Changes in rat melanin-concentrating hormone and dynorphin messenger ribonucleic acids induced by food deprivation

Neuropeptides (1997) 31 (3), 237-242 © Pearson ProfessionalLtd 1997

Changes in rat melanin. concentrating hormone and dynorphin messenger ribonucleic acids induced by food deprivation C. HervG D. Fellmann CNRS ESA 6025, Laboratoire d'Histologie Embryologie Cytogen6tique, Facult6 de M~decine, Besan£~on, France

Summary Melanin-concentrating hormone (MCH) and dynorphin genes are expressed in two discrete neuron populations of the rat lateral hypothalamus. Their roles remain hypothetical in mammals. In order to analyse changes in MCH and dynorphin gene expression, a multiplex competitive semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR) was developed to assay their mRNAs. This technique was used to examine MCH and dynorphin mRNA content in 24-h and 48-h food-deprived rats compared to controls. A two-fold induction of dynorphin mRNA by 24 h, followed by a sharp decrease at 48 h were observed. A moderate increase in MCH mRNA content was noticed by 24 h; 48 h of fasting restored the control levels.

INTRODUCTION Two peptidergic neuron populations located in the lateral hypothalamic area (LHA), were described several years ago by different groups: the melanin-concentrating hormone (MCH) neurons ~-s and neurons stained by some prolactin antisera. 6,7 In the latter, the nature of the prolactin-like immunoreactivity (PRL-ir) is still controversial9 ,9 Moreover, in-situ hybridization techniques with probes to prolactin mRNA always failed to stain these neurons. Conversely, they were shown to express dynorphin and secretogranin II immunoreactivities as well as the corresponding mRNAs. ~°,1~ The roles of these two neuron populations, distributed in an area participating in the regulation of various behaviours and vegetative functions (for review see ref. 12), are poorly understood. It has been suggested that MCH neurons are involved in the control of goal-oriented behaviours, and general arousal or stress responses (for review see ref. 13), as well as in the regulation of fluid homeostasis? ,14 Possible involvement in the control of food intake and feeding behaviour were also pointed out recently. 1~,~6Our group Received 15 November 1996 Accepted 20 March 1997 Correspondence to: C. Herv6, Laboratoire d'Histologie Embryologie Cytogen6tique, Facult6 de M6decine, Place Saint-Jacques, 25030 Besangon Cedex, France. Tel: +33 3 81 66 55 93. Fax: +33 3 81 66 56 15.

has previously shown that ventromedial nuclei lesions stimulate MCH gene expression ~7 as well as insulininduced hypoglycaemia. 18 Food deprivation for 3 or 4 days did not modify MCH mRNA levels as shown by in situ hybridization j9 or northern blot (unpublished observations), but shorter fasting times resulted in an increase in MCH mRNA levels. :5,16 Recent results suggested that PRL-ir neurons might be involved in carbohydrate homeostasis, as they are strongly stimulated by insulininduced hypoglycaemia, la They also respond to osmotic challenge and thus might be involved in water homeostasis? 9 Their response to food deprivation has not been reported. In an attempt to study the experimentally induced responses of MCH and PRL-ir neurons, a semi-quantitative competitive reverse transcription-polymerase chain reaction (RT-PCR) technique was developed in order to assay MCH and dynorphin (DYN) mRNA levels. This technique made it possible to demonstrate the expression of defined mRNAs in a very low number of cells. 2~ A linear relationship between template and amplification product was observed within the exponential range of amplification? 2-24 To overcome tube-to-tube variations influenced by differences in sample preparation, machine performance, reaction conditions and the presence of inhibitors - co-reverse transcription of target RNAs with known amounts of reference templates, consisting of competitor RNAs amplified with the same primers and 237

238

Herv6 & Fellmann

recognized from the target RNAs by their lengths has been proposed. 25 Constitutive expression of housekeeping genes, such as cyclophilin (CYC) is also used as an endogenous standard. This approach was used to investigate the MCH and DYN mRNA levels in the hypothalamus of rats after 24or 48-h food deprivation.

