santa Cruz, CA, U.S.A.) or (4) Cdk8 (antiserum kindly provided by Dr Eric Nigg). Samples were immunoprecipitated by adding 50 µl of protein G-agarose beads (GIBCO BRL, Bethesda, MD, U.S.A.), which had been washed once in 1 ml of bead buffer (50 m Tris (pH 7±4), 5 m NaF, 250 m NaCl, 5 m EDTA, 5 m EGTA, 0±1 % NP-40, 10 µg ml−" leupeptin, 10 µg ml−" aprotinin, 5 µg ml−" pepstatin). Tubes were kept under constant rotation at 4°C for at least 4 hr. After a brief centrifugation at 600 g and removal of the supernatant, the beads were washed five times with 1 ml bead buffer. The protein G agarose beads were resuspended in 50 µl of kinase buffer (50 m Tris (pH 7±6), 10 m MgCl, 1 m DTT). Immunoprecipitated proteins were either eluted with N-ethylmaleimide (NEM), which releases the antigen without dissociating the IgG heavy and light chains (Poon et al., 1995), or 10 µl aliquots of beads were used immediately to assay kinase activity.

697

Protein Kinase Assay Kinase activity of Cdk immunoprecipitates was measured on protein G-agarose beads using a modification of the method of Simanis and Nurse (Simanis and Nurse, 1986). Aliquots (10 µl) of protein Gagarose beads were added to 40 µl of kinase buffer with 300 µ ATP, 15 µCi of [γ-$#P]-ATP (sp act 4500 Ci}mmole−" ; ICN Radiochemicals, Irvine, CA, U.S.A.), and 25 µg of either histone H1 (Boehringer Mannheim, Indianapolis, IN, U.S.A.), pRb C-terminal domain peptide (kindly provided by Dr Steven Reed), or RNA polymerase C-terminal domain peptide (Research Genetics, Huntsville, AL, U.S.A.) as substrate. All kinase assays contained 20 n protein kinase A inhibitor [PKI (6–22) amide, TYADFIASGRTGRRNAINH2], a synthetic peptide with a structure that corresponds to the inhibitory site of cAMP-dependent protein kinase inhibitor (Scott et al., 1986) (GIBCO BRL, Bethesda, MA, U.S.A.). Reactions were incubated at 37°C for 20 min and were stopped by the addition of 12±5 µl of 5¬Laemmli sample buffer (Laemmli, 1970). The beads were pelleted and aliquots of the supernatant solution were loaded onto phosphocellulose spin columns (PIERCE, Rockford, IL, U.S.A.) and washed three times with 75 m phosphoric acid to remove unincorporated [γ-$#P]-ATP. Radioactivity remaining on the column was determined in triplicate by scintillation counting. Total pmoles of P04 transferred to H1 or pRb C-terminal peptide in 20 min was calculated from the specific activity of [γ-$#P]-ATP in the reaction mix ; phosphorylation of RNA polymerase C-terminal peptide was analysed by gel electrophoresis and autoradiography. The results were normalized to total protein content of the tissue extracts used for immunoprecipitation. As a positive control, Cdk immunoprecipitates from HeLa cell extracts were measured in parallel with each assay. Electrophoresis and Immunoblotting Immunoblotting was performed using 25 µg protein from epithelial cell or fiber cell extracts or using the total protein eluted from protein G-agarose beads as previously described (Gao et al., 1997). Samples were run in 12 % SDS}polyacrylamide gels and transferred to 0±1 mm nitrocellulose membrane. Membranes were first blocked and then incubated with the following primary antibodies at concentrations of 1 µg ml−" : (1) anti-human Cdk2 C-terminal, (2) anti-mouse Cdk4 C-terminal, (3) anti-human Cdk7 N-terminal, (4) rabbit polyclonal anti-p57, (all four from Santa Cruz Biotechnology, Santa Cruz, CA, U.S.A.), and (5) antihuman Cdk8 antiserum (kindly provided by Dr Eric Nigg). Incubation was carried out for 1 hr at room temperature. The filters were washed and incubated with goat anti-rabbit or goat anti-mouse horseradish peroxidase-conjugated antibodies (Amersham, Arlington Heights, IL, U.S.A.). Antibody-antigen com-

