Chapter 2 CCR5 Pharmacology Methodologies and Associated Applications

C H A P T E R

T W O

CCR5 Pharmacology Methodologies and Associated Applications Roy Mansfield,* Sarah Able,* Paul Griffin,* Becky Irvine,* Ian James,* Malcolm Macartney,* Ken Miller,† James Mills,* Carolyn Napier,* Iva Navratilova,* Manos Perros,* Graham Rickett,* Harriet Root,* Elna van der Ryst,* Mike Westby,* and Patrick Dorr* Contents 1. Introduction 2. CCR5 Signaling Assays and Application to Quantify and Characterize Ligand-Dependent Agonism, Antagonism, and Inverse Agonism 2.1. CCR5-mediated Ca2þ signaling 2.2. CCR5 cellular internalization assay 2.3. Application of CCR5 receptor internalization assay to investigate antagonist-dependent functional receptor occupancy in vivo (clinical trials) 2.4. GTP-associated CCR5 inverse agonism assay 2.5. cAMP-response-element-luciferase reporter gene assay 3. CCR5-Associated Ligand-Binding Assays 3.1. Radiolabeled CCR5 chemokine-binding assays 3.2. Radiolabeled antagonist-binding and -dissociation assays 3.3. Real-time ligand binding using Biacore technology 3.4. Real time HIV-1 gp120-CCR5 binding assay 3.5. Application of gp120 binding to characterize functional occupancy in vitro 4. Surrogate In Vitro Antiviral Assays 4.1. HIV-1 gp160-CCR5–mediated cell–cell fusion assay 4.2. Antiviral assays 5. CCR5 Site-Directed Mutagenesis and Ligand Docking Studies 5.1. Structural model generation 5.2. CCR5 site-directed mutagenesis

* {

18

19 19 24

25 28 30 33 33 34 34 35 37 38 38 40 43 44 45

Pfizer GRD-Sandwich Laboratories, Sandwich, Kent, United Kingdom Pfizer GRD-Groton Laboratories, Groton, Connecticut, USA

Methods in Enzymology, Volume 460 ISSN 0076-6879, DOI: 10.1016/S0076-6879(09)05202-1

#

2009 Elsevier Inc. All rights reserved.

17

18

Roy Mansfield et al.

5.3. Transfection of HEK Ga15 cells with pIRESneo-CCR5 (various isoforms) and pCRE-luc 5.4. CRE-Luc reporter assay 5.5. Example results/data 6. Non-HIV Indications–Associated Studies, Human CCR5 Knock-In Mice 6.1. Vector construction for hCCR5 knock-in 6.2. Transfection and human CCR5 knock-in mouse generation 6.3. Materials References

45 46 46 48 48 49 50 52

Abstract The G protein–coupled chemokine (C-C motif ) receptor, CCR5, was originally characterized as a protein responding functionally to a number of CC chemokines. As with chemokine receptors in general, studies indicate that CCR5 plays a role in inflammatory responses to infection, although its exact role in normal immune function is not completely defined. The vast majority of research into CCR5 has been focused on its role as an essential and predominant coreceptor for HIV-1 entry into host immune cells. Discovery of this role was prompted by the elucidation that individuals homozygous for a 32 bp deletion in the CCR5 gene do not express the receptor at the cell surface, and as a consequence, are remarkably resistant to HIV-1 infection, and apparently possess no other clear phenotype. Multiple studies followed with the ultimate aim of identifying drugs that functionally and physically blocked CCR5 to prevent HIV-1 entry, and thus provide a completely new approach to treating infection and AIDS, the world’s biggest infectious disease killer. To this end, functional antagonists with potent anti–HIV-1 activity have been discovered, as best exemplified by maraviroc, the first new oral drug for the treatment of HIV-1 infection in 10 years. In this chapter, the specific methods used to characterize CCR5 primary pharmacology and apply the data generated to enable drug discovery, notably maraviroc, for the treatment of HIV infection and potentially inflammatory-based indications, are described.

1. Introduction The CCR5-associated methods included in this chapter are described in fine detail to enable their various subtleties to be captured as far as possible for the reader, especially where the method in question is subject to failure due to minor changes in assay conditions. As the predominant application of CCR5 research is toward the discovery of agents to treat HIV infection, CCR5-associated virology methodologies are included. Where helpful for the reader, specific reagent volumes and working conditions are also described as ‘‘typical’’ in order to help their transfer to practical laboratory

CCR5 Primary Pharmacology Methods and Applications

19

situations. Where such fine details are captured elsewhere, an outline is given with the associated citation for the sake of brevity. Where methods and applications are described, but not available for transfer to third-party laboratories due to their proprietary nature, a citation and overview of the method are described. Example data, results, and application for specific methods are also described or cited both for purposes of providing information per se as well as to enable assay setup in independent laboratories where applicable or desired. The antagonists and agonists either discovered or used to exemplify the methods and associated applications or results are described in Table 2.1 with specific citation for each provided in the text.

2. CCR5 Signaling Assays and Application to Quantify and Characterize Ligand-Dependent Agonism, Antagonism, and Inverse Agonism Chemokine interaction with CCR5 initiates several events. The receptor associates with G proteins, leading to activation of signaling processes, that is, changes in receptor conformation, G-protein interaction and GTP binding, and intracellular Ca2þ redistribution and receptor internalization. A number of cognate/endogenous CC chemokines (see Table 2.2) bind to CCR5 with different affinities and abilities to activate the receptor (Blanpain et al., 2003). Discovery and characterization of novel, noncognate ligands, including quantification of their inhibitory (i.e., antagonistic) potencies can be determined using the various assays developed to measure chemokine-induced CCR5 signaling. The methods can be applied to show the qualitative functional binding of a ligand (i.e., agonism, inverse agonism, and functional antagonism), and the quantification in potency (i.e., EC50 [agonists]) or IC50 [antagonists]).

2.1. CCR5-mediated Ca2þ signaling This method was adapted from a previous reported methodology (Combadiere et al., 1996), and a summary with application for drug discovery has been reported (Dorr et al., 2005b; Napier et al., 2005). A CCR5 agonist would be expected to trigger a cascade of intracellular signaling events that may lead to activation of the target cell. Conversely, a functional antagonist or inverse agonist of the receptor would bind without triggering an intracellular signal to prevent attachment of the cognate chemokines and subsequent signaling events. Agonists bind to the CCR5 receptor to induce a signal transduction cascade provoking, among other events, redistribution of intracellular Ca2þ from the endoplasmic reticulum (i.e., Ca2þ flux). Ca2þ flux can be measured by the increase in fluorescence of an intracellular dye

Table 2.1 CCR5 antagonists described in this chapter CCR5 antagonist: status/application

Structure and general chemotype

Maraviroc (UK-427857): Approved drug for the F treatment of HIV-1 infection (Dorr et al., F 2005b; Dorr and Perros, 2008; Fatkenheuer et al., 2008)

N N H N

N

N

O

Tropane azole N

PF-232798: Phase 2 (Dorr et al., 2008)

N

O N

H N

N

O

F Tropane imidazipiperidine

UK-484900: Eexperimental CCR5 antagonist and inflammatory indications tool

N N

O N

H N

N

O

O

F Tropane imidazipiperidine

N

PF-501606: Experimental antagonist and docking standard.

O

O

N

N O

N N

Tropane imidazopiperidine

x

Table 2.1 (continued) CCR5 antagonist: status/application

Structure and general chemotype N

UK-396794: Experimental CCR5 antagonist O (Dorr et al., 2005a; Haworth et al., 2007)

N H N

N

O

Tropane benzimidazole

Me

UK-433370: Experimental CCR5 antagonist (Dorr et al., 2005a)

F

N N

H N

F

N

N

O

Tropane azole N

O

UK-438235: Experimental CCR5 antagonist (Haworth et al., 2007)

N

N H N

N

Tropane benzimidazole O

SCH-C Former clinical candidate (Tsamis et al., 2003a)

N

N+

O−

N

O N

Br Bis-piperidine

(continued)

22

Roy Mansfield et al.

Table 2.1 (continued) CCR5 antagonist: status/application

Structure and general chemotype N

UK-107543: CCR5 HTS hit (agonist) (Dorr et al., 2005b)

N

N

N

Imidazopyridine

Table 2.2 Cognate ligands for CCR5 Systematic ligand name

Original ligand name

CCL3 CCL4 CCL5

MIP-1a (macrophage inflammatory protein 1a) MIP-1b (macrophage inflammatory protein 1a) RANTES (regulated on activation, normally T -cell expressed and secreted)

CCL7 CCL8 CCL14 CCL3L1

MCP-2 (monocyte chemoattractant protein 1) HCC-1 (Haemofiltrate CC chemokine 1) LD78b

resulting from its combination with intracellular Ca2þ released from the ER. This can be monitored in real time using a fluorescent laser imaging plate reader (FLIPR) or an equivalent workstation technology. This allows a real-time assay of agonist and antagonist effects on CCR5-mediated Ca2þ flux in HEK-293 cells expressing the human chemokine receptor. 2.1.1. CCR5 stable transfected cell culture and preparation for calcium signaling assays CCR5 stably transfected cells, such as CHO or HEK-293 cells, are prepared in an appropriate cell culture medium to a density of 1  106 cells/ml. Suitable aliquots of this cell suspension (e.g., 100 ml for a 96-well, plate-based assay) are transferred into every well of poly-D-lysine plates

23

CCR5 Primary Pharmacology Methods and Applications

FLIPR-compatible plates and incubated overnight in a growth incubator (humidified 5% (v/v) CO2 incubator at 37 ) to ensure cell adhesion. 2.1.2. Calcium dye preparation and cell dye loading for calcium signaling assays A Calcium Plus KitTM dye is dissolved in 10 ml Ca2þ flux buffer (see Section 6.3) before adding 90 ml of the same buffer to create the final working solution. The media from the plated cells is removed and the adherent cells washed twice by removal of culture medium and replacement with 2  100 ml PBS into each well. The PBS is removed and the adherent cells are incubated with dye preparation (100 ml/well) and left gently rocking for 3 h. The dye is then aspirated and the plates washed three times with Ca2þ flux buffer, prior to addition of additional buffer (160 ml) immediately before the Ca2þ flux assay is undertaken. 2.1.3. Ca2þ flux assay Antagonist dilutions (20 ml, at appropriate concentrations) are added to designated wells of the dye-loaded cell plate after 30 s into a prewritten fluorescence program, to examine agonist activity. Chemokines (20 ml to enable testing at the predetermined EC50 at final assay concentration [FAC]) are added to each well after 4 min. Buffer–buffer and MIP-1b–buffer controls are performed to establish contribution of the artifact signal. 2.1.4. Example data and results The profile of maraviroc in this assay is shown in Fig. 2.1 as an example of a functional CCR5 antagonist. 1000 nM maraviroc 13,000

16 nM maraviroc

Fluorescent counts

12,000

4 nM maraviroc

11,000

Vehicle control

10,000 9000 8000 7000

Maraviroc

6000 5000

0

50

RANTES 100

150

200 250 Time (s)

300

350

400

450

Figure 2.1 Effect of RANTES (CCR5 agonist) and maraviroc (CCR5 functional antagonist) on recombinant CCR5-mediated Ca2þ signaling in HEK cells. The dynamic change in fluorescence after the addition of maraviroc (marked) is shown, as well as subsequent addition of agonist RANTES as marked 4 min later.

24

Roy Mansfield et al.