MATERIALS AND METHODS Animals

Eight-week-old male Sprague-Dawley rats were used in the study. Five rats were fasted for 24 h and five for 48 h before killing. Five control rats were given free access to food during the same period. Water was available in all groups of rat. The rats were sacrificed by decapitation, brains were removed and hypothalami were immediately dissected under a stereomicroscope. They were bordered anteriorly by the rostral edge of the optic chiasm, posteriorly by the region just rostral to the mamillary bodies and laterally by the hypothalamic sulci. The depth of the exposed tissue corresponded to the level of the anterior commissure. They were then cut sag;tally and halves were frozen separately in liquid nitrogen. RNA extraction

RNAs were isolated from individual halves of frozen hypothalamus (about 30 mg) with an RNA extraction kit (RNA NOW, Ozyme, Paris, France), according to the manufacturer's instructions. Internal standard construction

Deleted MCH (MCHA) and DYN (DYNA) cDNAs were constructed by the overlap extension method 2¢27to serve as templates for RNA competitors. Briefly, for each cDNA, two fragments were generated in separate PCRs with an external primer and an internal primer that hybridized at the deletion site. The two internal primers contained a 5' complementary sequence enabling annealing of these PCR fragments and subsequent amplification of the duplices with the external primers. MCH primers (external: MCH upstream; TCGGCCTCCAAGTCCATCAGG, MCH downstream; GCAGGTATCAGACTTGCCAACAGG and internal: MCHAu; CCAGGACGTTGCCGACCCAGCTGAGAATGG, MCHzXd; TCGGCAACGTCCTGGGAGGGGCAGACCGTG) synthesized by Eurogentec (Li6ge, Belgium) generated respectively 432-bp native MCH and 401-bp MCHA amplicons. DYN primers (external: DYN upstream; CTCTCCAGCAGGTTTGGC,DYN downstream; CTGGGACCGAGTCACCAC and internal: DYNzXu; CCAGGACGTTGCCGACCCAAGAGGAGCTCCG, DYNAd; Neuropeptides (1997) 31(3), 237-242

TCGGCAACGTCCTGGCCTCCTCGTTGAAATGGAGCG) generated 339-bp native DYN and 307-bp DYNAamplicons. Blunt end amplicons were obtained with a PWO Taq polymerase (Eurogentec). They were then gel purified by squeeze freeze and cloned into pCR-ScriptTMSK(+) (Stratagene, Paris, France) with the pCR-ScriptTMSK(+) cloning kit according to the manufacturer's instructions. Cloned products were checked with an automatic sequencer (Applied Biosystems 373A DNA Sequencer). The plasmids were extracted and linearized with NotI endonuclease. Competitor RNAs were generated by incubating 100ng of plasmid with 10 units of T7 polymerase (Stratagene) and 16 units of human placental inhibitor RNAguard TM (Pharmacia, Orsay, France) in 25 gl of reaction buffer (40 mM Tris HC1, 6 mM MgC12, 10 mM DTT, 2 mM spermidine, 1.6 mM NTP), for 30 rain at 37°C. The template was subsequently digested for 20 min at 37°C with 2.5 units of RNAase-free DNAaseI (Boehringer Mannheim, Meylan, France). MCHA and DYNA RNAs were further purified by sequential extraction with phenol-chloroform and ethanol precipitation. Competitive RT-PCR