698

plexes were detected by enhanced chemiluminescence (Amersham, Arlington Heights, IL, U.S.A.). 3. Results Expression of Cdk mRNAs To determine which Cdks are expressed in the developing rat lens, we examined expression of six Cdk mRNAs by competitive RT-PCR at E16, E18, P2 and P8. Cdk2 mRNA was expressed in lens epithelial cells, but was not detected in the fiber cell samples [Fig. 1 (A)]. RT-PCR products corresponding to the mRNAs of Cdk4, Cdk7, and Cdk8 were found in both epithelial cells and fiber cells throughout this developmental period, with little apparent change in concentration in either lens cell population with developmental age

C. Y. G A O E T A L.

[Fig. 1 (B–D)]. Cdk3 and Cdk6 were not detected by RT-PCR in epithelia or fiber cells, although the RTPCR assay detected these mRNAs in HeLa cell positive controls [Fig. 1 (E and F)]. Controls performed in the absence of reverse transcriptase were negative, confirming that the RT-PCR products corresponding to the Cdks were derived from RNA [Fig. 1 (A–F)]. The identities of all Cdk RT-PCR products (including the positive controls for Cdk3 and Cdk6 were confirmed by direct sequencing (data not shown). Expression of Cdk Protein in the Developing Rat Lens The relative concentration of each Cdk as a function of developmental age was determined by immunoblotting. Representative immunoblots of the Cdks in

F. 1. Detection of Cdk mRNAs by competitive RT-PCR. Two hundred ng of total RNA extracted from microdissected rat lens epithelia or lens fibers was amplified by RT-PCR in the presence of 5–10 fg of the appropriate cDNA internal standard. A negative control without reverse transcriptase (W}O) and a positive control using HeLa cell RNA (Pos) were performed with each assay. Positive controls are shown only if RT-PCR product was not detected in lens epithelia or fibers. DNA size was determined by comparison with markers run in parallel.

Cdks D U R I N G L E N S D I F F E R E N T I A T I O N

F. 2. Immunoblotting of 25 µg protein from P2 rat lens epithelial cell or fiber cell extracts using antibodies specific for Cdk 2, 4, 7 and 8. The location of protein molecular weight markers is indicated to the left.

lens epithelial and fibers at P2 are shown in Fig. 2 A. Interestingly, although RT-PCR failed to detect Cdk2 mRNA in lens fiber cells [Fig. 1 (A)], immunoblotting

699

detected Cdk2 protein as a closely spaced doublet of the correct molecular weight (Fig. 2). The Cdk2 immunoreactive bands were obliterated by incubation with the antigenic peptide, confirming the specificity of the reaction (not shown). The lower band, corresponding to the active, monophosphorylated form of Cdk2, appeared to be much less abundant in fiber cells (Fig. 2). Immunoreactive bands of the proper molecular weight were also detected for Cdk4, Cdk7, and Cdk8 (Fig. 2) and the specificity of the Cdk4 and Cdk7 antibodies was verified by blocking with a specific peptide (not shown). Since the Cdk8 antibody was raised against the intact protein, no blocking peptide was available to test the specificity. However, the antibody identified a single immunoreactive band of the correct molecular size. Immunoblotting did not detect proteins corresponding to Cdk3 and Cdk6 in lens epithelia or fibers, although these proteins were detected in HeLa cell extracts used as positive controls (data not shown). To determine the relative concentration of each Cdk in the epithelial cells and fiber cells as a function of

F. 3. Relative concentration of Cdks in lens epithelia and fibers as a function of developmental age. Immunoblots of 25 µg protein from E18, P2, and P8 rat lens epithelia and fiber cells were quantitated by densitometric scanning. Results from each experiment were normalized to the value obtained in the epithelia at E18 to permit data from several experiments to be combined. Graphs represent the average of three to five measurements at each age, ³..(.). Significance was determined using Mann–Whitney Rank Sum Test. (A) Cdk2 ; the developmental decrease in the epithelium from E18 to P2 and from P2 to P8, as well as the difference between epithelia and fibers at E18 are significant (P ! 0±03). (B) Cdk4 ; decrease in the epithelium from E18 to P2 and from P2 to P8, as well as the difference between epithelia and fibers at E18 are significant (P ! 0±05). (C) Cdk7 ; differences between epithelium and fibers at E18 and at P2 are significant (P ! 0±05). (D) Cdk8 ; no significant differences were observed.