2.2. CCR5 cellular internalization assay To enable characterization of ligand binding with association to agonism or antagonism, it is necessary to see if test compounds induce CCR5 internalization or not. A method for this has been summarized with application in reported drug discoveries (Dorr et al., 2003b, 2005b). Antiviral activity by CCR5 cognate chemokines is mediated by internalization of receptor, whereas antagonists block the receptor and stabilize a conformation that is not recognizable by CCR5-tropic (R5) HIV-CD4 complex. CCR5internalization–mediated antiviral activity has been reported to lead to HIV-1 resistance through tropism shift (Mosier et al., 1999), although the viruses used in such studies are associated with random tropism shift per se (i.e., shift to CXCR4 without CCR5 antagonist selection pressure) (Westby et al., 2004, 2007). A tropism shift to escape antagonist antiviral activity has not been observed to date in clinical or preclinical studies (Dorr and Perros, 2008). In light of the low and variable levels of CCR5 expression on primary cells, 300.19/R5 cells (an internalization-competent recombinant human CCR5 expressing mouse pre–B-cell line) can be used for quantitative preclinical pharmacology studies. Cell surface CCR5 levels are measured using a human CCR5-specific monoclonal antibody, with an associated labeled secondary antibody to enable fluorescenceactivated cell sorting (FACS) technology (alternatively, the primary antibody can be custom labeled). Endogenous CCR5 agonists and the CXCR4 agonist stromal derived factor 1a (SDF-1a) can be used as positive and negative CCR5 internalization controls, respectively. 2.2.1. Cell culture and reagent preparation 300.19/R5 cells (mouse pre–B-cell line, recombinantly expressing human CCR5) are cultured in a DMEM medium and adjusted to a cell density of 5  106/ml by dilution in the same medium. Anti-CCR5 antibody (2D7see Section 6.3) is diluted 1:10 in 0.5% (w/v) BSA/PBS. Antibody IgG2a (isotype control for the assay, see Section 6.3) is similarly diluted. The anti2D7 phycoerythrin (PE)–labeled, goat anti-mouse secondary antibody (see Section 6.3) is used at a 1:20 dilution in 0.5% (w/v) BSA/PBS. RANTES and SDF-1a (or any other cognate chemokine, see Section 6.3) is dissolved in PBS (100 mM), and then further diluted from a 1-mM final assay concentration (FAC) in cell culture medium. 2.2.2. FACS Assay 300.19/R5 cells (100 ml) at 5  106 cells/ml are added to each assay tube. Antagonists or chemokine controls (10 ml) are added to appropriate assay tubes to enable profiling (usually at 100 nM or below in situ). The tubes are incubated 37 for 45 min to enable CCR5 internalization. The samples are centrifuged (1500 rpm in a benchtop centrifuge) and washed twice in 0.5%

CCR5 Primary Pharmacology Methods and Applications

25

(w/v) BSA/PBS (100 ml). Washed samples are resuspended in 40 ml of the same buffer. Anti-CCR5 antibodies or isotype controls are then added to the samples followed by incubation for 45 min at 4 to enable antibody binding to CCR5. The samples are washed once in 0.5% (w/v) BSA/PBS, followed by the addition of 75 ml phycoerythrin (PE)–goat, anti-mouse secondary antibody with incubation at 4 for 45 min in the dark to enable binding. The samples are subsequently centrifuged (1500 rpm in a benchtop centrifuge for 5 min), washed twice in 0.5% (w/v) BSA/PBS (100 ml) and resuspended in 1% (v/v) formaldehyde/PBS (1 ml) for fixing. The fixed cells are processed using suitable instrumentation (e.g., Becton Dickinson FACScalibur), using excitation/emission wavelengths of 488 nm/530 nm, respectively. 2.2.3. Example results/data Figure 2.2 highlights the data generated from this method as plotted by fluorescence overlays showing chemokine induction of CCR5 cellular internalization. The plots highlight that agonism results in receptor internalisation and that antagonists do not induce this event. This method can also be modified by the addition of a ‘‘wash-and-chase’’ phase where cells are washed following a period of incubation with antagonists (for a set period) and then progressed to chemokine-induced internalization studies with FACS analysis. This enables the functional offset of the antagonist to be characterized and used to compare various antagonists. Figure 2.3 highlights this application with the experimental antagonist UK-484900 (Table 2.1), highlighting prolonged blockade of chemokine-induced CCR5 internalization, following removal (by cell washing) of exogenous antagonist and a 2-h incubation prior to chemokine addition.

2.3. Application of CCR5 receptor internalization assay to investigate antagonist-dependent functional receptor occupancy in vivo (clinical trials) As part of drug clinical development, it is becoming increasingly important to ensure that compounds under evaluation induce the desired mechanismassociated pharmacology in humans. The FACS-based CCR5 internalization assay has been adapted to enable functional CCR5 occupancy studies in humans. Placebo versus maraviroc (i.e., CCR5 antagonist)-dependent inhibition of MIP-1b–mediated CCR5 internalization (i.e., functional occupancy) can be assessed in CD4 T lymphocytes prepared from whole-blood citrate CPT (cell preparation tubes) samples taken from healthy volunteers participating in a clinical study designed to investigate CCR5 occupancy in vivo. The difference in CCR5 expression on the cell surface in the presence of high concentration exogenously supplied maraviroc treated (total CCR5) versus untreated (maximum internalization) peripheral

26

Roy Mansfield et al.

A

B 80

80

Control SDF-1a RANTES + 2 hr media RANTES

Control SDF-1a RANTES

Counts

4 ⬚C

Counts

37 ⬚C

0 100

101

102 103 Fluorescence

104

0 100

101

102 103 Fluorescence

104

C 80

Control SDF-1a 10 nM UK-427857 100 nM UK-427857

Counts

37 ⬚C

0 100

101

102 103 Fluorescence

104

Figure 2.2 Effect of maraviroc on 300.19 cell surface CCR5 levels (anti-CCR5 antibody^dependent cell population fluorescence). Isotype control fluorescence counts (y-axis) is depicted in grey. RANTES (100 nM)-induced reduction of CCR5 is shown by a reduction in fluorescence (green line in 2A) relative to parallel experiments using the negative control ligand SDF-1a (red line in 2A). Reemergence of CCR5 at the cell surface is apparent following a 2-h incubation period post addition of RANTES (blue line, 2A). RANTES-induced reduction in cell population fluorescence is reduced at 4 (2B) highlighting internalization to be an active biological process. Maraviroc did not affect cell population fluorescence at10 nM or 100 nM (blue and green lines, respectively, in 2C), as also seen for the negative control SDF-1a (red line). (From Dorr P., and Perros, M. (2008). CCR5 inhibitors in HIV therapy. Expert Opin. Drug Discov.3, 1^16; Dorr, P., et al. (2005). Maraviroc (UK-427,857), a potent, orally bioavailable, and selective smallmolecule inhibitor of chemokine receptor CCR5 with broad-spectrum anti-human immunodeficiency virus type1activity. Antimicrob. Agents Chemother.49,4721^4732.)

blood lymphocytes (PBLs) subjected to MIP-1b challenge, gives estimate of the proportion of free CCR5 present on the cell surface at any given plasma concentration of maraviroc. These data can then be used to estimate the degree of receptor occupancy obtained at different doses (and exposures) of maraviroc, or indeed any other CCR5 antagonist in clinical evaluation.

27

CCR5 Primary Pharmacology Methods and Applications

Counts

A

120 100 80 60 40 20 0 100

101

102 FL2-H

103

104

100

101

102 FL2-H

103

104

100

101

102 FL2-H

103

104

Counts

B

Counts

C

120 100 80 60 40 20 0

120 100 80 60 40 20 0

Figure 2.3 Prolonged inhibition of UK-484900 (antagonist)-dependent inhibition of chemokine-induced CCR5 internalization in 300.19 cells. Flourescence plot overlays of a representative FACS experiment with human CCR5 expressed on 300.19/R5 cells. Fluorescence units are shown on the x-axis, and cell counts on the y-axis. UK-484,900 is assayed at 1000 nM, 100 nM, and 10 nM (f3A, B, and C, respectively). Cells are treated with RANTES in the presence of the compound (depicted in black), following compound removal and wash (pink), or a further 1.5-h incubation (orange).Vehicle control is depicted in green.Total fluorescence (no RANTES) is depicted in red, and the isotype negative control is depicted in blue.

2.3.1. Dosing and sampling regimen CCR5 antagonists such as maraviroc versus placebo are dosed to volunteers at known levels for the purpose of evaluating dose-occupancy correlation. Blood samples are then taken (into citrate-CPT tubes, 4 ml) at intervals after dosing to evaluate occupancy. The residual CCR5receptor expression on CD4 positive lymphocyte populations is determined by FACS analysis of processed sodium citrate CPT anticoagulated whole-blood samples.

28

Roy Mansfield et al.

2.3.2. Sample preparation and FACS analysis Peripheral blood lymphocyte–rich plasma samples are isolated by centrifugation of CPT tubes at 1550g for 25 min at room temperature (RT) in a swing-out–rotor bench centrifuge. The buffy coat layer of cells is resuspended in the plasma. Each cell-enriched plasma sample (250 ml) is pipetted into three separately labeled 12  75–mm polystyrene roundbottomed tubes (Tube 1 [isotype control], Tube 2 [maraviroc-stabilized CCR5], and Tube 3 [test sample]). An aliquot (50 ml) of CCR5 stabilizing solution (see Section 6.3) is added to Tube 2, while PBS (1% (w/v) BSA) (50 ml) is added to Tubes 1 and 3, before briefly vortexing on a medium setting for 2 s and incubating at 37 for 30 min. All tubes are centrifuged at 400g for 5 min to isolate cells. Aliquots (15 ml) of MIP-1b (100 nM) are added to all tubes, and then gently vortexed on a medium setting for 2 s to resuspend pellet in fluid. The tubes are then incubated uncapped for 45 min in a growth incubator to enable CCR5 internalization. Aliquots (1 ml) of 0.5% (v/v) paraformaldehyde in PBS are added to each tube, followed by vortex (2 s) and incubation (10 min) in the dark at RT to fix the cells. Cells are washed with PBS/centrifugation (400g for 5 min) prior to antibody addition (50 ml—MsIgG R-phycoerythrin [PE], isotype control [Tube 1]; anti-CCR5 2D7, PE labeled, maraviroc stabilized and test samples [Tubes 2 and 3]). All tubes are then vortexed (2 s) and incubated for 20 min in the dark at RT, washed with PBS/BSA as before, with resuspension in 0.5 ml of 1%(v/v) paraformaldehyde by vortexing (2 s). Samples can be stored at 2 to 8 until FACS analysis as described above. 2.3.3. Example results/data The PBL population CCR5-mediated fluorescence profile and MIP-1b– induced effect to reduce this signal through receptor internalization on the cells taken from human volunteers are highlighted in Fig. 2.4. The effect of blockade of this agonist-induced internalization is used to measure the functional occupation of maraviroc in clinical studies, and example data highlighting the dynamic dose-occupancy relationship is highlighted in Fig. 2.5.

2.4. GTP-associated CCR5 inverse agonism assay CCR5 interacts with multiple G-protein species in recombinant cells, following binding of the various endogenous agonist ligands (Mueller et al., 2002, 2006; Mueller and Strange, 2004a, 2004b; Peltonen et al., 1998). MIP-1b–dependent stimulation of GTP can be examined using a radiolabeled nonhydrolyzable form of GTP (gS-GTP) exactly as described by (Haworth et al., 2007) to characterize the inverse agonism mechanism

29

CCR5 Primary Pharmacology Methods and Applications

Maraviroc plus chemokine

Vehicle plus chemokine 60 50

40

CCR5

30 20 10

Cell counts

Cell counts

50

40

CCR5

30 20

:

10 103 102 101 PE-dependent fluorescence

104

102 103 101 PE-dependent fluorescence

104

Figure 2.4 CCR5 occupancy assay in/ex vivo. FACS analysis of PBLs blockade of chemokine (MIP-1b)-induced CCR5 internalization by maraviroc in ex vivo PBMCs, as measured by PE-conjugated anti-CCR5-Mab (2D7) fluorescence measurements on a FACS technology platform.The presence of maraviroc inhibits MIP-1b^induced CCR5 internalization compared tovehicle. Analysis of placebo versus maraviroc dosed samples using this methodology enabled the dynamic functional occupancy of CCR5 to be profiled (Fig. 2.5).