Hypothalamic RNAs (usually 0.2-1 gg) were reverse transcribed in a reaction mixture (20 gl) containing a fixed amount of MCHA or DYNA RNA, 50mM Tris HC1 (pH 8.3), 75 mM KC1, 3 mM MgC12, 10 mM DTT, 2 mM dNTP, 16 units RNAguard, 100 pmol random hexamers (pd(N)6; Pharmacia), 200 units reverse transcriptase (MMLV; Promega, Lyon, France) which was incubated at 42°C for 60 min, after annealing of pd(N)~ for 10 min at room temperature. The quantity of internal standard (MCHA or DYNA RNA) was determined by a preliminary RT-PCR in which a titration series of RNAs from a control animal were mixed with a constant amount of MCHA or DYNzX RNAs. The ratio of extracted RNAs to competitor RNA producing similar amplification signals on an ethidium bromide-agarose gel was then determined. PCR was performed in the following reaction mixture (50 gl): 1.5 gl reverse transcription mixture, 5 gl 10 x buffer (750 mM Tris HC1, pH 9.0, 200 mM (NH4),2SO4, 0.1% w/v Tween 20), 3 gl 25 mM MgC12, 0.5 U Goldstar Polymerase (Eurogentec), 25 pmol of each of the two MCH or DYN primers, 50 pmol of each of the cyclophilin (CYC) primers (CYC upstream: CGCCGCTTGCTGCAGACATGG and CYC downstream: GAGTTGTCCACAGTCGGAGATGG), dNTP (50 gM of each in final concentration), 4 ~tCi 32p dCTP (Dupond de Nemours, Les Ulis, France). The solution was then overlaid with mineral oil. Optimal conditions for MCH amplification were experimentally determined and subsequently used as follows: denaturation at 94°C for 30 s, annealing/extension at 72°C for © Pearson Professional Ltd 1997

Melanin-concentrating hormone and dynorphin mRNAs in food deprivation

B

A IOD

Exponential phase

IOD

Exponential phase

250 -

250 -

/,

225 200 -

:

200 150 -

0"/ .¢.-"

175 -

100-

150 -

50-

125

I

18

239

20

22

24

I

I

I

26

28

30

0 2O

n u m b e r of cycles

22

I

I

24

26

28

I

32

number of cycles

.... 0 ....

CYCLOPH.

----0 ....

........~ ........

MCH

........o ........ DYN

A

I

30

MCH A

,e.

CYCLOPH.

DYN A

Fig. 1 Amplification kinetics. (A) MCH mRNA, MCHA RNA and cyclophilin mRNAs were reverse transcribed and amplified with (z32p-dCTP. After 20 cycles, and thereafter each second cycle until the 28th, a tube was removed and the products were resolved on a 2% agarose/ethidium bromide gel. The autoradiograph was analysed. The amount of PCR product (integrated OD of bands) was graphed as a function of cycle number. During the exponential phase, the amplification efficiencies of the three products were very similar. (B) The same comparison was also done for DYN mRNA, DYNA RNA and cyclophilin mRNAs with similar results.

2 min. The n u m b e r of cycles was 23, followed by incubation for 10 min at 72°C. Conditions for DYN amplification were: 'hot start' at 94°C for 5 min, denaturation at 94°C for 1 rain, annealing at 65°C for 1 min, extension at 72°C for 2 min. In the last cycle (cycle 24), the extension time was increased to 10 min. After amplification, an aliquot of the sample (10 gl) was loaded on to a 2% agarose gel, stained with ethidium bromide. The gel was visualized under UV light, and dried under vacuum. Radioactivity of the amplified DNA was visualized by autoradiography with Reflection TM NEF (Dupond de Nemours) after exposure for 0.5-4 h. In each electrophoresis lane, the integrated optical densities (IOD) of competitor (MCHzX or DYNA), template (MCH or DYN) and CYC bands were measured with a scanner linked to a Macintosh computer (Apple, Paris, France) and analysed with Image 1.49 Software (NIH, Bethesda, MD, USA). The ratios of MCH to M C H J IODs were calculated after correction for the decreased number of cytidines in MCHA (correction factor: * 1.08). To calculate the ratio of DYN to DYNA IODs, the correction factor was 1.15. Finally, these ratios were normalized to CYC IOD. © Pearson Professional Ltd 1997

Multiplex competitive RT-PCR Hypothalamic RNAs were reverse transcribed as described above with fixed amounts of MCHA and DYNa RNAs. The amount of internal standards and of PCR primers was determined according to the relative expression of the three genes (MCH, DYN and C¥C). The conditions for DYN amplification described above were used for 23 cycles.

