Changes in the activity of defense mechanisms against induced acidosis during meiotic maturation in mouse oocytes

Available online at www.sciencedirect.com

Theriogenology 75 (2011) 1057–1066 www.theriojournal.com

Changes in the activity of defense mechanisms against induced acidosis during meiotic maturation in mouse oocytes Seref Erdogana,*, Ali Cetinkayaa, Abdullah Tulib, Ebru Dundar Yilmazb, Ayse Dogana a b

Department of Physiology, Faculty of Medicine, University of Cukurova, 01330 Balcali, Adana, Turkey Department of Biochemistry, Faculty of Medicine, University of Cukurova, 01330 Balcali, Adana, Turkey Received 28 October 2009; received in revised form 8 November 2010; accepted 9 November 2010

Abstract Previous work has indicated that although activity of the HCO3-/Cl- exchanger (AE), which regulates intracellular alkalosis, is high in the germinal vesicle (GV) stage, the oocyte is inhibited as it progresses through meiotic maturation. In this study, we aimed to investigate the defense mechanisms against acidosis during the meiotic maturation stages. Intracellular pH (pHi) was recorded using a microspectrofluorometric technique, and Na⫹/H⫹ (NHE) and Na⫹-dependent HCO3-/Cl- exchanger (NDCBE) activity were determined by measuring the recovery rate from induced acidosis. Additionally, SLC9A1 (for NHE) and SLC4A8 (for NDCBE) gene transcription levels were determined by real-time PCR. The recovery rate of first meiotic prophase (GV) oocytes was high, but it decreased during the meiotic metaphase II (MII) stage in HCO3--free medium; it became high again at the pronuclear zygote (PN) stage. Recovery rate was significantly inhibited by 5-(N-ethyl-N-isopropyl) amiloride and cariporide or in the absence of extracellular Na⫹, implicating NHE, specifically NHE1 activity. Moreover, the level of SLC9A1 transcription correlated with the observed changes in NHE activity. The changes in NHE activity during meiotic maturation displayed a similar pattern to that of AE. The recovery rate from acidosis was significantly higher in MII stage oocytes and PN zygotes in HCO3--containing medium; however, the increase was significantly inhibited in Na⫹-free medium or 4,4’-diisocyanatostilbene2,2’-disulfonic acid. Furthermore, changes in the transcription of SLC4A8 during meiotic maturation were concordant with the level of exchanger activity. These results indicate that NDCBE activity is present in mouse oocytes and zygotes, and that this activity exhibits a different pattern than that of AE and NHE during meiotic maturation. © 2011 Elsevier Inc. All rights reserved. Keywords: Meiotic maturation; SLC9A1; Na⫹/H⫹ exchanger; SLC4A8; Na⫹, HCO3-/Cl- exchanger; Mouse

1. Introduction Intracellular pH (pHi) regulation is an important component of mammalian cell homeostasis. pHi is maintained within a narrow range by three major regulatory-mechanisms: the HCO3-/Cl- exchanger (AE), which alleviates alkalosis, and the Na⫹/H⫹ (NHE) and

* Corresponding author. Tel.: ⫹90 - 322 - 338 6795; Fax: ⫹90 322 - 338 6572. E-mail address: [email protected] (S. Erdogan). 0093-691X/$ – see front matter © 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.theriogenology.2010.11.014

Na⫹-dependent HCO3-/Cl- (NDCBE) exchangers, both of which alleviate acidosis. The AE mediates the electroneutral exchange of extracellular Cl- for intracellular HCO3-, thus decreasing pHi. The NHE mediates the electroneutral exchange of extracellular Na⫹ for intracellular H⫹ [1–5]. The Na⫹/H⫹ exchangers are encoded by members of the SLC9 NHE gene family with nine known members. Of these, NHE1-5 is localized, at least in part, to the plasma membrane; thus, it may participate in pHi regulation [6]. The NHE1 and NHE3 (coded by the SLC9A1 and SLC9A3 genes, respec-

1058

S. Erdogan et al. / Theriogenology 75 (2011) 1057–1066

tively) mRNA are present in mouse oocytes [7–9], but only NHE1 mRNA is detected in the post-fertilization stages [8]. Furthermore, only NHE1 activity were reported in unfertilized mouse oocyte [10] and its activity is responsible for correcting acidosis in fully grown GV mouse oocytes [7]. The Na⫹/H⫹ exchangers are inhibited by amiloride and their more potent derivatives (e.g., 5-[N-ethyl-N-isopropyl] amiloride, [EIPA]), although inhibitory potencies vary between isoforms [11]. On the other hand, cariporide is more specific inhibitor for NHE1 isoform [11]. Kinetic measurements indicate that many of these compounds antagonize transport by competing with extracellular Na⫹ for binding to a common or nearby site [6]. However, NDCBE imports Na⫹ and HCO3- in exchange for Cl-. Although it has been inconclusively identified at the molecular level, a likely candidate gene for the HCO3- transporter SLC4 family is NDCBE (coded by SLC4A8) [12–15]. NDCBE has absolute requirements for Na⫹ and HCO3-. A characteristic of many (though not all) SLC4 members is inhibition by disulfonic stilbene derivatives such as 4,4’-diisocyanatostilbene-2,2’-disulfonic acid (DIDS). This drug interacts with residues near the extracellular end of transmembrane 5 and possibly elsewhere [13]. The key feature of pHi regulatory transporters is their activation with changes in pHi; NHE and NDCBE are quiescent unless pHi falls below a threshold, or “set-point,” at which transport is activated [1,16,17]. Conversely, AE is activated when pHi rises above the set-point [17,18]. Oocyte pHi is regulated in primary follicles with support from granulosa cells [19]. As oocytes grow, they become meiotically competent when they reach 80% of full size. At this time, AE and NHE activity increases in the oocytes; thus, oocytes can regulate their own pHi independently from the follicular structure [20]. Therefore, when oocytes are in the fully-grown germinal vesicle (GV) stage, AE and NHE activity reaches high values [9,19,20]. Although NDCBE activity has not been evaluated during oocyte growth, the small pHi amiloride-insensitive component recovers in fully grown denuded oocytes in the presence of HCO3-, which might be the result of NDCBE activity [7]. During meiotic maturation, the fully grown GV stage oocyte completes the first meiotic metaphase (MI) and is then rearrested at the second meiotic metaphase (MII). Whereas AE activity is high in GV stage oocytes, this activity decreases during MI. During MII, AE activity is maintained at a low level [21,22]. AE activity returns to a high level about 8 hours following fertilization, at pronuclear formation [21,22], and it

