Changes in lipoxygenase activities in human erythroleukemia (HEL) cells during diosgenin-induced differentiation

ELSEVIER

Cancer Letters 96 (1995) 133-140

CANCER LETTERS

Changes in lipoxygenase activities in human erythroleukemia (HEL) cells during diosgenin-induced differentiation C. Nappez, B. Liagre, J.L. Beneytout* URA CNRS 1485, FaculGs de Midecine et de Pharmacie, 2 rue du Docreur Marcland, 87025 Limoges, Frunce

Received 16 July 1995; accepted25 July 1995

Abstract

A human erythroleukemia (HEL) cell line was used as a model to study dynamic changes in human 12-, 15, 5lipoxygenases, five lipoxygenase activating protein (FLAP), and leukotriene A4 (LTA4) hydrolase gene expression during megakaryocytic differentiation induced by diosgenin (Beneytout, J.L, Nappez, C., Leboutet, M.J. and Malinvaud, G., Biothem. Biophys. Res. Commun., 207 (1995) 398-404). The study was performed at the transcriptional level: 12- and 5lipoxygenase mRNAs, FLAP mRNA and LTA4 hydrolase mRNA were detected before and after diosgenin treatment iq HEL cells while 1Slipoxygenase mRNA was undetected.When HEL cells were incubated with arachidonic acid, 5-, 12-, 15hydroxyeicosatetraenoic acids (HETE) and LTC4 were synthesized. In contrast, the diosgenin treatment induced the suppression of 12-lipoxygenase activity and only 5-, I5-HETEs and LTC4 were synthesized. Keywords:

HEL cells; Diosgenin; Differentiation; Lipoxygenases

1. Introduction HEL cells are a triphenotypic cell line constitutively expressing an erythroid phenotype but also Abbreviations: 5-LO, 5-lipoxygenase; 12-LO, 12-lipoxygenase; 15-LO, 15-lipoxygenase; 5-HPETE, 5-hydroperoxyeicosatetraenoic acid; FLAP, five lipoxygenase activating protein; HEL, human erythroleukemia; HETE, hydroxyeicosatetraenoic acid; LTA, leukotriene A4 hydrolase; LTA,. leukotriene Ad; LTC4, leukotriene C4; LTD4, leukotriene D4; LTE4, leukotriene E4; NDGA, nordihydroguaiaretic acid; PGB2, prostaglandin B2; PMA, phorbol myristate acetate; RT-PCR, reverse transcription polymerase chain reaction; TPA, 12-O-tetradecanoyl phorbol 13acetate. * Corresponding author.

expressing antigens of the other lineages [l-3]. These cells increase their erythroid phenotype after stimulation with agents such as Q-aminolevulinique acid [I]. An increase in macrophage phenotype occurs after treatment with a micromolar dose of phorbol myristate acetate (PMA) [2]. Inducible changes in megakaryocyte phenotype have also been reported after treatment with a nanomolar dose of PMA [3], dimethylsulfoxide [4], retinoic acid [5] or la,25dihydroxyvitamin D3 [5]. Recently, it was demonstrated that a plant steroid, diosgenin, was a new megakaryocytic differentiation inducer of HEL cells 161. It was previously described that HEL cells exhibit both fatty acid cyclooxygenase and 12-LO activities and cDNAs for cyclooxygenase and 12-LO

0304-3835/95/$09.50 0 1995Elsevier Science Ireland Ltd. All rights reserved SSDI 0304-3835(95)03923-K