RESULTS In order to verify that primers amplify target and standard sequences with similar efficiencies, the amplification kinetics of MCH& MCH, DYN, DYNA and CYC were compared. In these studies, similar amounts of target and standard RNAs were reverse transcribed and amplified with 32P-dCTP. Each second cycle between the twentieth and thirtieth cycle, an aliquot was removed and native and deleted amplicons were quantified by computer imaging after agarose electrophoresis and autoradiography. The amounts of amplified MCH, MCHA and CYC were graphed as a function of cycle number (Fig. 1A). The

Neuropeptides (1997) 31(3), 237-242

240

Herve & Fellmann

A ~.

1.25 -

24h fasting

O

"~

I-

r~

0.75 -

J'°'o

0.5-

,.4

O

o

0.25 -

,6

CH/(MCHA corr)

48h fasting

Controls

// //

~ ~ J u -

~

~

CYC MCH MCH~ DYN - DYNA

• DYN/(DYNA COLT)

0 100

1000 tot RNA (ng)

Fig. 2 Validation of multiplex competitive PCR analysis as a method for determining relative levels of mRNA. PCR products were generated with cDNA templates, reverse transcribed from two-fold serial dilutions of hypothalamic total RNA (80-640 ng final), and a constant amount of competitor RNA (MCHA and DYNA). After 23 cycles, the PCR products labelled with c02P-dCTP were resolved on a 2% agarose/ethidium bromide gel. The integrated optical density of each band corresponding to MCH, MCHA, DYN and DYNA was determined and the relative amounts of products were calculated, after correcting the standards for their reduced sizes. The ratios were graphed as a function of the initial amount of total RNA. Lines were drawn from regression analyses of the data points.

slopes of the three curves did not differ statistically (slope comparison, Student's ttest), indicating that MCH, MCHA and CYC had very similar amplification efficiencies in the exponential phase (between 20 and 24 cycles). The linear portion of the curves (between 20 and 28 cycles) corresponding to DYN, DYNA and CYC amplification (Fig. 1B) had similar slopes, indicating that the amplification efficiencies were similar for these three templates. In the multiplex RT-PCR conditions, a titration series of total hypothalamic RNA was co-reverse transcribed and co-amplified with fixed amounts of internal standard (DYNA and MCHA RNAs). As shown in Figure 2 it was possible to co-amplify these different cDNAs without substantial interaction of primers with heterologous templates or primer sets. Linear relationships were observed for MCH and DYN assays in a range (80-640 ng) corresponding to the usual amounts of hypothalamic RNAs used in RT-PCR. To determine relative changes in MCH and DYN mRNA levels among rats belonging to treated or control groups, constant amounts of competitors (MCHA and DYNA) were added to RT reactions containing RNA samples. Then the relative abundance of the target mRNAs was estimated by comparing the ratios of amplified MCH to amplified MCHA and amplified DYN to amplified DYNA in each sample. These ratios directly reflected the initial abundance of MCH and of DYN within each Neuropeptides (1997) 31(3), 237-242

B

300cO

.y: 250200<

150lOO-

~.

[] MCH

50o

I

Controls

q~ ~

I

I

24 h fasting

48 h fasting

p <0.01

Fig. 3 MCH and DYN gene expression after food deprivation. (A) 1 gg of total RNA mixed with a constant amount of in-vitro transcribed RNA standards was retro-transcribed and amplified (MCH, DYN and CYC primers, see Materials and methods). The autoradiographic film was scanned and analysed. (B) For each sample the integrated optical density of each MCH and DYN band was divided by the integrated optical density of the corresponding standard band (corrected for size), the result was then normalized to the cyclophilin signal. The mean (± SEM) values for MCH and DYN mRNAs were graphed as a percentage of control rats.