% CCR5 functional occupancy

120 100 100 mg

80

25 mg 60

3 mg 10 mg

40

Placebo

20 0 0

10

20

30 Time (h)

40

50

60

Figure 2.5 Dynamic functional occupancy of CCR5 in humans by maraviroc blood sample for assay of CCR5-internalization on isolated PBMCs taken at times indicated following single dose to healthy volunteers. Data are mean  SD for each cohort. Note that 20% of 2D7-anti-CCR5^recognized CCR5 is not internalized by MIP-1b, leading to an apparent occupancy level of 20% for placebo-dosed human volunteers.

that is measurable in recombinant systems which underpins the functional antagonism of antiviral CCR5 inhibitors (Dorr et al., 2005b; Strizki et al., 2001). GTP binding to CCR5 is measured based on previously described methods ( Jansson et al., 1999; Labrecque et al., 2005). These can also be adapted to a time-resolved fluorometric assay, using a Europium (Eu3þ) labeled gS-GTP to avoid use of radioactivity.

30

Roy Mansfield et al.

2.4.1. Membrane preparation and GTP-binding assay CCR5 stable transfected HEK-293 cells are cultured to a confluency between 50 and 70% in standard culture medium (e.g., DMEM), typically in a 225-cm2 flask. Cells are washed once with PBS. The PBS is removed and the cells dislodged by rapping the side of the culture flask in the presence of 10 ml culture medium, harvested by centrifugation (350g for 10 min). Pelleted cells are resuspended in 15 ml lysis buffer (see Section 6.3), and homogenized with a handheld homogenizer (5 to 10 s on ice, three to four times). The homogenate is centrifuged at 40,000g for 30 min at 4 . The membranous pellet is resuspended in a minimal volume of lysis buffer (see Section 6.3) prior to estimation of protein concentration (e.g., Bradford microassay). Membrane aliquots (50 ml at 500 mg/ml) are added to designated wells of a 96-well assay plate. GTP binding is measured using a Delfia GTP-binding assay kit (see Section 6.3), according to the manufacturer’s protocol, with a ‘‘preoptimized’’ GTP assay buffer (see Section 6.3). Assay buffer (50 ml) is added to the plate wells prior to incubation at RT for 30 min with gentle rotary shaking. MIP-1b and test compounds are diluted in 50 mM HEPES buffer, pH 7.4, over a desired concentration range. The test compound is added and incubated at RT for 30 min prior to the addition of 10 ml GTP-Eu3þ (100 nM FAC). The reaction is incubated for a further 30 min at 37 before washing with 300 ml/well of ice-cold wash buffer (supplied with assay kit) and reading immediately at 615 nm using an appropriate plate reader. Basal GTP binding is calculated from the mean values obtained for vehicle control-designated wells (50 mM HEPES, pH 7.4). The effect of MIP-1b and the test compound on GTP incorporation is measured for each well (and meaned), with percent stimulation relative to vehicle control calculated. Nonspecific binding (NSB) is subtracted (NSB is determined as the background binding of GTP to the assay plate in the absence of membranes). 2.4.2. Example data and results Vicriviroc, maraviroc, and its analogues UK-396794 and UK-438235 show the classic inverse agonist profile of small concentration-dependent reductions in GTP-binding assays, compared to relatively large agonist-stimulated increase in binding as previously reported (Dorr et al., 2005b; Haworth et al., 2007; Strizki et al., 2001). This is depicted in the case of maraviroc in Fig. 2.6.

2.5. cAMP-response-element-luciferase reporter gene assay The cAMP-response-element-luciferase (CRE-luc) plasmid codes for a cAMP response element upstream of a luciferase reporter gene. HEKGa15 cells can be transiently cotransfected with the CRE-luc

31

CCR5 Primary Pharmacology Methods and Applications

1600

Stimulated/basal GTP binding (%)

1400 MIP-1b MIP-1 1200 1000 800 600 400 200 Maraviroc 0 3

6

10

30 60 100 Ligand concentration (nM)

300

600

1000

Figure 2.6 Inverse agonism of CCR percent by maraviroc. Stimulation of GTP binding to membrane preparations from CCR5-expressing HEK-293 cells by MIP-1b(pink line and data points), and UK-427,857 (blue line and data points). Data points represent the ratio of GTP binding in the presence of ligand over basal levels of GTP binding in vehicle control assays.

construct and a plasmid encoding the human CCR5 receptor. The transfected cells are stimulated with forskolin to activate adenylate cyclase, and increase intracellular cAMP to enable an assay window. The cAMP binds to its response element, which activates transcription of the luciferase reporter gene, leading to an increase in measured luminescence. The CCR5 receptor is a Gi-linked GPCR when expressed in an appropriate background, and agonism inhibits adenylate cyclase, reducing the intracellular cAMP concentration and thus decreasing the luminescence signal. The effect of preincubation with antagonists on the dose–response curve to MIP-1b, and therefore its functional activity at the CCR5 receptor can thereby be investigated. 2.5.1. Transient transfections and assay plate preparation Bulk preparations of human CCR5 receptor DNA (in the expression vector pIRESneo) and CRE-luc plasmid DNA (see Section 6.3) are used for transfections. HEKGa15 cells are cultured in standard medium (see Section 6.3), and passaged at 90% confluency using cell dissociation solution. Cells are transfected at 50 to 80% confluency in T75 flasks, using

32

Roy Mansfield et al.

lipofectamine (Plus) reagent. OptiMEM reduced serum medium is used in all transfection procedures. Two solutions are prepared for each transfection: Solution 1 ¼ 4 mg human CCR5 receptor DNA, 2.5 mg CRE-luc DNA, 45 ml Plus reagent, 0.75 ml OptiMEM; and Solution 2 ¼ 22.5 ml lipofectamine, 0.75 ml OptiMEM. Solution 1 is incubated at RT for 15 min. Solutions 1 and 2 are then mixed and incubated at RT for 15 min, before the addition of 7 ml OptiMEM. The flasks containing the cells for transfection are removed from the incubator and the media removed. The cells are washed in 10 ml OptiMEM, and the DNA/lipofectamine/OptiMEM mix (Solutions 1 and 2) added. The flasks are incubated in a growth incubator overnight. For cell plate preparation, DMEM medium without phenol red, supplemented with 10% (w/v) dialysed FCS, is used in the cell plate preparation. Media is removed from the transfected cells and each flask is washed once in 10 ml PBS. Cell dissociation solution is added (2 ml) and the flasks incubated at RT for up to 5 min. The flasks are tapped to dislodge the cells, and approximately 8 ml media (as above) added. The cells are pelleted by centrifugation at 1000g for 5 min. The cells are resuspended in fresh media and plated out (90 ml) into 96-well plates (2.5  104 cells/well), and are left to adhere overnight in a growth incubator. 2.5.2. CRE-luc assay To inhibit phophodiestrase activity and enable cAMP detection accordingly, isobutylmethylxanthine (500 mM in DMSO) is diluted to 1 mM in 0.1% (w/v) BSA/PBS to make the antagonist diluent. Test compounds e.g., maraviroc are diluted in antagonist diluent to 10x final assay concentration. MIP-1b is prepared at 36 mM in 0.1% (w/v) BSA/PBS, and aliquoted for freezing/use. MIP-1b is then diluted in 0.1% (w/v) BSA/PBS to 12 final assay concentration. Forskolin (1 mM in DMSO) is diluted to 3.6 mM in 0.1% (w/v) BSA/PBS to give a FAC of 300 nM. Test compounds (10 ml) are added to the cell and incubated at 37 for 30 min, prior to addiction of MIP-1b and forskolin (10 ml each). The plates are mixed gently, and incubated at 37 for 5 h. After equilibration to RT for 10 min. SteadyGlo luciferase (see Section 6.3) is prepared according to manufacturer’s instructions, added (100 ml/well), and incubated at RT for 10 to 15 min before reading luminescence on an appropriate plate reader with data transfer system to determine percent of cAMP inhibition values. 2.5.3. Example results/data Maraviroc at 1, 3, and 10 nM, caused a dose-dependent rightward shift of the dose–response curve to MIP-1b, together with a marked suppression of the maximum response, indicative of insurmountable antagonism (Fig. 2.7). The maraviroc pKb is determined following an assumption of hemiequilibrium conditions, and a double reciprocal regression is then constructed, and the slope of the line is used to calculate the Kb. The pKb

33

% Fitted max of control curve

CCR5 Primary Pharmacology Methods and Applications

150

Control 1 nM UK-427, 857

100

3 nM UK-427, 857 10 nM UK-427, 857

50 0 −12 −50

−11

−10

−9

−8

−7

−6

Log10 [MIP-1b]M

Figure 2.7 Effect of maraviroc on MIP-1b dose^response curveDose^response in the absence and presence of 1, 3, and 10 nM of former. Each data point represents the mean of n ¼ 4 experiments. In each experiment, the mean of duplicate wells is calculated.

value of maraviroc is determined as 9.4 (95% confidence interval 9.01– 9.75). A more detailed description of analysis of this type has been comprehensively reported for CCR5 (Kenakin et al., 2006; Watson et al., 2005b).

3. CCR5-Associated Ligand-Binding Assays The affinity of CCR5 ligands including antagonists with therapeutic potential can be characterized in terms of their potency in a range of binding assays, and also to examine relevant kinetic properties such as physical and functional receptor dissociation rates. This can be used for compound characterisation, or comparison in order to guide a synthetic program.

3.1. Radiolabeled CCR5 chemokine-binding assays Radiolabeled cognate chemokine-binding assays to recombinant CCR5 (membranes and whole cells) has been extensively reported to a level of detail that would enable straightforward setup in an independent laboratory. Classic membrane-filter binding assays were originally developed and reported by Combadiere et al. (1996), and described in detail to enable the characterization of specific CCR5 antagonist such as maraviroc by Dorr et al. (2005b) and Napier et al. (2005), and the bicyclics SCH-C and SCH-D (vicriviroc) by Strizki et al. (2001, 2005) and Tagat et al. (2004). Modification to enable homogenous assays using scintillation proximity assay technology for greater screening amenity has also been reported for the characterization of aplaviroc (Watson et al., 2005b). These and signaling assays have been applied across CCR5 isoforms in order to select

34

Roy Mansfield et al.

appropriate species to examine the mechanistic toxicology of CCR5 antagonists (Mosley et al., 2006; Napier et al., 2005).

3.2. Radiolabeled antagonist-binding and -dissociation assays Physical association and dissociation studies for maraviroc have been reported in fine detail by Napier et al. (2005). These include competition studies where excess unlabeled maraviroc is used to prevent reassociation of 3H-maraviroc in ligand-binding experiments (either isolated membrane preparations or intact recombinant CCR5-expressing cell lines). Data from such experiments highlighted the slow physical dissociation of maraviroc (T1/2 ¼ 16 h; see Napier et al., 2005)). This is a phenomenon that appears to be consistent for CCR5 antagonists and no freely reversible antagonists have been reported to date. Intriguingly, experiments that assess functional offset by gp120 offset or chemokine on-set assays (Dorr et al., 2005a; Watson et al., 2005a) imply even longer antagonist dissociation, or more strictly, receptor recovery. For gp120 binding, this may be a consequence of this glycoprotein linking to CCR5 clusters rather than single receptors for infection, and so antagonist dissociation may be required from each CCR5 molecule prior to a gp120accepting formation can be adopted, or that antagonist dissociation is followed by a period of CCR5 being in a nonfunctional conformation, or both.