134

C. Nuppez et al. I Cancer Letters 96 (19951133-140

were obtained from this cell line [7,8]. Because of the triple phenotype of HEL cells (erythroid, monocytic, megakaryocytic), we hypothesized that HEL cells would be an excellent model to study changes in lipoxygenase pathways during megakaryocytic diosgenin induced differentiation. The expression of 5, 12-, 15-LO, FLAP [9] and LTA [lo] was studied at the transcriptional level by RT-PCR analysis. Exogenous [ 1-i4C]arachidonic acid metabolism in control and diosgenin-treated cells was examined. 2. Materials and methods 2. I. Chemicals Oligonucleotides, Taq polymerase were from Appligene, Strasbourg, France. Sense and antisense primer sets were from Eurogentec, Seraing, Belgium. 5-LO and FLAP cDNA were a gift from Dr Jilly Evans, Merck-Frost Center for Therapeutic Research, Quebec. Molecular weight ladders were from GibcoBRL, Cergy Pontoise, France and restriction enzymes were from Boehringer-Mannheim, Meylan, France. Exogenous [ 1-i4C]arachidonic acid (55 mCi mmol-i) was from Isotopchim, Peyruis, France. Calcium ionophore A 23187, diosgenin, PMA, aspirin, indomethacin, NDGA, PGBz, synthetic standards of 5-, 12- and 15-HETEs, LTB4 and isomers (6-trans-LTB4 and 6-trans- 12-epi-LTB4), LTC4, LTD4 and LTE4 were from Sigma, St Quentin Fallavier, France. 2.2. Cell culture and treatment HEL cells were kindly provided by Pr Cartron (INSERM U76) and were cultured in RPM1 1640 medium supplemented with 10% (v/v) heat inactivated (56°C 30 min) fetal calf serum, 2 mM Lglutamine, 100 U/ml penicillin and lOO~g/ml streptomycin in a humidified atmosphere containing 5% (v/v) CO, at 37°C. For RT-PCR analysis and arachidonic acid metabolism studies, cells were seeded at 1.5 X lo5 cells ml-’ and grown in the presence or absence of diosgenin. The megakaryocytic differentiation of HEL cells induced by diosgenin was assessed by cellular morphology, endomitotic process and glycoprotein Ib expression. As previously described [6], a diosgenin concentration of 8pM was selected because this concentration resulted in a slight proliferation and size changes in a large number of cells which were characteristic of a megakar-

yocytic differentiation in comparison with nanomolecular dose PMA megakaryocytic induced differentiation [3]. To study the role of lipoxygenase in the megakaryocytic differentiation mechanism of HEL cells, diosgenin (8 PM) or PMA (1.6 nM) treated and untreated HEL cells were cultured in the presence or absence of a lipoxygenase inhibitor (NDGA 10pM) or cyclooxygenase inhibitors (aspirin 0.27 mM, indomethacin 80pM). Inhibitors and megakaryocytic differentiation inducers were simultaneously added to the culture medium. All compounds were dissolved in ethanol and the final concentration of ethanol, less than O.l%, did not cause morphological or growth changes. Cell viability and cellular morphology were examined by 1% trypan blue exclusion using a hemocytometer. 2.3. RT-PCR analysis Cells were washed twice with phosphate buffered saline (PBS) (pH 7.4) and total HEL cell RNAs were isolated during diosgenin treatment using a modification of t.he technique described by Chomzynski and Sacchi [ 1 l] (Bioprobe System, Montreuil sous-bois, France), reverse transcribed into cDNA (Superscript, Gibco-BRL) and amplified. Target cDNA was amplified according to the conditions as previously described [ 12,131. Ten microliters of the reverse transcribed cDNA were incubated with 10 pmol of sense and antisense primers (Table l), 10 mM dNTP, 0.5 U Taq polymerase in 1 X PCR buffer at a final volume of 50,ul. The primers used for the assays were designed to be RNA specific, based on known gene sequences [12]. The mixture was overlaid with mineral oil and amplified in a thermal cycler (ORI-Block PHC-1, OSI) for 30 cycles under the following conditions: 94°C for 45 s, 62°C for 45 s (except for LTA, 56°C for 45 s), 72°C for 1 min. Appropriate controls were included: as negative control, we used cDNA obtained from in vitro transcribed RNA from the chloramphenicol acetyltransferase gene containing a 3’ poly (A) tail, supplied in the SuperscriptTM Preamplification System, incubated with 5-LO, 12-LO, 15-LO, LTA and FLAP primers; as positive control, the same cDNA was incubated this time with corresponding primers (supplied in the kit). Additi’onal positive controls were included using FLAP cDNA (gifts from Dr Jilly Evans, Merck-