sample. Levels of MCH and DYN mRNA were estimated by this technique in the hypothalami of fasted and control rats. This experiment was repeated four times (Fig. 3A). A 120% increase in DYN mRNA was observed in rats fasted for 24 h as compared to controls (Fig. 3B). After food deprivation for 48 h, DYN gene expression returned to control levels. Although marked heterogeneity was noticed in the responses of rats to food deprivation, the difference between control and treated groups was statistically significant (P< 0.01, Mann-Whitney test). A similar response of MCH gene expression was observed. However, the 40% increase in MCH mRNA in 24 h fasted rats was not significant (P < 0.06). Conversely, the 50% decrease m MCH mRNA level in rats fasted for 48 h compared to the 24 h food deprivation level reached statistical significance (/9<0.01). © Pearson Professional Ltd 1997

Melanin-concentrating hormone and dynorphin mRNAs in food deprivation

DISCUSSION Competitive PCR is a powerful tool with which to m e a s u r e mRNA levels in gene regulation studies. It has proved useful for quantitative analysis of small a m o u n t s of RNAsY In our laboratory, this t e c h n i q u e was developed in order to investigate changes in M C H and DYN gene expression in small fragments of rat lateral h y p o thalamus. In this strategy, selection of competitors presenting amplification efficiencies similar to that of the native p r o d u c t s is a critical step. 29,3° The construction, by the overlap extension m e t h o d , of m u t a n t s that differed b y a b o u t 30 bp from the native amplicons met this crucial requirement. In order to verify the efficiency of the reverse transcription, the e x o g e n o u s standards h a d to be RNAs; 3~ t h e n the m u t a n t template DNAs were cloned in plasmids containing a T7 polymerase binding sequence so that competitor RNAs could be p r o d u c e d in vitro as needed. As a control for assessing the efficiency of RNA extraction and RT reaction appeared necessary, we also verified that an internal standard RNA - corres p o n d i n g to a constitutively expressed gene (cyclophilin mRNA) present t h r o u g h o u t all reactions 32 - could be coamplified with native a n d m u t a n t M C H and DYN amplicons with similar efficiency. The procedure presented here allows for multiple corrections of technical parameters and the results obtained s h o w that variations in mRNA levels can be quantified readily with synthetic m u t a n t RNAs. The described t e c h n i q u e m a y b e c o m e fully quantitative provided that the target RNAs are reverse transcribed and co-amplified with precisely k n o w n quantities of the competitors, either by a titration m e t h o d 29 or b y a single t u b e technique. ~° This technique a l s o presents the advantage of being m o r e rapid t h a n n o r t h e r n blotting (3 days versus 1 week). The present study looked at M C H a n d DYN mRNA changes generated b y food deprivation. As previously stated, 15 important variability in M C H mRNA levels was noticed a m o n g animals belonging to the same group. A similar result was obtained for DYN mRNA levels. However, a significant increase (120%) in the DYN mRNA was observed 2 4 h after food deprivation, followed b y a rapid decrease slightly below the control level after 48 h. Food deprivation for 24 h increased the content of M C H mRNA b y 40%, while fasting for 48 h restored the control level. An early increase in M C H gene expression has already b e e n observed in rats ~5 and mice. ~6 However, this increase was followed by a slow decrease after 48 h in Wistar rats. ~ Our previous finding in Sprague-Dawley rats s h o w e d that after 3 and 4 days fasting, M C H gene expression was not different from control animals. The differences observed in these sets of results deserve further investigation. The present

© Pearson Professional Ltd 1997

241

study also s h o w e d that this response of M C H n e u r o n s is a c c o m p a n i e d b y a m o r e important response of dynorphin neurons. Their involvement in feeding b e h a v i o u r has b e e n suggested previously. 18 The intermingling of M C H and d y n o r p h i n n e u r o n s in the LHA strongly suggests functional interaction, b u t their respective roles in the feeding suppressing circuit of the LHA epinephrineresponsive structures remain to be elucidated.