700

C. Y. G A O E T A L.

developmental change. Thus, by P8, the epithelium and fibers contained almost equal concentrations of Cdk4. In contrast to Cdk2 and Cdk4, Cdk7 showed little change in concentration with developmental age in either the epithelium or the fiber cells [Fig. 3 (C)]. Moreover, the relative concentration of Cdk7 in the fiber cells was almost twice as high as in the epithelial cells throughout this developmental period. Cdk8, like Cdk7, showed little change with developmental age in either the epithelia or fiber cells [Fig. 3 (D)]. Protein Kinase Activity F. 4. Kinase activity of immunoprecipitated Cdk2. Immunoprecipitated Cdk2, immobilized on protein Gagarose beads, was assayed for kinase activity using histone H1 as substrate. Activity is expressed as pmole PO4 transferred min−" mg−" total cellular protein. Light bars represent epithelial cell data ; dark bars, fiber cell data. Results are the average of three to five measurements at each age, ³..(.). Decrease in epithelial Cdk2 activity from E18 to P2 and from P2 to P8 as well as difference between epithelium and fibers at E18 are significant (P ! 0±001, Student’s unpaired t-test).

developmental age, we quantitated the results of multiple immunoblots and normalized the values to the amount detected in the epithelium at E18 [Fig. 3 (A–D)]. The results showed that the concentration of Cdk2 decreased about five-fold between E18 and P8 in the epithelial cells [Fig. 3 (A)]. Concentrations of Cdk2 were initially lower in the fiber cells, but did not decrease significantly with age. The developmental pattern of Cdk4 expression was almost identical to that of Cdk2 [Fig. 3 (B)]. Cdk4 concentration in the epithelium decreased about five-fold between E18 and P8. The concentration in the fiber cells, although initially lower than in the epithelial cells, showed little

To determine whether the Cdks expressed in the developing lens are enzymatically active, each Cdk was immunoprecipitated from lens epithelia and lens fibers at E18, P2 and P8, and the kinase activity of the immunoprecipitates was measured. Kinase activity measurements were normalized to the total protein content of the cell extracts prior to immunoprecipitation. As expected, Cdk2 immunoprecipitates from lens epithelial cell extracts showed kinase activity toward histone H1, implying that Cdk2 is paired with the appropriate cyclins and is properly phosphorylated in these cells (Fig. 4). In contrast, there was little or no Cdk2 kinase activity in the fiber cells (Fig. 4). We also assayed kinase activity of Cdk4, using pRb as a substrate, and of Cdk7 and Cdk8 using either histone H1 or a peptide derived from RNA polymerase II Cterminal domain as substrate. However, we did not detect significant kinase activity in immunoprecipitates of these Cdks in either epithelial cells or fiber cells with the small amounts of embryonic tissue available (data not shown). Several lines of evidence indicate that the Cdk inhibitor, p57kip#, is responsible for cell cycle arrest in differentiating lens fiber cells (Matsuoka et al., 1995 ; Zhang et al., 1997a ; Gomez Lahoz E et al., 1999). To

F. 5. Co-immunoprecipitation of p57kip# with G1 Cdks. Cdks were immunoprecipitated from epithelia or fiber cells obtained from 40 E18 rat lenses using specific antibodies coupled to protein G-agarose beads. Prior to immunoprecipitation epithelial samples contained approximately 1±0 mg protein, fiber cell samples 3±7 mg protein. Immunoprecipitated proteins were eluted with a small volume of N-ethylmaleimide, which does not disrupt the immunoglobulin heavy and light chains, and the entire eluted fraction was immunoblotted. Cdk2 and Cdk5 immunoprecipitates were electrophoresed on the same gel and immunoblotted together on a single membrane to permit quantitative comparison. Lane ‘ C ’ contains a negative control, performed in the absence of the primary antibody ; lane ‘ Br ’ contains proteins immunoprecipitated from rat brain by Cdk5 antibody. (A) Immunoblot with p57kip# antibody. (B) Immunobot with the same antibody used for immunoprecipitation, i.e. Cdk2, Cdk4, or Cdk5, respectively.