C. Nuppez et al. I Cancer Letters 96 (1995) 133-140

135

Table 1 Oligonucleotides

and PCR product size for target genes

mRNAs

Primer 5’

Primer 3’

Expected DNA (bp)

S-LO 12-LO ISLO LTA FLAP

ATCAGGAAAACGGTTCACGGCGAGG TGGACACTGAAGGCAGGGGCT GCCAAGGGGCTGGCCGACCT GATGACTGGAAGGATTKC ATGGATCAAGAAACTGTAGGC

CCAGGAACAGCTCG’I-ITTCCTG GGCTGGGAGGCTGAATCTGGA TGGTGGGGATCCTGTGCGGGGCA CCACTTGGATTGAATGCAGAGC ATGAGAAGTAGAGGGGGAGATG

412 442 447 378 479

All primers are displayed 5’ + 3’.

Frosst Center for Therapeutic Research, Quebec), 5LO cDNA and the corresponding primers previously described (Table 1). For LTA amplification, reverse transcribed mRNAs of alveolar macrophages, which were a gift of Dr Touraine (HGpital du Cluzeau, Limoges, France), were used as positive control because macrophages are known to produce LTB4 [ 141. PCR products were extracted, visualized and analyzed by electrophoresis on a 0.8% agarose gel containing ethidium bromide in Tris-acetate EDTA buffer. of PCR products Ten microliters of each PCR product were verified by digestion with 10 U restriction enzyme (Table 2). Resulting fragments were visualized by electrophoresis on a 2% agarose gel and size was calculated by linear regression with molecular weight ladders. 2.4. Verification

2.5. Arachidonic

acid metabolism

Exogenous [ l-14C]arachidonic acid metabolism of HEL cells was analyzed by RP-HPLC. Before and 72 h after diosgenin treatment, 50 X IO6 cells were

Table 2 Enzymes and expected size of fragments after restriction enzyme digestion PCR product

Restriction enzyme

Expected fragment (bp)

5-LO I2-LO LTA FLAP

BamHI EcoRI Ban1 BstElI

248 322 264 298

and and and and

164 120 114 181

pelleted and washed twice with PBS to eliminate culture medium. Then, cells were resuspended in 0.05 M phosphate buffer (pH 8.2) and preincubated for 5 min at 37°C with 2 mM CaCl* and 0.5 mM MgCl*. Calcium ionophore A23187 (0.5 pg) and exogenous [ l-14C]arachidonic acid (0.5 @i) in an ethanolic solution were added. After 15 min incubation at 37”C, the reaction was stopped by the addition of 0.5 ml CH,OH containing 50 ng PGB2 as internal standard. Precipitated material was removed by centrifugation at 600 X g and 4°C for 10 min and the pH was adjusted to 3 with H3P04. Acidified samples and synthetic standards were injected on a 5pm RadialPack C,s cartridge (Waters-Millipore, St Quentin en Yvellines, France) protected by a Waters C1sTM Guard Pack precolumn. Lipoxygenase metabolites were eluted at a flow rate of 2 ml mine1 using a tertiary methanol-acetonitrile-Hz0 gradient as previously described [15]. Radioactivity was detected at the exit of the column by a Flow One/Beta A500Packard system. 3. Results 3.1. Cell culture After 72 h diosgenin treatment, HEL cells exhibited approximately 20% of giant cells with more than one nucleus. After 72 h, proliferation of diosgenin treated cells was 4-fold lower than in control cells which continued to grow exponentially. 3.2. RT-PCR analysis