ACKNOWLEDGEMENT We t h a n k Fabrice Poncet at the Institute for Gene Studies and Transfer (Besan,con, University-Hospital) for MCHA and DYNA cDNA sequencing. REFERENCES 1. Skofitsch G, Jacobowitz D M, Zamir N. Immunohistochemical localization of melanin-concentrating hormone-like peptide in the rat brain. Brain Res Bull 1985; 15: 635-649. 2. Zamir N, Skofitsch G, Bannon M J, Jacobowitz D M. Melaninconcentrating hormone: unique peptide neuronal system in the rat brain and pituitary gland. Proc Natl Acad Sci USA 1986; 83: 1528-1531. 3. Fellmann D, Bugnon C, Risold P Y. Unrelated peptide immunoreactivities coexist in neurons of the rat lateral dorsal hypothalamus: human growth hormone-releasing factor~_37, salmon melanin-concentrating hormone- and amelanotropin-like substances. Neurosci Lett 1987; 74: 275-280. 4. Bittencourt J C, Presse F, Arias C et al. The melaninconcentrating hormone system of the rat brain: an immunoand hybridization histochemical characterization. J Comp Neurol 1992; 319:218-245. 5. Risold P Y, Fellman D, Rivier J, Vale W, Bugnon C. Immunoreactivities for antisera to three putative neuropeptides of the rat melanin-concentrating hormone precursor are coexpressed in neurons of the rat lateral dorsal hypothalamus. Neurosci Lett 1992; 136: 145-149. 6. Pant-Pagano L, Valatx J L, Kitahama K, Jouvet M. Neurones prolactine dans l'hypothalamus dorso-lat6ral du rat SpragueDawley. C R Acad Sci Paris 1989; 309: 369-376. Z Griffond B, Colard C, Deray A, Fellman D, Bugnon C. Evidence for the expression of dynorphin gene in the prolactinimmunoreactive neurons of the rat lateral hypothalamus, Neurosci Lett 1994; 165: 89-92. 8. Emanuele N V, Metcalfe L, Wallock Let al. Hypothalamic prolactin: characterization by radioimmunoassay and bioassay and response to hypophysectomy and restraint stress. Neuroendocrinology 1986; 44:217-221. 9. Harlan R E, Scammell J G. Absence of pituitary prolactin epitopes in immunoreactive prolactin of rat brain. J Histochem Cytochem 1991 ; 3 9 : 2 2 1 - 2 2 4 . 10. Griffond B, Deray A, Fellman D, Ciofi P, Croix D, Bugnon C. Colocalization of prolactin- and dynorphin-like substances in a neuronal population of the rat lateral hypothalamus. Neurosci Lett 1993; 156: 91-95. 11. Griffond B, Gritlon S, Duval Jet al. Occurrence of secretogranin II in the prolactin-immunoreactive neurons of the rat lateral hypothalamus: an in situ hybridization and immunocytochemical study. J Chem Neuroanat 1995; 9:113-119. Neuropeptides (1997) 31(3), 237-242