3.3. Real-time ligand binding using Biacore technology Biacore offers a technology platform that can monitor the binding of ligands to receptors and monitor interactions based on induced changes in the refractive index. This enables interactions to be monitored in real time, rather than by sampling at time points, and avoid the use of radiolabeled ligands. 3.3.1. Immobilization of 1D4 monoclonal antibody on a CM4 surface The monoclonal antibody 1D4 (see Section 6.3) is immobilized on a CM4 sensor chip using standard amine-coupling chemistry. HBS-N (10 mM Hepes, 0.15 M NaCl, pH 7.4) is used as the running buffer. The carboxymethyl dextran surface requires activation with a 12-min duration injection of a 1:1 ratio of 0.4 M 1-ethyl-3-(3-dimethylaminopropyl) carbodimide hydrochloride (EDC):0.1 M N-hydroxy succinimide (NHS). The antibody is coupled to the surface with a 15-min injection of 1D4 diluted in 10 mM sodium acetate (pH 5.0). Remaining activated groups are blocked with a 7-min injection of 1 M ethanolamine (pH 8.5). To obtain a 1D4 surface density of approximately 12,000 RU, immobilization is performed at 30 using Biacore S51.

CCR5 Primary Pharmacology Methods and Applications

35

3.3.2. Ligand binding to receptors CCR5 is solubilized as described previously (Navratilova et al., 2006) and captured by 1D4 immobilized on surfaces within a CM4 chip at densities equating to approximately 4000 RU (the running buffer consists of 50 mM Hepes, pH 7.0, 150 mM NaCl, 0.02% (w/v) CHS, 0.1% (w/v) DOM, 0.1% (w/v) CHAPS, and 50 nM DOPC/DOPS [7:3]). Small-molecule CCR5 compounds are dissolved in dimethyl sulfoxide (DMSO) and diluted into 50 mM HEPES (pH 7.0), 150 mM NaCl, 0.02% (w/v) CHS, 0.1% DOM, 0.1% CHAPS, and 50 nM DOPC/DOPS (7:3) to concentrations of 1 to 20 mM. These solutions are then serially diluted threefold in running buffer to produce the concentration series for each inhibitor. The receptor surfaces are stabilized by at least eight start-up buffer blanks before injecting a compound. To reference for drift, two blank injections are performed between analyte injections. Compounds are injected at a flow rate of 30 ml/min, and the association and dissociation phases are monitored for 1 and 10 min, respectively. The receptor surfaces are not regenerated between analyte injections. Instead, the injections are performed from lowest to highest concentrations and the data are normalized for the maximum binding capacity as described previously (Navratilova et al., 2006). 3.3.3. Example data and results Antagonist binding to solubilized CCR5 is highlighted in Fig. 2.8. The compounds are injected over freshly prepared CCR5 surfaces in increasing concentrations. All binding responses are globally fitted with a 1:1 interaction model that used a different maximum binding capacity (Rmax) for each analyte injection and data are normalized for Rmax. The compounds highlighted in Fig. 2.8 show their relative CCR5 affinities and physical association and dissociation rates.

3.4. Real time HIV-1 gp120-CCR5 binding assay CCR5 antagonists bind the receptor and stabilize a conformation that is unable to bind the HIV-1 gp120-CD4 complex. The method detailed in the following requires preparation of a crude gp120-containing extract to enable an empiric assay for IC50 determination, although commercially available sources of purified or semipurified gp120 also generate signals in this assay albeit to a lesser extent (Rickett et al., 2003). The requirement for gp120 preparations to enable a sufficiently high signal to noise in this assay reduces the ability of the assay to resolve/differentiate compounds of IC50 potencies less than 20 nM. Other limitations are the empiric nature of the screen and limited scope for kinetic validation. However, this assay is amendable to high throughput screening, and has utility for scrutinizing the molecular interaction for inhibitors of HIV-1 gp160-CCR5–mediated

36

Normalised response (% Rmax)

Roy Mansfield et al.

120 100 80 60 40 20 0

Maraviroc ka = 1.1 (±0.1) ⫻ 105 M−1s−1 kd = 6.0 (±0.2) ⫻ 10−4 s−1 KD = 25.0 (±4.0) ⫻ 10−9 M t1/2 = 1165 s 0

50

100

150

200

250

300

120 100 80 60 40 20 0

UK-438235−40 ka = 3.5 (±0.1) ⫻ 104 M−1s−1 kd = 7.1 (±0.1) ⫻ 10−4 s−1 KD = 2.0 (±0.1) ⫻ 10−8 M t1/2 = 976 s 0

50

100

150

200

250

300

10 8 6 4 2 0

UK-107543 (agonist) ka = 1.14(7)E + 06 kd = 0.27(2) KD = 2.40(20)E − 07 t1/2 = 2.56721178 0

50

100

150

200

250

Time(s)

Figure 2.8 Profile of small molecule antagonist and agonist binding in Biacore. Graphs highlighting association and dissociation of various CCR5 ligands as measured by dynamic change in refractive index on Biacore.

cell–cell fusion (Fig. 2.9), which better resemble the HIV-1 entry process in infection, and is now the favored screen for HTS (Dorr et al., 2003a), but does not define the specific interaction blocked by inhibitory compounds. 3.4.1. Preparation and assay of soluble recombinant gp120 CHO cells stably transfected with the HIV-1 gp120 expression vector pEE14.1 (see Section 6.3) are cultured in 200-ml roller bottles for 4 days, which is replaced by 200 ml DMEM-S medium with 1% (w/v) FCS for 3 days prior to supernatant harvest for gp120 preparation. The cell supernatant is concentrated by ultrafiltration and empirically quantified in the assay described in the following using a Europium-labeled, anti–HIV-1 gp120 IgG antibody (see Section 6.3) in the time-resolved fluorescence immunoassay (TRFIA). 3.4.2. Inhibition of soluble recombinant HIV-1 gp120 (Ba-L strain) binding to CCR5 by TRFIA This assay is performed as essentially as described by (Dobbs et al., 2001), and is depicted in Fig. 2.9. HEK-293 cell aliquots (100 ml at 1  106 cells/ml) are plated into poly-D-lysine–coated plates and incubated in a growth incubator overnight. A 1:1 mix of soluble recombinant human CD4 (sCD4, diluted to 4.5 nM in culture medium; see Section 6.3) and HIV-1

37

CCR5 Primary Pharmacology Methods and Applications

gp120-sCD4-CCR5 binding

gp160-CCR5 cell-cell fusion gp160

Eu-cryptate

TAT

CHO anti-gp120

TAT CD4

gp120 sCD4 CCR5

Hela P4

CCR5 b-Gal

+

b-Gal

Figure 2.9 Cartoon depictions of gp120-sCD4-CCR5 binding and gp160-CCR5 cell^ cell fusion assays.

gp120 (e.g., Ba-L strain) are incubated at RT for 15 min before its addition to PBS-washed cells, in the presence of dilutions of maraviroc to enable IC50 determination. The assay plates are incubated at 37 for 1 h and washed. Eu3þ labeled anti-gp120 antibody (1/500 dilution in assay buffer; see Section 6.3) is added to each well (50 ml) and incubated 1 h. The plate is washed three times with assay buffer, prior to the addition of enhancement solution (200 ml/well; see Section 6.3) and measurement of Eu3þ fluorescence. Nonspecific binding is taken as the fluorescence measured for gp120 incubated with cells in the absence of preincubation with sCD4. The data can be used to examine dose–response for compound-dependent inhibition of HIV gp120-sCD4 complex binding to CCR5 as shown for maraviroc in Fig. 2.10.

3.5. Application of gp120 binding to characterize functional occupancy in vitro CCR5 antagonists have slow physical dissociation from the receptor, as measured using radiolabeled antagonist competition assay. To investigate the more clinically relevant endpoint of dynamic compound stabilization of HIV-1 ‘‘unrecognizable’’ conformation (i.e., time required for receptor to become amenable for HIV-gp120 binding following antagonist onset), a wash-and-chase modification of the gp120 assay can be undertaken. This also offers the advantage of cross-compound comparisons, without the need for custom radiolabeling of each antagonist. The methodology is essentially the same, except that the following a 30min period of antagonist association (period in excess of the tritiated antagonist binding to a steady-state signal (various compounds, data not shown), the assay plates

38

Roy Mansfield et al.

100 90 80

% Inhibition

70 60 50

Fusion gp120

40 30 20 10 0 0.001

0.01

0.1

1

10

100

1000

[Maraviroc] (nM)

Figure 2.10 Dose^response curves for maraviroc-dependent inhibition of gp120sCD4 binding to CCR5, and gp160-CCR5 cell^cell fusion maraviroc-dependent inhibition of gp120 binding to CCR5 (red) and gp160-CCR5^mediated cell^cell fusion (black).

containing confluent, nonexpanding cell populations are washed three times in PBS to remove all exogenous antagonist, incubated for a set period (e.g., overnight), prior to completion of the assay for IC50 determination. The assay is run without the wash step, where exogenous antagonist is present throughout the assay in parallel. Control studies (unpublished) have shown that the wash-and-chase steps do not alter compound potency per se. The IC50 ratio for gp120-binding inhibition for assays run under non-wash versus wash-and-chase gives an indication of the functional occupancy of a given antagonist (as exemplified for PF-232798 in Fig. 2.11), and enable comparisons of different antagonists as previously reported (Dorr et al., 2005a, 2008).

4. Surrogate In Vitro Antiviral Assays The role of CCR5 as a coreceptor important in antiviral drug discovery has led to de novo assay developments that are of a bespoke nature. The novelty of CCR5 as an antiviral target has also led to the development of new surrogate antiviral assays, and modifications of infectious virus-based antiviral assays. These are described in the following in no particular order.

4.1. HIV-1 gp160-CCR5–mediated cell–cell fusion assay A high-throughput fully automated HIV-1 envelope or gp160-CCR5– dependent cell–cell fusion assay (fusion assay) has been previously reported in detail, and shown to be highly predictive of antiviral activity, with a

39

% Inhibition gp120-sCD4 binding

CCR5 Primary Pharmacology Methods and Applications

120 100 80 60 40 No wash 20

Wash and chase

0 0.1

1

10

100

1000

10000

[PF-232798] (nM)

Figure 2.11 Functional offset of PF-232798 from CCR5 as measured by a wash-andchase gp120-sCD4^binding assay. Dose^response curves for PF-232798^dependent inhibition of gp120-sCD4 binding to CCR5 in the presence of exogenous dosed antagonist (no wash) and when removed and incubated for 24 h (wash and chase).

greater correlation to antagonist potency in primary cell-based antiviral assays (deemed the most reliable predictor of efficacy in humans from a pharmacology perspective), than either the chemokine or gp120-binding assays (Bradley et al., 2004; Dorr et al., 2003a). This has enabled extensive screening for CCR5 ligands (and inhibitors against other cell-entry–associated targets), without the need to use hazardous systems such as infectious HIV preparations or radioligands. The fusion assay is depicted in Fig. 2.9, and requires functional complete viral envelope protein gp160, which is naturally processed into two linked subunits, gp120 and gp41. To enable quantitative evaluation of the process, the HeLaP4 cells express a b-galactosidase reporter gene under the control of HIV-1-LTR, while the gp160expressing CHO cells also expressed the HIV-1 transcriptional activator Tat. Fusion between the two cell lines allows soluble Tat from the CHOgp160 cells to transactivate the HIV-1 LTR present in the HeLaP4, leading to the expression of b-galactosidase. The level of b-galactosidase is determined using the fluorogenic substrate 4-methylumbelliferyl-galactopyranoside (MUG). b-galactosidase cleaves MUG to generate fluorescent 4-methylumbelliferone. Inhibition of cell–cell fusion reduces fluorescent signal levels in this assay relative to mock-treated controls, to enable dose– response evaluation (see Fig. 2.10). The methods and application of this method have been described in fine detail (Bradley et al., 2004) and are not included here for the sake of brevity. This assay can also be modified to become a direct antiviral assay by supplanting the CHO cell line with CCR5-tropic whole HIV virus (predetermined titer). However, correlation studies with antiviral activity of CCR5 antagonists in primary

40

Roy Mansfield et al.

cell–based assays with infectious virus show no advantage in the use of virus versus CHO cells in this reporter assay (unpublished data, Pfizer GRD), highlighting the advantage of the cell–cell fusion system in terms of safety and assay amenability.