Lipoxygenase gene expression, FLAP and LTA gene expression were first investigated at the transcriptional level during diosgenin treatment. In un-

136

C. Nappez et al. I Cancer Letters 96 (1995) 133-140

7 8 8 IO 11 14

Fig. 1, RT-PCR analysis of 5-LO and FLAP mRNAs extracted from HEL cells, reverse transcribed and amplified by PCR using specific primers as described in Section 2. PCR products were analyzed by electrophoresis on a 0.8% agarose gel. Lanes 1 and 7, molecular weight ladders; lanes 2 and 8, negative controls; lanes 3 and 9, positive controls; lane 4, 5-LO cDNA positive control; lanes 5 and 6, 5-LO mRNA from HEL cells; lane 10, FLAP cDNA positive control; lanes 11 and 12, FLAP mRN.4 from HEL cells. The data presented are representative of four experiments.

treated cells, after RNA extraction and RT-PCR, positive signals were observed for 5-LO, FLAP (Fig. l), 12-LO and LTA (data not shown). Signals corresponding to 15LO mRNA detection were not observed (data not shown). 5-LO and FLAP amplification products of untreated HEL cells, 5LO and FLAP control cDNA amplification products were simultaneously verified by digestion with BamHI and BstEII. Similar fragments (248 bp and 164 bp for 5LO; 298 bp and 181 bp for FLAP) were obtained with control cDNA or HEL amplification products (Fig. 2). Similarly, LTA and 12-LO amplification products were respectively digested with Ban1 and EcoRI (data not shown). For HEL cells LTA amplification products, the digestion gave fragments (264 bp and 114 bp) corresponding to the expected fragments when alveolar macrophage LTA amplification prod-

ucts were digested under the same conditions. For 12-LO amplification, control cDNA was not used because HEL cells are known to express 12-LO [7]. After 72 h diosgenin treatment and under the same technical conditions, positive signals were observed for 5-LO, 12-LO, FLAP and LTA mRNAs detection. All amplification products were confirmed by restriction enzyme digestion (data not shown), 15-LO mRNA was undetectable. 3.3. Arachidonic acid metabolism When 50 x lo6 cells were incubated with [li4C]arachidonic acid and calcium ionophore for 15 min at 37”C, the HPLC metabolic profile (data not shown) demonstrated that 12-HETE, 15-HETE, 5HETE and LTC4 were the major products of the lipoxygenase pathway. Their production was mark-

C. Nuppez et (11.I Cancer Letters 96 (1995) 133-140

6

7 8 9

137

IO

Fig. 2. Fragments obtained after restriction enzyme digestion of 5-LO and FLAP amplification products. Lane 1, molecular weight ladder; lane 2, undigested amplified 5-LO control cDNA; lane 3, undigested HEL products amplified with 5-LO primers; lane 4, digested amplified 5-LO control cDNA; lane 5, digested HEL products amplified with 5-LO primers; lane 6, molecular weight ladder; lane 7, undigested amplified FLAP control cDNA; lane 8, undigested HEL products amplified with FLAP primers; lane 9, digested amplified FLAP control cDNA; lane 10, digested HEL products amplified with FLAP primers. The data presented are representative of four experiments.

edly increased by the presence of 1 mM aspirin in the incubation medium (Fig. 3). On the contrary, their production was markedly decreased by the presence of 1 mM aspirin and 0.1 mM NDGA in the incubation medium (data not shown). After 72 h diosgenin treatment, the full scale metabolic profile was similar to that prior to diosgenin treatment (data not shown). The HETFZ elution zone revealed metabolites identified to be 15HETE, 5-HETE! and LTC4 but IZHETE was not detected (data not shown). 3.4. Effect of lipoxygenase

and cyclooxygenase inhibitors on diosgenin-induced differentiation HEL cells

NDGA were added simultaneously with diosgenin to the culture medium. Similar results were obtained with PMA differentiation of HEL cells when aspirin or NDGA were added simultaneously with PMA to the culture medium (data not shown). Surprisingly, when HEL cells were cultured in the presence of diosgenin and indomethacin, important differences were observed: differentiated cell number was decreased 3-fold, cellular proliferation was increased 3fold and the growth kinetic curve became exponential as did the control until 48 h. Results were unchanged when HEL cells were cultured in the presence of PMA and indomethacin.

