Channel catfish, Ictalurus punctatus, CD4-like molecules

ARTICLE IN PRESS

Developmental and Comparative Immunology 31 (2007) 172–187

Developmental & Comparative Immunology www.elsevier.com/locate/devcompimm

Channel catfish, Ictalurus punctatus, CD4-like molecules Eva-Stina Edholma, James L. Stafforda, Sylvie M. Quinioub, Geoff Waldbieserb, Norman W. Millera, Eva Bengte´na, Melanie Wilsona, a

Department of Microbiology, University of Mississippi Medical Center, 2500 North State Street, Jackson, MS 39216, USA b USDA-ARS/CGRU, 141 Experimental Station Road, Stoneville, MS 38701, USA Received 7 March 2006; received in revised form 25 May 2006; accepted 26 May 2006 Available online 30 June 2006

Abstract Two CD4-like (CD4L) molecules have been identified in channel catfish, Ictalurus punctatus. Although phylogenetically related to other vertebrate CD4 molecules, they exhibit only 19% amino acid identity to each other. IpCD4L-1 encodes a predicted protein containing four immunoglobulin domains, a transmembrane region and a cytoplasmic tail containing a p56lck binding site. In contrast, IpCD4L-2 encodes for a similar protein with three immunoglobulin domains. The gene organization of IpCD4L-1 is very similar to that of other vertebrate CD4 genes, while the genomic organization of IpCD4L-2 is different. Southern blots indicate both catfish molecules are likely single copy genes and mapping studies show that both are found on a single Bacterial Artificial Chromosome suggesting close linkage. At the message level, IpCD4L-1 and -2 are expressed in various catfish lymphoid tissues and in non-B-cell peripheral blood leukocytes (PBL). Both messages are upregulated in concanavalin A (ConA) and alloantigen stimulated PBL, but not in lipopolysaccharide (LPS)-stimulated cultures. In contrast, they are differentially expressed among the catfish clonal T cell lines. While both molecules appear to be T cell specific, their functional significance in catfish is unknown. r 2006 Elsevier Ltd. All rights reserved. Keywords: Channel catfish; CD4; B and T cells; Cytotoxic T lymphocytes; Target recognition

1. Introduction It is now well established that teleosts have the functional equivalents of T cells [1–8], which express Abbreviations: CD4L, CD4-like; D, Domain; PBL, Peripheral blood leukocytes; MLC, mixed leukocyte culture; CYT, cytoplasmic tail; TM, transmembrane; CTL, cytotoxic T cell line; MACS, magnetic activated cell sorting; 2-ME, beta 2-mercaptoethanol; LPS, lipopolysaccharide; ConA, Concanavalin A; UT, untranslated; LAG-3, lymphocyte activation gene-3 Corresponding author. Tel.: +1 601 984 1739; fax: +1 601 984 1708. E-mail address: [email protected] (M. Wilson).

genes homologous to mammalian T cell receptors (TCR; [9–19]) and to T cell accessory/signaling molecules such as CD3 and CD8 [20–26]. However, very little is known about teleost fish T cell subsets, their functional mechanisms and regulation. This has been, in part, due to a lack of T cell surface specific markers and viable in vitro culture systems for most fish species. Previous in vitro and molecular studies performed in the channel catfish indicate that catfish contain the functional and structural equivalents of mammalian T cells [14,27–33]. At a functional level, it was shown that catfish surface immunoglobulin-negative (sIg
) lymphocytes were the responding cells in mixed

0145-305X/$ - see front matter r 2006 Elsevier Ltd. All rights reserved. doi:10.1016/j.dci.2006.05.012

ARTICLE IN PRESS E.-S. Edholm et al. / Developmental and Comparative Immunology 31 (2007) 172–187

leukocyte culture (MLC; [27]) and in combination with B cells (sIg+) and accessory cells (presumably macrophages) were required for in vitro antibody responses to thymus-dependent antigens [28]. Additionally, catfish sIg
cells were shown to respond to concanavalin A (ConA) but not to lipopolysaccharide (LPS) [29] and proliferated in an antigenspecific fashion to autologously processed and presented antigens [30,31]. Moreover, the existence of T cells in catfish was unequivocally established by the cloning of catfish TCR a and b genes and the establishment of clonal T cell lines [14,32,33]. In birds and mammals, CD4 and CD8 define the major abT cell subsets into cytotoxic CD8+ T cells and helper CD4+ T cells. They each function as coreceptors binding MHC I and MHC II, respectively. Besides stabilizing the interaction of the TCR with the MHC–peptide complex, both CD8 and CD4 play roles in early T cell intracellular signaling events by their non-covalent association with the protein tyrosine kinase p56lck via a conserved binding site in their cytoplasmic tails (CYTs); [reviewed in 34]). Recently, CD4-like (CD4L) molecules in tiger pufferfish (Takifugu rubripes) and rainbow trout (Oncorhynchus mykiss) were reported [35,36 and accession numbers AAYY2068–71]. Identification of these genes, together with the previously reported teleost CD8 sequences [24–26], argues that fish have CD4 and CD8 T cell subpopulations. The CD4 cDNA first reported in pufferfish encodes for a molecule with four extracellular immunoglobulin (Ig) domains, a transmembrane (TM) region and a CYT containing a consensus tyrosine kinase p56lck binding site. Although this sequence has low amino acid identity (15–20%) with mammalian and avian CD4 molecules, it clustered with them in phylogenetic analyses and its overall gene structure is reminiscent of chicken, murine and human CD4 genes [35]. Smaller CD4L genes from pufferfish and trout were subsequently identified and shown to encode for a two Ig domain encoding molecule with a TM and a CYT containing a consensus tyrosine kinase p56lck binding site [36]. These shorter sequences were termed CD4L-2 and, like the larger pufferfish and trout CD4 molecules (termed CD4L-1) exhibited homology with other vertebrate CD4 sequences. Phylogenetic analyses, however, showed that trout CD4L-2 and pufferfish CD4L-1 Ig domain sequences clustered with both mammalian CD4 and lymphocyte activation gene-3 (LAG-3) sequences [36]. Mammalian LAG-3 is closely related to CD4

173

and is found next to CD4 on chromosome 12 in humans [37,38]. Importantly, homology searches indicate that the long and short forms of pufferfish CD4 are both located on a gene scaffold that has synteny to the genomic region encoding human CD4 [36]. For example, the pufferfish CD4L-1 and -2 genes are found between the ubiquitin-specific protease 5 (USP5) gene and the COP9 constitutive photomorphogenic homolog subunit 7A (COPS7A) gene. These surrounding genes also flank mammalian CD4 and LAG-3 [36]. Herein are reported the sequences, characterization and cell line expression patterns of two catfish CD4L molecules, a long form (IpCD4L-1) consisting of four Ig domains and a shorter form (IpCD4L-2) consisting of three Ig domains. The presence of message for two different CD4L molecules in catfish T cells is intriguing since it not only implies that bony fish have the functional equivalents of mammalian CD4+ T cells, but also that there may be multiple T cell subsets in teleosts. 2. Materials and methods 2.1. Animals and cell lines Channel catfish (1–2 kg) were obtained from a commercial source (ConAgra, Isola, MS) and maintained in individual tanks as previously described [39]. The catfish leukocyte cell lines were grown at 27 1C in AL-3 medium consisting of equal parts AIM-V and L-15 (Invitrogen Life Technologies, Gaithersburg, MD) adjusted to catfish tonicity with 10% (v/v) deionized water and supplemented with 1 mg/ml NaHCO3, 50 U/ml penicillin, 50 mg/ml streptomycin, 20 mg/ml gentamicin, 50 mM beta 2mercaptoethanol (2-ME) and 3% heat-inactivated, pooled, normal catfish serum [40]. The 1G8 and 3B11 cell lines are cloned autonomous B cells generated from two different outbred catfish by mitogen stimulation [41,42]. 42TA is a macrophage cell line that contains some T cells [41], 28S and G14D are T cell lines [14, 43], and TS32.15 and TS32.17 are cloned non-autonomous antigen-dependent cytotoxic T cell lines (CTL), which require weekly restimulation with irradiated catfish B cells for continuous proliferation [32,33]. 4G4 and 1F3 are catfish NK-like cell lines [44]. Catfish peripheral blood leukocytes (PBL) were isolated from heparinized blood by centrifugation on a cushion of Ficoll-Hypaque (Lymphoprep, Accurate Chemical Corp., Westbury, NY) as described previously [40].

ARTICLE IN PRESS 174

E.-S. Edholm et al. / Developmental and Comparative Immunology 31 (2007) 172–187

Before use, PBL were washed in RPMI-1640 adjusted to catfish tonicity by adding 10% H2O (CF-RPMI). 2.2. Identification and analyses of IpCD4L sequences IpCD4L-1 was originally obtained by searching the catfish EST databases using a rainbow trout CD4 cDNA sequence provided by Dr. John Hansen (Pathobiology, University of Washington, WA). A single EST (accession number, CV996750) from a catfish fry cDNA library was subsequently identified. Since the sequence was truncated, 50 and 30 RACE protocols were used to obtain the full-length sequence from pronephros (head kidney) mRNA. An IpCD4L-2 fragment was similarly obtained by searching the TIGR (www.tigr.org/tdb/tgi/) catfish EST databases with the rainbow trout CD4-related cDNA (accession number AAY42069) and fulllength IpCD4L-2 was obtained by 50 and 30 RACE. Both catfish CD4L cDNA sequences were then subsequently sequenced on both strands using universal forward and reverse primers and genespecific primers (Table 1). A single catfish bacterial artificial chromosome (BAC CCBL1_09I08) was identified by PCR screening of the CCBL1 BAC library [45] using specific IpCD4L-1 primers (Table 1). The IpCD4L-1 and IpCD4L-2 genes were sequenced directly from the BAC DNA by chromosome walking at the USDA-ARS MSA Genomics

Laboratory. Primers used for the BAC sequencing and their locations are available upon request. Nucleotide and amino acid sequences were analyzed using DNASTAR software (Madison, WI), and aligned using CLUSTALW [46]. Neighbor-joining (NJ) trees with pairwise gap deletions were drawn using MEGA v3.0 [47]. Similarity searches were performed using BLAST analysis [48] against the National Center for Biotechnology Information (NCBI) non-redundant database. Ig domains, TM segments and CYT regions were predicted using SMART (http://smart.emblheidelberg.de/), the signal peptide sequence was predicted using the CBS prediction SignalP 3.0 server (www.cbs.dtu.dk/services/SignalP). Sequence decorations were performed using GeneDoc (psc. edu/biomed/genedoc) and conserved substitutions were set according to the program’s Blossum 62 substitution matrix default values. Silencer elements in IpCD4L-1 were determined by sequence comparison to the chicken, murine and human CD4 genomic sequences [49–51]. Putative transcription factor binding sites were predicted using the TFSEARCH program version 1.3. (http:// www.cbrc.jp/reserche/db/TFSEARCHJ.htlm). 2.3. Southern blots Genomic DNA was prepared using erythrocytes from outbred and homozygous gynogenetic catfish

Table 1 IpCD4L-1and IpCD4L-2 primers Primer

Sequence 50 to 30

Locationa

Useb

CD4L1 UTR CD4L1 F0 CD4L1 R3 CD4L1 F1 CD4L1 R1 CD4L1 F4 CD4L1 R0 CD41 F2 CD4L1 F3 CD4L2 (I-472) CD4L2 (I-474) CD4l2 (I-475) CD4L2 (I-455) CD4L2 (I-465) CD4L2 (I-473) CD4L2 (I-454)

CCTGAGAAAGGGAACGACAAACA GACAGAATGAGCTTCTTATTGGG CTGGAAGTACCAGTTGACATG CATGTCAACTGGTACTTCCAGG GGAGGCGAGATCTACAATGATG ATGAAGTAATGATGTCTACACCG GGCATTCACTGTGCACCAGGGAA TTCCCTGGTCCACAGTGAATGC GAGGGTAACACAGTGAACTT AGCACAAGCTTCTCATCTCAG GGGAAGTTAAGACTCATGAAGG ATATCAGGATCATCACCATC CAACATGTGGAACAAACGTGTG CCCACACACGTTTGTTCCAC TCCGTTTGTTCCTGCAGTGAAT TACTGGTGCCTGGGTAGAGGT

130–152 214–236 355–376 379–400 832–855 578–600 929–951 929–950 1251–1268 23–43 641–662 973–992 1023–1042 1029–1048 1126–1147 1263–1283

s,p s s s,p,h s,p,h h s,p s s p p,h p s s s,h s,p

a

Nuclotide location in cDNA of IpCD4L-1 (DQ435301 ) and IpCD4L-2 (DQ435302). s ¼ sequencing, h ¼ hybridization, p ¼ RT-PCR.

b

ARTICLE IN PRESS E.-S. Edholm et al. / Developmental and Comparative Immunology 31 (2007) 172–187

as described previously [52]. The DNA (10 mg) was digested to completion with EcoRI, Pst I or Sac I restriction enzyme, separated on 1% agarose gels and transferred by capillary action onto HybondN+ membranes (Amersham Pharmacia Biotech, Piscataway, NJ) using standard techniques. Hybridizations were performed in Rapid-hyb buffer (Amersham Pharmacia Biotech) at 65 1C according to manufacturer’s instructions and membranes were washed at high stringency (65 1C with 0.1  SSC, 0.1% SDS). BAC CCBL1_09I08 blots were made as above except 0.4 mg of BAC DNA was digested with EcoRI. Hybridizations were performed using an IpCD4L-1 D2 or an IpCD4L-2 D3/TM probe. All probes were amplified by PCR using IDPol DNA polymerase (ID Labs Biotechnology, London, Ontario) according to the manufacturer’s protocol. Parameters were: 1 min 94 1C, followed by 29 cycles of 94 1C 30 s, 61 1C 30 s, 72 1C 1 min, then a final extension at 72 1C for 5 min. The primers used are listed in Table 1; probes were random primed labeled with [32P] dCTP by Megaprime labeling (Amersham Pharmacia Biotech). 2.4. RNA preparation, reverse transcription PCR (RT-PCR) For RT-PCR, total RNA from catfish PBL, various tissues and clonal cell lines (42TA, 3B11, 1G8, 28S, G14D, TS32.15, TS32.17, 4G4 and 1F3) were prepared using RNA-Bee (Tel-test Inc, Friendswood, TX). Before being reversed transcribed, RNA was treated with DNase I (Invitrogen Life Technologies) and 1 mg was subsequently converted into cDNA using an oligo-T primer and 200 units of Superscript III RT (Invitrogen Life Technologies). Amplification was performed using catfish-specific primers for the catfish CD4L molecules, TCRa, TCRb, membrane (m) IgM and elongation factor 1-a (EF1-a). Primer pairs are listed in Tables 1 and 2. Typical parameters for PCR reactions were: 3 min 94 1C, followed by 30 cycles of 94 1C 30 s, 58 1C 30 s, 72 1C 1 min 30 s, then a final extension at 72 1C for 10 min. Annealing temperatures varied from 55 to 61 1C depending upon the specific primers used. Products were visualized following separation on 1.2% TAEagarose gels. RT-PCR was also performed with total RNA obtained from catfish sorted PBL (sIgM+ and sIgM
) and short-term cultures of PBL stimulated with mitogens or alloantigen. To obtain sorted fractions,

175

Table 2 Channel catfish gene-specific primers used for RT-PCR Primer

Sequence 50 –30

Referencea

TCRa F TCRa R TCRb F TCRb R MIgm, F MIgm, R EF1-a F EF1-a R

AGCCGTCAATTTACAAACTTC GCAGGCAAATGAAAGTAGAATT AAACTCCAAGCACCAACTGTCACC AAAACCCTGTCTCCTAACGATGTA GAGTGGATCAATGGCACC CTCCATCACATAGTGGAAGAT GACTGCCACACTGCTCACATTG TTAGTTACTCAGCAGCTTTCTTCC

[14] [14] [14] [14] P23735 P23735 ABC75588 ABC75588

a

Reference or GenBank accession number is given.

PBL were separated into B-cell-enriched and B-celldepleted fractions by magnetic activated cell sorting (MACs). Approximately 2  108 cells were incubated with 1 ml of 9E1 mAb anti-catfish IgM [53] supernatant for 30 min at 4 1C. After washing with CFRPMI, the cells were resuspended in 240 ml of degassed CF-RPMI supplemented with 2 mM EDTA and 0.5% BSA. Sixty microliters of goat anti-mouse IgG microbeads (Miltenyi Biotec, Gladbach, Germany) was then added and the cells were incubated for 30 min at 4 1C, washed with CF-RPMI, and separated into sIgM
and sIgM+ fractions using MiniMACs separation columns (Miltenyi Biotec) according to the manufacturer’s protocol. Fractions were washed with CF-RPMI and the RNA was prepared. Mitogen-stimulated PBL were obtained as described previously [40]. Briefly, PBL were cultured in 24-well plates (Corning Inc., Corning, NY) in AL-5 media containing either 50 mg/ml of Con A (Sigma Chemical Co, St Louis, MO) or 100 mg/ml of LPS (from Salmonella typhimurium, Sigma). Proliferating cells (5  106) were harvested on days 4, 6, 8 and 12 post-stimulation for RNA preparations. The alloantigen-stimulated PBL were obtained according to the protocol originally described by Stuge et al. [54]. Typically, 5  106 catfish non-immune PBL were incubated with 2  106 irradiated (4000 rad) allogeneic 3B11 B cells and cultured in 1 ml Al-5 media per well in 24-well plates. These MLCs were incubated at 27 1C as described and restimulated with irradiated 3B11 B cells on day 12; 5  106 cells were harvested daily for RNA preparation beginning with day 4. 3. Results 3.1. Catfish IpCD4L-1 and CD4L-2 Catfish IpCD4L-1 and IpCD4L-2 encode for type I TM proteins with four and three extracellular Ig

ARTICLE IN PRESS 176

E.-S. Edholm et al. / Developmental and Comparative Immunology 31 (2007) 172–187

Fig. 1. Catfish CD4-like sequences. Nucleotide and predicted amino acid sequences of (A) IpCD4L-1 (DQ435301) and (B) IpCD4L-2 (DQ435302). The predicted 50 UT, signal peptide, Ig domains, TM and CYT are labeled above the sequence. Potential N-linked glycosylation sites are underlined and the conserved p56Lck site is gray shaded. The stop (TGA) codon is marked with (*), putative polyadenylation sites are dashed-underlined and nucleotide and amino acid numbers are at left.

ARTICLE IN PRESS E.-S. Edholm et al. / Developmental and Comparative Immunology 31 (2007) 172–187

177

Fig. 1. (Continued)

domains (D), respectively. Both encode for molecules with long positively charged CYT containing conserved protein tyrosine kinase p56Lck binding motifs (C-X-C) akin to those found in all vertebrate CD4 molecules (Fig. 1). The full-length IpCD4L-1 transcript consists of 2015 nucleotides with a 1413 bp open reading frame encoding 471 amino acids, and the mature CD4L-1 protein is predicted to have a molecular weight of 53 kDa. Four Nglycosylation sites are present and the single glycosylation site in D4 appears to be conserved in all vertebrate CD4 molecules [35,55] Comparatively, the full-length IpCD4L-2 transcript consists of 1587

nucleotides with a 1236 bp open reading frame encoding 412 amino acids. The mature CD4L-2 protein is predicted to have a molecular weight of 46 kDa and five N-glycosylation sites are present. Overall, the two catfish molecules have only 19% amino acid identity to each other and the TM/CYT regions share the most identity at 23%. As expected, database searches using the IpCD4L-1-predicted amino acid sequence identified the trout and fugu CD4 molecules containing four Ig domains and various avian and mammalian CD4 sequences as potential relatives (E-values ranging from 2e–65 to 1e–05). Among the three fish, amino

ARTICLE IN PRESS 178

E.-S. Edholm et al. / Developmental and Comparative Immunology 31 (2007) 172–187

Fig. 2. IpCD4L-1 and IpCD4L-2 sequence analyses. (A) Amino acid alignment of IpCD4L-1 with fish CD4L-1s, and avian, mouse and human CD4 sequences. (B) Amino acid alignment of IpCD4L-2 with other fish CD4L-2 sequences. Gray shading shows conserved (X80%) amino acids and (-) represent gaps in the alignment. Immunoglobulin domains are labeled according to the catfish, the p56lck site in the CYT is over and underlined; (*) mark conserved cysteines that form the intrachain disulfide bonds. The number of amino acids is listed at the right. The abbreviations and accession numbers for the various sequences used are: rainbow trout (Om CD4L-1, AAY42070); tiger pufferfish (Tr CD4L-1, BAD37153); chicken (Gg CD4, ABA55042); Muscovey duck (Cm CD4, AAW63065); mouse (Mm CD4, AAC36010); human (Hs CD4, CAA60883); tiger pufferfish (Tr CD4L-2, [35]); rainbow trout (Om CD4L-2a01, AY772711); rainbow trout (Om CD4L-2b01, AY899932).

ARTICLE IN PRESS E.-S. Edholm et al. / Developmental and Comparative Immunology 31 (2007) 172–187

acid sequence identities range from 31% to 41%. However, when the fish CD4 sequences are compared to avian (chicken and Moscovy duck), murine and human CD4 sequences, identities range from 16% to 18%. Similar identities are also found when the avian molecules are compared to mammalian CD4s. For example, the chicken and duck CD4s share 24% amino acid identity with mouse and human CD4s, but are 62% identical to each other. The murine and human CD4 molecules share 55% sequence identity. An amino acid alignment comparing representative vertebrate CD4 sequences with IpCD4L-1 is shown in Fig. 2A; conserved amino acids are shaded in gray. The highest sequence identities/similarities occur in the D4, TM and CYT regions. As with the trout and pufferfish CD4L-1 sequences, IpCD4L-1 lacks the first cysteine that would form the intrachain disulfide bond of D1. However, all the other cysteines for disulfide bond formation are in place. In contrast, avian D2 sequences lack the first cysteine for forming a disulfide bond, and in avian, murine and human CD4 D3 sequences, both cysteines are missing. None of the fish CD4L sequences contain the conserved amino acids that precede the p56lck site in mammalian CD4 that are known to be involved in antigen-induced CD4 internalization, i.e. the di-leucine motif and the serine residue that becomes phosphorylated are missing. However, the functional relevance of these missing residues in fish CD4L-1 molecules is unknown. An amino acid alignment comparing the trout and pufferfish CD4L-2 sequences with IpCD4L-2 is shown in Fig. 2B. The catfish sequence is quite different from the other fish sequences in that it contains a third Ig domain and there is no evidence of a connecting peptide region. IpCD4L-2 shares only 20–24% amino acid identity with the short CD4Ls of the other fish species. In comparison, pufferfish CD4L-2 exhibits 35% and 33% amino acid identities with the trout CD4L-2a and 2b, respectively. Similar to the fish long CD4L-1 sequences, the CD4L-2 TM and CYT regions show the highest sequence identities/similarities. Phylogenetic analyses also support the relationships of IpCD4L-1 and L-2 to other CD4 sequences. First, a neighbor-joining tree comparing the complete IpCD4L-1 sequence with vertebrate full-length CD4 sequences shows that IpCD4L-1, along with trout and pufferfish CD4L-1 sequences, cluster with mammalian and avian CD4 sequences and not with LAG-3 sequences (Fig. 3, panel A). Second, the

179

clustering of IpCD4L-1 and L-2 with other CD4 sequences is supported by high bootstrap values when their D1, D2 and D3 sequences are compared with D1, D2 and D3 sequences of mammalian and avian CD4 molecules, as well as those of trout and pufferfish CD4L-1 (Fig. 3, panel B). Third, when the short CD4L-2 forms of the other fish species are included, the catfish sequences, as well as the trout and pufferfish sequences, all cluster with mammalian and avian CD4 sequences, albeit the short forms cluster with themselves (Fig. 3, lower panel C) and appear to be less like CD4 in comparison with the D1 and D2 sequences of the fish CD4L-1 forms. Neither of the two catfish molecules seems to be related to the sea lamprey CD4L molecule (data not shown [56]). 3.2. The IpCDL-1 and IpCD4L-2 genes and Southern blot analyses The IpCD4L-1 gene spans at least 14,000 nucleotides and consists of 11 exons and its overall structure is quite similar to the chicken and mouse CD4 genes (Fig. 4). Exons 1, 2 and the first 35 nucleotides of leader (L) exon 3, are untranslated (UT). The remaining 55 nucleotides of exon 3 encode the predicted signal peptide. Exons 4 and 5, as in mouse and human CD4 and LAG-3 [37,38] and in chicken CD4 [49], encode for the first Ig domain (D1) and are termed D1a and D1b. The intron between catfish D1a and D1b is quite short, only 100 bp. In chickens this intron is also short, 85 bp, while in mice it is much longer, approximately 6.4 kb [49,51]. Catfish exons 6, 7 and 8 encode Ig domains D2, D3 and D4, respectively, and exon 9 encodes the TM. The CD4 CYT is encoded by exons 10 and the first 29 bp of exon 11. In mouse and human CD4 genes, the first intron, i.e. the intron preceding the Leader exon, contains a silencer that has been functionally mapped [reviewed in 57]. This element is inactive in CD4 expressing cells and down-regulates CD4 expression during several stages of thymocyte development. A similar silencer element, identified only on the basis of sequence, is present in the first CD4 intron in chickens where three transcription factor binding sites are conserved, a Hes-1, a Myb and one for the silencer-associated factor (SAF) [49]. A putative silencer region can also identified in the second intron between the second 50 UT exon and the Leader exon in the catfish CD4L-1 gene. It contains a putative Hes-1 (CACAAG) binding site and similar

ARTICLE IN PRESS E.-S. Edholm et al. / Developmental and Comparative Immunology 31 (2007) 172–187

180

LAG-3s CD4s

Rn LAG-3 Mm LAG-3 Hs LAG-3

D1

Ip CD4L-1

85 100

Om CD4L-1 Tr CD4L-1 100

97

D2

Dl CD4

99

Tt CD4

81

Ss CD4

D3

Fc CD4 53

Cf CD4

100

100

D4

Ca CD4

96

Pt CD4

100 100

Hs CD4

100

Oc CD4 Rn CD4 100

94

Mm CD4 Gg CD4

(A)

Ap CD4

100

Cm CD4

100 Dl CD4

100 99

Tt CD4 Ss CD4

70

Hs LAG-3 Mm LAG-3 Rn LAG-3 Tr CD4L-2 Om CD4L-2b01 Om CD4L-2a01 Ip CD4L-2 Gg CD4 Cm CD4 Ap CD4 Hs CD4 Pt CD4 Ca CD4 Mm CD4 Rn CD4 Oc CD4 Cf CD4 Fc CD4 Ss CD4 Dl CD4 Tt CD4 Tr CD4L-1 Om CD4L-1 Ip CD4L-1

99

Fc CD4 94

Cf CD4

99

75

85

Oc CD4

100

Ca CD4 100

Pt CD4

100

99

Hs CD4

99

100

Rn CD4

76

Mm CD4

100

99

80

100

100 56

Gg CD4 100

Ap CD4

100

100 100

Cm CD4

100

75

IpCD4L-2 94

62

60

Tr CD4

51

Ip CD4L-1

93

96

Om CD4L-1

81

100 84

Rn LAG-3 Mm LAG-3

97

98

Hs LAG-3

LAG-3s LAG-3s CD4s Ip CD4L-1 Tr CD4L-1 Om CD4L-1

CD4s IpCD4L-1 Om CD4L-1 Tr CD4L-1 Ip CD4L-2 Ip CD4L-2

D1

D1

D2

D2

D3

D3

D1

D1

D1

D2

D2

D2

D3

D3

D4 D4

(B)

Om CD4L-2 Tr CD4L-2

(C)

ARTICLE IN PRESS E.-S. Edholm et al. / Developmental and Comparative Immunology 31 (2007) 172–187

Exon

1

2

3

45

6

7

8

9 10

181

11

IpCD4L-1 5’UTR

5’UTR

L

D1-a D1-b

D2

D3 D4

TM CYT

CYT/3’UTR

1kb Exon

1

2

5’UTR

L

34 5

6

7 8 9

10

GgCD4

Exon

1

D1-a D2 D1 -b

D3 D4 CYT TM

23

CYT/3’UTR

4 5

6

7

8 9 10

D1-b D2

D3

D4 TM CYT/3’UTR CYT

MmCD4 5’UTR

L D1-a

Exon

1

234

5

6 7 8 9 10

IpCD4L-2 5’UTR

L D1-b D2 D1-a

D3-a

TM CYT/3’UTR

D3-b CYT

Fig. 4. Schematic representations of the IpCD4L-1, chicken CD4 and mouse CD4 genes. Exons are numbered (top) and labeled (underneath) with the regions they encode. White boxes represent 50 and 30 untranslated exons. The symbol (/ /) in the catfish schematic marks where there is a gap in the sequence. GenBank accession numbers for the catfish CD4L-1 and CD4L-2 genes are DQ435305 and DQ435304, respectively; chicken and mouse CD4 genes are AJ401223 and AAC36010.

to chicken CD4, two SAF site subunits (CTGTG) and a SAF-like site (GTGTGGTGTGTGCTGTG) downstream (Fig. 5). Whether these sites actually function as part of a catfish CD4 silencer remains to be determined. The IpCD4L-2 gene spans  6 kb and consists of 10 exons (see Fig. 4). Exons 1 and the first 13 nucleotides of exon 2 are UT. The remaining 36 nucleotides of exon 2 encode the predicted signal peptide. The first and third Ig domains in IpCD4L2, like the first Ig domain in IpCD4L-1, are encoded by two exons split by a short intron, while the

second Ig domain, D2, is encoded by one exon. The IpCD4L-2 TM is encoded by exon 8 and the CYT is encoded by exon 9 and part of exon 10. No putative silencer element was identified in the intron preceding the IpCD4L-2 Leader exon. Notably, Southern blot analyses using three different restriction enzymes (EcoRI, PstI and SacI) show that IpCD4L-1 and IpCD4L-2 are found on the same BAC and that they are likely single copy genes (Fig. 6). Only a single hybridizing band for IpCD4L-1 was observed in Southern blot analyses of genomic and BAC DNA; however, the IpCD4L-2 hybridizing

Fig. 3. Phylogenetic analyses demonstrate that catfish CD4-like sequences, as the other fish CD4-like sequences, are related to avian and mammalian CD4s. In the upper panel, the schematic indicates that full-length protein sequences were compared. In the lower panels, gray shading in the schematics indicates which Ig domains were compared. Bootstrap values are shown as % of 10,000 repetitions. The abbreviations and accession numbers for the various sequences used are: rainbow trout (Om CD4L-1, AAY42070); tiger pufferfish Tr (BAD37153); beluga whale (Dl CD4, AAD23738); bottlenose dolphin (Tt AAQ03208); Pig (Ss NP 001001908); cat (Fc AAB24450); dog (Cf NP0010032520); African green monkey (Ca AAB60875); chimpanzee (Pt NP 001009043); human (Hs CAA60883); rabbit (Oc AAA31198); norweigan rat (Rn AAA91470); mouse(Mm AAC36010); chicken Gg (ABA55042); duck (Ap AAW63061); muscovy duck (Cm AAW63065); rainbow trout (Om2a01 AY772711); rainbow trout (Om2b01 AY899932); tiger pufferfish Tr (CAAB01000627, [35]) LAG-3; human (Hs CAA73914); mouse (Mm NP 032505); norwegian rat (Rn NP 997678).

ARTICLE IN PRESS 182

E.-S. Edholm et al. / Developmental and Comparative Immunology 31 (2007) 172–187

Fig. 5. Putative IpCD4L-1 silencer element. Potential binding sites are underlined and labeled. The sequence is numbered starting from the beginning of the second intron, i.e. the intron between exons 2 and 3 (see Fig. 4). The potential binding sites for Hes-1 and SAF are marked and underlined.

Fig. 6. Genomic and BAC CCBL1_09I08 Southern blot analysis of IpCD4L-1 and IpCD4L-2. Genomic DNA from two gynogenetic (labeled G) and two outbred catfish were hybridized with either an IpCD4L-1 D2-specific probe or an IpCD4L-2 D3/TM probe. EcoRI was the restriction enzyme used for these representative blots. The catfish BAC DNA was also digested with EcoRI and hybridized with the same probes. The gray shading in the schematic below each panel shows the location of the probe. Arrows mark the faint hybridizing bands observed with the IpCD4L-2 probe. Size markers in kb are shown.

pattern was slightly different. A single strong IpCD4L-2 hybridizing band and four weak hybridizing bands were observed. The presence of these weak bands raises the possibility that there may be

other catfish CD4L-2 family members. Since all three restriction enzymes used showed similar results, only representative EcoRI digests are shown.

ARTICLE IN PRESS E.-S. Edholm et al. / Developmental and Comparative Immunology 31 (2007) 172–187

3.3. IpCD4L-1 an IpCD4L-2 expression analyses Message levels of both CD4L-1 and CD4L-2 transcripts were readily detectable in catfish lymphoid

183

tissues (such as thymus, spleen, head kidney and trunk kidney). A slight difference in expression between CD4L-1 and CD4L-2 was seen in non-lymphoid tissues, with CD4L-1 message levels appearing lower

Fig. 7. RT-PCR analyses of catfish IpCD4L-1 and IpCD4L-2 expression in various catfish tissues, enriched and stimulated PBL, and cell lines. (A) Total RNA was obtained from various catfish tissues. RT-PCR was performed using primers specific for IpCD4L-1, IpCD4L-2 and catfish EF1a (positive control). Schematics of each CD4-like sequence and the location of the primers are shown next to their respective panels. (B) Total RNA was obtained from catfish PBL and B-cell-enriched (IgM+) and -depleted (IgM
) fractions from that same fish. RT-PCR was performed using primers specific for catfish IgM membrane form, TCRa, IpCD4L-1, IpCD4L-2 and EF1aU The IpCD4L-1 and IpCD4L-2 primers are the same as used for panel A. (C) Total RNA was obtained from catfish mitogen- and alloantigenstimulated PBL. The panels are labeled according to the stimulation given and the days (D) the cell aliquots were harvested. As a control, RNA was obtained from a sample of the PBL before stimulation and this panel is labeled (-). The IpCD4L-1 and IpCD4L-2 primers are the same as used for panel A. The 500 bp marker is shown for each panel. (D) Total RNA was obtained from TS32.15 and TS32.17 CTLs; 28S.3 and G14D T cells; 42TA macrophages; 3B11 and 1G8 B cells; and 4G4 and 1F3 NK cells. RT-PCR was performed using primers specific for IpCD4L-1, IpCD4L-2 and catfish EF1a (positive control). Schematic of each CD4-like sequence and the location of the primers is shown below their respective panel.

ARTICLE IN PRESS 184

E.-S. Edholm et al. / Developmental and Comparative Immunology 31 (2007) 172–187

in intestine, liver and muscle when compared to the control expression of EFa-1a (Fig. 7A). Differences in expression were also observed when catfish PBL were separated into B (sIgM+) and non-B (sIgM
) cell enriched fractions. Catfish IpCD4L-1 message was found in the non-B-cell fraction while IpCD4L-2 message was found in both B-cell and non-B-cell fractions (Fig. 7B). However, one must take into account that MACs sorting is not 100% efficient and leakiness does occur. Fig. 7C shows the RT-PCR results from differentially stimulated PBL. LPSstimulated PBL contained very low, if any, IpCD4L1 and -2 message, presumably due to the preferential expansion of B cells in these cultures. In contrast, message for both IpCD4L-1 and IpCD4L-2 could easily be detected in the Con A and alloantigenstimulated cultures from day 4 (the first sample day), through day 12 (the last sample day of the cycle). Interestingly, the pattern of IpCD4L-1 and L-2 message expression for the alloantigen-stimulated cultures mimicked TCR alpha and beta message expression (data not shown). Message for both IpCD4L-1 and IpCD4L-2, as well as TCR, was clearly detectable on day 8 and then began to decline until the cultures were restimulated on day 12; Two days after alloantigen restimulation (D2*), message levels were again detectable. Various catfish clonal cell lines including B cells (3B11 and 1G8), macrophage (42TA), NK-like cells (4G4 and 1F3) and T cells (28S, G14D, TS32.15 and TS32.17), as well as freshly isolated PBL, were examined for IpCD4L-1 and IpCD4L-2 expression (Fig. 7D). In addition to PBL, the only catfish cells with detectable levels of IpCD4L-1 were CTL TS32.17 [32,33], which raises the possibility that TS32.17 is a CD4+ CTL. Here, it should be noted that CD8-like sequences have not yet been identified in catfish. Interestingly, no IpCD4L-1 message could be found in autonomous T cell lines 28S [14] and G14D [43]. In comparison, IpCD4L-2 message was found in both TS32.17 T cells and G14D T cells. 4. Discussion The identification and characterization of the catfish CD4L-1 and -2 molecules compliments the sequence analyses of the pufferfish and trout CD4L molecules previously reported [35,36]. The major difference between the two CD4L forms in the different fish is that the short CDL-2 gene of catfish encodes for three Ig domains, instead of two as in

the pufferfish and trout. Even so, it is clear that the sequences from each of the fish species are related to avian and mammalian CD4 sequences and all possess a p56lck site in their CYT regions implying an involvement in cell activation and signaling. The catfish CD4L molecules also differ in other ways, besides in their number of Ig domains. For example, the IpCD4L-1 exon/intron structure resembles that of the avian and mammlian CD4 genes, whereas the IpCD4L-2 gene organization does not. The D1 and D3 of IpCD4L-2 are each encoded by two exons (Fig. 4). The IpCD4L-1 gene also contains a putative silencer element composed of a Hes-1 binding site and SAF binding sites. The IpCD4L-2 gene does not contain an identifiable silencer element. In mice, the CD4 silencer consists of a Hes-1 site, followed by a Myb site and then a SAF binding site [57]. Hes-1 is an end factor protein in the lin12/Notch signaling pathway, a pathway that is important in the developmental fate of T cells. The Hes-1 site is an N box (consensus CACNAG) and the Myb site binds c-Myb protein, which is reported to be a negative regulator in T cell development [58]. The human CD4 silencer however lacks a Myb site. In murine and human CD4 genes, the SAF binding site is found downstream of the Myb and Hes-1 sites, respectively, and it consists of two CTGTG repeats separated by six nucleotides. In chickens, the CD4 silencer consists of an N box CACTAG, followed by a potential v-Myb binding site (CGTTCAA) and then a SAF site consisting of two A/GTGTG repeats separated by six nucleotides preceded upstream by two individual CTGTG subunits [49]. The IpCD4L-1 putative Hes-1 site sequence is CACAAG, the two SAF site subunits are CTGTG and the SAF-like site sequence consists of two repeats separated by seven nucleotides (GTGTGGTGTGTGCTGTG). Southern blot analyses and BAC hybridizations indicate that both IpCD4L-1 and IpCD4L-2 genes are likely single copy and closely linked. However, there may be other IpCD4L-2-related genes in the catfish genome based upon the presence of weakly hybridizing bands observed in Southern blots using the IpCD4L-2 probe. At the mRNA level, catfish clonal T cells differentially express IpCD4L-1 and IpCD4L-2 message, i.e. some express only IpCD4L2, some express both and some express neither (see Fig. 7). In comparison, clonal B cell lines do not express either IpCD4L-1 or IpCD4L-2 message. However, a MACS-enriched B-cell (sIgM+) cDNA pool did express IpCD4L-2 message but not

ARTICLE IN PRESS E.-S. Edholm et al. / Developmental and Comparative Immunology 31 (2007) 172–187

IpCD4L-1 message, suggesting that either in vivo B cells and/or possibly FcR-bearing cells express IpCD4L-2, if there are no remaining T cells in the B-cell-enriched fraction. Finally, Con A and alloantigen-stimulated PBL cultures each expressed message for both CD4L forms and in each instance, except for the enriched B-cell pool, IpCD4L-1 and IpCD4L2 message expression correlated with TCR a and b message expression. Thus, when comparing expression profiles, IpCD4L-1 appears to be T cell specific. The finding of both IpCD4L-1 and IpCD4L-2 message in TS32.17 cells implies that catfish have cytotoxic CD4+ CTL with the caveat being that one or both of these molecules may have CD4 function. In mammals, CD4+ CTL have been shown in vitro to use the same cytolytic pathways as CD8+ CTL [59–63]. However, the importance of CD4+ CTL still remains unclear. It was originally thought that CD4+ CTL were the result of long-term cell cultures and only recently were CD4+ CTL detected directly from peripheral blood in patients with viral infections (such as HIV, CMV and EBV), rheumatoid arthritis and B-cell chronic lymphocytic leukemia [reviewed in 64]. Moreover, it has now been demonstrated that CD4-dependent MHC class II restricted killing in lymphocytic chroriomeningitis virus (LCMV)-infected mice occurs in vivo [65]. Hence, there is a possibility for CD4+ CTL to exist in fish. Unfortunately, determining if TS32.17 is a true CD4+ CTL or if CD4+ CTLs exist in vivo is not currently possible. Presently, it can only be concluded that two types or groups of catfish CTL have been identified in vitro [32,33]. Group I (TS32.15) CTL cells have strict alloantigen specificity, they kill and proliferate specifically in response to one allogeneic target, 3B11 B cells. In contrast, group II (TS32.17) CTL cells have broader specificity. They kill and proliferate in response to several different allogeneic targets. Both groups form conjugates with and kill their targets by apoptosis. Group I killing is mediated exclusively by the secretory perforin/granzyme pathway and group II killing is mediated by another cytotoxic mechanism in addition to that involving perforin/granzyme [33]. It is tempting to argue that the identification of CD8 and CD4L genes in different fish species coupled with the presence of CD4L messages in catfish sIgM
-enriched PBL and in clonal T cells is evidence that T cell subsets exist in teleosts. However, the characterization of T cell subsets in teleost will only be possible when the appropriate antibody reagents are produced and characterized.

185

Acknowledgments We thank Dr. Bill Clem for critical review of this manuscript. This work was supported by grants from the National Science Foundation (MCB0211785), the National Institutes of Health (R01 AI-19530) and a Natural Sciences and Engineering Research Council of Canada PDF to JS.

References [1] Miller N, Wilson M, Bengten E, Stuge T, Warr G, Clem W. Functional and molecular characterization of teleost leukocytes. Immunol Rev 1998;166:187–97. [2] Hansen JD, Zapata AG. Lymphocyte development in fish and amphibians. Immunol Rev 1998;166:199–220. [3] Boudinot P, Boubekeur S, Benmansour A. Rhabdovirus infection induces public and private T cell responses in teleost fish. J Immunol 2001;167:6202–9. [4] Engelsma MY, Hougee S, Nap D, Hofenk M, Rombout JHWM, van Muiswinkel WB, et al. Multiple acute temperature stress affects leucocyte populations and antibody responses in common carp, Cyprinus carpio L. Fish Shellfish Immunol 2003;5:397–410. [5] Zapata A, Cejalvot T, Gutierrez-de Frias C, Corte A. Ontogeny of the immune system in fish. Fish Shellfish Immunol 2006;20:126. [6] Fischer U, Utke K, Somamoto T, Kollner B, Ototake M, Nakanishi T. Cytotoxic activities of fish leucocytes. Fish Shellfish Immunol 2006;20:209. [7] Meloni S, Zarletti G, Benedetti S, Randelli E, Buonocore F, Scapigliati G. Cellular activities during a mixed leukocyte reaction in the teleost sea bass Dicentrarchus labrax. Fish Shellfish Immunol 2006;20:739–49. [8] Huttenhuis HB, Romano N, Van Oosterhoud CN, TaverneThiele AJ, Mastrolia L, Van Muiswinkel WB, et al. The ontogeny of mucosal immune cells in common carp (Cyprinus carpio L). Anat Embryol 2006;211:19–29. [9] Rast JP, Haire RN, Litman RT, Pross S, Litman GW. Identification and characterization of T-cell antigen receptor-related genes in phylogenetically diverse vertebrate species. Immunogenetics 1995;42:204–12. [10] Hordvik I, Torvund J, Moore L, Endresen C. Structure and organization of the T cell receptor alpha chain genes in Atlantic salmon. Mol Immunol 2004;41:553–9. [11] Partula S, de Guerra A, Fellah JS, Charlemagne J. Structure and diversity of the TCR alpha-chain in a teleost fish. J Immunol 1996;157:207–12. [12] Partula S, de Guerra A, Fellah JS, Charlemagne J. Structure and diversity of the T cell antigen receptor beta-chain in a teleost fish. J Immunol 1995;155:699–706. [13] Charlemagne J, Fella JS, De Guerra A, Kerfourn F, Partula S. T-cell receptors in ectotermic vertebrates. Immunol Rev 1998;166:87–102. [14] Wilson MR, Zhou H, Bengten E, Clem LW, Stuge TB, Warr GW, et al. T-cell receptors in channel catfish: structure and expression of TCR alpha and beta genes. Mol Immunol 1998;35:545–57.

ARTICLE IN PRESS 186

E.-S. Edholm et al. / Developmental and Comparative Immunology 31 (2007) 172–187

[15] Haire RN, Rast JP, Litman RT, Litman GW. Characterization of three isotypes of immunoglobulin light chains and Tcell antigen receptor alpha in zebrafish. Immunogenetics 2000;51:915–23. [16] Wang K, Gan L, Kunisada T, Lee I, Yamagishi H, Hood L. Characterization of the Japanese pufferfish (Takifugu rubripes) T-cell receptor alpha locus reveals a unique genomic organization. Immunogenetics 2001;53:31–42. [17] Fischer C, Bouneau L, Ozouf-Costaz C, Crnogorac-Jurcevic T, Weissenbach J, Bernot A. Conservation of the T-cell receptor alpha/delta linkage in the teleost fish Tetraodon nigroviridis. Genomics 2002;79:241–8. [18] Nam BH, Hirono I, Aoki T. The four TCR genes of teleost fish: the cDNA and genomic DNA analysis of Japanese flounder (Paralichthys olivaceus) TCR alpha-, beta-, gamma, and delta-chains. J Immunol 2003;170:3081–90. [19] Zhou H, Bengten E, Miller NW, Clem LW, Wilson M. The T cell receptor beta locus of the channel catfish, Ictalurus punctatus, reveals unique features. J Immunol 2003;170:2573–81. [20] Park CI, Hirono I, Enomoto J, Nam BH, Aoki T. Cloning of Japanese flounder Paralichthys olivaceus CD3 cDNA and gene, and analysis of its expression. Immunogenetics 2001;53:130–5. [21] Guselnikov SV, Najakshin AM, Taranin AV. Fugu rubripes possesses genes for the entire set of the ITAM-bearing transmembrane signal subunits. Immunogenetics 2003;55:472–9. [22] Araki K, Suetake H, Kikuchi K, Suzuki Y. Characterization and expression analysis of CD3varepsilon and CD3gamma/ delta in fugu, Takifugu rubripes. Immunogenetics 2005;57:158–63. [23] Park CI, Hirono I, Aoki T. Molecular characterization of the Japanese flounder, Paralichthys olivaceus, CD3epsilon and evolution of the CD3 cluster. Dev Comp Immunol 2005;29:123–33. [24] Hansen JD, Strassburger P. Description of an ectothermic TCR coreceptor, CD8 alpha, in rainbow trout. J Immunol 2000;164:3132–9. [25] Moore LJ, Somamoto T, Lie KK, Dijkstra JM, Hordvik I. Characterisation of salmon and trout CD8 alpha and CD8 beta. Mol Immunol 2005;42:1225–34. [26] Somamoto T, Yoshiura Y, Nakanishi T, Ototake M. Molecular cloning and characterization of two types of CD8 alpha from ginbuna crucian carp, Carassius auratus langsdorfii. Dev Comp Immunol 2005;29:693–702. [27] Miller NW, Deuter A, Clem LW. Phylogeny of lymphocyte heterogeneity: cellular requirements for the mixed leukocyte reaction in the channel catfish. Immunol 1986;59:123–8. [28] Miller NW, Sizemore RC, Clem LW. Phylogeny of lymphocyte heterogeneity: the cellular requirements for in vitro antibody responses of channel catfish leukocytes. J immunol 1985;134:2884–8. [29] Sizemore RC, Miller NW, Cuchens MA, Lobb CJ, Clem LW. Phylogeny of lymphocyte heterogeneity: the cellular requirements for in vitro mitogenic responses of channel catfish leukocytes. J immunol 1984;133:2920–4. [30] Vallejo AN, Miller NW, Clem LW. Phylogeny of immune recognition: processing and presentation of structurally defined proteins in channel catfish immune response. Dev Immunol 1991;1:137–48.

[31] Vallejo AN, Miller NW, Clem LW. Phylogeny of immune recognition: roles of alloantigens in antigen presentation in channel catfish immune response. Immunol 1991;74:165–8. [32] Stuge TB, Wilson MR, Zhou H, Barker KS, Bengten E, Chinchar VG, et al. Development and analysis of various clonal alloantigen-dependent cytotoxic cell lines from channel catfish. J Immunol 2000;164:2971–7. [33] Zhou H, Stuge TB, Miller NW, Bengten E, Naftel JP, Bernanke JM, et al. Heterogeneity of channel catfish CTL with respect to target recognition and cytotoxic mechanisms employed. J Immunol 2001;167:1325–32. [34] Weiss A, Samelson LE. T-lymphocyte activation. In: Paul WE, editor. Fundamental immunology. 5th ed. Philadelphia, PA: Lippincott Williams & Williams; 2003. p. 321–63. [35] Suetake H, Araki K, Suzuki Y. Cloning, expression, and characterization of fugu CD4, the first ectothermic animal CD4. Immunogenetics 2004;56:368–74. [36] Dijkstra JM, Somamoto T, Moore L, Hordvik I, ototake M, Fischer U. Identification and characterization of a second CD4-like gene in teleost fish. Mol Immunol 2006;56:410–9. [37] Triebel F, Jitsukawa S, Baixeras E, Roman-Roman S, Genevee C, Viegas-Pequignot E, et al. LAG-3, a novel lymphocyte activation gene closely related to CD4. J Exp Med 1990;171:1393–405. [38] Bruniquel D, Borie N, Triebel F. Genomic organization of the human LAG-3/CD4 locus. Immunogenetics 1997;47:96–8. [39] van Ginkel FW, Miller NW, Lobb CJ, Clem LW. Characterization of anti-hapten antibodies generated in vitro by channel catfish peripheral blood lymphocytes. Dev Comp Immunol 1992;16:139–51. [40] Miller NW, Chinchar VG, Clem LW. Development of leukocyte cell lines from the channel catfish (Ictalurus punctatus). J Tissue Cult Methods 1994;16:117–23. [41] Miller NW, Rycyzyn MA, Wilson MR, Warr GW, Naftel JP, Clem LW. Development and characterization of channel catfish long term B cell lines. J Immunol 1994;52:2180–9. [42] Wilson M, Bengten E, Miller NW, Clem LW, Du Pasquier L, Warr GW. A novel chimeric Ig heavy chain from a teleost fish shares similarities to IgD. Proc Natl Acad Sci USA 1997;94:4593–7. [43] Hogan R, Waldbieser G, Goudie CA, Antao A, Godwin UB, Wilson MR, et al. Molecular and immunological characterization of gynogenetic channel catfish (Ictalurus punctatus). Mar Biotechnol 1999;1:317–27. [44] Shen L, Stuge TB, Bengten E, Wilson M, Chinchar VG, Naftel JP, et al. Identification and characterization of clonal NK-like cells from channel catfish (Ictalurus punctatus). Dev Comp Immunol 2004;28:139–52. [45] Quiniou SM, Katagiri T, Miller NW, Wilson M, Wolters WR, Waldbeiser GC. Construction and characterization of a BAC library from a gynogenetic channel catfish Ictalurus punctatus. Genet Sel Evol 2003;35:673–83. [46] Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DJ. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 1997;24:4876–82. [47] Kumar S, Tamura K, Jakobsen IB, Nei M. MEGA2: molecular evolutionary genetics analysis software. Bioinformatics 2001;7:1244–5. [48] Altschul SF, Gish W, Miller W, Meyers EW, Lipman DJ. Basic local alignment search tool. Mol Biol 1990;215:403–10.

ARTICLE IN PRESS E.-S. Edholm et al. / Developmental and Comparative Immunology 31 (2007) 172–187 [49] Koskinen R, Salomonsen J, Tregaskes CA, Young JR, Goodchild M, Bumstead N, et al. The chicken CD4 gene has remained conserved in evolution. Immunogenetics 2002;54:520–5. [50] Maddon PJ, Molineaux SM, Maddon DE, Zimmerman KA, Godfrey M, Alt FW, et al. Structure and expression of the human and mouse T4 genes. Proc Natl Acad Sci USA 1987;84:9155–9. [51] Gorman SD, Tourveille B, Parnes JR. Structure of the mouse gene encoding CD4 and an unusual transcript in brain. Proc Natl Acad Sci USA 1987;84:7644–8. [52] Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988;16:1215. [53] Miller NW, Bly JE, van Ginkel F, Ellsaesser CF, Clem LW. Phylogeny of lymphocyte heterogeneity: identification and separation of functionally distinct subpopulations of channel catfish lymphocytes with monoclonal antibodies. Dev Comp Immunol 1987;11:739–47. [54] Stuge TB, Yoshida SH, Chinchar VG, Miller NW, Clem LW. Cytotoxic activity generated from channel catfish peripheral blood leukocytes in mixed leukocyte cultures. Cell Immunol 1997;177:154–61. [55] Koskinen RK, Lamminmaki U, Tregaskes CA, Salomonsen J, Young JR, Vainio O. Cloning and modeling of the first nonmammalian CD4. J Immunol 1999;162:4115–21. [56] Pancer Z, Mayer WE, Klein J, Cooper MD. Prototypic T cell receptor and CD4-like xoreceptor are expressed by

[57]

[58]

[59]

[60]

[61]

[62]

[63]

[64] [65]

187

lymphocytes in the agnathan sea lamprey. Proc Natl Acad Sci USA 2004;101:13273–8. Ellmeier W, Sawada S, Littman DR. The regulation of CD4 and CD8 coreceptor gene expression during T cell development. Annu Rev Immunol 1999;17:523–54. Allen RD, Kim HK, Sarafova SD, Siu G. Negative regulation of CD4 gene expression by a hes-1-c-myb complex. Mol Cell Biol 2001;21:3071–82. Stalder T, Hahn S, Erb P. Fas antigen is the major target molecule for CD4+ T cell-mediated cytotoxicity. J Immunol 1994;152:1127–33. Tite JP. Evidence of a role for TNF-a in cytolysis by CD4+, class II MHC-restricted cytotoxic T cells. Immunology 1990;71:208–12. Williams NS, Engelhard VH. Identification of a population of CD4+ CTL that utilizes a perforin-rather than a Fas ligand dependent cytotoxic mechanism. J Immunol 1996;156:153–9. Williams NS, Engelhard VH. Perforin-dependent cytotoxic activity and lymphokine secretion by CD4+ T cells are regulated by CD8+ T cells. J Immunol 1997;159:2091–9. Appay V, Zaunders JJ, Papagno L, Sutton J, Jaramillo A, Waters A, et al. Characterization of CD4+ CTls ex vivo. J Immunol 2002;168:5954–8. Appay V. The physiological role of cytotoxic CD4+ T-cells: the holy grail? Clin Exp Immunol 2004;138:10–3. Jellison ER, Kim S-K, Welsh RM. MHC class II-restricted killing in vivo during viral infection. J Immunol 2005;174:614–8.