Cdks D U R I N G L E N S D I F F E R E N T I A T I O N

determine whether p57kip# is, in fact, bound to the Cdks that promote cell cycle progression, we immunoprecipitated Cdk2 and Cdk4 from lens epithelia and lens fiber masses and immunoblotted with p57kip# antibody. Note that these experiments employed epithelia and fibers from equal numbers of lenses, rather than equal quantities of epithelia cell and fiber cell protein. To eliminate interference from the IgG heavy chain near 60 kDa, the immunoprecipitated proteins were eluted with N-ethylmaleimide (NEM), which releases the antigen without dissociating the IgG heavy and light chains (Poon et al., 1995). The results showed that p57kip# coimmunoprecipitated with Cdk2 and Cdk4 in differentiating lens fibers, supporting the view that their activity is inhibited by this member of the Cip}Kip family (Fig. 5). Essentially no p57kip# immunoprecipitated with Cdk2 from the epithelial extracts, even though the total amount of Cdk2 in the sample was greater. A small amount of p57kip# did coimmunoprecipitate with Cdk4 from epithelial cells, but comparing the ratio of p57kip# to Cdk4 in each sample shows that a larger fraction of the total Cdk4 was bound to p57kip# in the fiber cells. We also tested for coimmunoprecipitation of p57kip# and Cdk5, a Cdk that maintains its activity in developing lens fiber cells (Gao et al., 1997). Only a slight trace of p57kip# was detected in immunoprecipitates of Cdk5 from lens fiber cells (Fig. 5). 4. Discussion We have examined the expression and activity of several members of the Cdk family in developing rat lens epithelia and fibers. Four of the Cdks examined (Cdk2, Cdk3, Cdk4, Cdk6), participate in the hyperphosphorylation of pRb at the transition from G1 to S phase (Kato et al., 1993 ; Kraneneburg et al., 1995) and their expression in proliferating cells is cell cycle dependent. Our data indicate that two members of this group (Cdk3 and Cdk6) are not expressed in the lens, while the remaining two, Cdk2 and Cdk4, are expressed in the fiber cells as well as in the epithelial cells. In the lens epithelium, expression of Cdk2 and Cdk4 decreased with developmental age, in parallel with the decrease in cell proliferation (Mikulicich and Young, 1963). The activity of Cdk2 also decreased with developmental age, suggesting that it is associated primarily with cycling cells. We were unable to measure significant kinase activity in Cdk4 immunoprecipitates from either epithelial cells or fiber cells, although Cdk4 activity has been shown to be essential for pRb phosphorylation and entry into S phase (Kato et al., 1993). The only other kinase able to substitute for Cdk4 in this regard is Cdk6 (Meyerson and Harlow, 1994), which is not expressed in the lens. Since we consider it unlikely that cell cycle regulation in lens epithelial cells differs greatly from that in other cell types, we conclude that our assay may not be sufficiently sensitive to detect Cdk4 activity. Moreover,