of

No significant changes were noted in HEL cells undergoing diosgenin differentiation when aspirin or

4. Discussion The regulation of expression of 5, 12-, 15L0,

138

C. Nappez et al. I Cancer Letters 96 (1995; 133-140

CPM 3825

2871

191f

96t

wti\ 10

1s

20

25

M

35

40

4s

(*I Fig. 3. Extended scale of radioactive profile of untreated HEL cells incubated in the presence of aspirin (1 n&i). Metabolites identified were LTB4 (9.8 min), 15HETE (16.8 min), 1ZHETE (18.4 min), 5-HETE (20.4 min) and LTC4 (25.6 min). Other detected peaks were unidentified. The data presented are representative of two experiments.

FLAP and LTA genes was studied at the transcriptional level in HEL cells upon diosgenin induced differentiation. 12-LO mRNA was detected before and after diosgenin treatment. These results are similar to those of Mahmud et al. [16] who described 12-LO mRNA in TPA treated HEL cells using Northern blot analysis. Funk and Fitzgerald [ 121 have developed a quantitative polymerase chain reaction and selected HEL cells as a source of RNA to characterize the assay. They reported that HEL cells expressed mRNAs for LTA, cyclooxygenase and 12LO in decreasing order but mRNAs for 5-LO and 15 LO were undetectable. Using the same primers and amplification conditions but different reagents, we detected 5LO mRNA before and after diosgenin treatment. 5LO mRNA detection could be the consequence of properties acquired spontaneously during the course of cell culture. Similarly, FLAP and LTA mRNAs were also detected before and after diosgenin treatment. Monocytic cells are known to ex-

press LT [ 171 so 5-LO, FLAP and LTA mRNAs detection was in agreement with monocytic phenotype of HEL cells. Dixon et al. [9] reported that FLAP increased the efficiency with which 5-LO converts 5HPETE to LTA4. 15-LO mRNA were not detected in treated and untreated HEL cells. This result was surprising because of the erythroid phenotype of HEL cells, but Funk and Fitzgerald [12] also failed to detect 15-LO mRNA in their HEL cells. Before differentiation, HEL cells are known to express a constitutive and active cyclooxygenase [8] so incubation of HEL cells with [1-14C]arachidonic acid and aspirin abolished cyclooxygenase activity and increased lipoxygenase product amounts which were identified to be 15-HETE, 12-HETE, 5-HETE, LTB4 and a large amount of LTC4. LTD4 and LTE4 were undetectable. The presence of 15-HETE was surprising due to the inability to detect 15-LO mRNA but Hagman et al. [ 181 have suggested that 12-LO in HEL cells also possess 15-LO activity. Moreover, Sloane et al. [19] reported that substitution of methionine with valine at position 418 of human 15-LO results in an enzyme that performs 12- and 15lipoxygenation equally. After 72 h diosgenin treatment, 15-HETE, 5HETE and LTC4 were detected, indicating that 5-LO and FLAP genes were unaffected upon diosgenin treatment. 1ZHETE and LTB, were not detected; Mahmud et al. [16] described suppression of 12-LO activity in HEL cells upon PMA induced differentiation but 1:zumi et al. [7] reported a 4-fold increase of 12-LO activity in TPA treated HEL cells. Perhaps we and other investigators worked on the same cell line but with different properties acquired spontaneously during the course of cell culture. LTC4 synthase activity was unchanged by diosgenin treatment but can be induced by TPA, la,25-dihydroxyvitamin D, and dimethylsulfoxide although not by retinoic acid [ 191. Secondly, the role of lipoxygenase or cyclooxygenase during megakaryocytic induced differentiation of HEL cells was explored. In the present report, we investigat.ed the effect of a cyclooxygenase inhibitor, aspirin and the effect of a lipoxygenase inhibitor, NDGA as possible inhibitors of megakaryocytic differentiation of HEL cells induced by diosgenin or PMA. No significant changes were noted in HEL cell differentiation (by diosgenin or PMA) when aspirin or NDGA were simultaneously added with diosgenin