4.2. Antiviral assays A range of antiviral assays have been used to profile CCR5 antagonists ranging from systems using ex vivo native cells, through to proprietary high throughput recombinant systems as described in detail by Petropoulos et al. (2000), which are commercially available for compound screening (PhenoSenseTM assay) or for determination of HIV coreceptor usage (i.e., tropism) of patient HIV samples (TrofileTM assay). The details of these assays are not described here in light of their proprietary nature. The principles of their use and general methodologies in the field of CCR5 research are outlined in Dorr et al. (2005b) and Westby et al. (2007). In light of the notorious difficulty yet high importance in establishing cross-laboratory consistency with native cell–based antiviral assays, and their general utility in establishing target exposure levels in patients for dose setting in clinical trials, fine details in these methods are described. 4.2.1. CCR5-associated primary cell–based antiviral assays: Peripheral blood lymphocytes and monocyte-derived macrophages HIV-1 replicative systems Cell preparation: Peripheral blood lymphocytes Peripheral blood lymphocytes (PBLs) are typically prepared in convenient batch sizes using buffy coats from individual donors or combined from two to four HIV- and HBV-seronegative donors. Each buffy coat is diluted in an equal volume of PBS and mixed. From this, 30 ml is layered onto 20 ml of Ficoll-Paque in 50 ml centrifuge tubes, followed by centrifugation for 30 min at 1000g at RT. The PBLs are harvested at the Ficoll–plasma interface. The PBLs are washed twice in PBS by centrifugation for 10 min at 500g at 4 . Contaminating erythrocytes are lysed by adding 9 ml sterile water, stored at 4 , to the resuspended PBL pellet, followed immediately by 1 ml of RT 10  Hanks Buffered Saline. PBS is added to a final volume of 45 ml and the PBLs are pelleted by centrifugation for 10 min at 100g at 4 . The pellet is washed twice more in PBS at 4 prior to resuspension and pooling of pellets from other tubes in 30 ml RPMI cell culture medium at RT. Cells can be pooled, and if required, frozen (liquid nitrogen storage) from individual donors at this stage. Cell viability is determined, such as by trypan blue exclusion. Only cell suspensions showing greater than 95% viability are typically used in antiviral assays. The cell suspensions are adjusted to 1  106 cells/ml by the addition of fresh RT RPMI cell culture medium containing 1.5 mg/ml phytohemaglutinin (PHA) to enable enhanced

CCR5 Primary Pharmacology Methods and Applications

41

CCR5 expression to facilitate viral entry, aliquoted into 50 ml cultures and incubated for 3 days in a growth incubator, prior to counting for viral expansion or antiviral assays. Cell preparation: Monocyte-derived macrophages Harvested buffy coats (single donors) are diluted with an equal volume of DPBS and layered in 30-ml aliquots onto an Accuspin tube prior to centrifugation for 30 min at RT (1000g). Harvested monocyte-derived macrophages (MDMs) are washed three times in approximately 50 ml PBS and centrifuged for 10 min at 750g prior to resuspension in RPMI growth medium. Monocytes are adjusted to 1.0  105/well (200 ml) in a 96-well plate and incubated in a growth incubator for 1 h (to enable MDM-selective adhesion). The supernatant is discarded from the cells, and plates are washed twice with 200 ml RT PBS, prior to addition of fresh cell culture medium (200 ml) and incubated for 7 days prior to antiviral assay in a growth incubator. Antiviral assay: PBL cultures PBLs are infected for 1 h at 37 with a predetermined volume of virus calculated to give an equal amount of HIV-1 reverse transcriptase (RT) activity per virus stock. Infected cells are washed and added to assay plates (e.g., 7.2  104 cells/well [200 ml] for a 96-well plate) containing serial dilutions of test compounds (in RPMI culture medium and DMSO 0.1% (v/v) FAC). After 5 to 7 days of incubation, the cultures are examined visually with a microscope for evidence of cytotoxicity and viral replication and compound-dependent inhibition is quantified by measuring RT activity (see the following). Antiviral assay: MDM cultures MDMs are used after 7 days in culture (to enable full differentiation). The supernatant is replaced with 50 ml of either compound preparation or vehicle (RPMI medium containing DMSO at 0.1% (v/v) FAC). Cells are transferred to a growth incubator for 1 h, and then 50 ml of pretiter virus stock (see the following) is added prior to return to the incubator for 3 h. Following removal of medium, plates are washed five times using 200 ml of RT PBS per well prior to readdition of test compounds and vehicle at 2  FAC equivalent. A further 50 ml of cell culture medium are added to all wells and plates transferred to a growth incubator for 7 days. After this period, culture supernatant is harvested from the assay plates and tested directly in the HIV-1 RT detection assay as a surrogate of HIV-1 replication for compound susceptibility profiling and quantification (i.e., IC50 and IC90). Reverse transcriptase assay RT activity is quantified in culture supernatants using and appropriate assay kit such as the Quan-T-RT assay (see Section 6.3) (Amersham Pharmacia Biotech). Assay reagent sufficient for the whole assay is prepared based on the following reagent volumes

42

Roy Mansfield et al.

per well: 50ml H2O; 19 ml assay buffer; 10 ml primer/template bead/scintillant complex, and 1 ml [3H]TTP. The mixture is vortexed to ensure full suspension of the beads, and 80 ml are transferred to each well of a 96-well Isoplate, to which 20 ml culture supernatant or standard is added and mixed by pipetting. The plate is sealed and incubated at 37 for 1 h in a growth incubator to allow incorporation of the tritiated thymidine triphosphate into the primer/template by the virus RT enzyme. The reaction is terminated with the addition of the supplied stop solution (EDTA) containing 1% (w/v) SDS) to inactivate HIV-1. Light emission (SPA bead-driven from kit) is measured in a scintillation counter (results recorded as cpm). Samples are considered positive for virus if the cpm value is fourfold greater than that of the uninfected cell control. An RT standard curve (Quant-T kit; see Section 6.3) ranging from 0 to 10 mU/ml is prepared in culture medium and treated in the same manner as the test material. Expansion and storage of HIV-1 stocks HIV-1 isolates (laboratory and primary origin; see Section 6.3) can progress through a typical methodology as follows to supply virus of sufficient titer for antiviral assay: Typically, an aliquot (0.5 ml) of isolate sample is added to a 15-ml conical centrifuge tube, prior to the addition of 1.0  107 PBLs, in RT RPMI growth medium. Following incubation for 1 h in a growth incubator, the infected cells are pelleted by centrifugation at 225g for 10 min, and resuspended in a small volume of RPMI medium at RT. The resuspended cells are transferred to a T75 tissue culture flask and diluted up to a final volume up to 50 ml with RPMI growth medium containing IL-2 (enhances proliferation and CCR5 expression) at 10 ng/ml. The cells are reincubated for 3 to 4 days. After this, 25 ml of the spent medium is removed and replaced with 30 ml fresh growth medium containing IL-2 (10 ng/ml). Following, 3 4 days incubation as before, 20 ml of the supernatant is assayed for reverse transcriptase (RT) activity for evidence of replication as described above. Counts above 2000 cpm are deemed sufficiently high to enable CCR5 antagonist antiviral testing. Supernatants with counts less than 2000 cpm/20 ml supernatant in the RT assay are typically further expanded by replacement of half the culture medium with fresh, and addition of a further 1  107 PBL cells, with a further 3- to 4-day incubation and RT assay until counts of more than 2000 cpm are achieved. HIV-1 resistance to CCR5 antagonists This has become a rapidly growing research field that cannot be detailed to the level as for more direct CCR5 pharmacology- and virology-associated methodologies. However, this important preclinical and clinical field has been included in a recent review with citations of key methodologies and applications included (Dorr and Perros, 2008). The methodology for viral passage for generating

43

CCR5 Primary Pharmacology Methods and Applications

120

% Inhibition

100 80

MVC plus MVC Res CC185

60

MVC plus start CC185

40

PF-232798 plus start CC185 PF-232798 plus MVC Res CC185

20 0 −20 1.0E-11

1.0E-10

1.0E-09

1.0E-08

1.0E-07

[Antagonist] (M)

Figure 2.12 Antiviral dose^response curves highlighting activity of PF-232798 against laboratory-generated MVCRES HIV-1 isolate CC1/85. All data points are from parallel PBL cultures using RT activity as measurement of HIV-1 replication. Inhibition is measured versus vehicle-dosed control cultures. MVC retained expected activity against passaged control start cultures of HIV-1 isolate CC1/85 (blue line and data points), and is inactive against MVC-passaged isolate (red line and data points). PF-232798 shows retention of activity against both passaged isolates (green and pink lines and data points). Graphs highlighting association and dissociation of various CCR5 ligands as measured by dynamic change in refractive index on Biacore.

laboratory-resistant CCR5 antagonist HIV strains and examining crossresistance has been extensively detailed and exemplified (Westby et al., 2007). Example results and data Figure 2.12 shows the dose–response curves for CCR5 antagonist profiling in PBL-based antiviral assays, using a laboratorygenerated maraviroc-resistant (MVCRES) isolate generated by long-term serial passage in gradually increasing maraviroc concentrations (Dorr et al., 2008; Westby et al., 2007). This has been used to show the potential of second-generation CCR5 antagonists to retain activity against laboratory generated MVCRES isolates (see Fig. 2.12).

5. CCR5 Site-Directed Mutagenesis and Ligand Docking Studies The techniques for visualizing ligand-GPCR interactions are significantly hampered by the insolubility of the receptors, and the associated difficulties involved in crystal formation for x-ray diffraction. To investigate the molecular interactions between CCR5 antagonists and specific amino

44

Roy Mansfield et al.

acids of the CCR5 receptor, and to support a computer-assisted docking model of maraviroc and other CCR5 antagonists into the presumed binding pocket, a CCR5 site-directed mutagenesis–based approach can be used. By homology modeling with bovine rhodospin, a structurally characterized GPCR (Palczewski et al., 2000), amino acid residues that are presumed to form the CCR5 equivalent of the retinol-binding pocket of bovine rhodopsin can be identified. This region of the CCR5 receptor has been widely identified as the binding site for CCR5 antagonists and numerous models reported, including an excellent cross-template study (Kondru et al., 2008). Although all such studies have been retrospective (i.e., visual models generated following antagonist design and established SARs), the structural information has highlighted receptor–ligand interactions that might be the driving various SARs observed. The example cited here shows the use of structural information on the CCR5 program and various antagonists, and specifically its application to rationalize the SAR associated with crossand nonoverlapping activity against laboratory generated MVCRES virus (strain CC1/85). This strain, in common with all HIV-1 isolates that eventually acquire resistance to maraviroc following in vitro passage or prolonged clinical exposure, gains cell entry through maraviroc-occupied CCR5 rather than via CXCR4 (Dorr and Perros, 2008; Westby et al., 2004, 2007).

