Characterisation and differential expression during development of a duplicate Disabled-1 (Dab1) gene from zebrafish

Comparative Biochemistry and Physiology, Part B 155 (2010) 217–229

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part B j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / c b p b

Characterisation and differential expression during development of a duplicate Disabled-1 (Dab1) gene from zebrafish M. Javier Herrero-Turrión a, Almudena Velasco a,b, Rosario Arevalo a,b, José Aijón a,b, Juan M. Lara a,b,⁎ a b

Institute of Neuroscience of “Castilla y León” (INCYL), University of Salamanca, Spain Department of Cellular Biology and Pathology, University of Salamanca, Spain

a r t i c l e

i n f o

Article history: Received 16 April 2009 Received in revised form 4 November 2009 Accepted 8 November 2009 Available online 29 November 2009 Keywords: Alternative splicing Disabled 1 (Dab1) Duplication Gene expression In silico Phylogeny Teleosts Zebrafish (Danio rerio)

a b s t r a c t We identified a new duplicated Dab1 gene (drDab1b) spanning around 25 kb of genomic DNA in zebrafish. Located in zebrafish chromosome 2, it is composed of 11 encoding exons and shows high sequence similarity to other Dab1 genes, including drDab1a, a zebrafish Dab1 gene previously characterised. drDab1b encodes by alternative splicing at least five different isoforms. Both drDab1a and drDab1b show differential gene expression levels in distinct adult tissues and during development. drDab1b is expressed in peripheral tissues (gills, heart, intestine, muscle), the immune system (blood, liver) and the central nervous system (CNS), whereas drDab1a is only expressed in gills, muscle and the CNS, suggesting a division of functions for two Dab1 genes in zebrafish adult tissues. RT-PCR analysis also reveals that both drDab1 genes show distinct developmental-specific expression patterns throughout development. drDab1b expression was higher than that of drDab1a, suggesting a major role of drDab1b in comparison with drDab1a during development and in different adult tissues. In addition, new putative Dab1 (a and/or b) from different teleost species were identified in silico and predicted protein products are compared with the previously characterised Dab1, demonstrating that the Dab1b group is more ancestral than their paralogue, the Dab1a group. © 2009 Elsevier Inc. All rights reserved.

1. Introduction The Reelin-Disabled 1 (Dab1)-signalling pathway is involved in the development of the brain and in adult brain function, in the positioning of migrating neurons of different brain areas and spinal cord, synaptic connectivity, axonal pathfinding, synaptogenesis, dendritic arborisation, and neuronal plasticity, which also suggests a role in neurodegeneration (Rice and Curran, 2001; Tissir and Goffinet, 2003; Stolt and Bock, 2006; Yang et al., 2006; Katyal et al., 2007). The Reelin pathway is mediated by the binding of Dab1, the homologue of Drosophila Disabled 1, which is a nucleocytoplasmic shuttling protein (Honda and Nakajima, 2006), to Asn-Pro-X-Tyr (NPxY) motifs located in the cytoplasmic tails of lipoprotein receptors and to a Tyr-Glu-AsnPro-Thr-Tyr (YENPTY) motif located in the cytoplasmic domain of

Abbreviations: ApoER2, apolipoprotein E receptor 2; APP, amyloid precursor protein; bp, base pairs; cDNA, complementary DNA; CNS, central nervous system; C-terminal, carboxyl-terminus; Dab, Disabled; hpf, hours post fertilisation; kb, kilobase; kDa, kilodalton; LDLR, low-density lipoprotein receptor; MS-222, tricaine methanesulfonate; NJ, neighbourjoining; N-terminal, amino-terminus; ORF, open reading frame; PCR, polymerase chain reaction; PTB domain, phosphotyrosine binding domain; RT-PCR, reverse transcriptasepolymerase chain reaction; Tyr, tyrosine; UTR, untranslated region; VLDLR, very low density lipoprotein receptor. ⁎ Corresponding author. Institute of Neuroscience of “Castilla y León” (INCYL), C/ Pintor Fernando Gallego No. 1, Salamanca 37007, Spain. Tel.: +34 923 294500x5323; fax: +34 923 294750. E-mail addresses: [email protected], [email protected] (J.M. Lara). 1096-4959/$ – see front matter © 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.cbpb.2009.11.003

amyloid precursor protein (APP) family members (Trommsdorff et al, 1998, 1999; Howell et al., 1999b; Hoe et al., 2006; Pramatarova et al., 2008). Reelin is a glycoprotein, mainly expressed in the Central Nervous System (CNS). It mainly binds to the very low density lipoprotein receptor (VLDLR) and apolipoprotein E receptor 2 (ApoER2), resulting in receptor clustering and membrane recruitment of Dab1, which is activated (Herz and Chen, 2006; Stolt and Bock, 2006). Binding of Reelin to its receptors induces Dab1 tyrosine phosphorylation and stimulates the activation of the Src family tyrosine kinases (Src, Fyn and Yes) at the membrane. Furthermore, Dab1 has only been characterised in non-mammalians in zebrafish (Costagli et al., 2006). The prototypical form of Dab1 in tetrapods has an open reading frame (ORF) of around 555 amino acids encoding an 80 kDa protein and consists of an N-terminal domain, the phosphotyrosine binding (PTB) domain, which associates with Reelin receptors, an internal domain containing a cluster of five Reelindependent potential tyrosine phosphorylation sites and a C-terminal domain implicated in the modulation of Reelin-Dab1 signalling (Stolt and Bock, 2006). The genomic organisations of Dab1 genes identified up to now in human and mouse (Bar et al., 2003) and a first Dab1 gene from zebrafish (Costagli et al., 2006) have a high complexity with several alternatively spliced exons. As a result they are translated in different Dab1 isoforms that present developmental- and tissue-specific expression patterns, suggesting different roles in embryogenesis and organogenesis. Thus,

218

M.J. Herrero-Turrión et al. / Comparative Biochemistry and Physiology, Part B 155 (2010) 217–229