C. Nappet

et al. 1 Cancer Letters

or PMA to the culture medium. Surprisingly, when HEL cells were cultured in the presence of diosgenin and indomethacin (cyclooxygenase inhibitor), important differences were observed: differentiated cell number was decreased 3-fold and the growth kinetic curve became exponential like the control curve until 48 h and decreased afterwards (data not shown). The same experiment with indomethacin showed no change with PMA treated cells. Indomethacin has been described as potentiating HL60 differentiation to neutrophils or to monocytes induced by retinoic acid and by vitamin Da, respectively [20]. Phorbol esters could act on protein kinase C [21]. la,25 Dihydroxyvitamin Da has been demonstrated to induce cell differentiation via a specific DNA-binding receptor that belongs to the superfamily of nuclear receptors for steroid and thyroid hormones [22]. Retinoic acid acts on differentiation via a receptor (RAR) which also belongs to the steroid and thyroid receptor superfamily [23,24]. Indomethacin treatment showed that diosgenin and PMA could act according to two different mechanisms. References r11 Papayannopoulou, T., Nakamoto, B., Kurachi, S. and Nelson, R. (1987) Analysis of the erythroid phenotype of HEL cells: clonal variation and the effects of inducers. Blood, 70, 1764-1772. 121 Papayannopoulou, T., Nakamoto, B., Yockochi, T., Chait, A. and Kannagi, R. (1983) Human erythroleukemia cell line (HEL) undergoes a drastic macrophage-like shift with TPA. Blood, 62,832-X45. I31 Long, M.W., Heffner, C.H., Williams, J.L., Peters, C. and Prochownick, E.V. (1990) Regulation of megacaryocyte phenotype in human erythroleukemia cells. J. Clin. Invest., 85, 1072-1084. l41 Tabilio, A., Rosa, J.P., Testa, U., Kieffer, N., Nurden, A.T., Del Canizo, M.C., Breton-Go&s, J. and Vainchenker, W. (1984) Expression of platelet membrane glycoproteins and a-granule proteins by a human erythroleukemia cell line (HEL). EMBO J., 3.453-459. 151 Soderstrom, M., Bolling, A. and Hammarstrom, S. (1992) Induction of leukotriene C4 synthase activity in differentiation human erythroleukemia cells. Biochem. Biophys. Res. Commun., 189, 1043-1049. WI Beneytout, J.L., Nappez, C., Leboutet, M.J. and Malinvaud, G. (1995) A plant steroid, diosgenin, a new megakaryocytic differentiation inducer of HEL cells. Biochem. Biophys. Res. Commun., 207, 398404. [71 Izumi, T., Hoshiko, S., Rdmark, 0. and Samuelsson, B. (1990) Cloning of the cDNA for human 1Zlipoxygenase. Proc. Nat]. Acad. Sci. USA, 87, 7477-7481.