701

there is evidence to suggest that lens epithelial cells may be subject to a diurnal rhythm in vivo. Partial synchronization of lens epithelial cell division has been observed in the chicken embryo (Brewitt et al., 1992) and differences in daytime and nighttime labeling index have been reported in the rat lens epithelium (von Sallman et al., 1962). Other parameters of rat lens cell growth, such as protein accumulation, also show diurnal periodicity (Brewitt and Clark, 1988). If lens epithelial cells are synchronized with respect to the cell cycle, Cdk4 activity might be very difficult to detect, since it is confined to a brief period in mid-tolate G1 (Sherr, 1993). Detection of Cdk2 activity would be less affected, since it persists throughout S phase (Krek et al., 1994 ; Zindy et al., 1992). The present results also demonstrate that two additional Cdks, Cdk7 and Cdk8, are expressed in lens epithelial cells and fiber cells. Although we did not detect significant Cdk7 or Cdk8 kinase activity in the lens, the concentration of Cdk7 was greater in the fiber cells than in the epithelial cells, suggesting that it may have some specific function during differentiation. Two independent functions have been reported for Cdk7. First, it is a Cdk activating kinase, CAK, which phosphorylates all Cdks except Cdk5 at a site required for activation (Poon et al., 1993 ; Fesquet et al., 1993 ; Zhong et al., 1994 ; Poon et al., 1997). Second, Cdk7 phosphorylates the C-terminal domain of RNA polymerase II, facilitating the ‘ promoter clearance ’ step of transcription (Reardon et al., 1996 ; Roy et al., 1994). Cdk8 is also implicated in phosphorylation of the RNA polymerase II C-terminal domain (Rickert et al., 1996). Since lens fiber cells actively transcribe a variety of mRNAs, including the crystallin mRNAs (Piatigorsky, 1981), and since Cdk1 is activated during fiber cell differentiation (He et al., 1998 ; Gao et al., 1995) it is likely that Cdk7 and Cdk8 are active in these cells, although we were unable to detect their activity. Since pRb is found only in the active, hypophosphorylated form in lens fiber cells (Rampalli et al., 1998), differentiating lens fibers must either repress expression of Cdks that hyperphosphorylate pRb or block their activation. The present results demonstrate that two of these kinases, Cdk3 and Cdk6, are not expressed in lens fiber cells, while the remaining two, Cdk2 and Cdk4, are complexed with the Cdk inhibitor, p57kip#. Although we have not examined the cyclin partners of these Cdks in the lens, it is clear that the appropriate cyclins are present, since p57kip# binds Cdks only when they are complexed with cyclins (Harper et al., 1995 ; Lee et al., 1996). Indeed, expression of cyclins D1, D2, and D3 has been observed previously in lens fiber cells (Gomez Lahoz E et al., 1999). Although the importance of p57kip# for cell cycle arrest during fiber cell differentiation is well established (Matsuoka et al., 1995 ; Zhang et al., 1997a ; Zhang et al., 1998 ; Gomez Lahoz E et al., 1999), the present study provides the first direct evidence that it binds both Cdk2 and Cdk4 in the

702

differentiating fibers. Equally important, this study demonstrates that p57kip# fails to bind Cdk5, a member of the Cdk family that maintains activity during lens fiber cell differentiation (Gao et al., 1997). Cdk5, like the closely related protein Cdk1, has low affinity for the Cip}Kip family of Cdk inhibitors in vitro (Harper et al., 1995 ; Lee et al., 1996). Lens fiber cells seem to have taken advantage of the differential binding affinities of these two Cdk family members for p57kip# to permit these two kinases to be activated during terminal differentiation, while holding in check the activity of Cdks that could drive the cell into S phase.

Acknowledgements We thank Dr Eric Nigg for providing Cdk8 antibody, Dr Steven Reed for pRb C-terminal domain peptide, and Drs Donna Garland and Paul Russell for critically reading the text.

References Bassnett, S. and Beebe, D. C. (1992). Coincident loss of mitochondria and nuclei during lens fiber cell differentiation. Develop. Dynamics 194, 85–93. Brewitt, B. and Clark, J. I. (1988). Growth and transparency in the lens, an epithelial tissue, stimulated by pulses of PDGF. Science 242, 777–9. Brewitt, B., Talian, J. C. and Zelenka, P. S. (1992). Cell cycle synchrony in the developing chicken lens epithelium. Develop. Biol. 152, 315–22. Chan, F. K., Zhang, J., Cheng, L., Shapiro, D. N. and Winoto, A. (1995). Identification of human and mouse p19, a novel CDK4 and CDK6 inhibitor with homology to p16ink%. Mol. Cell Biol. 15, 2682–8. Cho, F. S., Phillips, K. S., Khan, S. A. and Weaver, T. E. (1993). Cloning of the rat cyclin-dependent kinase 4 cDNA : implication in proliferation-dependent expression in rat tissues. Biochem. Biophys. Res. Commun. 191, 860–5. Dobashi, Y., Kudoh, T., Toyoshima, K. and Akiyama, T. (1996). Persistent activation of CDK4 during neuronal differentiation of rat pheochromocytoma PC12 cells. Biochem. Biophys. Res. Comm. 221, 351–5. Draetta, G. and Beach, D. (1988). Activation of cdc2 protein kinase during mitosis in human cells. Cell 54, 17–26. Fesquet, D. (1993). The MO15 gene encodes the catalytic subunit of a protein kinsase that activates cdc2 and other cyclin-dependent kinases (CDKs) through phosphorylation of Thr 161 and its homologues. EMBO J. 12, 3111–21. Gao, C. Y., Bassnett, S. and Zelenka, P. S. (1995). Cyclin B, p34cdc#, and H1-kinase activity in terminally differentiating lens fiber cells. Develop. Biol. 169, 185–94. Gao, C. Y., Zakeri, Z., Zhu, Y., He, H. Y. and Zelenka, P. S. (1997). Expression of Cdk-5, p35, and Cdk5-associated kinase activity in the developing rat lens. Develop. Genetics 20, 267–75. Gao, C. Y. and Zelenka, P. S. (1997). Cyclins, cyclindependent kinases and differentiation. BioEssays 19, 307–15. Gilliand, G., Perrin, S., Blanchard, K. and Kerry, H. F. (1990). Analysis of cytokine mRNA and DNA : Detection and quantitation by competitive polymerase chain reaction. Proc. Natl. Acad. Sci., USA 87, 2725–9.