242

Herv# & Fellmann

12. Bernardis L L, Belinger L L. The lateral hypothalamic area revisited: neuroanatomy, body weight regulation, neuroendocrinology and metabolism. Neurosci Biobehav Rev 1993; 17: I41-193. 13. NahonJ L. The melanin-concentrating hormone: from the peptide to the gene. Crit Rev Neurobiol 1994; 8: 221-262. 14. Parkes G P. Diuretic and natriuretic actions of melanin concentrating hormone in conscious sheep. J Neuroendocrinol 1996; 8: 57-63. 15. Presse F, Sorokovsky I, Max J P, Nicolaidis S, Nahon J L. Melanin-concentrating hormone is a potent anorectic peptide regulated by food-deprivation and glucopenia in the rat. Neuroscience 1996; 71: 735-745. 16. Qu D, Ludwig D S, Gammeltoft Set al. A role for melaninconcentrating hormone in the central regulation of feeding behaviour. Nature 1996; 380: 243-247. 17. Deray A, Grfffond B, Colard C, Jacquemard C, Bugnon C, Fellmann D. Activation of the rat melanin-concentrating hormone neurons by ventromedial hypothalamic lesions. Neuropeptides 1994; 27: 185-194. 18. Bahjaoui-Bouhaddi M, Fellmann D, Griffond B, Bugnon C. Insulin treatment stimulates the rat melanin-concentrating hormoneproducing neurons. Neuropeptides 1994; 27: 251-258. 19. Fellmann D, Risold P Y, Bahjaoui Met al. Morphofunctional studies on the neurons producing melanin-concentrating hormone. Ann NY Acad Sci 1993; 680:511-516. 20. Grillon S, Griffond B, Fellmann D. Alteration of dynorphin and secretogranin II in the prolactin immunoreactive neurons of the rat lateral hypothalamus upon osmotic stimulation. Neurosci Lett 1996; 208: 33-36. 21. Welsh J, Lin J P, Efstratiadis A. Cloning of PCR-amplified cDNA: construction of a mouse oocyte cDNA library. Genet Anal Tech Appl 1990; 7: 5-17. 22. Rappolee D A, Wang A, Mark D, Werb Z. Novel method for studying mRNA phenotypes in single or small numbers of cells. J Cell Biochem 1989; 39:1-11.

Neuropeptides (1997) 31(3), 237-242

23. Singer-Sam J, Robinson M O, Belly4 A R, Simon M I, Riggs A D. Measurement by quantitative PCR of changes in HPRT, PGK1, PGK-2, APRT, MTase, and Zfy gene transcripts during mouse spermatogenesis. Nucleic Acids Res 1990; 18: 1255-1259. 24. Chelly J, Montarras D, Pinset C, Berwald-Netter Y, Kaplan J C, Kahn A. Quantitative estimation of minor mRNAs by cDNApolymerase chain reaction - application to dystrophin mRNA in cultured myogenic and brain cells. Eur J Biochem 1990; 187: 691-698. 25. Guilliand G, Perrin S, Blanchard K, Bunn H F. Analysis of cytokine mRNA and DNA: detection and quantitation by competitive polymerase chain reaction. Proc Natl Acad Sci 1990; 87: 2725-2729. 26. Ho S N, Hunt H D, Horton R M, Pullen J K, Pease L R. Sitedirected mutagenesis by overlap extension using the polymerase chain reaction. Gene 1989; 77:51-59. 27. Diviacco S, Norio P, Zentilin Let al. A novel procedure for quantitative polymerase chain reaction by coamplification of competitive templates. Gene 1992; 122: 313-320. 28. Gebhardt A, Peters A, Gerding D, Niendorf A. Rapid quantitation of mRNA species in ethidium bromide-stained gels of competitive RT-PCR products. Lipid Res 1994; 35: 976-981. 29. Ferr6 E Marchese A, Pezzoli P, Griffin S, Buxton E, Boyer V. Quantitative PCR: an overview. In: Mullis K B, Ferre F, Gibbs R A eds. The Polymerase Chain Reaction. Boston: Birkauser. 1994: 67-88. 30. Hayward-Lester A, Oefner P J, Sabatini S, Doris P A. Accurate and absolute quantitative measurement of gene expression by single-tube RT-PCR and HPLC. Genome Res 1995; 5: 495-499. 31. Kanangat S, Solomon A, Rouse B. Use of quantitative polymerase chain reaction to quantitate cytokine messenger RNA molecules. Mol Immunol 1992; 29: 1229-1236. 32. Riedy M C, Timm E A Jr, Stewart C C. Quantitative RT-PCR for measuring gene expression. BioTechniques 1995; 18: 70-76.

© Pearson Professional Ltd 1997