96 (1995)

133-140

139

181 Funk, CD., Funk, L.B., Kennedy, M.E., Pong, AS. and Fitzgerald, GM. (1991) Human plateletierythroleukemia cell prostaglandin G/H synthase: cDNA cloning, expression, and gene chromosomd assignment. FASEB J., 5, 23042312. [91 Dixon, R.A.F., Diehl, R.E., Opas, E., Rands, E., Vickers, P.J., Evans, J.F., Gillard, J.W. and Miller, D.K. (1990) Requirement of a 5-lipoxygenase-activating protein for leukotriene synthesis. Nature, 343.282-284. 1101Radmark, O., Shimizu, T., Jomvall, H. and Samuelsson, B. (1984) Leukotriene A4 hydrolase in human leukocytes. J. Biol. Chem., 259, 12339-12345. Ull Chomzynski, P. and Sacchi, N. (1987) Single-step method of RNA isolation by acid thiocyanate-guanidium-chloroform extraction. AnaI. Biochem., 162, 156-159. iI21 Funk, C.D. and Fitzgerald, G.A. (1991) Eicosanoid forming enzyme mRNA in human tissues. J. Biol. Chem., 266, 12508-12513. [I31 El Makhour-Hojeij, Y., Baclet, M.C., Chable-Rabinovitch, H., Beneytout, J.L. and Cook, J. (1994) Expression of 5lipoxygenase in lymphoblastoid B and T cells. Prostaglandins, 48, 21-29. 1141 Fels, A.O.S., Pawlowski, N.A., Cramer, E.B., King, T.K.C., Cohn, Z.A. and Scott, W.A. (1982) Human alveolar macrophages produce leukotriene B4. Proc. Natl. Acad. Sci. USA, 79,7866-7870. u51 Borgeat, P., Fruteau de Laclos, B., Rabinovitch, H., Picard, S., Braquet, P., Hebert, J. and Laviolette, M.E. (1984) Eosinophil-rich human polymorphonuclear leukocyte preparations characteristically release leukotriene C4 on ionophore A 23178 challenge. J. Allergy Clin. Immunol., 74, 310-317. U61 Mahmud, I., Suzuki, T., Yamamoto, Y., Suzuki, H., Takashi, Y., Yoshomoto, T. and Yamamoto, S. (1993) Induction of cyclooxygenase and suppression of 1Zlipoxygenase in human erythroleukemia cells upon phorbol ester-induced differentiation Biochim. Biophys. Acta, 1166, 211-216. r171 Lewis, R.A., Austen, K.F. and Soberman, R.J. (1990) Leukotrienes and other products of the 5-lipoxygenase pathway. N. Engl. J. Med., 323, 645655. 1181Hagman, W., Kagawa, D., Renaud, C. and Honn, K.V. (1993) Activity and protein distribution of 12-lipoxygenase in HEL cells: induction of membrane-association by phorbol ester TPA, modulation of activity by glutathione and 13HPODE and Ca*+-dependent translocation to membranes. Prostaglandins, 46,47 l-477. [I91 Sloane, D.L., Leung, L., Craik, C.S. and Sigal, E. (1991) A primary determinant for lipoxygenase positional specificity. Nature, 354, 149-152. PO1 Bunce, CM., French, P.J., Durham, J., Stockley, R.A., Michell, R.H. and Brown, G. (1994) Indomethacin potentiates the induction of HL60 differentiation to neutrophils by retinoic acid and granulocyte colony-stimulating factor, and to monocyte by vitamin D3. Leukemia, 8, 595-604. 1211Ways, D.K., Cook, P.P., Webster, C. and Parker, P.J. (1992) Effect of phorbol esters on protein kinase C. J. Biol. Chem., 267.47994805. WI Evans, R.M. (1988) The steroid and thyroid hormone receptor superfamily. Science, 240, 889-895.

140

C. Nuppez et al. I Cuncer Letters 96 (199.5) 133-140

[23] Mangelsdorf, D.J., Ong, ES., Dyck, J.A. and Evans, R.M. (1990) A nuclear receptor that identifies a novel retinoic acid responsepathway. Nature, 345.224-229. [24] Mangelsdorf, D.J., Umesono, K., Kliewer, LA., Borgmeyer,

U., Ong, ES. and Evans, R.M. (1991) A direct repeat in the cellular retinal-binding protein type 11gene confers differential regulation by RXR and RAR. Cell, 66,555-561.