C. Y. G A O E T A L.

Gomez Lahoz E., Liegeois, N. J., Zhang, P., Engelman, J. A., Horner, J., Silverman, A., Burde, R., Roussel, M. F., Sherr, C. J., Elledge, S. J. and DePinho, R. A. (1999). Cyclin D- and E-dependent kinases and the p57(KIP2) inhibitor : cooperative interactions in vivo. Mol. Cell Biol. 19, 353–63. Harper, J. W., Elledge, S. J., Keyomarsi, K., Dynlacht, B., Tsai, L. H., Zhang, P., Dobrowolski, S., Bai, C., ConnellCrowley, L., Swindell, E. et al. (1995). Inhibition of cyclin-dependent kinases by p21. Mol. Biol. Cell. 6, 387–400. Harris, L. L., Talian, J. C. and Zelenka, P. S. (1992). Contrasting patterns of c-myc and N-myc expression in proliferating, quiescent, and differentiating cells of the embryonic chicken lens. Development 115, 813–20. He, H. Y., Gao, C., Vrensen, G. and Zelenka, P. (1998). Transient activation of cyclin B}cdc2 during terminal differentiation of lens fiber cells. Develop. Dynam. 211, 26–34. Hirai, H., Roussel, M. F., Kato, J. Y., Ashmun, R. A. and Sherr, C. J. (1995). Novel INK4 proteins, p19 and p18, are specific inhibitors of the cyclin D-dependent kinases CDK4 and CDK6. Mol. Cell. Biol. 15, 2672–81. Jahn, L., Sadoshima, J. and Izumo, S. (1994). Cyclins and cyclin-dependent kinases are differentially regulated during terminal differentiation of C2C12 muscle cells. Exp. Cell Res. 212, 296–307. Kaffman, A., Herskowitz, I., Tjian, R. and O’Shea, E. K. (1994) Phosphorylation of the transcription factor PHO4 by a cyclin-CDK complex, PHO80-PHO85. Science 263, 1153–6. Kato, J., Matsushime, H., Hiebert, S. W., Ewen, M. E. and Sherr, C. J. (1993). Direct binding of cyclin D to the retinoblastoma gene product (pRb) and pRb phosphorylation by the cyclin D-dependent kinase CDK4. Genes Dev. 7, 331–42. Kranenburg, O., Scharnhorst, V., Van der Eb, A. J. and Zantema, A. (1995). Inhibition of cyclin-dependent kinase activity triggers neuronal differentiation of mouse neuroblastoma cells. J. Cell Biol. 131, 227–34. Krek, W., Ewen, M. E., Shirodkar, S., Arany, Z., Kaelin, W. G. J. and Livingston, D. M. (1994). Negative regulation of the growth-promoting transcription factor E2F-1 by a stably bound cyclin A-dependent protein kinase. Cell 78, 161–72. Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of the bacteriaophage T4. Nature 227, 680–5. Lahti, J. M., Xiang, J. L., Heath, L. S., Campana, D. and Kidd, V. J. (1995). PITSLRE protein kinase activity is associated with apoptosis. Mol. Cell. Biol. 15, 1–11. Lee, M.-H., Nikolic, M., Baptista, C. A., Lai, E., Tsai, L.-H. and Massague, J. (1996). The brain-specific activator p35 allows Cdk5 to escape inhibition by p27Kip" in neurons. Proc. Natl. Acad. Sci. USA 93, 3259–63. Matsuoka, S., Edwards, M. C., Bai, C., Parker, S., Zhang, P., Baldini, A., Harper, J. W. and Elledge, S. J. (1995). p57KIP#, a structurally distinct member of the p21CIP" inhibitor family, is a candidate tumor suppressor gene. Genes Dev. 9, 650–62. Meyerson, M., Enders, G. H., Wu, C. L., Su, L. K., Gorka, C., Nelson, C., Harlow, E. and Tsai, L. H. (1992). A family of human cdc2-related protein kinases. EMBO J. 11, 2909–17. Meyerson, M. and Harlow, E. (1994). Identification of a G1 kinase activity for cdk6, a novel cyclin D partner. Mol. Cell. Biol. 14, 2077–86. Mikulicich, A. and Young, R. W. (1963). Cell proliferation and displacement in the lens epithelium of young rats injected with tritiated thymidine. Invest. Ophthalmol. 2, 344–52.