5.1. Structural model generation Following site-directed mutagenesis of selected residues in CCR5 the interaction of antagonists with a selected residue can be determined in terms of change in functional affinity. For this, the EC50 of chemokine (e.g., MIP-1b)-induced signaling is determined, and compared to that measured for wildtype receptor. For this, expression plasmids encoding the CCR5 isoforms can be individually cotransfected into HEK cells in combination with a plasmid encoding a CRE-dependent luciferase reporter gene. Following elevation of intracellular cAMP levels by exposure to forskolin (a nonspecific activator of adenylate cyclase), CCR5 signaling is subsequently measured by MIP-1b–induced agonism of the receptor, which reduces of intracellular cAMP levels due to CCR5 Gi protein coupling. Intracellular levels of cAMP can be assessed following luciferase expression as a result of cAMP-dependent induction of the cre-luc reporter plasmid. Antagonistdependent inhibition of MIP-1b–induced signaling of each CCR5 isoform is thus enabled through IC50 measurement. The change in IC50 values for each mutant can be compared to wildtype to gain insight into which residues in the putative binding pocket formed an interaction with a given antagonist. The very general rule is that interaction is proportional to the loss in IC50 against the mutated residue as compared to wildtype. The MIP-1b–dependent reduction of cAMP levels is deemed to be a consequence of CCR5 signaling, in light of this chemokine being a highly specific cognate ligand for this

CCR5 Primary Pharmacology Methods and Applications

45

receptor, and the absence of such signaling being seen in the absence of recombinant receptor, and complete inhibition seen at high doses of applied CCR5 antagonist. Computer-assisted docking using this ‘‘IC50-shift’’ parameter of antagonists requires an initial dock of a test compound of known crystal structure and rigidity, with following docks of test compounds thereafter. Site directed mutagenesis studies as reported here run against this compound resulted in a loss in potency for the Y108A and E283A mutants. This enabled an overlay and subsequent docking of other CCR5 antagonists such as maraviroc, vicriviroc, and PF-232798 into the modeled putative binding pocket of CCR5 using a Pfizer software package (FLOPS, Flexes Ligands Optimizing Property Similarity). Similar packages are reported with this type of utility (Kondru et al., 2008; Tsamis et al., 2003b).

5.2. CCR5 site-directed mutagenesis Mutant CCR5 isoforms made de novo or sourced directly are cloned into an appropriate expression plasmid, such as pIRESneo (see Section 6.3 section). For de novo mutations and the desired mutation (e.g., glutamic acid 283, alanine (E283A)) is constructed using polymerase chain reaction (PCR)– based site directed mutagenesis methodology with the wildtype CCR5encoding pIRESneo plasmid as the substrate DNA source, and mutant-specific primer pairs for E283A. The PCR is run according to a manufacturer’s instructions (e.g., Quikchange mutagenesis kit; see Section 6.3). Parent template wildtype CCR5 DNA is removed by digestion using methylasedependent Dpn-1 endonuclease (part of Quikchange kit), leaving amplified mutant CCR5. The retained DNA preparations containing the CCR5 point mutations are transformed into XL-1 blue supercompetent E. coli (according to associated kit instructions) and incubated overnight on plates containing LB agar supplemented with 100 mg/ml ampicillin at 37 . Resulting colonies are expanded (e.g., 5 ml cultures of LB broth containing 100 mg/ml ampicillin at 37 overnight). Plasmid DNA is purified from the E. coli cultures using a Miniprep kit (see Section 6.3) according to the manufacturer’s protocol and the insert verified using restriction digest with EcoRV. Cultures associated with the expected restriction pattern are replated. Confirmed sequencevalidated clones are bulked up (e.g., 200 ml culture), DNA extracted, and quantified by UV spectroscopy (using maxi prep kit; see Section 6.3) for large-scale plasmid purification and HEK cell transfection.

5.3. Transfection of HEK Ga15 cells with pIRESneo-CCR5 (various isoforms) and pCRE-luc This method is a modification of the CRE-luc assay described above, with the following modifications: Solution 1 contains 7.5 mg CCR5 construct, 2.5 mg pCRE-luc reporter plasmid (see Section 6.3), 45 ml lipofectamine

46

Roy Mansfield et al.

plus reagent, and 800 ml optimem (see Section 6.3). Solution 2 contains 22.5 ml lipofectamine and 800 ml optimem. Transfected cells are washed with prewarmed (37 ) optimem (10 ml) and growth media (20 ml) prior to incubation overnight in a growth incubator and trypsin-EDTA treatment (1 ml supplied reagent; see Section 6.3) incubation for 2 min at RT, media resuspension, to 3  105 viable cells/ml. Cells are plated at 90 ml/well in 96-well, white opaque plates, incubated overnight prior to functional (CRE-luc) assay.

5.4. CRE-Luc reporter assay The CCR5-associated CRE-luc assay was described above. This can be undertaken for mutants versus wildtype to measure the effect of the mutation on the IC50 value. Loss in potency is implicated with a loss in binding at the mutation site. The docking pattern is computed accordingly.

5.5. Example results/data The data from such studies enable overlays of various antagonists based on an initial dock into CCR5, and can be validated using functional inhibition studies comparing compound potency for mutated versus wildtype receptor. This is exemplified in Fig. 2.13A where maraviroc and analogues in the monocyclic tropane series show an inhibitory potency loss against CCR5 signaling following Y108A and E283A mutation. The resultant docks respectably show the hydrophobic and ionic interactions at these residues by the phenyl and amine moieties of maraviroc. Similar interactions are seen with the tropane antagonist PF-232798 (Fig. 2.13B). A dock of the bispiperidine (i.e., bicyclic) CCR5 antagonist SCH-C is shows no equivalent interaction with Y108 (Fig. 2.13c), consistent with previous reports, highlighting this residue to be relatively unimportant in enabling interaction with CCR5 (Tsamis et al., 2003a). Comparative docks with other templates within the tropane series of CCR5 antagonists can be made to highlight differential occupation potentially underpinning the SAR required to enable activity against the laboratory generated MVCRES HIV-1 CC1/85, which has evolved resistance through multiple envelope mutation to enable entry via maraviroc-occupied CCR5 (Westby et al., 2004, 2007). The overlays highlight the additional spatial occupation by the imidazopiperidine group of PF-232798 (and UK-484900; see Table 2.1) around the ECL2 region, which is believed to stabilize CCR5 in a conformation that MVCRES HIV-1 CC1/85 cannot bind. This represents highly specific SAR, as close-in analogue benzimidazole tropanes such as UK-396794 and UK-438235 (see Table 2.1 and Fig. 2.13D) are inactive against MVCRES HIV-1 CC1/85 (Dorr et al., 2005a; Dorr and Perros, 2008; Westby et al., 2005).

47

CCR5 Primary Pharmacology Methods and Applications

A ECL2

E283

Y108

C

B E283

E283

Y108

Y108

D E283

Y108

UK-433370 (cyclopropyl-triazole): inactive against MVCRES HIV-1 CC185

UK-396794 (benzimidazole): inactive against MVCRES HIV-1 CC185

PF-232798 (imidazopiperidine) active against MVCRES HIV-1 CC185

Figure 2.13 Computer-assisted docks of CCR5 antagonists and HIV resistance SAR. Computer-modeled docking of maraviroc (green) into the transmembrane pocket of CCR5, highlighting hydrophobic interaction between the maraviroc phenyl moiety with the tyrosine (Y) 108, and the ionic interaction between the tropane basic amine and the glutamic acid (E) 283 (A). Overlaps between maraviroc and PF-232798 (purple) and the bicyclic CCR5 antagonist SCH-C (yellow) are highlighted in (B) and (C), respectively. The extracellular loop 2 (ECL2) hinge region of CCR5 is highlighted. SAR associated with antiviral activity of CCR5 antagonists in the tropane series against laboratory-generated MVCRES HIV-1 CC185, with the requirement of differential occupancy at the ECL2 hinge region (specifically achieved by the imidazopiperidine substituent) highlighted, is shown in (D). Maraviroc is depicted in green and test compounds are depicted in purple. Full structures of compounds are shown inTable 2.1.

48

Roy Mansfield et al.

6. Non-HIV Indications–Associated Studies, Human CCR5 Knock-In Mice CCR5 is a chemokine receptor, and has subsequently been investigated as a potential target against a wide range of predominantly inflammatory disorders. Such studies have been driven by expression studies in disease states and pharmacogenomic data highlighting positive, negative, or neutral correlation with diseases. Animal models using CCR5 ligands have also inferred association of CCR5 antagonism with efficacy against various disorders. Reviews on the potential of CCR5 antagonist for treatment of non-HIV diseases include Turner et al. (2007) and Wells et al. (2006). Preclinical evaluation of the utility of CCR5 antagonists against non-HIV diseases would be greatly facilitated by a highly potent and selective murine CCR5 antagonist. Unfortunately, no such tool has been reported, and compounds in current clinical HIV programs are highly selective for primate isoforms, and are devoid of activity against rodent species CCR5. To this end, a human CCR5 knock-in mouse has been constructed, where the human ORF supplants the murine ORF to ensure expression, and physiological role is as analogous to wildtype as possible. This, together with the identification of UK-484900 as a highly potent and selective human CCR5 antagonist with equivalent primary and selectivity pharmacology to maraviroc, coupled a PK profile (and dosing regime) in mice that ensures free compound exposure to be equivalent to maraviroc as seen in HIV-1 associated clinical practice (i.e., 100% functional CCR5 blockade), and has enabled a model for studying antagonist efficacy in various murine disease models (Dorr, 2008). Further validation has shown that hCCR5 is activated by murine chemokines (same EC50 as for human chemokines), and this is inhibited by hCCR5 antagonists. This validation of the model and utility in non-HIV diseases has recently been reported by (Dorr, 2008).

6.1. Vector construction for hCCR5 knock-in To generate a knock-in CCR5 mouse model, homologous recombination is used to replace the murine CCR5 gene with its human orthologue. Only the coding sequence of the human gene is inserted; thus the recombinant locus retains all mouse CCR5 cis-regulatory sequences and is expected to express the human CCR5 gene with the same cell specificity. The neomycin-resistance cassette used for targeting into ES cells is flanked by loxP sites and placed immediately after the stop codon (see Fig. 2.14). Therefore, the only permanent alteration of the locus is a 34 bp loxP site left after subsequent CRE-mediated recombination (Sauer and Henderson,

loxP

Spe

Stop

Human CCR5

Neomycin resistance

Xbol

3 kb Murine genomic DNA

BamH1 Sca

Kpn

ATG

loxP

3.5 kb Murine genomic DNA

Not1

49

CCR5 Primary Pharmacology Methods and Applications

Figure 2.14 CCR5 knock-in miceçtarget vector. Neomycin resistance cassette used for targeting into ES cells by homologous recombination with murine orthologue^ flanking regions (in situ) for human CCR5 (ORF-only) knock-in mice generation.The selection, excision, and marker restriction sites are shown.

1988). To achieve the seamless insertion of the human coding sequence into the mouse locus, the 50 arm of the targeting vector is constructed by overlapping PCR. The reverse oligo used to amplify the 3 kb of the murine genomic sequence upstream of the ATG includes 10 bp of the human coding sequence (Table 2.3). Likewise, the forward oligo used to amplify the human cDNA incorporated 30 bp of mouse genomic sequence at its 50 end, while the reverse primer contains a BamH1 cloning site, the loxP sequence, and stop codons. To complete the seamless junction at the ATG, another PCR is performed, which uses these two products as template to make a shorter product that bridges the mouse and human sequences. The full-length 50 homology arm is then assembled using naturally occurring restriction sites. The 30 homology arm is also made by PCR, using oligos that included a second loxP site in the forward primer. The completed homology arms are cloned into the pJNS2 vector containing PGKneomycin phosphotransferase for positive selection and the HSV thymidine kinase gene for negative selection. All products should be sequenced to ensure accuracy of the PCR.