remains high during all preimplantation (PI) embryonic stages [23,24]. Although NHE activity is present in GV stage oocytes [7,20], it becomes inactivated in the MII stage, as shown in human and hamster oocytes [25,26]. Furthermore, NHE activity can be detected maximally at 7 hours after egg activation in hamsters [26]. However, whether NHE activity changes from the GV oocyte to the PN zygote (throughout meiotic maturation) under the same conditions has not been studied. NHE activity, which is one of the defense mechanisms against acidosis, has been well documented. NHE is functional in hamster [26,27] and mouse embryos [28,29] and mediates complete recovery from acidosis. However, possible NDCBE activity, which is functional in the presence of Na⫹ and HCO3-, has been reported only in human PI stage embryos. However, it could not be conclusively shown that the HCO3--dependent component of recovery in human embryos was due to NDCBE activity because recovery was not inhibited by DIDS, as would be expected [25]. Nevertheless, human embryos can possibly recover completely with this NDCBE activity [25]. Moreover, the Na⫹driven Cl-/HCO3- exchanger, which has absolute requirements for Na⫹ and HCO3- and is blocked by DIDS, has been shown based on a functional characterization in NDCBE-transfected Xenopus leavis oocytes [30]. NDCBE activity in the oocyte or embryo of other experimental mammalian species such as mice and hamsters has not been reported. Given that AE activity is inhibited during meiotic maturation, we investigated whether NHE and NDCBE activity, which are both functional against acidosis, change from GV stage oocytes to pronuclear stage zygotes in mice. 2. Materials and methods Five- to 8-week-old Balb/c strain mice were used in this study. Light (12:12-h light:dark cycle), temperature (21 ⫾ 1 °C), and humidity (40 – 60%) were kept stable in the animal laboratory. All procedures were approved by the Ethics Committee of Medical Sciences Research and Application Center, University of Cukurova, Turkey. GV stage oocytes were obtained by injecting 5 IU of pregnant mare serum gonadotropin (PMSG, Sigma G-4877), intraperitoneally (i.p.). After 48 h, GV oocytes were mechanically isolated from the ovarium. db cAMP (100 ␮M, Sigma D-0627) was added to all holding and recording solutions to maintain meiotic

S. Erdogan et al. / Theriogenology 75 (2011) 1057–1066

1059

arrest. To obtain MII stage oocytes, 5 IU hCG (Sigma, CG-5) was injected i.p. 48 h after the PMSG injection. Approximately 18 –20 h after the hCG injection, MII oocytes were collected from ampulla. Cumulus cells were removed by short exposure (⬃2 min) to 75 ␮g/ml hyaluronidase (Sigma H-3506). Some of the female mice injected with hCG were kept with male mice overnight. PN zygotes were collected from ampulla 22 h after the hCG injection, as explained in MII stage oocyte retrieval.

Stock solutions were prepared in dimethyl sulfoxide (carboxyseminapthorhodafluor-1-acetoxymethyl ester [SNARF-1-AM, Molecular Probes C-1271]; 5-(Nethyl-N-isopropyl) amiloride [EIPA, Sigma A-3085]; valinomycin [Sigma V-0627]), in ethanol (nigericin, [Sigma N-7143]), in water (db cAMP [Sigma D-0627], cariporide [kindly supplied by Sanofi-Aventis Deutschland GmbH]), and in 0.1 M KHCO3 (4,4’diisocyanatostilbene-2,2’-disulfonic acid disodium salt [DIDS, Sigma D-3514]).

2.1. Solutions and chemicals

2.2. pHi measurements

Media were based on the KSOM mouse oocyte/ embryo culture medium [31]; KSOM contains (in mM): 95 NaCl, 2.5 KCl, 0.35 KH2PO4, 0.2 MgSO4, 10 Na lactate, 0.2 glucose, 0.2 Na pyruvate, 25 NaHCO3, 1.7 CaCl2, 1 glutamine, 0.01 tetra sodium EDTA, 0.03 streptomycin SO4, 0.16 penicillin G, and 1 mg/ml bovine serum albumin (BSA). Hepes-buffered KSOM (KFHM) was used for collecting oocytes/zygotes from the oviduct and for oocyte/zygote handling. This medium was prepared by replacing 21 mM (of 25 mM) NaHCO3 with equimolar Hepes (pH adjusted to 7.40 with NaOH). Unfertilized mouse oocytes [32] and 2-c mouse embryos [28] possess an H⫹-monocarboxylate cotransporter that transports lactate and pyruvate. Transport via this mechanism can affect pHi because of its cotransport of H⫹ across the plasma membrane, although this is not a pHi-regulatory mechanism per se [28,33]. However, in the present study, low (1 mM) lactate media were used to prevent any possibility of contribution by lactate transport. Moreover, pHi values recorded in monocarboxylates, lactate and pyruvate, free media were not significant compared those of recorded in low lactate media. Thus, for the measurement all fluorophore loading and pHi, 9 mM Na lactate was replaced with NaCl (total 104 mM NaCl and 1 mM Na lactate) and no BSA was included. In the experiments in which HCO3--free media were used, fluorophore loading and pHi measurements were made in HEPESKSOM (defined as 0 Bic. pHKFHM), from which HCO3- was also omitted. HCO3-/CO2- buffered medium was expressed as pHKSOM and equilibrated with 5% CO2/air. Na⫹-free media were produced by replacing the Na⫹ salts with the corresponding choline salts. For ammonium-containing solutions, 35 mM NaCl was replaced with equimolar NH4Cl. Where specified, HCO3--free media were used, in which 21 mM of NaHCO3 was replaced by HEPES, pH adjusted to 7.40, and equilibrated with air.

pHi was measured using the pH-sensitive carboxyseminaphthorhodafluor-1 (SNARF-1) loaded into oocytes/zygotes by incubation with 5.0 ␮M SNARF1-AM at 37 °C for 30 min in pHKFHM. After SNARF-1 was loaded, oocytes/zygotes were washed several times with pHKFHM and placed in a chamber that was modified to allow solution changes. All measurements were made in a temperature- and atmosphere-controlled chamber (37 °C, 5% CO2/air for HCO3-/CO2-buffered media, or air for HCO3--free media). pHi measurements were performed using photomultiplier tubes attached to an epifluorecense microscope. Oocytes/zygotes loaded with SNARF-1 were excited at a wavelength of 535 nm, and two emission wavelengths (640 and 600 nm) were determined. The ratio of the two intensities (640/600), which is mainly pHi dependent, was calculated by dividing the intensities after background subtraction. This ratio was calibrated to pHi using a calibration solution with 10 ␮g/ml nigericin and 5 ␮g/ml valinomycin added [34]. Initial pHi was determined in pHKSOM or 0 Bic. pHKFHM solutions after a 15-min stabilization period. 2.3. Testing Procedure of the Activities of Exchangers Following the initial pHi measurements, the NH4⫹ pulse method was used to induce acidosis [34]. This pulse produces an immediate alkalinization due to rapid NH3 equilibration across the membrane, followed by a slower partial reacidification as a result of the slower influx of the less permeable NH4⫹. Upon removal of external NH4Cl, the NH3 rapidly exits the cell, leaving behind any H⫹ that has entered as NH4⫹, thereby causing a net acidification of the cell [34]. The NH4Cl pulse was followed by a 10- to 20-min period in pHKSOM or 0 Bic. pHKFHM or in other appropriate medium, during which the ability of the oocyte/ zygote to recover from acidosis was assessed. Na⫹-

1060

S. Erdogan et al. / Theriogenology 75 (2011) 1057–1066

Table 1 The primers (Roche) and probes (Roche) used for PCR. Gene Target SLC9A1 (Q61165) SLC4A8 (NM_021530.2)

Primer sequences 5=¡=

Probe sequences 5=¡3=

CACCCTTTGAGATCTCCCTCT GGTGGGGATCACATGGAA CTGGACGATGCGAAGAAGA AACTTGTCACCCCCAATGTC

CACCCTTTGAGATCTCCCTCT GGTGGGGATCACATGGAA CTGGACGATGCGAAGAAG AACTTGTTCACCCCCAATGTC

free pHKSOM or Na⫹-free 0 Bic. pHKFHM was used immediately after the pulse, and measurements were taken for 10 min in Na⫹-free medium. The medium was then replaced with normal pHKSOM or 0 Bic. pHKFHM containing Na⫹, and pHi was measured for an additional 20 min. NHE activity and total recovery activity (NHE plus NDCBE activity) were determined as the recovery rate from induced acidosis in 0 Bic. pHKFHM and in pHKSOM, respectively [20,24,29,34]. NDCBE activity was estimated as the recovery difference, which occurred in pHKSOM and in 0 Bic. pHKFHM. EIPA (100 ␮M) or cariporide (1 ␮M) and DIDS (500 ␮M) were used to inhibit NHE and NDCBE, respectively. 2.4. Real-time RT-PCR analysis Real-time RT-PCR analyses were conducted using mRNA isolated from three sets of GV, MII oocytes, and PN zygote samples, with each sample containing 60 oocytes/zygotes. mRNA and cDNA extraction were accomplished using the High Pure RNA Isolation Kit (Roche Biochemicals) and Transkriptor First Strand cDNA Synthesis kit (Roche), respectively, following the manufacturer’s instructions. Each extracted sample (1 ␮g) was subjected to reverse transcription in 20 ␮L of a reverse transcriptase mixture containing 4 ␮L of reverse transcription buffer (0.5 mM each deoxynucleotide triphosphate, 5 mM MgCl2, 75 mM KCl, 50 mM Tris-HCl, pH 8.3), 2 ␮L of random hexamer primer, 0.5 ␮L of Protector RNase inhibitor, and 0.5 ␮L of Transcriptor reverse transcriptase (Roche). The mixture was incubated for 10 min at 25 °C followed by 60 min at 50 °C, and the reverse transcriptase was inactivated by heating at 85 °C for 5 min. We used 5 ␮L of the resulting cDNA as a template in the real-time PCR amplification using primers specific for the Mus musculus sodium/hydrogen exchanger 1 (solute carrier family 9 member 1-SLC9A1) and solute carrier family 4 (anion exchanger, member 8, SLC4A8) genes. Amplification was performed in a LightCycler® 480 instrument (Roche). PCR reactions were prepared in a final volume of 20 ␮L using the Fast DNA Master Hybridization Probes kit (Roche), with 0.2 ␮M of each

primer, 0.2 ␮M of each probe, and Taqman mix 2⫻ (Roche). After an initial denaturation step of 5 min at 95 °C, amplification was performed for 40 cycles (denaturation at 95 °C for 10 s, annealing at 60 °C for 30 s). The annealing step for each sample was monitored by continuous fluorescence. As a control for the quality of the extracted RNA, all samples were subjected to a reverse transcription-PCR assay targeted to mouse actin beta mRNA, which is expressed by GV and MII oocytes as well as PN zygote samples. The primers (Roche) and probes (Roche) used for PCR were as seen in Table 1. Although a significant difference in ␤-actin (Actb) expression exists between oocytes and blastocysts, no significant difference was found between oocytes and PN zygotes in mice [35,36]. Based on this result and because other studies have used the Actb gene as a reference gene, we also used it. For the mathematical analysis, it was necessary to determine the threshold cycle (Ct) value for each transcript. The Ct value represents the cycle number at which a fluorescent signal rises statistically above background. The Ct was used to determine the relative expression level of each gene by normalizing to the Ct of Actb. The ⌬⌬Ct method was used to calculate the relative fold change for each gene [37,38] using the following equations [38]: 1. Fold change(MII vs. GV) ⫽ 2-⌬⌬Ct, where ⌬⌬Ct ⫽ (CtMII/GOI⫺Ct GV/GOI)⫺(Ct MII/Actb⫺CtGV/Actb) and 2. Fold change(PN vs. MII) ⫽ 2-⌬⌬Ct, where ⌬⌬Ct ⫽ (CtPN/GOI⫺CtMII/GOI)⫺(Ct PN/Actb⫺CtMII/Actb). GOI, gene of interest (SLC9A1 or SLC4A8). 2.5. Statistics The rates at which oocytes/zygotes recovered from induced acidosis were compared by determining the recovery rate following an NH4Cl pulse. Recoveries were approximately linear until the pHi began to plateau. Thus, the recovery rate was calculated by linear regression from the data recorded at the initial linear portion of the recovery. The first one or two points

S. Erdogan et al. / Theriogenology 75 (2011) 1057–1066

1061

immediately following the solution change were not included in the regression to diminish the contribution of any perturbing effects of the solution change. Comparisons were made using a one-way ANOVA followed by the Tukey’s multiple comparison test. The statistical analysis of the data obtained from different solutions at the same oocyte/zygote stages were subjected to a t-test. Real-time RT-PCR was performed independently three times. The Kruskal–Wallis nonparametric ANOVA test was conducted to evaluate differences in expression between the GV and MII oocytes and PN zygotes. The Mann-Whitney U test was used to evaluate differences between the fold changes in expression in the MII vs GV and PN vs MII comparisons. SPSS software (ver. 13.0; SPSS, Inc., Chicago, IL, USA) was utilized. Data are presented as the mean ⫾ SEM; statistical significance was accepted at p ⬍ 0.05. 3. Results 3.1. Initial oocyte and zygote pHi Initial (resting) oocyte and zygote pHi values were stable before inducing acidosis in 0 Bic. pHKFHM and pHKSOM (Fig. 1). No statistically significant difference was observed between the initial pHi values of any oocyte/zygote stages recorded in the same solution (Table 2). 3.2. Assessment of NHE activity and its changes during meiotic maturation In the first step of the study, the presence and properties of defense mechanisms against acidosis were investigated. Because Na⫹ (but not bicarbonate) must be present in medium for NHE (a major defense mechanism against acidosis) to be functional, recovery was evaluated in the Na⫹-free 0 Bic. pHKFHM. No significant recovery from induced acidosis was observed in this solution. Recovery from acidosis occurred after reintroducing extracellular Na⫹ (Fig. 1). A series of experiments were conducted to verify the presence of NHE; following treatment in an Na⫹-free solution, recovery was evaluated in a medium in which extracellular Na⫹ was reintroduced, and EIPA or cariporide (NHE specific and a potent inhibitors) was also added to the solution. As a result, recovery was significantly inhibited by EIPA and cariporide in the GV and MII stages of the oocyte and in PN zygotes (Fig. 2). These findings indicated that recovery against acidosis in 0 Bic. pHKFHM occurred by NHE activity. Moreover,

Fig. 1. The recovery responses of GV (A) and MII (B) stage oocytes and PN zygotes (C) in 0 Bic. pHKFHM (‘) and pHKSOM (●). Traces were drawn using mean values. The initial part of each trace shows the baseline pHi. An NH4Cl pulse was applied from 10 to 20 min, resulting in net acidification after removal of NH4Cl. External Na⫹ was removed from 20 to 30 min, and the effect of reintroducing Na⫹ on recovery from induced acidosis was recorded from 30 to 50 min. The rate of recovery was determined from the slope of a line fit by linear regression.

1062

S. Erdogan et al. / Theriogenology 75 (2011) 1057–1066

Table 2 The mean initial pHi values for GV and MII stage oocytes and PN zygotes determined in 0 Bic. pHKFHM and pHKSOM. 0 Bic. pHKFHM pHKSOM a

GV

MII

PN

7.21 ⫾ 0.02a (N ⫽ 8, n ⫽ 77) 7.29 ⫾ 0.01 (N ⫽ 6, n ⫽ 67)

7.23 ⫾ 0.03 (N ⫽ 7, n ⫽ 35) 7.28 ⫾ 0.02 (N ⫽ 6, n ⫽ 32)

7.18 ⫾ 0.02a (N ⫽ 8, n ⫽ 63) 7.28 ⫾ 0.02 (N ⫽ 7, n ⫽ 57)

Significant when compared to the values of same stage oocytes/zygotes determined in pHKSOM (p ⬍ 0.05); N, mice used; n, oocytes/zygotes used

because NHE1 mRNA has been detected in both oocytes and post-fertilization stages in mice [8], SLC9A1 gene expression was investigated. Significantly higher SLC9A1 gene expression was observed compared with that observed for the internal control Actb gene in GV, MII stage oocytes, and PN zygotes (Table 3). Although NHE activity was 0.025 pHU/min in GV oocytes, it decreased at the MII stage. However, the recovery rate increased to a higher value in PN zygotes (Fig. 2, Table 4), indicating that the change in NHE activity was similar to that of AE during meiotic maturation, as reported by Phillips et al [21]. Accordingly, level of SLC9A1 expression was found to be decrease when GV oocytes proceeded to the MII stage; however, expression of gene increased when the MII oocytes proceeded to PN zygotes (Fig. 3). 3.3. Assessment of NDCBE activity and its changes during meiotic maturation NDCBE function (another defense mechanism against acidosis) requires both extracellular Na⫹ and

bicarbonate. Therefore, recovery was evaluated in Na⫹-free pHKSOM. No significant recovery was recorded in Na⫹-free pHKSOM (Fig. 1). However, when the oocytes and zygotes were reexposed to Na⫹ in pHKSOM following the Na⫹-free medium, the recovery rate was higher than that recorded in 0 Bic. pHKFHM (Fig. 1). This increased recovery rate was significantly inhibited by DIDS and EIPA (inhibitors of NDCBE and NHE, respectively) (Fig. 4). SLC4A8 gene expression was studied to further validate the presence of the Na⫹-driven Cl--HCO3- exchanger (NDCBE) [15]. The results showed a nonsignificant increase in SLC4A8 expression when compared with that of the Actb gene in GV and MII oocytes, but it was significantly higher in PN zygotes (Table 3). These findings indicated the presence of NDCBE in GV and MII oocytes and PN zygotes and also indicated that NDCBE was functional together with NHE in the recovery from acidosis. Although NHE activity was directly determined in 0 Bic. pHKFHM, HCO3--dependent recovery (mediated by NDCBE) was estimated from the difference between the responses determined in pHKSOM and in 0 Bic. pHKFHM. NDCBE activity as determined in EIPApHKSOM (a medium that inhibits NHE activity) supported such an approach (Fig. 4). Accordingly, the NDCBE contribution was obvious in MII stage oocytes and PN zygotes. (Fig.5). Furthermore, the expression of SLC4A8 gradually increased when GV oocytes proceeded to MII stage and then to PN zygote (Fig. 3). The contributions of NHE and NDCBE to the recovery rate Table 3 The mean SLC9A1, SLC4A8, and Actb gene Ct values in GV and MII stage oocytes and PN zygotes. Ct value data were collected from triplicate experiments.

Fig. 2. Mean rates of recovery from acidosis in 0 Bic. pHKFHM for GV and MII stage oocytes and PN zygotes, and the effects of EIPA and cariporide, and absence of Na⫹ in 0 Bic. pHKFHM (a, significant when compared to recovery rate recorded in 0 Bic. pHKFHM for the same oocyte or zygote stages; b, significant when compared to the values for GV stage oocytes and PN zygotes).

GV MII PN a

SLC9A1

SLC4A8

ACTB

28.51 ⫾ 0.88a 29.85 ⫾ 0.67a 27.95 ⫾ 0.29a

29.44 ⫾ 2.02 29.69 ⫾ 1.15 27.66 ⫾ 0.68a

31.94 ⫾ 0.81 32.52 ⫾ 0.54 31.32 ⫾ 0.27

Significant when compared to the Ct values of Actb of same stage oocytes or of PN zygotes (p ⬍ 0.05)

S. Erdogan et al. / Theriogenology 75 (2011) 1057–1066

1063

Table 4 The mean recovery rates from induced acidosis in GV and MII stage oocytes and PN zygotes in 0 Bic. pHKFHM and pHKSOM (values are given as pHU/min).

0 Bic. pHKFHM pHKSOM a b

GV

MII

PN

0.025 ⫾ 0.007 (N ⫽ 8, n ⫽ 77) 0.032 ⫾ 0.003 (N ⫽ 6, n ⫽ 67)

0.008 ⫾ 0.001 (N ⫽ 7, n ⫽ 35) 0.031 ⫾ 0.002b (N ⫽ 6, n ⫽ 32) a

0.025 ⫾ 0.003 (N ⫽ 8, n ⫽ 63) 0.047 ⫾ 0.005b (N ⫽ 7, n ⫽ 57)

Significant when compared to the values for GV stage oocytes and PN zygotes recorded in 0 Bic. pHKFHM (p ⬍ 0.05). Significant when compared to the values recorded in 0 Bic. pHKFHM (p ⬍ 0.05); N, mice used; n, number of recorded oocytes/zygotes.

from induced acidosis during meiotic maturation can be clearly seen in Fig. 5. 4. Discussion We found that NHE was active in GV stage oocytes and PN zygotes, but less active in MII stage oocytes. However, defense mechanisms against acidosis became more active in MII oocytes and PN zygotes in the presence of Na⫹ and HCO3-. Moreover, the expression levels of SLC9A1 and SLC4A8, encoding NHE1 and NDCBE, respectively, were consistent with these activity changes during meiotic maturation. Results when monocarboxylates: pyruvate and lactate were omitted indicate that MCT play no part in recovery from acidosis in these conditions. 4.1. Defense mechanisms against acidosis Oocyte and zygote pHi values did not completely return to their initial values upon recovery in HCO3--

Fig. 3. Fold changes in expression in MII vs GV and MII vs PN comparisons, as determined by real-time PCR in GV and MII oocytes and PN zygotes. Three replicates were used per gene for each reaction (a, significant when compared to MII vs GV comparison of SLC9A1 transcription).

free medium (Fig. 1). Effective recovery mechanisms from acidosis in the presence of Na⫹ and the absence of HCO3- medium occurs by Na⫹/H⫹ exchange [25,26,34,39]. Our findings indicating the inhibition of recovery in Na⫹-free medium and with EIPA and cariporide, a potent inhibitor of NHE1 [11], also illustrate the presence of NHE (Figs. 1 and 2). Moreover, NHE1 and NHE3 mRNA (coded by the SLC9A1 and SLC9A3 genes, respectively) are present in mouse oocytes [7–9], but only NHE1 mRNA has been detected in postfertilization stages [8]. Furthermore, only presence NHE1 activity were reported in unfertilized mouse oocyte [10] and its activity acts to correct acidosis in fully grown GV oocytes of mice [7,9]. We also found NHE1 expression in oocytes and zygotes (Table 3), but we determined that NHE activity alone was insufficient to allow complete recovery from induced acidosis in all oocyte stages and in PN zygotes. Similarly, NHE activity alone was found to be insufficient for a complete recovery from acidosis in human embryos [25]; that study found that pHi values occurring as a result of recovery from induced acidosis in HCO3--free medium

Fig. 4. Mean recovery rates from acidosis in pHKSOM for GV and MII stage oocytes and PN zygotes, and the effects of EIPA, DIDS, and the absence of Na⫹ (a, significant when compared to recovery rate of pHKSOM for the same oocyte stages/zygotes).

1064

S. Erdogan et al. / Theriogenology 75 (2011) 1057–1066

and zygotes are similar to those of that study. In contrast, recovery from acidosis in HCO3--containing medium was significantly inhibited by DIDS in our study (Fig. 4). Thus, our results indicated that this complementary regulation is likely to have been accomplished by NDCBE. These results showed that the presence of two acidalleviating mechanisms (Na⫹/H⫹ and Na⫹ HCO3-/Clexchangers) in mouse oocytes/zygotes was similar to the presence of redundant pathways to alleviate pHi in human cleavage-stage embryos and other cell types [6,12,17,25]. Fig. 5. Mean total exchanger and NHE activity in GV and MII stage oocytes and PN zygotes. NDCBE activity is shown as the difference between total recovery of activity determined in pHKSOM (all parts of the bar) and NHE activity determined in 0 Bic. pHKFHM (black portion of the bar); thus, the white portion of the bar represents the NDCBE activity. Following the induction of acidosis and upon the reintroduction of Na⫹, NDCBE significantly contributed to the recovery from acidosis in MII oocytes and PN zygotes.

were ⬃0.2 pHU below the initial pHi values. Although this research was conducted on human embryos, its findings are comparable to ours. The recovery responses from induced acidosis in HCO3--containing medium were better than were those in HCO3--free medium. Oocyte and zygote pHi values returned to their initial values following recovery in HCO3--containing medium (Fig. 1). Together with NHE, defense mechanism against acidosis can also be established by NDCBE [6,13,25,40], which is functional in Na⫹- and HCO3--containing medium [2,4,5,40,41]. Although no reports have addressed NDCBE activity in mice oocytes/embryos, the Na⫹driven Cl-/HCO3- exchanger is based on a functional characterization, partially in Xenopus oocytes [30]. In that study, it was reported that NDCBE has absolute requirements for Na⫹ and HCO3-, and it is blocked by DIDS in NDCBE-transfected Xenopus oocytes. Moreover, SLC4A8 gene expression has been reported in mouse oocytes and embryos [38,42], as we have shown in oocytes and zygotes (Table 3). The findings of these studies are supported by Na⫹-dependent HCO3-/Cl- exchanger availability and functional results. Furthermore, NDCBE-like activity in human embryos has been reported [25]. In that study, whereas the initial pHi value of 7.10 recovered to 6.90 by NHE activity following acidosis recovery, complete recovery was realized by adding HCO3- to the medium. The activity was evaluated as “NDCBE-like” activity because it was not inhibited by DIDS. Our findings from mouse oocytes

4.2. Changes in acidosis defense mechanisms during meiotic maturation AE and NHE activity is high in GV stage oocytes [19 –21]. Thus, the GV oocytes have defense mechanisms against alkalosis and acidosis. Interestingly, high AE activity decreases to a low level during MI and remains at a low level as long as oocytes are at the MII stage [9,21,22]. However, this low AE activity returns to its initial high level at the time of PN formation [21,22]. Similarly, NHE activity in GV stage oocytes [7,20] is inactivated at the MII stage in human and hamster oocytes [25,26]. Moreover, NHE activity is maximally detected at 7 hours after egg activation in hamsters [26]. According to our study, NHE activity in GV stage oocytes and PN zygotes was significantly higher than that in MII stage oocytes (Table 4). Thus, changes in NHE activity during meiotic maturation appear to be similar to changes in the pattern of AE activity, as shown by Phillips et al [21]. Accordingly, SLC9A1 expression was found to decrease when GV oocytes proceeded to the MII stage, however, its expression significantly increased when MII oocytes proceeded to PN zygotes (Fig. 3). The physiological reason for the specific meiotic inhibition during the GV-to-MII transition in oocytes remains unclear, although it may be related to the loss of transcripts involved in energyproducing processes [38]. Consequently, there is a need to conserve energy in the ovulated egg until fertilization and metabolic activation [43]. In our study, NDCBE activity (estimated as the recovery difference, which occurred in pHKSOM and in 0 Bic. pHKFHM) was low in GV oocytes, but increased in MII stage oocytes and PN zygotes (Fig. 5). Thus, these oocyte stages and zygotes recovered completely from induced acidosis. Although NDCBE activity has not been evaluated directly, Fitzharris et al [7] reported that the small amiloride-insensitive component of pHi recovery in fully grown denuded mouse

S. Erdogan et al. / Theriogenology 75 (2011) 1057–1066

oocytes observed in the presence of HCO3- might result from NDCBE activity. Moreover, whereas the recovery rates from induced acidosis, as determined in HCO3-containing medium from a few MI stage human oocytes, were low, those of human MII oocytes were high, as reported by Phillips et al [25]. Furthermore, human embryos recovered completely in HCO3--containing medium in the same study [25]. However, acidosis defense mechanisms during meiotic maturation were not investigated systematically in that study. The findings of Fitzharris et al [7], obtained from mouse oocytes, and those of Phillips et al [25], from human oocytes and embryos, support our results regarding changes in NDCBE activity during meiotic maturation. Additionally, the expression level of SLC4A8, which encodes NDCBE, showed gradually increase when GV oocytes proceeded to the MII stage and then to PN zygotes (Fig. 3). NDCBE activity seems to develop through a different pattern than that observed in AE and NHE; NDCBE activity was low in GV oocytes, but high in MII stage oocytes and PN zygotes. In summary, our results demonstrate the presence of two acid-alleviating mechanisms (Na⫹/H⫹ and Na⫹ HCO3-/Cl- exchangers) in mouse oocytes/zygotes, and suggest that complete recovery from acidosis is obtained with complementary NDCBE activity in mouse. On the other hand, during meiotic maturation, NHE was active in GV stage oocytes and PN zygotes, but less active in MII stage oocytes, as reported for AE. However, NDCBE activity was high in MII oocytes and PN zygotes. Thus, the contribution of NDCBE to the recovery from acidosis was most apparent in MII stage oocytes and PN zygotes. Finally, SLC9A1 and SLC4A8 transcription appears to be correlated with these changes in activity.

Acknowledgments We gratefully acknowledge our helpful discussions with Dr. Jay M. Baltz. We thank Dr. Jürgen Pünter (Sanofi Aventis, Frankfurt) for the kind gift of cariporide, and Senay Dagilgan for technical assistance. This study was supported by TUBITAK (SBAG-3154) and performed in the Medical Sciences Research and Application Center of Cukurova University, Adana, Turkey.

References [1] Roos A, WF Boron. Intracellular pH. Physiol Rev 1981;61: 296 – 434.

1065

[2] Boron WF. Intracellular pH regulation. In: Membrane Transport Processes. In: T.E. Andreoli et al, editors. Organized Systems. Plenum: NY; 1987 p. 39 –51. [3] Boyarsky G, Ganz MB, Sterzel RB, Boron WF. pH regulation in single glomerular mesangial cells. I. Acid extrusion in absence and presence of HCO3. Am J Physiol 1988;255:C844 – 56. [4] Boyarsky G, Ganz MB, Sterzel RB, Boron WF. pH regulation in single glomerular mesangial cells. II. Na⫹-dependent and -independent Cl(-)-HCO3-exchangers. Am J Physiol, 1988;255: C857– 69. [5] Tonnessen TI, Sandvig K, Olsnes S. Role of Na(⫹)-H⫹ and Cl(-)-HCO3- antiports in the regulation of cytosolic pH near neutrality. Am J Physiol 1990;2586:C1117–26. [6] Orlowski J, Grinstein S. Diversity of the mammalian sodium/ proton exchanger SLC9 gene family. Pflugers Arch 2004;447: 549 – 65. [7] FitzHarris G, Siyanov V, Baltz JM. Granulosa cells regulate oocyte intracellular pH against acidosis in preantral follicles by multiple mechanisms. Development 2007;134:4283–95. [8] Barr KJ, Garrill A, Jones DH, Orlowski J, Kidder GM. Contributions of Na⫹/H⫹ exchanger isoforms to preimplantation development of the mouse. Mol Reprod Dev 1998;50:146 –53. [9] FitzHarris G, Baltz JM. Regulation of intracellular pH during oocyte growth and maturation in mammals. Reproduction 2009; 138:619 –27. [10] Harding EA, Gibb CA, Johnson MH, Cook DI, Day ML. Developmental changes in the management of acid loads during preimplantation mouse development. Biol Reprod 2002;67: 1419 –29. [11] Masereel B, Pochet L, Laeckmann D. An overview of inhibitors of Na(⫹)/H(⫹) exchanger. Eur J Med Chem 2003;38:547–54. [12] Alper SL. The band 3-related anion exchanger (AE) gene family. Annu Rev Physiol 1991;53:549 – 64. [13] Romero MF, Fulton CM, Boron WF. The SLC4 family of HCO 3 - transporters. Pflugers Arch, 2004;447:495–509. [14] Damkier HH, Nielsen S, Praetorius J. Molecular expression of SLC4-derived Na⫹-dependent anion transporters in selected human tissues. Am J Physiol Regul Integr Comp Physiol 2007; 293:R2136 – 46. [15] Chen LM, Kelly ML, Parker MD, et al. Expression and localization of Na-driven Cl-HCO(3)(-) exchanger (SLC4A8) in rodent CNS. Neuroscience 2008;153:162–74. [16] Aronson PS, Nee J, Suhm MA. Modifier role of internal H⫹ in activating the Na⫹-H⫹ exchanger in renal microvillus membrane vesicles. Nature 1982;299:161–3. [17] Vaughan-Jones RD. Regulation of intracellular pH in cardiac muscle. In: Bock G, Marsh J, editors. Proton Passage Across Cell Membranes. Chichester: Wiley; 1988, p. 23-46. [18] Olsnes S, Tonnessen TI, Sandvig K. pH-regulated anion antiport in nucleated mammalian cells. J Cell Biol 1986;102:967– 71. [19] Fitzharris G, Baltz JM. Granulosa cells regulate intracellular pH of the murine growing oocyte via gap junctions: development of independent homeostasis during oocyte growth. Development 2006;133:591–9. [20] Erdogan S, FitzHarris G, Tartia AP, Baltz JM. Mechanisms regulating intracellular pH are activated during growth of the mouse oocyte coincident with acquisition of meiotic competence. Dev Biol 2005;286:352– 60. [21] Phillips KP, Petrunewich MA, Collins JL, Baltz JM. The intracellular pH-regulatory HCO3-/Cl- exchanger in the mouse

1066

[22]

[23]

[24]

[25]

[26]

[27]

[28]

[29]

[30]

[31] [32]

[33]

S. Erdogan et al. / Theriogenology 75 (2011) 1057–1066 oocyte is inactivated during first meiotic metaphase and reactivated after egg activation via the MAP kinase pathway. Mol Biol Cell 2002;13:3800 –10. Cetinkaya A, Erdogan S. Changes of HCO3-/Cl- exchanger activity during meiotic maturation in Balb/c strain mouse oocytes and zygotes. J Reprod Dev 2008;54:492–5. Baltz, J.M., J.D. Biggers, and C. Lechene, Relief from alkaline load in two-cell stage mouse embryos by bicarbonate/chloride exchange. J Biol Chem 1991;266:17212–7. Zhao, Y. and J.M. Baltz, Bicarbonate/chloride exchange and intracellular pH throughout preimplantation mouse embryo development. Am J Physiol 1996;271:C1512–20. Phillips KP, Léveillé MC, Claman P, Baltz JM. Intracellular pH regulation in human preimplantation embryos. Hum Reprod 2000;15:896 –904. Lane M, Baltz JM, Bavister BD. Na⫹/H⫹ antiporter activity in hamster embryos is activated during fertilization. Dev Biol 1999;208:244 –52. Lane M, Baltz JM, Bavister BD. Regulation of intracellular pH in hamster preimplantation embryos by the sodium hydrogen (Na⫹/H⫹) antiporter. Biol Reprod 1998;59:1483–90. Gibb CA, Poronnik P, Day ML, Cook DI. Control of cytosolic pH in two-cell mouse embryos: roles of H(⫹)-lactate cotransport and Na⫹/H⫹ exchange. Am J Physiol 1997;273:C404 –19. Steeves CL, Lane M, Bavister BD, Phillips KP, Baltz JM. Differences in intracellular pH regulation by Na(⫹)/H(⫹) antiporter among two-cell mouse embryos derived from females of different strains. Biol Reprod 2001;65:14 –22. Wang CZ, Yano H, Nagashima K, Seino S. The Na⫹-driven Cl-/HCO3- exchanger. Cloning, tissue distribution, and functional characterization. J Biol Chem 2000;275:35486 –90. Lawitts JA, Biggers JD. Culture of preimplantation embryos. Methods Enzymol 1993;225:153– 64. Leese HJ, Barton AM. Pyruvate and glucose uptake by mouse ova and preimplantation embryos. J Reprod Fertil 1984;72:9 – 13. Harding EA, Day ML, Gibb CA, Johnson MH, Cook DI. The activity of the H⫹-monocarboxylate cotransporter during pre-

[34]

[35]

[36]

[37]

[38]

[39]

[40]

[41]

[42]

[43]

implantation development in the mouse. Pflugers Arch 1999;438:397– 404. Baltz JM, Phillips KP. Intracellular ion measurements in single eggs and embryos using ion-sensitive fluorophores. In: Richter JD, editor. A Comparative Methods Approach to the Study of Oocytes and Embryos. Oxford University Press: New York and Oxford. 1999, p. 39 – 82. Mamo S, Gal AB, Bodo S, Dinnyes A. Quantitative evaluation and selection of reference genes in mouse oocytes and embryos cultured in vivo and in vitro. BMC Dev Biol 2007;7:14. Jeong YJ, Choi HW, Shin HS, et al., Optimization of real time RT-PCR methods for the analysis of gene expression in mouse eggs and preimplantation embryos. Mol Reprod Dev 2005;71: 284 –9. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001;25:402– 8. Su YQ, Sugiura K, Woo Y, et al., Selective degradation of transcripts during meiotic maturation of mouse oocytes. Dev Biol 2007;302:104 –17. Zhao Y, Chauvet PJ, Alper SL, Baltz JM. Expression and function of bicarbonate/chloride exchangers in the preimplantation mouse embryo. J Biol Chem 1995;270:24428 –34. Sipos H, Törocsik B, Tretter L, Adam-Vizi V. Impaired regulation of pH homeostasis by oxidative stress in rat brain capillary endothelial cells. Cell Mol Neurobiol 2005;25:141–51. Taylor CJ, Nicola PA, Wang S, Barrand MA, Hladky SB. Transporters involved in regulation of intracellular pH in primary cultured rat brain endothelial cells. J Physiol 2006;576: 769 – 85. Zeng F, Baldwin DA, Schultz RM. Transcript profiling during preimplantation mouse development. Dev Biol 2004;272:483– 96. Baltz JM. pH-regulatory mechanisms in the mammalian oocyte and early embryo. Ch. 7. In: Karmazyn M, Avkiran M, Fliegel L, editors. The Sodium-Hydrogen Exchanger. From Molecule to its Role in Disease. Kluwer Academic Publishers: Boston; 2003, p. 123–136.