Cdks D U R I N G L E N S D I F F E R E N T I A T I O N

Modak, S. P. and Perdue, S. W. (1970). Terminal lens cell differentiation. I. Histological and microspectrophotometric analysis of nuclear degeneration. Exp. Cell Res. 59, 43–56. Nikolic, M., Dudek, H., Kwon, Y. T., Ramos, Y. F. M. and Tsai, L.-H. (1996). The cdk5}p35 kinase is essential for neurite outgrowth during neuronal differentiation. Genes Dev. 10, 816–25. Noguchi, E., Sekiguchi, T., Yamashita, K. and Nishimoto, T. (1993). Molecular cloning and identification of two types of hamster cyclin-dependent kinases : Cdk2 and Cdk2L. Biochem. Biophys. Res. Comm. 197, 1524–9. Nurse, P. (1994). Ordering S phase and M phase in the cell cycle. Cell 79, 547–50. Piatigorsky, J. (1983). Lens differentiation in vertebrates : A review of cellular and molecular features. Differentiation 19, 134–52. Poon, R. Y., Toyoshima, H. and Hunter, T. (1995). Redistribution of the CDK inhibitor p27 between different cyclin-CDK complexes in the mouse fibroblast cell cycle and in cells arrested with lovastatin or ultraviolet irradiation. Mol. Biol. Cell 6, 1197–213. Poon, R. Y. C., Yamashita, K., Adamczewski, J. P., Hunt, T. and Shuttleworth, J. (1993). The cdc2-related protein p40MO"& is the catalytic subunit of a protein kinase that can activate p33cdk# and p34cdc#. EMBO J. 12, 3123–32. Poon, R. Y. and Hunter, T. (1997). Identification of functional domains in the neuronal Cdk5 activator protein. J. Biol. Chem. 272, 5703–8. Quelle, D. E., Ashmun, R. A., Shurtleff, S. A., Kato, J. Y., BarSagi, D., Roussel, M. F. and Sherr, C. J. (1993). Overexpression of mouse D-type cyclins accelerates G1 phase in rodent fibroblasts. Genes Dev. 7, 1559–71. Rampalli, A. M., Chauthaiwale, V. M., Gao, C. Y. and Zelenka, P. S. (1998). pRb and p107 regulate E2F activity during lens fiber cell differentiation. Oncogene 16, 399–408. Reardon, J. T., Ge, H., Gibbs, E., Sancar, A., Hurwitz, J. and Pan, Z. Q. (1996). Isolation and characterization of two human transcription factor IIH(TFIIH)-related complexes : ERCC2}CAK and TFIIH. Proc. Natl. Acad. Sci. USA 93, 6482–7. Resnitzky, D., Gossen, M., Bujard, H. and Reed, S. I. (1994). Acceleration of the G1}S phase transition by expression of cyclins D1 and E with an inducible system. Mol. Cell. Biol. 14, 1669–79. Resnitzky, D. and Reed, S. I. (1995). Different roles for cyclins D1 and E in regulation of the G -to-S transition. " Mol. Cell. Biol. 15, 3463–9. Rickert, P., Seghezzi, W., Shanahan, F., Cho, H. and Lees, E. (1996). Cyclin C}CDK8 is a novel CTD kinase associated with RNA-polymerase-II. Oncogene 12, 2631–40. Roy, R., Adamczeski, J. P., Seroz, T., Vermeulen, W., Tassan, J. P., Schaeffer, L., Nigg, E. A., Hoejimakers, J. H. J. and Egly, J. M. (1994). The MO15 cell cycle kinase is associated with the TFIIH transcription-DNA repair factor. Cell 79, 1093–101.

703

Sanger, F., Nicklen, S. and Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463–76. Sanwal, M., Muel, A. S., Chaudun, E., Courtois, Y. and Counis, M. F. (1986). Chromatin condensation and terminal differentiation process in embryonic chicken lens in vivo and in vitro. Exp. Cell Res. 167, 429–39. Scott, J. D., Glaccum, M. B., Fisher, E. H. and Krebs, E. G. (1986). Primary-structure requirements for inhibition by the heat-stable inhibitor of the cAMP-dependent protein kinase. Proc. Natl. Acad. Sci. USA 83, 1613–6. Sherr, C. J. (1993). Mammalian G1 cyclins. Cell 73, 1059–69. Shi, L., Nishioka, W. K., Th’nh, J., Bradbury, E. M., Litchfield, D. W. and Greenberg, A. H. (1994). Premature p34cdc# activation required for apoptosis. Science 263, 1143–5. Simanis, V. and Nurse, P. (1986). The cell cycle control gene cdc2­ of fission yeast encodes a protein kinase potentially regulated by phosphorylation. Cell 45, 261–8. Tassan, J.-P., Jaquenoud, M., Leopold, P., Schultz, S. J. and Nigg, E. A. (1995). Identification of human CDK8, a protein kinase partner for cyclin C and potential homolog of yeast SRB10. Proc. Natl. Acad. Sci. USA 92, 8871–5. Von Sallmann, L., Grimes, P. and McElvain, N. (1962). Aspects of mitotic activity in relation to cell proliferation in the lens epithelium. Exp. Eye Res. 1, 449–56. Vrensen, G. F. J. M., Graw, J. and DeWolf, A. (1991). Nuclear breakdown during terminal differentiation of primary lens fibers in mice : a transmission electron microscopic study. Exp. Eye Res. 52, 647–59. Wang, Q. M., Luo, X. and Studzinski, G. P. (1997). Cyclindependent kinase 6 is the principal target of p27}Kip1 regulation of the G1-phase traverse in 1,25-dihydroxyvitamin D3-treated HL60 cells. Cancer Res. 57, 2851–5. Zhang, P., Liegeois, N. J., Wong, C., Finegold, M., Hou, H., Thompson, J. C., Silverman, A., Harper, J. W., DePinho, R. A. and Elledge, S. J. (1997a). Altered cell differentiation and proliferation in mice lacking p57KIP2 indicates a role in Beckwith-Wiedemann syndrome. Nature 387, 151. Zhang, P., Wong, C., DePinho, R. A., Harper, J. W. and Elledge, S. J. (1998). Cooperation between the Cdk inhibitors p27(KIP1) and p57(KIP2) in the control of tissue growth and development. Genes Dev. 12, 3162–7. Zhang, Q., Ahuja, H. S., Zakeri, Z. F. and Wolgemuth, D. J. (1997b). Cyclin-dependent kinase 5 is associated with apoptotic cell death during development and tissue remodeling. Dev. Biol. 183, 222–33. Zhong, Q. H., Qi-Quan, L., Ki-Young, L. J. and Wang, J. H. (1995). Reconstitution of neuronal Cdc2-like kinase from bacteria-expressed Cdk5 and an active fragment of the brain-specific activator. J. Biol. Chem. 270, 10847–54. Zindy, F., Lamas, E., Chenivesse, X., Sobczak, J., Wang, J., Fesquet, D., Henglein, B. and Brechot, C. (1992). Cyclin A is required in S phase in normal epithelial cells. Biochem. Biophys. Res. Commun. 182, 1144–54.