6.2. Transfection and human CCR5 knock-in mouse generation The linearized targeting vector is electroporated into E14 129 ES cells (Hooper et al., 1987). Targeted clones can be identified by Southern blot using a 50 probe generated by PCR using oligos 585F/1521R and a 30 probe is made using oligos 9570F/10524. Targeting the 50 is determined by Sca1digestion (wt ¼ 6.5 kb, targeted ¼ 5.8 kb) and 30 targeting by Spe1 digestion (wt ¼ 11, targeted ¼ 7.5). Heterozygous animals carrying the targeted human allele are bred to mice expressing Cre recombinase under control of the E2A promoter (Lakso et al., 1996) to remove the neomycinresistance cassette, and then bred to homozygosity for the human CCR5, with cell surface expression checked in target cells (e.g., splenocytes, PBLs, etc.) using FACS technology as described above. These mice are available from Pfizer-GRD and are used in various academic laboratories as tools to investigate the potential of CCR5 antagonists to treat diverse inflammatory diseases.

50

Roy Mansfield et al.

Table 2.3 Oligos used to build CCR5 KI vector

CCR5-10254R CCR5-9570F CCR5-585F CCR5-1521R CCR5-Kpn1755F CCR5-Not9496R CCR5-50 arm-R hCCR5-50 F hCCR5-50 R

CATGATCTTCTTCATTCTCC TCCTTGCATTTCACTCTAGC GGAACTTGAGAATATCATCC GATTTGAAGGTAACAGAGCG ATGGTACCATTGGTGTCTGGGATAAAGC ATAAGAATGCGGCCGCTCCAGCATTCTGCAGATCCACC GATAATCCATCCTGCAAGAG CCTATGAATAAATAAAAGAC GTCTTTTATTTATTCATAGGCTCTTGCAGGATGGATTA TCAAGTGTCAAGTCCAATCTATGAC TTGGATCCATAACTTCGTATAATGTATGCTATACGAA GTTATTCATCATCACAAGCCCACAG

hCCR5 30 arm-F

ATATTTCCTGCTCCCCAGTG ATACTCGAGATAACTTCGTATAGCATACATTATACGAAGT TATCCTGGTTGACTTTTGTGTATCACGTAG

hCCR5-690R muCCR5-4697-F

CCTCTTCTTCTCATTTCG CACTACTCATTCTTTCTGGC

6.3. Materials Most materials described as reagents can be sourced from various commercial suppliers. Bespoke materials (and their final preparation) used in the methods are listed in the following against each method section number, with associated supplier. 2.1. CCR5-associated Ca2þ signaling—Ca2þ flux buffer and assay reagents: One bottle HANKS balanced salts powder (Sigma), 1.6 ml of 1 M CaCl2 (Sigma), 10 ml of 1 M HEPES, pH 8 (Sigma, cat no. H-0763), made up to 1 l with sterile water and adjusted to pH 7.4 with hydrochloric acid (HCl). Calcium Plus Kit (Molecular Devices). 2.2. Receptor internalization signaling assay—Assay buffer: RPMI (10% FBS) (RPMI, Gibco Invitrogen Corporation), RANTES and SDF-1a (R&D Systems, Becton Dickinson), FACScalibur (Cell Quest Software). Mouse antihuman CCR5 monoclonal antibodies: 2D7 (Pharmingen). Isotype control antibodies: mouse IgG2a, (Pharmingen). Secondary PE-labeled antibody: PE-labeled goat anti-mouse antibody (Sigma). Sodium citrate CPT (4-ml draw) blood tubes (Becton Dickinson). Sample processing tubes (12  75-mm polystyrene round bottomed) and caps (push fit) (Sarstedt Ltd). Reagents: MIP-1b working solution (R & D systems, 100 nM MIP-1b) aliquots stored frozen at – 70 . CCR5 stabilizing solution (600 nM maraviroc in PBS), stabilizing control solution (PBS), CCR5 MsIgG R-phycoerythrin 2D7 antiCCR5 antibody (Pharmingen) (PE-labeling by custom order).

CCR5 Primary Pharmacology Methods and Applications

51

2.4. GTP-associated CCR5 inverse agonism assay—Delfia GTPbinding kit (Perkin Elmer). Assay buffer: 50 mM HEPES, pH 7.4, containing 1 mM GDP, 10 mM MgCl2, 100 mM NaCl, and 100 mg/ ml saponin. MIP-1b (R & D Systems). Lysis buffer: 20 mM HEPES in purified water, containing 1 mM CaCl2, one tablet COMPLETETM protease inhibitors per 50-ml lysis buffer (BoehringerMannheim) adjusted to pH 7.4 (2 M HCl). 2.5. CRE-luciferase (CRE-Luc) reporter gene assay—Steady Glo Luciferase reagent (Promega). pCRE-luc, Pathdetect CRE cis reporting system (Stratagene). IBMX (Sigma). Human recombinant MIP-1b (R&D Systems). Forskolin (Sigma). 3.3. Real-time ligand binding using Biacore technology—Biacore 2000 and S51 optical biosensors, CM4 sensor chips, and the aminecoupling kit (Biacore AB). 1D4 antibody (University of British Columbia). The human chemokine receptor CCR5 is overexpressed in Cf2Th canine thymocyte cells as described previously (Mirzabekov et al., 1999); the cells are propagated by the National Cell Culture Center and contain a C-terminal linear C9 peptide tag (TETSQVAPA) that is recognized by the 1D4 monoclonal antibody (Oprian et al., 1987). Lipids (synthetic phospholipid blend [Dioleoyl] DOPC: DOPS [7:3, w/w]), Mini-Extruder kit, and polycarbonate filters (100 nm) (Avanti Polar Lipids). 3.4. HIV gp120 binding assay—pEE14.1 (Ba-L strain, Lonza Biologics). Human-soluble CD4 (Immunodiagnostics). Europium-labeled anti–HIV-1 gp120 IgG antibody (AALTO). Enhancement solution (EG&G Wallac). Wash buffer, Dulbecco’s PBS (Gibco). 4.2.1. CCR5-associated primary cell–based antiviral assays, peripheral blood lymphocytes (PBLs) and monocyte-derived macrophages (MDMs) HIV-1 replicative systems—HIV-1 isolates and strains and MT-2 cells: AIDS Reagent Project (NIBSC, Potters Bar, Herts, UK). All antiviral drug susceptibility assays are performed in RPMI 1640 medium, containing 10% v/v heat inactivated FCS, 2 mM L-glutamine, and antibiotics (1 U/ml penicillin and 0.1 mg/ml streptomycin). Phytohaemagglutinin (PHA), 1.5 mg/ml (Murex, Abbott Laboratories). Human recombinant interleukin2 (IL-2), 10 ng/ml (R&D Systems). QuanT RT kits (Amersham Pharmacia Biotech). 5. CCR5 site-directed mutagenesis and ligand docking studies— Plasmid pIRES neo (Clontech) pCRE-luc (Stratagene). Quikchange Site-Directed Mutagenesis kit (Stratagene). EcoRV (R&D Systems). QIAprep 8 Miniprep KitCat and QIAfilter Plasmid Maxi Kit (Qiagen). One ShotÒ TOP10 chemically competent cells E. coli (Invitrogen). HEK Ga15 cells (Aurora). HEK cell media: Dulbecco’s Modified Eagles Medium (DMEM) supplemented with 10% fetal calf serum, 2 mM

52

Roy Mansfield et al.

L-glutamine, sodium pyruvate, HEPES, nonessential amino acids, and blasticidin. DMEM (Dulbecco’s), with/without phenol red (Invitrogen). Blasticidin (Invitrogen R21001). OptiMEM 1 (Invitrogen). Lipofectamine reagent (Invitrogen). Plus reagent (Invitrogen). Steady Glo Luciferase reagent (Promega). pCRE-luc, Pathdetect CRE cis reporting system (Stratagene). IBMX (Sigma). 6. Non-HIV indications–associated studies, human CCR5 knock-in mice—Animals are housed in an AAALAC-accredited facility and handled according to Pfizer global research guidelines complying with the U.S. Public Health Service policy for the care and use of laboratory animals. PCR is carried out using Expand HighFidelity polymerase (Roche, Laval, QC, Canada).

REFERENCES Blanpain, C., Doranz, B. J., Bondue, A., Govaerts, C., De Leener, A., Vassart, G., Doms, R. W., Proudfoot, A., and Parmentier, M. (2003). The core domain of chemokines binds CCR5 extracellular domains while their amino terminus interacts with the transmembrane helix bundle. J. Biol. Chem. 278, 5179–5187. Epub 2002 Dec 3. Bradley, J., Gill, J., Bertelli, F., Letafat, S., Corbau, R., Hayter, P., Harrison, P., Tee, A., Keighley, W., Perros, M., Ciaramella, G., Sewing, A., et al. (2004). Development and automation of a 384-well cell fusion assay to identify inhibitors of CCR5/CD4-mediated HIV virus entry. J. Biomol. Screen 9, 516–524. Combadiere, C., Ahuja, S. K., Tiffany, H. L., and Murphy, P. M. (1996). Cloning and functional expression of CC CKR5, a human monocyte CC chemokine receptor selective for MIP-1(alpha), MIP-1(beta), and RANTES. J. Leukoc. Biol. 60, 147–152. Dobbs, S., Perros, M., and Rickett, G. A. (2001). An assay method for determining whether an agent is capable of mudlating the interaction of CCR5 with gp120. Dorr, P., and Perros, M. (2008). CCR5 inhibitors in HIV therapy. Expert Opinion for Drug Discovery 3, 1–16. Dorr, P., Corbau, R., Pickford, C., Rickett, G., Macartney, M., Griffin, P., Dobbs, S., Irvine, R., Westby, M., and Perros, M. (2003). Evaluation of the mechanism underlying the anti-HI activity of a series of experimental CCR5 antagonists. on. 43rd Annual Interscience Conference Antimicrobial Agents and Chemotherapy. Sept 14-17 2003, Poster, Chicago, F1466. Dorr, P., and Perros, M. (2008). CCR5 inhibitors in HIV therapy. Expert Opinion for Drug Discovery 3, 1345–1361. Dorr, P., Rickett, G., and Perros, M. (2003). A method for identifying CCR5 receptor antagonists by measuring residency time. Patent Ref. US20040023845 A1. Dorr, P., Todd, K., Irvine, B., Robas, N., Thomas, A., Fidock, M., Sultan, H., Mills, J., Perrucio, F., Burt, C., Rickett, G., Perkins, H., et al. (2005a). Site-Directed Mutagenesis Studies of CCR5 Reveal Differences in the Interactions between the Receptor and Various CCR5 Antagonists. In ‘‘45th Interscience Conference on Antimicrobial Agents and Chemotherapy,’’ Washington DC, USA. Dorr, P., Westby, M., Dobbs, S., Griffin, P., Irvine, B., Macartney, M., Mori, J., Rickett, G., Smith-Burchnell, C., Napier, C., Webster, R., Armour, D., et al.

CCR5 Primary Pharmacology Methods and Applications

53

(2005b). Maraviroc (UK-427,857), a potent, orally bioavailable, and selective smallmolecule inhibitor of chemokine receptor CCR5 with broad-spectrum anti-human immunodeficiency virus type 1 activity. Antimicrob. Agents Chemother. 49, 4721–4732. Dorr, P., Westby, M., McFadyen, L., Mori, J., Davis, J., Perruccio, F., Jones, R., Stupple, P., Middleton, D., and Perros, M. (2008). PF-232798, a Second Generation Oral CCR5 Antagonist. 15th Conference on Retroviruses and Opportunistic Infections, pp. 3–6. Boston. (Boston). February, 2008. Abstract 737. Dorr, P. (2008). Maraviroc outlook in HIV and non-HIV diseases. HIV-Infection and Organ Transplantation Symposium University Medical Center Hamburg-Eppendorf Hamburg, Germany. Haworth, B., Lin, H., Fidock, M., Dorr, P., and Strange, P. G. (2007). Allosteric effects of antagonists on signalling by the chemokine receptor CCR5. Biochem. Pharmacol. 74, 891–897. Epub 2007 Jun 26. Hooper, M., Hardy, K., Handyside, A., Hunter, S., and Monk, M. (1987). HPRT-deficient (Lesch-Nyhan) mouse embryos derived from germline colonization by cultured cells. Nature 326, 292–295. Jansson, C. C., Pohjanoksa, K., Lang, J., Wurster, S., Savola, J. M., and Scheinin, M. (1999). Alpha2-adrenoceptor agonists stimulate high-affinity GTPase activity in a receptor subtype-selective manner. Eur. J. Pharmacol. 374, 137–146. Kenakin, T., Jenkinson, S., and Watson, C. (2006). Determining the potency and molecular mechanism of action of insurmountable antagonists. J. Pharmacol. Exp. Ther. 319, 710–723. Epub 2006 Jul 20. Kondru, R., Zhang, J., Ji, C., Mirzadegan, T., Rotstein, D., Sankuratri, S., and Dioszegi, M. (2008). Molecular interactions of CCR5 with major classes of small-molecule anti-HIV CCR5 antagonists. Mol. Pharmacol. 73, 789–800. Epub 2007 Dec 20. Labrecque, J., Anastassov, V., Lau, G., Darkes, M., Mosi, R., and Fricker, S. P. (2005). The development of an europium-GTP assay to quantitate chemokine antagonist interactions for CXCR4 and CCR5. Assay Drug Dev. Technol. 3, 637–648. Lakso, M., Pichel, J. G., Gorman, J. R., Sauer, B., Okamoto, Y., Lee, E., Alt, F. W., and Westphal, H. (1996). Efficient in vivo manipulation of mouse genomic sequences at the zygote stage. Proc. Natl. Acad. Sci. USA 93, 5860–5865. Mirzabekov, T., Bannert, N., Farzan, M., Hofmann, W., Kolchinsky, P., Wu, L., Wyatt, R., and Sodroski, J. (1999). Enhanced expression, native purification, and characterization of CCR5, a principal HIV-1 coreceptor. J. Biol. Chem. 274, 28745–28750. Mosier, D. E., Picchio, G. R., Gulizia, R. J., Sabbe, R., Poignard, P., Picard, L., Offord, R. E., Thompson, D. A., and Wilken, J. (1999). Highly potent RANTES analogues either prevent CCR5-using human immunodeficiency virus type 1 infection in vivo or rapidly select for CXCR4-using variants. J. Virol. 73, 3544–3550. Mosley, M., Pullen, S., Botham, A., Gray, A., Napier, C., Mansfield, R., and Holbrook, M. (2006). The molecular cloning and functional expression of the dog CCR5. Vet Immunol. Immunopathol. 113, 415–420. Epub 2006 Jun 27. Mueller, A., Mahmoud, N. G., Goedecke, M. C., McKeating, J. A., and Strange, P. G. (2002). Pharmacological characterization of the chemokine receptor, CCR5. Br. J. Pharmacol. 135, 1033–1043. Mueller, A., Mahmoud, N. G., and Strange, P. G. (2006). Diverse signalling by different chemokines through the chemokine receptor CCR5. Biochem. Pharmacol. 72, 739–748. Epub 2006 Jul 17. Mueller, A., and Strange, P. G. (2004a). CCL3, acting via the chemokine receptor CCR5, leads to independent activation of Janus kinase 2 ( JAK2) and Gi proteins. FEBS Lett. 570, 126–132. Mueller, A., and Strange, P. G. (2004b). The chemokine receptor, CCR5. Int. J. Biochem. Cell. Biol. 36, 35–38.

54

Roy Mansfield et al.

Napier, C., Sale, H., Mosley, M., Rickett, G., Dorr, P., Mansfield, R., and Holbrook, M. (2005). Molecular cloning and radioligand binding characterization of the chemokine receptor CCR5 from rhesus macaque and human. Biochem. Pharmacol. 71, 163–172. Epub 2005 Nov. 18. Navratilova, I., Dioszegi, M., and Myszka, D. G. (2006). Analyzing ligand and small molecule binding activity of solubilized GPCRs using biosensor technology. Anal. Biochem. 355, 132–139. Epub 2006 May 15. Oprian, D. D., Molday, R. S., Kaufman, R. J., and Khorana, H. G. (1987). Expression of a synthetic bovine rhodopsin gene in monkey kidney cells. Proc. Natl. Acad. Sci. USA 84, 8874–8878. Palczewski, K., Kumasaka, T., Hori, T., Behnke, C. A., Motoshima, H., Fox, B. A., Le Trong, I., Teller, D. C., Okada, T., Stenkamp, R. E., Yamamoto, M., and Miyano, M. (2000). Crystal structure of rhodopsin: A G. protein-coupled receptor. Science 289, 739–745. Peltonen, J. M., Pihlavisto, M., and Scheinin, M. (1998). Subtype-Specific Stimulation of [S-35]Gtp-Gamma-S Binding by Recombinant Alpha(2)-Adrenoceptors. European Journal of Pharmacology 355, 275–279. Petropoulos, C. J., Parkin, N. T., Limoli, K. L., Lie, Y. S., Wrin, T., Huang, W., Tian, H., Smith, D., Winslow, G. A., Capon, D. J., and Whitcomb, J. M. (2000). A novel phenotypic drug susceptibility assay for human immunodeficiency virus type 1. Antimicrob. Agents Chemother. 44, 920–928. Rickett, G., Dobbs, S., Griffin, P., Dorr, P., Hitchcock, C., and Perros, M. (2003). Development of a high throughput time resolved immunoassay to support discovery of HIV-1 entry inhibitors. 43rd Annual Interscience Conference on Antimicrobial Agents and Chemotherapy, Abstract F-1461. Sauer, B., and Henderson, N. (1988). Site-specific DNA recombination in mammalian cells by the Cre recombinase of bacteriophage P1. Proc. Natl. Acad. Sci. USA 85, 5166–5170. Strizki, J. M., Tremblay, C., Xu, S., Wojcik, L., Wagner, N., Gonsiorek, W., Hipkin, R. W., Chou, C. C., Pugliese-Sivo, C., Xiao, Y., Tagat, J. R., Cox, K., et al. (2005). Discovery and characterization of vicriviroc (SCH 417690), a CCR5 antagonist with potent activity against human immunodeficiency virus type 1. Antimicrob. Agents Chemother. 49, 4911–4919. Strizki, J. M., Xu, S., Wagner, N. E., Wojcik, L., Liu, J., Hou, Y., Endres, M., Palani, A., Shapiro, S., Clader, J. W., Greenlee, W. J., Tagat, J. R., et al. (2001). SCH-C (SCH 351125), an orally bioavailable, small molecule antagonist of the chemokine receptor CCR5, is a potent inhibitor of HIV-1 infection in vitro and in vivo. Proc. Natl. Acad. Sci. USA 98(22), pp. 12718–12723. Tagat, J. R., McCombie, S. W., Nazareno, D., Labroli, M. A., Xiao, Y., Steensma, R. W., Strizki, J. M., Baroudy, B. M., Cox, K., Lachowicz, J., Varty, G., and Watkins, R. (2004). Piperazine-based CCR5 antagonists as HIV-1 inhibitors. IV. Discovery of 1-[(4,6-dimethyl-5-pyrimidinyl)carbonyl]-4-[4-[2-methoxy-1(R)-4-(trifluoromethyl) phenyl]ethyl-3(S)-methyl-1-piperaz inyl]-4-methylpiperidine (Sch-417690/Sch-D), a potent, highly selective, and orally bioavailable CCR5 antagonist. J. Med. Chem. 47, 2405–2408. Tsamis, F., Gavrilov, S., Kajumo, F., Seibert, C., Kuhmann, S., Ketas, T., Trkola, A., Palani, A., Clader, J. W., Tagat, J. R., McCombie, S., Baroudy, B., et al. (2003a). Analysis of the mechanism by which the small-molecule CCR5 antagonists SCH351125 and SCH-350581 inhibit human immunodeficiency virus type 1 entry. J. Virol. 77, 5201–5208. Tsamis, F., Gavrilov, S., Kajumo, F., Seibert, C., Kuhmann, S., Ketas, T., Trkola, A., Palani, A., Clader, J. W., Tagat, J. R., McCombie, S., Baroudy, B., et al. (2003b). Analysis of the mechanism by which the small-molecule CCR5 antagonists SCH-

CCR5 Primary Pharmacology Methods and Applications

55

351125 and SCH-350581 inhibit human immunodeficiency virus type 1 entry. J. Virol. 77, 5201–5208. Turner, J. E., Steinmetz, O. M., Stahl, R. A., and Panzer, U. (2007). Targeting of Th1-associated chemokine receptors CXCR3 and CCR5 as therapeutic strategy for inflammatory diseases. Mini Rev. Med. Chem. 7, 1089–1096. Watson, C., Jenkinson, S., Kazmierski, W., and Kenakin, T. (2005a). The CCR5 receptorbased mechanism of action of 873140, a potent allosteric noncompetitive HIV entry inhibitor. Mol. Pharmacol. 67, 1268–1282. Watson, C., Jenkinson, S., Kazmierski, W., and Kenakin, T. (2005b). The CCR5 receptorbased mechanism of action of 873140, a potent allosteric noncompetitive HIV entry inhibitor. Mol. Pharmacol. 67, 1268–1282. Epub 2005 Jan. 11. Wells, T. N., Power, C. A., Shaw, J. P., and Proudfoot, A. E. (2006). Chemokine blockers-therapeutics in the making? Trends Pharmacol. Sci. 27, 41–47. Epub 2005 Nov. 28. Westby, M., Smith-Burchnell, C., Hamilton, D., Robas, N., Irvine, B., Fidock, M., Mills, J., Perruccio, F., Mori, J., Macartney, M., Barber, C., Dorr, P., et al. (2005). UK-427,857resistant Primary Isolates are Susceptible to Structurally-related CCR5 Antagonists. In ‘‘12th Conference on Retroviruses and Opportunistic Infections,’’ Boston, MA. Westby, M., Smith-Burchnell, C., Mori, J., Lewis, M., Mosley, M., Stockdale, M., Dorr, P., Ciaramella, G., and Perros, M. (2007). Reduced maximal inhibition in phenotypic susceptibility assays indicates that viral strains resistant to the CCR5 antagonist maraviroc utilize inhibitor-bound receptor for entry. J. Virol. 81, 2359–2371. Westby, M., Smith-Burchnell, C., Mori, J., Lewis, M., Whitcomb, J., Petropoulos, C., and Perros, M. (2004). In vitro Escape of R5 Primary Isolates from the CCR5 Antagonist, UK-427,857, is Difficult to Achieve and Involves Continued Use of the CCR5 Receptor. In ‘‘XIII International HIV Drug Resistance Workshop,’’ Tenerife.