the differential expressions of some Dab1 isoforms have been detected in the developing CNS of mouse (Howell et al., 1997a,b), chicken (Katyal and Godbout, 2004) and zebrafish (Costagli et al., 2006). In an attempt to shed light on the biological role of Dab1 and to investigate its phylogeny more widely, we have firstly identified a second Dab1 gene, drDab1b, from zebrafish (Danio rerio). This fish is widely used as a study model for developmental biology and evolutionary genetics (Amsterdam and Hopkins, 2006). Here we present the sequence and genomic structure of this duplicate drDab1 gene. Using RT-PCR techniques, we also analyse the expression levels of both drDab1 genes in different tissues of adult zebrafish and during development. Finally, using searches based on the conservation of nucleotide and amino acid sequences, we have identified, in silico, putative Dab1 (a and/or b) of different teleost species demonstrating that the duplicate genes, Dab1a and Dab1b, have been conserved during vertebrate evolution and may represent a new model for studying Reelin-Dab1 pathways. 2. Materials and methods 2.1. Animals We used embryos and adult specimens of both sexes of cyprinid teleost, zebrafish (Danio rerio), obtained from the Animal Experimentation Service of the University of Salamanca. All procedures and experimental protocols were in accordance with the guidelines of the European Communities Directive (86/609/EEC and 2003/65/EC). The animals were kept in aquaria at an appropriate temperature (25–28 °C), with 12 h light/12 h dark periods of light cycle and fed once a day. The fish, previously anaesthetised with 150 mg/L tricaine methanesulfonate (MS-222, Sigma-Aldrich), were sacrificed by rapid cervical transection. 2.2. Isolation of RNA, RT-PCR and expression analysis Various adult tissues (brain, retina, pituitary gland, gills, intestine, heart, muscle, liver and blood) and whole embryos of distinct developmental stages [0.5, 1.5, 4, 7.5, 14, 20, 30, 40, 70, 95 and 120 hours post fertilisation (hpf)] of zebrafish were homogenised with a Brinkmann PolytronTM. The total RNA was extracted from each unfixed frozen adult tissue or a pool of whole embryos of one determined developmental stage and purified according to the acid-guanidinium phenol chloroform method (TRIZOL Reagent; Gibco-BRL) (Chomczynski and Sacchi, 1987). The quantification of RNA was carried out using a NanoPhotometer (Implen GmbH). RNA quality was assessed on an RNA 6000 NanoLabChip (Agilent Technologies), using an Agilent 2100 Bioanalyzer to assess the integrity of the 18S and 28S rRNA bands. Total RNA (2 µg), primed with oligo-dT, was reverse-transcribed into cDNA at 37 °C for 2 h using the first-strand cDNA synthesis kit (ImProm-II Reverse-Transcriptase System; Promega), according to the manufacturer's instructions in a 20 µL volume and stored at −20 °C until use. Then, we used a 25 µL PCR mixture which contained 250 ng of cDNA template, 20 pmol of each primer (Table 1), 0.2 mM dNTPs, 1.5 mM MgCl2 and 5 units of GoTaq Flexi DNA polymerase (Promega). The primers were designed on the basis of the nucleotide sequences of Dab1 genes known for distinct vertebrate species, with the help of Oligo 4.05 Primer Analysis Software (National Biosciences). In order to distinguish the differential expression of both genes in the gene expression studies, we used the pairs of primers H & I and B & D (Table 1). PCR amplifications were as follows: 1 cycle at 95 °C for 5 min as an initial denaturation step, denaturation at 95 °C for 30 s, annealing at 56–62 °C for 30 s and extension at 72 °C for 45 s (35 cycles), followed by further incubation for 10 min at 72 °C (1 cycle). The PCR products were electrophoresed on 2% agarose gels in 1× 40 mM Tris-acetate, 1 mM ethylenediamine tetraacetic acid pH 8.0 and visualised by ethidium bromide staining. The amplification

Table 1 PCR primers used for molecular characterisation of drDab1b and gene expression studies of both drDab1 genes. Primer location in the corresponding GenBank sequences of zebrafish origin is indicated. Symbol Name

Sequence

Primer type

A B C D E F G H I

GAAGCAGCTCCATGATACGG AGCCATGCAGCAGCGCCA GAYTCCATGATGAAGCTSAAGGG ACAAATCGTCGTCTCCTTCC CGGGTGGACTAAAATGCGTG CTGATGTCGACGGCTCTGTAG TGAGCCTGGGTTGACTAGTT GGCTCAGTCTGCTGAGCGG GGGTCTGGTGGGCCAGCAA

Forward Forward Forward Reverse Reverse Reverse Reverse Forward Reverse

drDab1_b–for5 exon 2 drDab1_b-e6–for drDab1_a/b–for4 exon 3 drDab1_b-e11–rev drDab1_b-rev5 exon 11 drDab1_b-rev6 exon 12 drDab1_b-e12–rev drDab1_a-e6–for drDab1_a-e11–rev

of zebrafish β-actin (GenBank accession no. NM_131031) was used as an internal and loading control. Moreover, an RNA free (negative) control sample was used which did not produce any amplified bands. RT-PCR was performed with two independently isolated RNA samples and the PCRs were repeated three times. The relative abundance of each transcript was calculated by quantifying the intensity of each DNA band by ImageJ 1.42 software (http://rsb.info.nih.gov/ij/). The results are expressed as mean ± standard error of the mean (SEM). Student's t-test statistical analyses were done using Prism software (GraphPad). 2.3. Cloning, sequencing and sequence analysis Some PCR products were extracted and purified from the gel using a QIAquick Gel Extraction Kit. (Qiagen), or ligated in pGEM®-T Easy Vector (Promega) following the manufacturer's indications. The supercompetent TG1 strain of Escherichia coli was transformed by the calcium chloride method and cells were selected on TYE/ampicillin/IPTG/X-Gal plates. Plasmid DNA was extracted after culture growth, and colonies containing appropriate-sized inserts were screened by EcoRI (Promega) enzymatic digestion. The PCR product (50–150 ng) or plasmid DNA (400–600 ng) together with 3 pmol primer sequenced [specific primer of Dab1 (see Table 1), or SP6 or universal primer (Promega)] were used for sequencing reactions which were performed in a 3100 Genetic Analyzer (Applied Biosystems). Similarly, DNA sequencing was performed on both strands from at least 2 independent cDNA clones. DNA sequences were analysed with Chromas 2.3® (School of Health Science, Griffith University, Australia) software and compared with other nucleotide and/or protein sequence databases using the FASTA and BLAST programmes from the European Molecular Biology Laboratory (EMBL; http://www.ebi.ac.uk/embl/) and from the National Center for Biotechnology Information (NCBI; http://www.ncbi.nlm.nih.gov). The distinct DNA sequences were aligned with the ClustalW programme using default parameters (Thompson et al., 1994). 2.4. Databases, identification of new Dab1 in teleosts and phylogenetic analysis Dab1 sequences (genomics, cDNAs and proteins) from teleost species were retrieved from the Ensembl site (http://www.ensembl. org) as recently described by Herrero-Turrion and Rodríguez (2008). Briefly, we were able to analyse the new Dab1 of the following teleosts: Tetraodon nigroviridis (black pufferfish), Takifugu rubripes (Japanese pufferfish), Oryzias latipes (Japanese medaka) and Gasterosteus aculeatus (three-spined stickleback), using the queries Dab1a and/or Dab1b sequences (nucleotide sequences at the level of each of the exons present and cDNAs) of zebrafish. These nucleotide sequences were used with different BLAST algorithms (mainly tBLASTn or BLASTx) from the NCBI to determine the possible existence of hitherto undescribed Dab1 in teleosts. The predicted sequences for the new

M.J. Herrero-Turrión et al. / Comparative Biochemistry and Physiology, Part B 155 (2010) 217–229

219

Fig. 1. Nucleotide and predicted amino acid sequences of zebrafish Dab1b, drDab1b. Nucleotides are numbered in the 5′ to 3′ direction and the amino acids are shown in single-letter code above the nucleotide sequence. The PTB domain is underlined. Indicated in boxes are the main regions that can be splicing alternatives (exons 8 and 9) to obtain four different Dab1b isoforms: drDab1b_tv1 (lacks this region), drDab1b_tv2 (contains this entire region), drDab1b_tv3 (lacks exon 8) and drDab1b_tv4 (lacks exon 9). Note drDab1b_tv5 partially lacks three exons (6–8). Predicted Ser (*), Thr (¶) and Tyr (Δ) phosphorylation sites (16/11/8) were located in the deduced complete amino acid sequence. The nucleotide sequence marked in grey indicates the exon–intron boundaries. The oligonucleotide sequences used as primers have been italicised and are denominated in the 5′ to 3′ direction as: A, C, J, D, E, F and G (see also Table 1).

Dab1a and/or Dab1b, determined in silico, were identified considering their sequence similarity to drDab1a or drDab1b genes using a higher cut-off E-value (E = 1e-12) and a higher sequence length (65% of query over subject) and their sequences were edited manually according to their similarity to homologous Dab1 genes in vertebrates and to the available data. In particular, the sequences found were verified as Dab1a or Dab1b by BLAST searches in the nucleotide database. A sequence was considered a true Dab1a or Dab1b if it had a

known Dab1a or Dab1b as the best hit and had an E-value significantly better than best non-Dab or non-Dab2 in the nucleotide database. A crude phylogenetic analysis containing a representative set of Dab, Dab1 and Dab2 proteins was used as a second step to verify the Dab1 nature of the novel sequences. Using the ClustalW programme with default parameters (Thompson et al., 1994) we aligned nucleotide and/or amino acid sequences from Dab1 orthologues of different vertebrate species. The alignments in ClustalW_pir format

Fig. 2. Alignment of Dab1 proteins of several species. Alignment produced with the ClustalW programme of deduced complete amino acid sequences for Dab1 identified in zebrafish species (drDab1a_tv2 and drDab1b_tv2, which are the prototypical Dab1 proteins, GenBank accession no. NP_001035775 and EF028079, respectively) and its homologues identified in other vertebrates, such as human–Homo sapiens-(hsDab1-555, AAC70068), rat–Rattus norvegicus-(rnDab1-555, BAC20288.1), mouse–Mus musculus-(mmDab1-555, CAM26762.1), chicken–Gallus gallus-(ggDab1-L, AAP70754.1) and western clawed frog–Xenopus tropicalis-(xtDab1, AAI55685). The PTB domain is underlined. Indicated in boxes are the main regions that can be splicing alternatives (exons 8 and 9). Dots indicate amino acid residues identical to those of zebrafish Dab1b, dashes indicate sequence gaps.

220 M.J. Herrero-Turrión et al. / Comparative Biochemistry and Physiology, Part B 155 (2010) 217–229

M.J. Herrero-Turrión et al. / Comparative Biochemistry and Physiology, Part B 155 (2010) 217–229

221

Fig. 3. Genomic organisation and transcription of zebrafish Dab1a and Dab1b genes. Exons and introns are represented by boxes and solid bars. Exons are numbered (1–15) on top of each box. Encoding exons and the non-coding (untranslated) regions are represented by black and white, respectively. Encoding exons of the PTB domain and five tyrosine phosphorylation sites are underlined (exons 3–6) and marked with arrows in each chromosomic locus. The number of amino acids encoded by each transcript is shown. The exon– intron boundaries are indicated by arrows in each of two groups of transcripts drDab1a and drDab1b and the numbers above the arrows describe the position in the codon at which the coding sequence is separated by an intron (0, at the codon junction; 1 and 2, after the first codon and the second codon position, respectively). Broken lines indicate the corresponding exons of the drDab1a and drDab1b genes. Chromosome locations of drDab1a and drDab1b genes are indicated in parentheses. Letters below the exons stand for primers used in gene cloning from Table 1.

obtained using the Molecular Evolutionary Genetics Analysis (MEGA) version 4.0.2 (Tamura et al., 2007) were then used to construct a neighbour-joining (NJ) tree (Saitou and Nei, 1987) analysing the parameters p-distance (calculating the proportion of amino acid differences), complete deletion and considering a bootstrap value of 1000 replicates. 3. Results 3.1. Molecular characterisation of drDab1b A putative Dab1 gene (drDab1a, GenBank accession no. NP_001035775) was previously identified in teleost zebrafish (Costagli et al., 2006). We have identified a second Dab1 gene of zebrafish, drDab1b (EF028079), by bio-informatic analysis and RT-PCR studies of extracts of RNA of CNS, using a combination of primers (Table 1) based on known nucleotide sequences of Dab1 of zebrafish [drDab1a; (Costagli et al., 2006] and other species, such as human and mouse (Bar et al., 2003) and chicken (Katyal and Godbout, 2004). Using the BLASTn programme we analysed the chromosome location of both Dab1 genes, drDab1b and drDab1a, from zebrafish aligning both drDab1 sequences versus the zebrafish genome (Zv7, Apr 2007). drDab1b and drDab1a were identified in chromosomes 2 and 5 of zebrafish, respectively. The molecular characterisation of the nucleotide sequences of new drDab1b genomic loci and their corresponding transcript(s) led to a prediction of at least a cDNA-drDab1b of 1565 bp (Fig. 1). The assembly of this cDNA consists of at least a 42 bp 5′-untranslated region (UTR), a coding sequence of 1446 bp and at least a 77 bp 3′UTR.

The ORF encodes a sequence of 482 amino acids with a deduced molecular mass of 53.549 kDa that corresponds approximately to the predicted length of other Dab1 proteins (469–588 amino acids). The cDNA-drDab1b showed close identity with four clones of zebrafish chromosome 2 (CR848026.12, NM_001135042, NM_001040386, NW_001878763). Our sequence showed 91% and 95% nucleotide and predicted amino acid identity, respectively, with the longest clone, NM_001135042. In particular, exon 2 of drDab1b is slightly longer than the clones mentioned and it has twenty-seven nucleotide insertions (and nine amino acid insertions). Surprisingly, in contrast to known clones of chromosome 2, exon 12 of our drDab1b sequence is slightly modified in the 3′ end, including a stop codon. Like all Dab1 proteins reported in different species up to now (Bar et al., 2003; Katyal and Godbout, 2004; Costagli et al., 2006), drDab1b contains five important potential tyrosine phosphorylation sites (Tyr194, Tyr207, Tyr209, Tyr229, Tyr241) and an N-terminal region contains a putative PTB domain (Fig. 1). In addition, predicted Ser and Thr phosphorylation sites (16/11), one potential N-glycosylation site (Asn-Xaa-Ser/Thr; 251–253) and seventeen potential O-glycosylation sites (Thr-Xaa-Ser) were found in the deduced amino acid sequence. No potential N-myristoylation or prenylation sites were detected. We have also used the ClustalW alignment programme to compare the new Dab1 sequence from zebrafish (drDab1b) with the drDab1a sequence and other Dab1 sequences (Fig. 2) published for other vertebrate species. Specifically, the nucleotide and amino acid sequences of drDab1b showed around 40 and 55% identity, respectively, with drDab1a. In addition, the primary sequence of drDab1b protein showed around 45% identity with the mammals and 50%

222

M.J. Herrero-Turrión et al. / Comparative Biochemistry and Physiology, Part B 155 (2010) 217–229

Table 2 Exon–intron junctions in the zebrafish drDab1b gene. Exon and intron sequences are in upper and lowercase letters, respectively. Start and stop codons are labelled in bold. The gene contains the typical gt and ag at the 5′ splice site (donor site) and 3′ splice site (acceptor site) for RNA splicing required for intron removal. In contrast to the drDab1a gene, we cannot identify an orthologue exon 1 of drDab1a for drDab1b upstream of exon 2. Nevertheless, we have preferred to maintain the same numbering for both drDab1 genes for a better comparison between them, therefore, drDab1b exons are numbered from 2 to 12. Sizes in bp of introns and exons are indicated. Exon no.

Nucleotide sequence around exon–intron boundaries of drDab1_b gene

Nucleotide position in the cDNA sequence

Exon size

Intron size

2 3 4 5 6 7 8 9 10 11 12

GAAGCA…ATG_TGACCGgtaata gtttagGTCAGG…CTGAAGgtaaac ctccagGGAATC…TCAGGGgtaaga cctcagGTCTTA…CATGCAgtaagt atttagGCAGCG…TATCAGgtaaga gcacagACTATT…TATCAGgtgagt ttgtagTACATT…TTACCAGgtactt tttctagGTCCCC…ATGGCTgtaggt ttgcagAATATT…CTTTCTgtaagt tcacagATGCCC…CCACAGgtatcc cctcagGTTATA…TGA...GGCTCA

1–136 (43-CDS) 137–276 277–375 376–507 508–627 628–666 667–732 733–792 793–849 850–949 950–1565 (−1491 CDS)

136 140 99 132 120 39 66 60 57 100 629

5002 2469 1579 1492 716 2418 884 2971 319 1561

identity with chicken Dab1. These data demonstrate that our drDab1b sequence is an orthologue of Dab1. 3.2. Genomic structure of drDab1b and alternative splicing isoforms The gene structure of drDab1b, which presents some differences with respect to its homologue drDab1a (Costagli et al., 2006), was determined by database searching and PCR approaches. The drDab1b gene was mapped in zebrafish chromosome 2, spanning 25,204 bp. As shown in Fig. 3, the drDab1b gene consisted of 11 encoding exons [exon 12 is partially not translated (3′UTRs)] with 10 introns of various lengths, whereas the drDab1a gene presented 15 exons with 14 introns. Table 2 shows the distinct exon and intron compositions as well as the exon–intron junctions of the drDab1b gene. Although we could not identify an orthologue exon 1 of drDab1a in drDab1b upstream of exon 2, we have preferred to maintain the same numbering for both drDab1 genes for a better comparison (Fig. 3). In both genes, the PTB domain was encoded by exons 4–5 and partially by exons 3 and 6. As shown in Fig. 1, exon 2 of drDab1b encodes the initial 31 amino acids and the first nucleotide of the 32nd amino acid, in contrast to other vertebrate Dab1 genes known up to now, which only encode the initial 23 amino acids and the first nucleotide of the 24th amino acid. In drDab1b, exon 3 encodes the following 46 amino acids and the last two nucleotides of the 32nd amino acid. Exons 4, 5, 6, 7, 8, 9 and 10 encode 33, 44, 40, 13, 22, 20 and 19 amino acids, respectively. Exon 11 encodes 33 amino acids and the first nucleotide of the 303rd amino acid and exon 12 encodes the last 179 amino acids and the last two nucleotides of the 303rd amino acid (Fig. 1). In contrast to drDab1a, in which at least four isoforms have been identified (Costagli et al., 2006), using RT-PCR assays we have identified at least five drDab1b transcripts: drDab1b_tv1, drDab1b_tv2 (DQ883567, EF028079, respectively), drDab1b_tv3, drDab1b_tv4 and drDab1b_tv5; with 1596, 1722, 1656, 1622 and 1497 bp, with ORFs encoding sequences of 440, 482, 460, 462 and 407 amino acids and with deduced molecular masses of 51.302, 51.01, 48.763 and 44.746 kDa, respectively (Figs. 1 and 3). Exons 8 and 9 are usually skipped by alternative splicing at the mRNA level to produce the

following isoforms: drDab1b_tv2 (containing both exons 8–9), drDab1b_tv3 and drDab1b_tv4, which lack exons 8 and 9, respectively. On the other hand, both exons are skipped by alternative splicing in the drDab1b_tv1 isoform and the drDab1b_tv5 isoform lacks exons 6, 7 and 8. Other isoforms similar to human/mouse Dab1, differing from prototypical Dab1-555 protein, such as mouse Dab1-217*, Dab1-271* and Dab1-555* isoforms (Bar et al., 2003), do not seem to be present in either drDab1a (Costagli et al., 2006) or drDab1b in zebrafish. Using sequences encoding for Dab1 sequences 217*, 271* and 555* as queries in in silico assays, shows that both zebrafish Dab1 genes probably lack specific encoding exons of these similar isoforms, which are located between exons 7–8 and exons 9–10 in the mouse Dab1 gene that encodes the isoforms 217* and 271*, respectively (Bar et al., 2003).

3.3. Dab1b expression in zebrafish Because drDab1a and drDab1b show a high degree of homology, the next objective was to investigate whether these genes could be differentially expressed both in adult tissues and developmental stages. We designed two pairs of specific primers (forward and reverse) at the boundaries of exons 5–6 and in exon 11, which are amplified through the zone rich in tyrosines, to study, using RT-PCR experiments, the different gene expression levels of distinct drDab1 isoforms (Table 1: primers H & I and B & D; Figs. 3–5). As shown in Fig. 4, we found that all tissues of adult zebrafish studied in this work (retina, pituitary gland, gills, heart, intestine, muscle, blood, liver and brain) express, at different levels, at least the drDab1b_tv2. Specifically, the highest gene expression levels of this isoform are detected in retina, gills, intestine, muscle, liver and brain. Furthermore, we identified significant expression levels of one and/or two more transcripts (drDab1b_tv3 and/or drDab1b_tv4) in tissues of the CNS (retina, pituitary and brain), gills and heart. In particular, the highest gene expression levels of these isoforms are found in the retina and heart. Moreover, Dab1b_tv1 presents low expression levels in CNS (retina, pituitary and brain), gills and heart. It is noteworthy that the lowest isoform identified of drDab1b, drDab1b_tv5, was highly expressed in muscle and gills and presented a relatively lower expression level in liver. On the other hand, we detected high expression of drDab1a_tv2 in retina, gills and brain (Fig. 4), whereas Dab1b_tv1 was uniquely detected in brain. Subsequent cloning and sequencing of some amplicons confirmed the drDab1 isoforms mentioned. Regarding the developmental profiles of different isoforms of both Dab1 genes expressed in zebrafish, we found that both genes are expressed using different alternative splice isoforms throughout development, including maternally (Fig. 5). In the case of drDab1b, we found that drDab1b_tv2 and drDab1b_tv5 are highly expressed during all embryonic developmental stages. In particular, these isoforms are down-regulated at the end of the embryonic stage and then their expression levels decrease or disappear at the moment of hatching. In contrast, other isoforms, such as drDab1b_tv3 and/or drDab1b_tv4, are up-regulated from hatching (70 hpf) until after 1–2 days posthatching (= 4–5 days post fertilisation; 95–120 hpf). Finally, drDab1b_tv1 presents moderate gene expression levels and is transiently expressed throughout the embryonic stages until hatching. On the other hand, the transcripts drDab1a_tv1 and drDab1a_tv4 are expressed during all developmental stages and embryonic development, respectively, whereas the drDab1a_tv2 is transiently expressed

Fig. 4. Differential expression of drDab1b and drDab1a in adult zebrafish tissues. The expression of drDab1b and drDab1a was assessed by RT-PCR. Pairs of primers used for amplifying part of the transcripts drDab1a and drDab1b were H & I, and B & D, respectively (see Table 1 and Fig. 3). The size of each PCR fragment and the specific isoform of each of the zebrafish Dab1 genes/transcripts are shown. Amplification of zebrafish β-actin was used as an internal control and its expression is constantly statistically significant in all stages analysed, as expected for a housekeeping gene. PCR product amounts are calculated as corresponding band intensity (mean grey value) using ImageJ 1.42 software (http://rsb.info. nih.gov/ij). Each bar represents the mean of expression levels of the studied gene/transcript at each developmental stage ± SEM. For each stage the number of the experiments represented in this graph was between 3 and 5.

M.J. Herrero-Turrión et al. / Comparative Biochemistry and Physiology, Part B 155 (2010) 217–229

223

224

M.J. Herrero-Turrión et al. / Comparative Biochemistry and Physiology, Part B 155 (2010) 217–229

M.J. Herrero-Turrión et al. / Comparative Biochemistry and Physiology, Part B 155 (2010) 217–229

during development in the following stages: zygote (0.5 hpf), blastula (4 hpf), later segmentation (20 hpf), pharyngula (30 hpf), hatching (70 hpf) and post-hatching (95–120 hpf) (Fig. 5). The study of the gene expression of zebrafish β-actin (NM_131031) was used as an internal and loading control, showing a similar statistically significant expression pattern in all adult tissues and developmental stages used (Figs. 4 and 5).

4. Discussion 4.1. Comparison of drDab1b with drDab1a and other Dab1 proteins We have identified a second zebrafish Dab1 gene (drDab1b) and compared its structure with the first Dab1 gene (drDab1a) previously identified in zebrafish (Costagli et al., 2006). In general, the degree of homology is not uniform along the amino acid sequence, because, as shown in Fig. 6, the N-terminal and C-terminal regions are longer and shorter, respectively, in drDab1b than in drDab1a and the number and location of potential Tyr, Ser and Thr phosphorylation sites are also different. All these potential phosphorylation sites can be involved in distinct functions, some of which might be phosphorylated by the Cyclin-dependent kinase 5 in a Reelin-independent manner (Keshvara et al., 2002), Fyn tyrosine kinases and other Ser/Thr kinases. In particular, it is known that the cluster of phosphorylation tyrosine residues of Dab1 proteins is phosphorylated in response to the binding of Reelin to lipoprotein receptors (Herz and Chen, 2006; Stolt and Bock, 2006) and also it performs other specific associated functions (Howell et al., 1999a; Keshvara et al., 2001; Magdaleno et al., 2002; Katyal et al., 2007; Feng and Cooper, 2009). The phosphorylation of multiple tyrosine residues of Dab1 is required to mediate the full spectrum of downstream cytoskeletal-modulating and cell migratory signals that accompany Reelin-Dab1 signalling. Some of these functions, or other new ones, might also be carried out by one and/or two Dab1 genes of zebrafish. In the main form of Dab1 proteins (Dab1-555) of mammals (human and mouse) and chicken, Tyr185 and Tyr198/Tyr200 residues are part of two YQXI motifs that bind to Scr-homologue 2 (SH2) domains, whereas Tyr220 and Tyr232 are part of two YXVP motifs that bind to Abl/Nck/ Crk-like SH2 domains (Songyang et al., 1993; Howell et al., 1997a; Pramatarova et al., 2003; Ballif et al., 2004; Bar et al., 2003). In zebrafish, drDab1b_tv2 has two Y(194/207)QXI motifs and two Y(229/241)XVP motifs that could, potentially, bind to Scr- and Abl/Nck/Crk-like SH2 domains, respectively. However, our analysis also demonstrated that drDab1a_tv2 and the isoforms that lack exons 8 and 9 of both drDab1 genes (drDab1a_tv1 and drDab1b_tv1) have only two YQXI motifs. These could, potentially, bind to Scr-like SH2 domains, in contrast to the isoforms with only two phosphorylation tyrosine residues in chicken (ggDab1-E) and mammals, which have two YXVP motifs that bind to Abl/Nck/Crk-like SH2 domains (Katyal and Godbout, 2004). Therefore, one great difference between drDab1a and drDab1b genes is that the latter gene, and specifically the drDab1b_tv2, could play a key role in the Reelin-Dab1 pathway in zebrafish, because it contains the same motifs that bind to Scr- and Abl/Nck/Crk-like SH2 domains as the homologue isoforms in mammals and chicken. In the future, it will be interesting to determine if the five Tyr phosphorylation sites identified in each of the two Dab1 proteins of zebrafish (Dab1a/b) are functional and have specific roles.

225

4.2. Identification by bio-informatic analysis of new putative Dab1 in teleosts and phylogenetic analysis Using the NJ method of the MEGA4 programme (Tamura et al., 2007) one phylogenetic tree of the aligned amino acid sequences from Dab1 of different species was constructed (Fig. 7). We have also included in this analysis the disabled (Dab) gene of Drosophila melanogaster (Gertler et al., 1989) and Caenorhabditis elegans, and additional sequences which correspond to Dab2 as outgroups. Moreover, in order to obtain a broader knowledge of Dab1's and their origin and relationships with one another, new putative Dab1's from four teleost species [three-spined stickleback (gaDab1b), Japanese medaka (olDab1a and olDab1b), Japanese pufferfish (trDab1a and trDab1b) and black pufferfish (tnDab1a and tnDab1b)] were identified using different in silico analyses and predicted protein products were compared with the previously characterised Dab1 of vertebrates, providing important clues about their origin and evolution of this protein. We have identified, for the first time, that in several teleosts there are normally two Dab1 genes (Dab1a and Dab1b) which can be the result of an extra duplication that took place in teleosts. Thus, the existence of two rounds of chromosome duplication is well known (probably whole genome duplication) before the divergence of ray-finned and lobe-finned fish and one more duplication event in ray-finned fish before the teleost radiation (Taylor and Raes, 2004; Vandepoele et al., 2004). Not all the genes of teleosts are duplicated and conserve a new or a complementary function (Force et al., 1999). We show that there are a wide number of Dab1's identified in vertebrates, but not in protostomes (only the Dab gene) and other deuterostomes, such as urochordates, cephalochordates and echinoderms, which suggests that Dab1 may be specific to vertebrate lineage. As shown in Fig. 7, drDab1b (specifically, drDab1b_tv2) is aligned in the same clade as the rest of the Dab1's of vertebrates. It can, therefore, be concluded that this new Dab1 identified in this work corresponds to an orthologue Dab1 in zebrafish. In particular, Dab1 sequences of teleosts (black pufferfish, Japanese pufferfish, three-spined stickleback, Japanese medaka and zebrafish) are positioned basal to the rest of the Dab1 clade. Moreover, the group of teleosts forms two subclades, one of them more ancestral (Dab1b), the second subclade corresponding to Dab1a. Similar phylogenetic trees were obtained when the nucleotide sequences (among cDNAs) were analysed and no differences between them were observed (data not shown).

4.3. Genomic organisation of drDab1b and its alternative splice forms Previous studies of genomic organisation of Dab1 genes demonstrated that the mammalian Dab1 genes [mouse and human (Bar et al., 2003)], chicken Dab1 gene (Katyal and Godbout, 2004) and the first Dab1 gene identified in zebrafish (Costagli et al., 2006), together with the second Dab1 gene identified in this work have similar organisation, further suggesting that they are evolutionally conserved. The length of the exons and the location of exon/intron boundaries, containing the highly conserved sequences for RNA splicing in higher eukaryotes, namely gt at the 5′ splice site (donor site) and ag at the 3′ splice site (acceptor site) (Green, 1986), are well conserved in fish and Dab1 genes of tetrapods, although the introns are shorter in fish than other vertebrates. In general, the extension of the specific genomic locus is tighter in teleosts than in amphibians, chickens and mammals. Different nucleotide sequences have been incorporated into many

Fig. 5. Differential expression of drDab1b and drDab1a in zebrafish development. The expression of drDab1b and drDab1a was assessed by RT-PCR. PCR product amounts are calculated as corresponding band intensity (mean grey value) using ImageJ 1.42 software (http://rsb.info.nih.gov/ij). Pairs of primers used for amplifying part of the transcripts drDab1a and drDab1b were H & I, and B & D, respectively (see Table 1 and Fig. 3). The size of each PCR fragment and the specific isoform of each of the zebrafish Dab1 genes/ transcripts are shown. Developmental stages: zygote (0.5 hpf), division (1.5 hpf), blastula (4 hpf), gastrula (7.5 hpf), segmentation (14–20 hpf), pharyngula (30–40 hpf), hatching (70 hpf) and post-hatching (95–120 hpf). Amplification of zebrafish β-actin was used as an internal control and its expression is constant in all stages analysed, as expected for a housekeeping gene. Each bar represents the mean of expression levels of the studied gene/transcript at each developmental stage ± SEM. For each stage the number of the experiments represented in this graph was between 3 and 5; *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001 (unpaired Student's t-test with Welch correction).

Fig. 6. Alignment of both Dab1a and Dab1b proteins of zebrafish. Alignment produced with the ClustalW programme of deduced complete amino acid sequences for Dab1 identified in zebrafish species (drDab1a_tv2 and drDab1b_tv2, which are the prototypical Dab1 proteins, GenBank accession no. NP_001035775 and EF028079, respectively). The PTB domains are underlined. Exons 8 and 9 (e8 and e9) are the main regions that can be splicing alternatives. Predicted Ser, Thr and Tyr phosphorylation sites are marked in each amino acid residue in green, blue and red, respectively. Each of the exons in each Dab1 gene is indicated as e2-e15. The amino acid residues marked in grey indicate the exon/intron boundaries. Dashes have been introduced to maximise sequence identity. The total number of amino acids is indicated at the end of each sequence. Other legends: *, alignment that is perfectly conserved in both sequences; :, conserved residues in both sequences; ., similar residues in both sequences.

226 M.J. Herrero-Turrión et al. / Comparative Biochemistry and Physiology, Part B 155 (2010) 217–229

M.J. Herrero-Turrión et al. / Comparative Biochemistry and Physiology, Part B 155 (2010) 217–229

227

Fig. 7. Phylogenetic analysis of the family of Dab proteins of several species. Phylogram generated by the neighbour-joining method [MEGA4 programme (Tamura et al., 2007)] from the alignment of the amino acid sequences of Dab1. Organisms of Dab1 proteins are indicated in the prefix. hs, human (H. sapiens, AAC70068); mf, crab eating macaque (M. fascicularis, Q9BGX5); pt, chimpanzee (P. troglodytes, XP_001155092); rn, rat (R. norvegicus, BAC20288.1); mm, mouse (M. musculus, CAM26762.1); ss, pig (S. scrofa, NP_001090911.1); cf, dog (C. familiaris, XP_852920), md, opossum (M. domestica, XP_001365192)]; gg, chicken (G. gallus, AAP70754.1); xt, western clawed frog (X. tropicalis, AAI55685)]; dr, zebrafish (D. rerio, NP_001035775 and EF028079); ga, three-spined stickleback (G. aculeatus); ol, Japanese medaka (O. latipes); tr, Japanese pufferfish (T. rubripes); and tn, black pufferfish (T. nigroviridis). We also included the amino acid sequences of Dab2 and Dab as outgroups: hs, human (H. sapiens, EAW55990); pt, chimpanzee (P. troglodytes, XP_001140442); rn, rat (R. norvegicus, GenBank accession no. EDL75714); mm, mouse (M. musculus, NP_001032994); cf, dog (C. familiaris, XP_536493); md, opossum (M. domestica, XP_001372050); dr, zebrafish (D. rerio, NP_991320); tn, black pufferfish (T. nigroviridis, CAG05213); ce, (C. elegans, NP_49573); and dm, (D. melanogaster, AAB08527). Whole numbers (bold) indicate bootstrap values (occurrence of presented branching after 1000 iterations) and branch distances are given in decimal numbers when N 50%.

chromosomal loci during evolution (Zhang and Chasin, 2006; Babushok et al., 2007), such as new exons for an alternative splicing of Dab1 genes in mammalian species (e.g. exons corresponding to mouse 217*, 271* and 555*). Moreover, it is known that in Drosophila, the Dab gene has even smaller introns and extends over 12 kb of genomic DNA (Gertler et al., 1989), suggesting that the large size of Dab1 in vertebrates depends on intron extension and is an evolutionary acquisition. Therefore, we can emphasise that the drDab1b gene could be more ancestral

than the Dab1a gene, because the introns of drDab1a are longer than those of drDab1b and, as mentioned previously, the phylogenetic analyses demonstrate it. In addition, we show that the most significant differences between two zebrafish Dab1 genes are the distinct lengths of the introns and that the drDab1b gene is substantially shorter than drDab1a. Moreover, the intron phases were not well conserved and exon 12 of drDab1b contains the stop codon, in contrast to the other Dab1 gene of zebrafish (drDab1a) and other vertebrate Dab1 genes, which

228

M.J. Herrero-Turrión et al. / Comparative Biochemistry and Physiology, Part B 155 (2010) 217–229

contain the stop codon in exons 14 or 15 (Bar et al., 2003; Costagli, et al., 2006). Regarding the numbers of exons, we demonstrated, for the first time, that all Dab1 genes' identities, up to now in vertebrates, were composed of 14 encoding exons, except drDab1b, which is composed of 12 encoding exons. Some Dab1 genes have some alternative internal exons, such as mouse Dab1, with a total of four Dab1 cDNA forms (of 555, 217*, 271* and 555* amino acids; Howell et al., 1997a; Bar et al., 2003). Moreover, two Dab1 cDNAs (of 551-ggDab1-L “later”- and 535ggDab1-E “early”-amino acids) and at least four Dab1a isoforms have been reported in chicken (Katyal and Godbout, 2004) and zebrafish (Costagli et al., 2006), respectively. In our work, we have also identified at least five drDab1b isoforms. With respect to isoforms of both drDab1 genes, the drDab1a_tv2 and drDab1b_tv2 isoforms might be the homologue isoforms to the prototypical form of Dab1 in mammals, Dab1-555. The presence (or absence) in a specific isoform of some of the exons located between exons 6 and 9, which encode the cluster of potential tyrosine phosphorylation residues may be crucial in Reelin signalling. Thus, other isoforms, such as drDab1a_tv3, drDab1b_tv3 and drDab1b_tv4, which lack one or two exons 8 and 9, or drDab1a_tv1 and drDab1b_tv1, which lack both exons, might have dominant negative effects and influence positive feedback control (Howell et al., 2000; Katyal and Godbout, 2004; Costagli et al., 2006). Moreover, it has been reported that Dab1 tyrosine-lacking forms can produce an accumulation of these Dab1 proteins. This is because they do not became ubiquitinated, which requires tyrosine phosphorylation of Dab1 and, therefore, are not degraded via the proteasome pathway and might participate in other pathways (Arnaud et al., 2003; Morimura et al., 2005). The disruption of Reelin signalling leads to the accumulation of Dab1 protein in vivo, suggesting that Reelin limits its action by eventually down-regulating Dab1 levels (Sheldon et al., 1997; Rice et al., 1998; Trommsdorff et al., 1999; Arnaud et al., 2003). We suggest that drDab1a_tv1, drDab1b_tv1, ggDab1-E, Dab1-217* and Dab1-271* might be functionally similar, since they have the same number of potential tyrosine phosphorylation residues, although their C-terminal domains are very different. This latter domain could be involved in the modulation of Reelin-Dab1 signalling (Herrick and Cooper, 2002). 4.4. Differential expression of drDab1b in tissues and during development In our approach to studying the expression of drDab1b, we have shown that this gene is expressed in the CNS (retina, pituitary and brain) in a detectable manner. This is in accordance with the fact that different drDab1a isoforms and other Dab1 isoforms in human, mouse and chicken were also detected in the CNS (Bar et al., 2003). Moreover, drDab1b was detected in some non-neuronal tissues (gills, heart, intestine, muscle, blood and liver), like some mammalian Dab1 isoforms in liver, kidney and some haematopoietic cell lines (Howell et al., 1997a; Bar et al., 2003), different chicken Dab1 isoforms in kidney, heart, liver and gut (Katyal and Godbout, 2004) and drDab1a in pronephric ducts, blood vessels and branchial arches in zebrafish (Costagli et al., 2006). All these data suggest the existence of different tissue-specific expression patterns of both drDab1 genes and each Dab1 isoform in zebrafish and other species may play the same or different roles in the same or distinct tissues. We found that two drDab1 genes are expressed throughout developmental stages and show different developmental-specific expression patterns, as reported by Costagli et al. (2006) for drDab1a and Howell et al. (1997a) for embryos of mouse. This suggests complementary or distinct roles of each drDab1 isoform in embryogenesis and organogenesis, as has been reported for mouse and chicken (Bar et al., 2003). In particular, the mouse Dab1 transcript contained fragment 555* and the exclusion of the 555* exon occurs in parallel with neural differentiation. In addition, the early isoform of chicken Dab1 (ggDab1-E), predominantly detected in early stages of development, like drDab1b_tv2 drDab1b_tv5 and drDab1b_tv1, represents a novel way of uncoupling the Reelin-Dab1 pathway, to ensure that this

signalling cascade is not prematurely induced in undifferentiated retinal and brain cells by secreted Reelin. Only the later isoform ggDab1-L, expressed in neurons, which contains all the tyrosine phosphorylation sites, is able to grow neurites in response to the Reelin signal (Katyal and Godbout, 2004). We also show that there are more development stages and adult tissues that express drDab1b isoforms than those that express drDab1a isoforms. In addition, drDab1b expression in developmental and different tissues of the adult species was higher than that of drDab1a. All this suggests a major role for drDab1b in contrast to drDab1a in both processes. 4.5. Conclusion Our results prove the existence of two functional duplicate genes of Dab1 in the zebrafish and other teleosts and the combined analyses of both genes opens a new exciting door for the understanding of the Reelin-Dab pathway function throughout evolution. Acknowledgements This work was supported by the Junta de Castilla y León (SAN673/ SA15/08). We are grateful to F. Macho Sánchez-Simón for her help in the early phases of this study, to Prof. R.E. Rodríguez for her helpful advice and critical comments on the manuscript and to Mr. G.H. Jenkins for revising the English version of the manuscript. References Amsterdam, A., Hopkins, N., 2006. Mutagenesis strategies in zebrafish for identifying genes involved in development and disease. Trends Genet. 22, 473–478. Arnaud, L., Ballif, B.A., Cooper, J.A., 2003. Regulation of protein tyrosine kinase signaling by substrate degradation during brain development. Mol. Cell Biol. 23, 9293–9302. Babushok, D.V., Ostertag, E.M., Kazazian Jr., H.H., 2007. Current topics in genome evolution: molecular mechanisms of new gene formation. Cell Mol. Life Sci. 64, 542–554. Ballif, B.A., Arnaud, L., Arthur, W.T., Guris, D., Imamoto, A., Cooper, J.A., 2004. Activation of a Dab1/CrkL/C3G/Rap1 pathway in Reelin-stimulated neurons. Curr. Biol. 14, 606–610. Bar, I., Tissir, F., Lambert, D.R., De Backer, O., Goffinet, A.M., 2003. The gene encoding disabled-1 (DAB1), the intracellular adaptor of the Reelin pathway, reveals unusual complexity in human and mouse. J. Biol. Chem. 278, 5802–5812. Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159. Costagli, A., Felice, B., Guffanti, A., Wilson, S.W., Mione, M., 2006. Identification of alternatively spliced dab1 isoforms in zebrafish. Dev. Genes Evol. 216, 291–299. Feng, L., Cooper, J.A., 2009. Dual functions of Dab1 during brain development. Mol. Cell. Biol. 29, 324–332. Force, A., Lynch, M., Pickett, F.B., Amores, A., Yan, Y.L., Postlethwait, J., 1999. Preservation of duplicate genes by complementary, degenerative mutations. Genetics 151, 1531–1545. Gertler, F.B., Bennett, R.L., Clark, M.J., Hoffmann, F.M., 1989. Drosophila abl tyrosine kinase in embryonic CNS axons: a role in axonogenesis is revealed through dosagesensitive interactions with disabled. Cell 58, 103–113. Green, M.R., 1986. Pre-mRNA splicing. Annu. Rev. Genet. 20, 671–708. Herrero-Turrion, M.J., Rodríguez, R.E., 2008. Bioinformatic analysis of the origin, sequence and diversification of _ opioid receptors in vertebrates. Molecular Phylogenetics and Evolution 49, 877–892. Herrick, T.M., Cooper, J.A., 2002. A hypomorphic allele of dab1 reveals regional differences in reelin-Dab1 signaling during brain development. Development 129, 787–796. Herz, J., Chen, Y., 2006. Reelin, lipoprotein receptors and synaptic plasticity. Nat. Rev. Neurosci. 7, 850–859. Hoe, H.S., Tran, T.S., Matsuoka, Y., Howell, B.W., Rebeck, G.W., 2006. Dab1 and Reelin effects on APP and ApoEr2 trafficking and processing. J. Biol. Chem. 281, 35176–35185. Honda, T., Nakajima, K., 2006. Mouse disabled1 (DAB1) is a nucleocytoplasmic shuttling protein. J. Biol. Chem. 281, 38951–38965. Howell, B.W., Gertler, F.B., Cooper, J.A., 1997a. Mouse disabled (mDab1): a Src binding protein implicated in neuronal development. EMBO J. 16, 121–132. Howell, B.W., Hawkes, R., Soriano, P., Cooper, J.A., 1997b. Neuronal position in the developing brain is regulated by mouse disabled-1. Nature 389, 733–737. Howell, B.W., Herrick, T.M., Cooper, J.A., 1999a. Reelin-induced tryosine phosphorylation of disabled 1 during neuronal positioning. Genes Dev. 13, 643–648. Howell, B.W., Lanier, L.M., Frank, R., Gertler, F.B., Cooper, J.A., 1999b. The disabled 1 phosphotyrosine-binding domain binds to the internalization signals of transmembrane glycoproteins and to phospholipids. Mol. Cell Biol. 19, 5179–5188. Howell, B.W., Herrick, T.M., Hildebrand, J.D., Zhang, Y., Cooper, J.A., 2000. Dab1 tyrosine phosphorylation sites relay positional signals during mouse brain development. Curr. Biol. 10, 877–885.

M.J. Herrero-Turrión et al. / Comparative Biochemistry and Physiology, Part B 155 (2010) 217–229 Katyal, S., Godbout, R., 2004. Alternative splicing modulates disabled-1 (Dab1) function in the developing chick retina. EMBO J. 23, 1878–1888. Katyal, S., Gao, Z., Monckton, E., Glubrecht, D., Godbout, R., 2007. Hierarchical disabled1 tyrosine phosphorylation in Src family kinase activation and neurite formation. J. Mol. Biol. 368, 349–364. Keshvara, L., Benhayon, D., Magdaleno, S., Curran, T., 2001. Identification of reelin-induced sites of tyrosyl phosphorylation on disabled 1. J. Biol. Chem. 276, 16008–16014. Keshvara, L., Magdaleno, S., Benhayon, D., Curran, T., 2002. Cyclin-dependent kinase 5 phosphorylates disabled 1 independently of Reelin signaling. J. Neurosci. 22, 4869–4877. Magdaleno, S., Keshvara, L., Curran, T., 2002. Rescue of ataxia and preplate splitting by ectopic expression of Reelin in reeler mice. Neuron 33, 573–586. Morimura, T., Hattori, M., Ogawa, M., Mikoshiba, K., 2005. Disabled1 regulates the intracellular trafficking of reelin receptors. J. Biol. Chem. 280, 16901–16908. Pramatarova, A., Ochalski, P.G., Chen, K., Gropman, A., Myers, S., Min, K.T., Howell, B.W., 2003. Nck beta interacts with tyrosine-phosphorylated disabled 1 and redistributes in Reelin-stimulated neurons. Mol. Cell Biol. 23, 7210–7221. Pramatarova, A., Chen, K., Howell, B.W., 2008. A genetic interaction between the APP and Dab1 genes influences brain development. Mol. Cell Neurosci. 37, 178–186. Rice, D.S., Curran, T., 2001. Role of the reelin signaling pathway in central nervous system development. Annu. Rev. Neurosci. 24, 1005–1039. Rice, D.S., Sheldon, M., D'Arcangelo, G., Nakajima, K., Goldowitz, D., Curran, T., 1998. Disabled-1 acts downstream of Reelin in a signaling pathway that controls laminar organization in the mammalian brain. Development 125, 3719–3729. Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425. Sheldon, M., Rice, D.S., D'Arcangelo, G., Yoneshima, H., Nakajima, K., Mikoshiba, K., Howell, B.W., Cooper, J.A., Goldowitz, D., Curran, T., 1997. Scrambler and yotari disrupt the disabled gene and produce a reeler-like phenotype in mice. Nature 389, 730–733.

229

Songyang, Z., Shoelson, S.E., Chaudhuri, M., Gish, G., Pawson, T., Haser, W.G., King, F., Roberts, T., Ratnofsky, S., Lechleider, R.J., Neel, B.G., Birge, R.B., