Chaperones are the target in aloe-emodin-induced human lung nonsmall carcinoma H460 cell apoptosis

European Journal of Pharmacology 573 (2007) 1 – 10 www.elsevier.com/locate/ejphar

Chaperones are the target in aloe-emodin-induced human lung nonsmall carcinoma H460 cell apoptosis Miao-Ying Lai a,1 , Mann-Jen Hour a,1 , Henry Wing-Cheung Leung b , Wen-Hui Yang c , Hong-Zin Lee a,⁎ a School of Pharmacy, China Medical University, Taichung, Taiwan Department of Radiation Oncology, Chi Mei Hospital, Liouying, Tainan, Taiwan School of Health Services Management, China Medical University, Taichung, Taiwan b

c

Received 29 September 2006; received in revised form 15 June 2007; accepted 18 June 2007 Available online 12 July 2007

Abstract Our previous study has demonstrated that aloe-emodin induced a significant change in the expression of apoptosis-related proteins in H460 cells. However, the molecular mechanisms underlying the biological effects of aloe-emodin still remain unknown. The present study applied 2D electrophoresis (pH range 4–7) to the proteins involved in aloe-emodin (40 μM)-induced H460 cell apoptosis. Eleven proteins were found to markedly change. These altered proteins were identified as ATP synthase, vimentin, HSP60, HSP70 and protein disulfide isomerase. Aloe-emodin caused a time-dependent decrease in intracellular ATP levels, which might be related to direct inhibition of ATP synthase. We also observed that the activity of mitochondria was injured by aloe-emodin. These data clearly demonstrated that mitochondria may play a critical role in aloeemodin-induced H460 cell death. Many reports emphasize that chaperones have a complex role in apoptosis. The present study suggested that the increasing protein expression of HSP60, HSP70, 150 kDa oxygen-regulated protein and protein disulfide isomerase is involved in aloe-emodininduced H460 cell apoptosis. HSP70, 150 kDa oxygen-regulated protein and protein disulfide isomerase are endoplasmic reticulum chaperone. Therefore, we hypothesized that the increasing endoplasmic reticulum stress serves to promote H460 cell apoptosis after treatment with aloeemodin. We also demonstrated aloe-emodin-induced H460 cell death through caspase-3 apoptotic pathway, but not apoptosis-inducing factor apoptotic pathway. © 2007 Elsevier B.V. All rights reserved. Keywords: Aloe-emodin; Apoptosis; ATP; Chaperone; 2D electrophoresis; Human lung nonsmall carcinoma cell line H460

1. Introduction Proteins that facilitate the folding of other proteins are called molecular chaperones. Molecular chaperones are integral components of the cellular machinery involved in ensuring correct protein folding and the continued maintenance of protein structure. The binding of chaperones stabilizes those unfolded polypeptides, thereby preventing incorrect folding or aggregation and allowing the polypeptide chain to fold into its correct conformation. Many of the proteins now known to function as ⁎ Corresponding author. School of Pharmacy, China Medical University, 91, Hsueh-Shih Road, Taichung, 40402, Taiwan. Tel.: +886 4 22312427; fax: +886 4 22316290. E-mail address: [email protected] (H.-Z. Lee). 1 These authors equally contributed to this work. 0014-2999/$ - see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.ejphar.2007.06.061

molecular chaperones were initially identified as heat shock proteins (HSPs), a family of proteins expressed in cells. Heat shock proteins are synthesized by cells in response to various stress conditions, including heat, hypoxia, ATP depletion, free radical and carcinogenesis. Heat shock proteins primarily protect cells by folding denatured proteins, stabilizing macromolecules and targeting irreversibly denatured proteins for clearance. Heat shock proteins are also important in unfolding and refolding macromolecules as they are transported across organelle membranes. Many reports emphasize that heat shock proteins have a complex role in apoptosis, but they are primarily anti-apoptotic. Heat shock protein 70 inhibits apoptosis by preventing recruitment of procaspase-9 from the apaf-1 apoptosome (Beere et al., 2005). Heat shock protein 27 inhibits cytochrome c-dependent activation of procaspase-9 (Garrido et al., 1999). Overexpression of heat shock protein 60 prevents

2

M.-Y. Lai et al. / European Journal of Pharmacology 573 (2007) 1–10

apoptosis by protecting mitochondrial function in cardiac myocytes (Lin et al., 2001). It has also been demonstrated that heat shock protein 60 accelerated activation of caspase-3 during apoptosis (Samali et al., 1999). Therefore, the heat shock proteins have a significant and complex role in apoptosis. Proteomics is now generally accepted as a method to total protein expression and elucidate cellular processes at the molecular level (Dallmann et al., 2004; van den Bogaerdt et al., 2004). Therefore, proteome analysis allowed the identification of marker proteins that are involved in the induction of apoptotic cell death in cancer cells. Our previous study applied 2D gel electrophoresis to analyze the proteins involved in aloe-emodin-induced apoptosis at the protein level in H460 cells (Lee et al., 2005). We have demonstrated that the aloe-emodin caused increase in the amount of proform and fragment of nucleophosmin (Lee et al., 2005). The nucleophosmin, which is a molecular chaperone, is required for the assembly of nucleosomes from histones and DNA. Aloe-emodin (1,8-dihydroxy-3-(hydroxymethyl)-anthraquinone) is one of the active constituents from the root and rhizome of Rheum palmatum. Our previous study demonstrated that 24 h of continuous exposure to 40 μM of aloe-emodin induced a typical apoptosis on lung carcinoma cell line H460. Aloe-emodininduced apoptosis was accompanied by nuclear morphological changes, DNA fragmentation and changing the protein expression of protein kinase C, Bcl-2, caspase and the mitogen-activated protein kinase family members (Lee, 2001; Yeh et al., 2003). However, the molecular mechanisms underlying the biological effects of aloe-emodin still remain unknown. The overall objective of the present study is to further explore the mechanisms of aloe-emodin-induced H460 cell apoptosis by proteomics. 2. Materials and methods 2.1. Materials Aloe-emodin (1,8-dihydroxy-3-(hydroxymethyl)-anthraquinone), antipain, aprotinin, dithiothreitol (DTT), ethyleneglycolbis-(β-aminoethyl ether)-N,N,N′,N′-tetraacetic acid (EGTA), leupeptin, pepstatin, phenylmethylsulfonyl fluoride, Tris and apoptosis-inducing factor antibody were purchased from Sigma Chemical Company (St. Louis, MO, USA); HSP60 antibody was purchased from Calbiochem (Germany); HSP70 and protein disulfide isomerase antibodies were purchased from BD Biosciences (San Diego, CA, USA); 150 kDa oxygen-regulated protein was from IBL (Japan). Anti-mouse IgG peroxidase-conjugated secondary antibody was purchased from Jackson ImmunoResearch (Hamburg, Germany). Fluorescein (FITC)-conjugated AffiniPure goat anti-mouse and anti-rabbit IgG was from Jackson Immunoresearch (Hamburg, Germany). MitoTracker Red CMXRos was from Molecular Probes (Leiden, The Netherlands). ATP bioluminescent assay kit was purchased from ThermoLabsystem (Finland).

Logan, UT, USA), 100 U/ml penicillin and 100 μg/ml streptomycin (Gibco BRL, Rockville, MD, USA) and 2mM glutamine (Merck, Darmstadt, Germany) at 37 °C in a humidified atmosphere comprised of 95% air and 5% CO2. When H460 cells were treated with 40 μM aloe-emodin, the culture medium containing 1% fetal bovine serum was used. All data presented in this report are from at least 3 independent experiments showing the same pattern of expression. 2.3. Mitochondrial reductase activity Cellular mitochondrial reductase activity of live H460 cells was determined by measuring the reduction of 3-(4,5-dimethylthiazol2-yl)-2,5-diphenyltetrazolium bromide (MTT). H460 cells were seeded at a density of 5 × 104 cells per well onto 12-well plates 48 h before being treated with drugs. The cells were incubated with 0.1% DMSO or 40 μM aloe-emodin for various indicated times. At each end point, the treatment medium was replaced with fresh serum-free medium containing 2.4 × 10− 4 M MTT at pH 7.4. Cells were incubated with MTT medium for 1 h at 37 °C. After solubilization in DMSO, absorbance was measured at 550 nm. 2.4. Protein preparation Adherent and floating cells were collected at the indicated time intervals and washed twice in ice-cold PBS. Cell pellets were resuspended in modified RIPA buffer (50 mM Tris–HCl, pH 7.5, 150 mM NaCl, 1% Nonidet P-40, 0.25% sodium deoxycholate, 1 mM EGTA, 1 mM DTT, 1 mM phenylmethylsulfonyl fluoride, 1 mM sodium orthovanadate, 1 mM sodium fluoride, 5 μg/ml aprotinin, 5 μg/ml leupeptin and 5 μg/ml antipain) for 30 min at 4 °C. Lysates were clarified by centrifugation at 16,000 g for 30 min at 4 °C and the resulting supernatant was collected, aliquoted (50 μg/tube for Western blot; 150 μg/tube for two-dimensional gel electrophoresis) and stored at − 80 °C until assay. The protein concentrations were estimated with the Bradford method. 2.5. Two-dimensional gel electrophoresis The proteins (150 μg) were dissolved in a rehydration buffer (9.8 M urea, 0.5% CHAPS, 10 mM DTT, 0.2% Biolytes (BioRad, Hercules, CA, USA) and a trace of bromophenol blue) to a final volume of 125 μl. The samples were added to the 7-cm IPG strips (pH 4–7, linear, Readystrip; BioRad), which were rehydrated for 12 h. After rehydration, the strips were focused for 60,000 Vh, starting at 250 V and gradually raising the voltage to 10,000 V. Once the IEF was completed, the strips were equilibrated in 6 M urea containing 2% sodium dodecyl sulfate (SDS), 0.375 M Tris (pH 8.8), 20% glycerol and 130 mM DTT. The 2D electrophoresis was performed using 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).

2.2. Cell culture 2.6. Silver staining of proteins H460 cells were grown in monolayer culture in Dulbecco's modified Eagle's medium (DMEM; Life Technologies, Rockville, MD, USA) containing 5% fetal bovine serum (HyClone,

All the gels were silver stained according to the following protocol: Gels were fixed in 50% methanol (v/v) and 12% acetic

M.-Y. Lai et al. / European Journal of Pharmacology 573 (2007) 1–10

acid (v/v) for 2 h, then washed 3 times in 50% ethanol (v/v). The duration of each wash was 20 min. Gels were then incubated in a 0.02% sodium thiosulfate solution (w/v) for 1 min, followed by four 1-min washes in water. Gels were then placed in a solution composed of 0.2% silver nitrate (w/v) and 0.075% (v/v) formaldehyde for a period of 20 min, followed by three 1-min washes in water. Gels were then developed in a 6% sodium carbonate (w/v), 0.005% formaldehyde (v/v) and 0.004% sodium thiosulfate (w/v) solution until the protein spots were visualized. A 1% acetic acid solution was added to stop the staining reactions. 2.7. NanoLC-MS/MS analysis and database searches NanoLC-MS/MS analysis was performed on an integrated nanoLC-MS/MS system (QSTAR XL) comprising a LC Packings NanoLC system with an autosampler and a QSTAR XL Q-Tof mass spectrometer (Applied Biosystems, Foster City, CA, USA) fitted with nano-LC sprayer. Mass analysis was carried out according to the Analyst QS software (Applied Biosystems). The proteins were identified by searching in SWISS-PROT and NCBI database using the Mascot program with the following parameters: peptide mass tolerance, 50 ppm; MS/MS ion mass tolerance, 0.25 Da; allow up to one missed cleavage. Only significant hits as defined by Mascot probability analysis will be considered initially. 2.8. Mitochondria activity assay and immunostaining MitoTracker Red CMXRos is a red fluorescent dye that stains mitochondria in live cells and its accumulation is dependent upon membrane potential. Cells grown on glass plates were incubated for 30 min at 37 °C with 100 nM MitoTracker Red CMXRos, washed with PBS, fixed with formaldehyde for 10 min, transferred to acetone (−20 °C) for 2 min and briefly air-dried. Cells were permeabilized with 1% Triton X-100 in PBS for 10 min. Fixed cells were subsequently incubated with a blocking solution (2.5% bovine serum albumin) for 1 h at room temperature. Cells were then incubated 1 h at 37 °C with HSP60 or apoptosisinducing factor antibody diluted 1:50 in TBST solution. The cells were washed 3 times with TBST and incubated for 30 min at 37 °C with fluorescein-conjugated anti-mouse or -rabbit IgG antibody diluted 1:50 in TBST. After three washings in TBST, the specimens were mounted in glycerin and observed by confocal spectral microscopy (TCS SP2, Leica). 2.9. ATP determination H460 cells were seeded at a density of 5 × 104 cells per well onto 12-well plates 48 h before being treated with drugs. The ATP measurement was performed using an ATP bioluminescent assay kit. Briefly, H460 cells were treated with 40 μM aloeemodin for various indicated time periods. After being washed with PBS, cells were lysed and the ATP assay was carried out according to the manufacturer's instructions. The bioluminescence was assessed using a luminometer (Fluoroskan Ascent; Helsinki, Finland). The ATP content was expressed as percentages of untreated cells (control).

3

2.10. Reverse transcriptase-polymerase chain reaction (RT-PCR) Total RNAs were isolated from control or aloe-emodintreated H460 cells with RNeasy Mini kit (QIAGEN, USA) according to the manufacturer's descriptions. RNA concentration was quantified using a spectrophotometer at a wavelength of 260 nm. cDNA was prepared by reverse transcription of 1.5 μg of total RNA. Gene transcripts were determined by reverse transcriptase-polymerase chain reaction with RNA PCR kit (Invitrogen life technologies, USA). The primers of investigated genes are shown in Table 3. The amplification was performed with one denaturing cycle at 95 °C for 5 min, then 30 cycles at 95 °C for 1 min, at 55 °C for 1 min, at 72 °C for 1 min, and one final extension at 72 °C for 10 min. RT-PCR products were separated by electrophoresis on 2% agarose gel and visualized by ethidium bromide staining. 2.11. Western blot analysis Samples were separated by various appropriate concentrations (7, 9 and 10%) of sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE; Bio-Rad, Hercules, CA, USA). The SDS-separated proteins were equilibrated in transfer buffer (50 mM Tris–HCl, pH 9.0–9.4, 40 mM glycine, 0.375% SDS [Bio-Rad], 20% methanol [Merck]) and electrotransferred to Immobilon-P Transfer Membranes (Millipore Corporation, Bedford, MA, USA). The blot was blocked with a solution containing 5% nonfat dry milk in Tris-buffered saline (10 mM Tris–HCl, 150 mM NaCl [Sigma]) with 0.05% Tween 20 (TBST; Merck) for 1 h, washed and incubated with antibodies to β-actin (1:5000 [Sigma], the detection of β-actin was used as an internal control in all of the data of Western blotting analysis), 150 kDa oxygen-regulated protein (1:100), protein disulfide isomerase (1:250), HSP60 (1:1000) and HSP70 (1:1000). Secondary antibody consisted of a 1:20,000 dilution of horseradish peroxidase (HRP)-conjugated rabbit anti-mouse IgG. The enhanced chemiluminescent (NEN Life Science Products, Boston, MA, USA) detection system was used for immunoblot protein detection. 2.12. Assay of lactate dehydrogenase (LDH) release Cells were seeded at a density of 5 × 104 cells per well onto 12-well plate 48 h before being treated with drugs. The cells were incubated with 40 μM aloe-emodin for various indicated times (in phenol-free DMEM with 1% fetal bovine serum). The control cultures were treated with 0.1% DMSO (in phenol-free DMEM with 1% fetal bovine serum). After treatment, the supernatant was removed and centrifuged at 16,000g for 10 min. LDH activity in the supernatant was determined with the LDH Detection kit (Roche Applied Science, Germany). 3. Results 3.1. Aloe-emodin induces H460 cell death The present study served to evaluate the effects of aloeemodin on cell death of H460 cells by mitochondrial reductase

4

M.-Y. Lai et al. / European Journal of Pharmacology 573 (2007) 1–10

Table 1 Effects of aloe-emodin on cell death in H460 cells

Table 2 Characteristics of the analyzed spots

Treatment time (aloe-emodin, 40 μM)

Cell viability (% of control) a

Spot

Protein

Mr (Da)

pI

Accession no.

Score

4h 8h 16 h 24 h

91 ± 4 86 ± 4 72 ± 2 55 ± 1

1 2 3 4 5 6 7 8 9 10 11

ATP synthase Heat shock 70 kDa protein Heat shock 70 kDa protein Heat shock 70 kDa protein Protein disulfide isomerase Protein disulfide isomerase Protein disulfide isomerase Chaperonin 60, HSP60 Chaperonin 60, HSP60 Chaperonin 60, HSP60 Vimentin

56525 73682 73682 73682 56644 56644 56644 61016 61016 61016 53653

5.26 6.03 6.03 6.03 6.10 6.10 6.10 5.70 5.70 5.70 5.06

AAH16512 AAH24034 AAH24034 AAH24034 CAA89996 CAA89996 CAA89996 CAB75426 CAB75426 CAB75426 CAA79613

350 285 751 484 509 189 498 503 1469 988 389

a

Cells were seeded at a density of 5 × 104 cells per well onto 12-well plate 48 h before aloe-emodin treatment. The cells were incubated with 0.1% DMSO or 40 μM aloe-emodin for various indicated times. The viable cells were measured by MTT assay. The results are expressed as the mean percentage of control ± S.D. of six independent experiments.

activity assay. The data are presented as proportional viability (%) by comparing the treated group with the untreated cells, the viability of which was assumed to be 100%. As shown in Table 1, 24 h of continuous exposure to 40 μM aloe-emodin resulted in time-dependent decreases in viable cells relative to control cultures. 3.2. Identification of differentially expressed proteins by 2D gel In our previous study, many protein spots were found varying in intensity between the control-cell-loaded and the aloe-emodin-treated cell-loaded gels. However, those of protein with pI values between 4.75 and 6.5 were not separated perfectly. This study was to further investigate the difference between control-cell-loaded and the aloe-emodin-treated cellloaded gels in the pH range of 4.75–6.5, using a 4–7 pH range IPG strip in the first dimension. In aloe-emodin-treated cells, 10 protein spots were found to markedly increase compared to the control cells after 40 μM aloe-emodin treatment 24 h (Fig. 1). These altered proteins were characterized by mass spectrometry. Using the amino acid sequences of these protein spots as the query in a basic local alignment search tool (BLAST) of the EST database at the NCBI, protein spots were identified as HSP70 (pI/molecular weight [Mw]: 6.03/73682, protein accession no. AAH24034), HSP60 (pI/molecular weight [Mw]: 5.70/ 61016, protein accession no. CAB75426), protein disulfide isomerase (pI/molecular weight [Mw]: 6.10/56644, protein ac-

cession no. CAA89996) and vimentin (pI/molecular weight [Mw]: 5.06/53653, protein accession no. CAA79613) (Table 2). In contrast to these protein spots, protein spot 1 is significantly greater in the control-treated cells than that in aloe-emodintreated cells (Fig. 1). Protein spot 1 was identified as ATP synthase (pI/molecular weight [Mw]: 5.26/56525, protein accession no. AAH16512) (Table 2). It is interesting to note that the HSP70, HSP60 and protein disulfide isomerase revealed spot families in the horizontal direction of the 2D gel (Fig. 1). These variants are identical in molecular weight but different in pI values. It has been indicated that the single spots of the complex pattern were probably due to post-translational modifications of one particular protein. These results suggested that aloe-emodin-induced changes in protein expression of many proteins include the pattern of their post-translational modifications in H460 cells. 3.3. The effect of aloe-emodin on intracellular ATP level in H460 cells Based on above data, aloe-emodin-treated samples had a significant decrease in the expression of ATP synthase. Maintenance of cellular ATP levels is believed to be essential for the phosphorylation cascade that precedes apoptosis. It has already been well established that ATP can act as a switch between apoptosis and necrosis. To investigate whether ATP

Fig. 1. Two-dimensional electrophoresis maps of control or aloe-emodin-treated H460 cells. Cells were incubated with or without 40 μM aloe-emodin in the presence of 1% serum for 24 h. Proteins were separated on a pH 4–7 IPG strip (7 cm) in the first dimension and on a 12% SDS-polyacrylamide gel in the second dimension. Staining of the protein spots was accomplished by silver nitrate. Results are representative of three independent experiments.

M.-Y. Lai et al. / European Journal of Pharmacology 573 (2007) 1–10

Fig. 2. Intracellular ATP levels in H460 cells after aloe-emodin exposure. Cells were cultured with 0.1% DMSO or 40 μM aloe-emodin for 2, 4, 8, 12, 16 and 24 h. After aloe-emodin treatment, intracellular ATP level was estimated by using an ATP bioluminescent assay kit. Aloe-emodin (40 μM) at all indicated time periods caused significant decrease in cellular ATP levels. Results are representative of three independent experiments.

levels are involved in aloe-emodin-induced H460 cell apoptosis, we estimated the intracellular ATP levels of H460 cells after exposure to 40 μM aloe-emodin for 2, 4, 8, 12, 16 and 24 h. It was observed that aloe-emodin (40 μM) caused a timedependent decrease in intracellular ATP levels (Fig. 2). 3.4. Effects of aloe-emodin on mitochondria activity in H460 cells It is well-known that mitochondria are the main cellular organelles, which produce ATP through cellular respiration in

5

physiological conditions. The relationship between the mitochondrial activity and the decrease in intracellular ATP level was investigated in this study. We examined whether the activity of mitochondria was injured by treatment H460 cells with aloeemodin, MitoTracker Red CMXRos was used. MitoTracker Red CMXRos is a red fluorescent dye that stains mitochondria in live cells and its accumulation is dependent upon membrane potential. A bright red fluorescence was observed on numerous and dot-like structures in control-treated cells' cytoplasm using the mitochondrial specific marker dye MitoTracker Red CMXRos (Fig. 3). In aloe-emodin-treated cells, the red fluorescence was faint (Fig. 3). This result suggested that the capability for MitoTracker Red CMXRos uptake by mitochondria in control cells is higher compare to those in the aloe-emodin-treated cells. These data clearly demonstrated that mitochondrial function is severely impaired by aloe-emodin. 3.5. Effects of aloe-emodin on immunofluorescence localization of HSP60 and AIF in H460 cells HSP60 has primarily been known as a mitochondrial protein that is important for folding key proteins after import into the mitochondria. To further investigate whether the effect of aloeemodin on the impairment of mitochondria could be linked to the HSP60 distribution, we used the immunostaining to examine the effect of aloe-emodin on the distribution of HSP60.

Fig. 3. Effects of aloe-emodin on the activity of mitochondria and localization of HSP60 protein in H460 cells. The activity of mitochondria was performed by uptake of MitoTracker Red CMXRos of mitochondria. Cells were incubated with or without 40 μM aloe-emodin in the presence of 1% serum for 16 and 24 h. Cells were incubated for 30 min at 37 °C with 100 nM MitoTracker Red CMXRos (CMX). After washing with PBS, fixation and permeabilization, immunostaining of cells was performed with mouse monoclonal anti-HSP60 antibody as described in Materials and methods. The specimens were observed by confocal spectral microscopy. Results are representative of 3 independent experiments.

6

M.-Y. Lai et al. / European Journal of Pharmacology 573 (2007) 1–10

The specificity of the staining reaction was confirmed by incubation of the HSP60 antibody. HSP60 was found to be localized mainly to mitochondria in the H460 cells. The dotted staining and bright green fluorescence of HSP60 was most intense in the cytoplasm after treatment with aloe-emodin (Fig. 3). To determine whether aloe-emodin induce the translocation of AIF from mitochondria to nucleus, we stained H460 cells with anti-AIF antibody after treatment with 40 μM of aloe-emodin for 24 h. The fluorescence was observed on numerous, dot-like structures in a pattern resembling mitochondria (Fig. 4). The immunofluorescence of AIF appeared as diffuse staining throughout control cells (Fig. 4). Aloe-emodin had no significant effect on the AIF protein expression or translocation from mitochondria to nuclear (Fig. 4). This result suggested that the translocation of AIF to nuclear is not observed during aloe-emodin-induced H460 cell apoptosis even though aloe-emodin enhanced an increase in HSP70 protein expression. 3.6. The effect of aloe-emodin on HSP60, HSP70 and protein disulfide isomerase gene and protein level in H460 cells According to the results of proteome, aloe-emodin induced an increase in the HSP60, HSP70 and protein disulfide isomerase protein levels. This study also examined whether aloe-emodin induced changes in the gene expression of HSP60, HSP70 and protein disulfide isomerase. The gene expression of

Table 3 Primers of HSP60, HSP70 and protein disulfide isomerase for PCR analysis Genes (accession no) HSP60 (AJ250915)

Primers

F: GGTGGCAAGCACTAAAATC R: AAAGGCTGGCTGAAAATC HSP70 (BC024034) F: GCTGCTCTTGCCTATGGTC R: GGTATCCCCATTTGTGGATTTC Protein disulfide isomerase F: CTGGGTATTTCCATAAACAGTG (Z49835) R: GATCTCTAAAGCAGTAGCCAAAC β-actin (G15871) F: ACAAAACCTAACTTGCGCAG R: TCCTGTAACAACGCATCTCA

Product (bp) 243 138 196

241

HSP60, HSP70 and protein disulfide isomerase during aloeemodin-induced apoptosis was performed by reverse transcriptase-polymerase chain reactions (RT-PCR). The primers of investigated genes are shown in Table 3. After H460 cells were treated with 40 μM aloe-emodin for 24 h, there were no changes in the expression of HSP60, HSP70 and protein disulfide isomerase mRNA (Fig. 5A). The detection of β-actin was used as an internal control in the data of PCR. This result indicated that aloe-emodin had no significant effect on the mRNA levels of HSP60, HSP70 and protein disulfide isomerase in H460 cells. To further elucidate whether the protein expression of HSP60, HSP70 and protein disulfide isomerase is involved in

Fig. 4. Immunofluorescence localization of apoptosis-inducing factor (AIF) in control or aloe-emodin-treated H460 cells. Cells were incubated with or without 40 μM aloe-emodin in the presence of 1% serum for 16 and 24 h. Cells were also co-stained with MitoTracker Red CMXRos to detect mitochondria. Cells were incubated for 30 min at 37 °C with 100 nM MitoTracker Red CMXRos (CMX). After washing with PBS, fixation and permeabilization, immunostaining of cells was performed with rabbit monoclonal AIF antibody as described in Material and methods. The specimens were observed by confocal spectral microscopy. Results are representative of 3 independent experiments.

M.-Y. Lai et al. / European Journal of Pharmacology 573 (2007) 1–10

aloe-emodin-induced H460 cell apoptosis, this study examined by Western blotting analysis the regulation of HSP60, HSP70 and protein disulfide isomerase levels. Exposure of H460 cells to 40 μM aloe-emodin resulted in increases in HSP60 and protein disulfide isomerase levels after 8 h of treatment (Fig. 5B). The expression of HSP70 was significantly increased

7

Table 4 Lactate dehydrogenase release from H460 cells Treatment time (aloe-emodin, 40 μM)

LDH release (% of control) a

2h 4h 8h 12 h 16 h 24 h

102 ± 4 99 ± 1 100 ± 3 99 ± 2 101 ± 5 99 ± 4

a

Cells were seeded at a density of 5 × 104 cells per well onto 12-well plate 48 h before aloe-emodin treatment. The cells were incubated with 0.1% DMSO or 40 μM aloe-emodin for various indicated times. After treatment, lactate dehydrogenase (LDH) activity in the supernatant was determined with the LDH Detection kit. The results are expressed as the mean percentage of control ± S.D. of six independent experiments.

after treatment with aloe-emodin for 16 h (Fig. 5B). The Western blot results of HSP60, HSP70 and PDI was quantified by AlphaEase image software (Fig. 5C). To further demonstrate the possible role of ER stress of aloe-emodin-induced cell death, this study investigated the expression of ER stress protein, 150 kDa oxygen-regulated protein. As shown in Fig. 5B, the protein expression of 150 kDa oxygen-regulated protein was significantly increased after treatment with aloe-emodin for 4 h. 3.7. The effect of aloe-emodin on lactate dehydrogenase (LDH) activity in H460 cells To investigate aloe-emodin-mediated cell death of the H460 cells was associated with the induction of apoptosis and not necrosis, LDH assay was used in this study. After treatment with aloe-emodin, the release of LDH was not significantly different from the control value (Table 4). This finding indicated that aloe-emodin-induced cell death was not due to necrosis. 4. Discussion

Fig. 5. Effects of aloe-emodin on the protein and mRNA expression of HSP60, HSP70 and protein disulfide isomerase in H460 cells. (A) Aloe-emodin-induced gene expression of HSP60, HSP70 and protein disulfide isomerase (PDI) was detected by RT-PCR. H460 cells were incubated with 0.1% DMSO or 40 μM aloe-emodin in the presence of 1% serum for 24 h. RNA samples were prepared from control or aloe-emodin-treated cells. PCR products run on a 2% agarose gel. M, molecular weight marker; lanes 1, 4, 7 and 10, control cells; lanes 2, 5, 8 and 11, aloe-emodin-treated cells; lanes 3, 6, 9 and 12, no template control in PCR reaction. Results are representative of three independent experiments. (B) The effects of aloe-emodin on the protein levels of 150 kDa oxygen-regulated protein, HSP60, HSP70 and protein disulfide isomerase in H460 cells. The effects of aloe-emodin on the protein levels of 150 kDa oxygen-regulated protein (ORP150), HSP60, HSP70 and protein disulfide isomerase (PDI) were detected by Western blot analysis. Cells were incubated with or without 40 μM aloe-emodin in the presence of 1% serum for 4, 8, 16 and 24 h. Cell lysates were analyzed by 7% (ORP150), 9% (HSP60 and HSP70) and 10% (PDI) SDSPAGE, and then probed with primary antibodies as described in Materials and methods. (C) Densitometric analysis of HSP60, HSP70 and protein disulfide isomerase (PDI) was carried out on autoradiographs. Data are plotted as percentages of control. Results are representative of three independent experiments.

Many proteins, such as protein kinase C, mitogen-activated protein kinase, Bcl-2 and caspase family members, have been demonstrated to be involved in aloe-emodin-induced apoptosis of H460 cells in our previous studies (Lee, 2001; Yeh et al., 2003). However, the molecular mechanisms underlying the biological effects of aloe-emodin remain unknown. Our previous study has also analyzed the changes in total proteins of H460 cells during aloe-emodin-induced apoptosis by proteomics, which is used to study the large-scale screening of proteins. Many protein spots were found to vary in intensity between the control-cell-loaded and the aloe-emodin-treated cell-loaded gels. However, those of proteins with pI values between 4.75 and 6.5 were not separated clearly (Lee et al., 2005). This study was to further investigate the difference between the control-cell-loaded and the aloe-emodin-treated cell-loaded gels in the pH range of 4.75–6.5 using a 4–7 pH range IPG strip in the first dimension. In aloe-emodin-treated cells, 10 protein spots were found to markedly increase. These altered proteins were identified as heat shock protein 60, heat shock protein 70 and protein disulfide isomerase.

8

M.-Y. Lai et al. / European Journal of Pharmacology 573 (2007) 1–10

It is well-known that mitochondria are the main cellular organelles, which produce ATP through cellular respiration in physiological conditions. In the result of 2D gel electrophoresis, aloe-emodin-treated samples had a significant decrease in the expression of ATP synthase. We investigated whether the activity of mitochondria was injured by treatment H460 cells with aloeemodin. MitoTracker Red CMXRos was used in this study. MitoTracker Red CMXRos is a red fluorescent dye that stains mitochondria in live cells and its accumulation is dependent upon membrane potential. As shown in Fig. 3, the activity of mitochondria in control cells was higher compared to those in the aloeemodin-treated cells. Mitochondria dominate the process of lifeand-death decisions of the cell. Therefore, we predicted that the damage of mitochondria and loss of mitochondrial membrane potential are involved in aloe-emodin-induced H460 cell apoptosis. Many reports have suggested that ATP was required for the execution of several distinct processes in the apoptotic program (Genini et al., 2000; Kass et al., 1996; Nicotera et al., 2000; Stefanelli et al., 1997). In cells, ATP-dependent steps take place in apoptotic signal transduction including apoptosome complex formation and processing of pro-caspase-9, chromatin condensation and apoptotic body formation (Genini et al., 2000; Kass et al., 1996; Nicotera et al., 2000; Stefanelli et al., 1997). It has already been well established that ATP can act as a switch in the decision between apoptosis and necrosis (Leist et al., 1997; Saito et al., 2006). Some evidence has demonstrated that a depleted cellular ATP level has been shown to convert druginduced apoptosis to necrosis, indicating that ATP is most likely involved in the switching mechanism (Luo et al., 2005; Saito et al., 2006). In the present study, the decreased cellular ATP level after aloe-emodin treatment could encourage necrotic over apoptotic cell death in the late stage of aloe-emodin-induced H460 cell apoptosis. The mechanism of aloe-emodin-induced ATP reduction may be related to direct inhibition of ATP synthase since aloe-emodin has been shown to be able to inhibit ATP synthase protein expression in 2D gel electrophoresis. The results presented in the current study show that mitochondria may play a critical role in aloe-emodin-induced H460 cell death. In the result of 2D gel electrophoresis, we observed that HSP60 protein was significantly increased in aloe-emodintreated H460 cells. HSP60 has been known as a mitochondrial protein that is important for folding key proteins after importing into the mitochondria. A number of different models have been proposed to explain that HSP60 has a complex role in apoptosis (Gupta and Knowlton, 2005; Lin et al., 2001; Samali et al., 1999). Several reports have demonstrated that reduction of HSP60 protein expression is sufficient to precipitate apoptosis as manifested by cytochrome c release from the mitochondria, cleavage of proform caspase-3 and DNA fragmentation (Gupta and Knowlton, 2005; Lin et al., 2001). In contrast, it has also been found that HSP60 acceleration of the cleavage of procaspase-3 during apoptosis (Samali et al., 1999). Thus, the role of HSP60 in apoptosis may be both pro- and anti-apoptotic. The present study suggested that HSP60 is involved in aloe-emodininduced H460 cell apoptosis by increasing HSP60 protein level. The endoplasmic reticulum is the site for synthesis, folding, modification and trafficking of secretory and plasma membrane

proteins. In the endoplasmic reticulum lumen, disulfide bond formation, the oxidative cross-linking of certain thiol groups, is a major characteristic post-translational modification of the luminal proteins. It has been demonstrated that alterations in the redox state of the lumen generates under- or over-oxidized thiols, which is deleterious to the protein folding machinery and leads to the accumulation of unfolded or misfolded proteins in the organelle. Such an imbalance between protein synthesis and folding is a stress for the endoplasmic reticulum. Irreversible perturbations in the homeostasis of the endoplasmic reticulum are thought to lead to cell apoptosis (Momoi, 2006; Oakes et al., 2006). The persistent endoplasmic reticulum stress-induced apoptosis has been implicated in the development of multiple human diseases, including Alzheimer disease and Parkinson disease (Lindholm et al., 2006; Oakes et al., 2006). In this study, we found that aloe-emodin induced an increase in the expression of protein disulfide isomerase, a hallmark of endoplasmic reticulum stress, in 2D gel. Therefore, alteration of the redox state of endoplasmic reticulum lumen may play an important role in the aloe-emodin-induced H460 cell apoptosis. It also has been suggested that a variety of endoplasmic reticulum stresses result in unfolded protein accumulation, which triggers a compensatory mechanism referred to as unfolded protein response (UPR). It includes the inhibition of overall protein synthesis to decrease the protein-load, as well as the induction of endoplasmic reticulum chaperones and foldases, by which the cell attempts to increase the folding capacity. For survival, the cells induce endoplasmic reticulum chaperone proteins to alleviate protein aggregation, transiently attenuate translation and activate the proteosome machinery to degrade misfolded proteins. In addition to inducing protein disulfide isomerase overexpression, aloe-emodin also induced the increase in the expression of HSP70 and 150 kDa oxygenregulated protein (ORP150) in H460 cells in this study. The 150 kDa oxygen-regulated protein, a new member of HSP family, functions as a molecular chaperone in the endoplasmic reticulum (Ikeda et al., 1997). Previous studies have reported that overexpression of 150 kDa oxygen-regulated protein involved in various pathological conditions, such as diabetes, atherosclerosis and ischemia (Aleshin et al., 2005; Nakatani et al., 2006; Tsukamoto et al., 1996). Furthermore, many investigators suggested the up-regulated 150 kDa oxygen-regulated protein in isolated tumors or cancer cell lines (Tsukamoto et al., 1998; Miyagi et al., 2002). However, we observed that up-regulated 150 kDa oxygen-regulated protein was involved in aloe-emodininduced cell apoptosis of H460 cells. Consistent with our result, Ohse et al. (2006) have suggested that the overexpression of 150 kDa oxygen-regulated protein induced by albumin overload was associated with apoptosis in renal proximal tubular cells. This study demonstrated that endoplasmic reticulum stress induced by aloe-emodin was associated with apoptosis of H460 cells. Our previous study also observed that the aloe-emodin caused increase in the amount of proform and fragment of nucleophosmin (Lee et al., 2005). Nucleophosmin is a ubiquitously expressed nucleolar phosphoprotein that continuously shuttles between the nucleus and cytoplasma (Borer et al., 1989). It has been proposed to function in ribosomal protein assembly and transport, and also

M.-Y. Lai et al. / European Journal of Pharmacology 573 (2007) 1–10

as a molecular chaperone that prevents proteins from aggregating in the crowded environment of the nucleolus (Colombo et al., 2005; Yu et al., 2006). These results suggested that chaperones may be the target of aloe-emodin during aloe-emodin-induced H460 cell apoptosis. Based on our findings, an increase in HSP70 protein level is involved in aloe-emodin-induced H460 cell apoptosis. This is inconsistent with those of previous investigators that have shown HSP70 antagonizing apoptosis by inhibiting mitochondrial apoptosis-inducing factor (AIF) release in the apoptosis pathway (Matsumori et al., 2005; Ruchalski et al., 2006). This study further investigated whether the translocation of AIF to nuclear was inhibited during aloe-emodin-induced H460 cell apoptosis. The nuclear translocation of AIF activated endogenous endonucleases leading to degradation of native DNA into fragments, peripheral chromatin condensation and nuclear shrinkage that is sufficient to cause apoptosis. The translocation of AIF to nuclear was not observed during aloe-emodin-induced H460 cell apoptosis even though aloe-emodin enhanced an increase in HSP70 protein expression in this study. Based on the above reasons, we hypothesized that the increase endoplasmic reticulum stress serves to promote H460 cell apoptosis by increasing the protein secretory capacity, such as 150 kDa oxygen-regulated protein, HSP70 and protein disulfide isomerase, of the H460 cells after treatment with aloe-emodin. Endoplasmic reticulum stress may be more important than AIF translocation during aloe-emodin-induced H460 cell apoptosis. Furthermore, our previous study has demonstrated that aloeemodin-induced H460 cell apoptosis was caspase-3-dependent (Lee, 2001). Caspase-3 is required for many of the nuclear changes associated with apoptosis, including DNA fragmentation and chromatin condensation. These results indicated that aloe-emodin-induced DNA fragmentation, chromatin condensation and apoptosis were associated with caspase-3-dependent pathway. Acknowledgement This work was supported by the China Medical University Grant CMU94-147 of the Republic of China. References Aleshin, A.N., Sawa, Y., Kitagawa-Sakakida, S., Bando, Y., Ono, M., Memon, I.A., Tohyama, M., Ogawa, S., Matsuda, H., 2005. 150-kDa oxygen-regulated protein attenuates myocardial ischemia-reperfusion injury in rat heart. J. Mol. Cell. Cardiol. 38, 517–525. Beere, H.M., Wolf, B.B., Cain, K., Kuwana, T., Tailor, P., Morimoto, R.I., Cohen, G., Green, D., 2005. Heat shock protein 70 inhibits apoptosis by preventing recruitment of procaspase-9 to the apaf-1 apoptosome. Nat. Cell Biol. 2, 469–475. Borer, R.A., Lehner, C.F., Eppenberger, H.M., Nigg, E.A., 1989. Major nucleolar proteins shuttle between nucleus and cytoplasm. Cell 56, 379–390. Colombo, E., Bonetti, P., Lazzerini Denchi, E., Martinelli, P., Zamponi, R., Marine, J.C., Helin, K., Falini, B., Pelicci, P.G., 2005. Nucleophosmin is required for DNA integrity and p19Arf protein stability. Mol. Cell. Biol. 25, 8874–8886. Dallmann, K., Junker, H., Balabanov, S., Zimmermann, U., Giebel, J., Walther, R., 2004. Human agmatinase is diminished in the clear cell type of renal cell carcinoma. Int. J. Cancer 108, 342–347.

9

Garrido, C., Bruey, J.M., Fromentin, A., Hammann, A., Arrigo, A.P., Solary, E., 1999. HSP27 inhibits cytochrome c dependent activation of procaspase-9. FASEB J. 13, 2061–2070. Genini, D., Budihardjo, I., Plunkett, W., Wang, X., Carrera, C.J., Cottam, H.B., Carson, D.A., Leoni, L.M., 2000. Nucleotide requirements for the in vitro activation of the apoptosis protein activating factor-1-mediated caspase pathway. J. Biol. Chem. 275, 29–34. Gupta, S., Knowlton, A.A., 2005. HSP60, Bax, apoptosis and the heart. J. Cell. Mol. Med. 9, 51–58. Ikeda, J., Kaneda, S., Kuwabara, K., Ogawa, S., Kobayashi, T., Matsumoto, M., Yura, T., Yanagi, H., 1997. Cloning and expression of cDNA encoding the human 150 kDa oxygen-regulated protein, ORP150. Biochem. Biophys. Res. Commun. 230, 94–99. Kass, G.E., Eriksson, J.E., Weis, M., Orrenius, S., Chow, S.C., 1996. Chromatin condensation during apoptosis requires ATP. Biochem. J. 318, 749–752. Lee, H.Z., 2001. Protein kinase C involvement in aloe-emodin-and emodininduced apoptosis in lung carcinoma cell. Br. J. Pharmacol. 134, 1093–1103. Lee, H.Z., Wu, C.H., Chang, S.P., 2005. Release of nucleophosmin from the nucleus: involvement in aloe-emodin-induced human lung non small carcinoma cell apoptosis. J. Int. Cancer 113, 971–976. Leist, M., Single, B., Castoldi, A.F., Kuhnle, S., Nicotera, P., 1997. Intracellular adenosine triphosphate (ATP) concentration: a switch in the decision between apoptosis and necrosis. J. Exp. Med. 185, 1481–1486. Lin, K.M., Lin, B., Lian, I.Y., Mestril, R., Scheffler, I., Dillmann, W.H., 2001. Combined and individual mitochondrial HSP60 and HSP10 expression in cardiac myocytes protects mitochondrial function and prevents apoptotic cell deaths induced by simulated ischemia-reoxygenation. Circulation 103, 1787–1792. Lindholm, D., Wootz, H., Korhonen, L., 2006. ER stress and neurodegenerative diseases. Cell Death Differ. 13, 385–392. Luo, J., Robinson, J.P., Shi, R., 2005. Acrolein-induced cell death in PC12 cells: role of mitochondria-mediated oxidative stress. Neurochem. Int. 47, 449–457. Matsumori, Y., Hong, S.M., Aoyama, K., Fan, Y., Kayama, T., Sheldon, R.A., Vexler, Z.S., Ferriero, D.M., Weinstein, P.R., Liu, J., 2005. Hsp70 overexpression sequesters AIF and reduces neonatal hypoxic/ischemic brain injury. J. Cereb. Blood Flow Metab. 25, 899–910. Miyagi, T., Hori, O., Koshida, K., Egawa, M., Kato, H., Kitagawa, Y., Ozawa, K., Ogawa, S., Namiki, M., 2002. Antitumor effect of reduction of 150-kDa oxygen-regulated protein expression on human prostate cancer cells. Int. J. Urol. 9, 577–585. Momoi, T., 2006. Conformational diseases and ER stress-mediated cell death: apoptotic cell death and autophagic cell death. Curr. Mol. Med. 6, 111–118. Nakatani, Y., Kaneto, H., Hatazaki, M., Yoshiuchi, K., Kawamori, D., Sakamoto, K., Matsuoka, T., Ogawa, S., Yamasaki, Y., Matsuhisa, M., 2006. Increased stress protein ORP150 autoantibody production in Type 1 diabetic patients. Diabet. Med. 23, 216–219. Nicotera, P., Leist, M., Fava, E., Berliocchi, L., Volbracht, C., 2000. Energy requirement for caspase activation and neuronal cell death. Brain Pathol. 10, 276–282. Oakes, S.A., Lin, S.S., Bassik, M.C., 2006. The control of endoplasmic reticulum-initiated apoptosis by the BCL-2 family of proteins. Curr. Mol. Med. 6, 99–109. Ohse, T., Inagi, R., Tanaka, T., Ota, T., Miyata, T., Kojima, I., Ingelfinger, J.R., Ogawa, S., Fujita, T., Nangaku, M., 2006. Albumin induces endoplasmic reticulum stress and apoptosis in renal proximal tubular cells. Kidney Int. 70, 1447–1455. Ruchalski, K., Mao, H., Li, Z., Wang, Z., Gillers, S., Wang, Y., Mosser, D.D., Gabai, V., Schwartz, J.H., Borkan, S.C., 2006. Distinct hsp70 domains mediate apoptosis-inducing factor release and nuclear accumulation. J. Biol. Chem. 281, 7873–7880. Saito, Y., Nishio, K., Ogawa, Y., Kimata, J., Kinumi, T., Yoshida, Y., Noguchi, N., Niki, E., 2006. Turning point in apoptosis/necrosis induced by hydrogen peroxide. Free Radic. Res. 40, 619–630. Samali, A., Cai, J., Zhivotovsky, B., Jones, D.P., Orrenius, S., 1999. Presence of a pre-apoptotic complex of procaspase-3, HSP60 and HSP10 in the mitochondrial fraction of Jurkat cells. EMBO 18, 2040–2048. Stefanelli, C., Bonavita, F., Stanic, I., Farruggia, G., Falcieri, E., Robuffo, I., Pignatti, C., Muscari, C., Rossoni, C., Guarnieri, C., Caldarera, C.M., 1997.

10

M.-Y. Lai et al. / European Journal of Pharmacology 573 (2007) 1–10

ATP depletion inhibits glucocorticoid-induced thymocyte apoptosis. Biochem. J. 322, 909–917. Tsukamoto, Y., Kuwabara, K., Hirota, S., Ikeda, J., Stern, D., Yanagi, H., Matsumoto, M., Ogawa, S., Kitamura, Y., 1996. 150-kD oxygen-regulated protein is expressed in human atherosclerotic plaques and allows mononuclear phagocytes to withstand cellular stress on exposure to hypoxia and modified low density lipoprotein. J. Clin. Invest. 98, 1930–1941. Tsukamoto, Y., Kuwabara, K., Hirota, S., Kawano, K., Yoshikawa, K., Ozawa, K., Kobayashi, T., Yanagi, H., Stern, D.M., Tohyama, M., Kitamura, Y., Ogawa, S., 1998. Expression of the 150-kd oxygen-regulated protein in human breast cancer. Lab. Invest. 78, 699–706.

van den Bogaerdt, A.J., El Ghalbzouri, A., Hensbergen, P.J., Reijnen, L., Verkerk, M., Kroon-Smits, M., Middelkoop, E., Ulrich, M.M.W., 2004. Differential expression of CRABP-II in fibroblasts derived from dermis and subcutaneous fat. Biochem. Biophys. Res. Commun. 315, 428–433. Yeh, F.T., Wu, C.H., Lee, H.Z., 2003. Signaling pathway for aloe-emodininduced apoptosis in human H460 lung nonsmall carcinoma cell. J. Int. Cancer 106, 26–33. Yu, Y., Maggi Jr., L.B., Brady, S.N., Apicelli, A.J., Dai, M.S., Lu, H., Weber, J.D., 2006. Nucleophosmin is essential for ribosomal protein L5 nuclear export. Mol. Cell Biol. 26, 3798–3809.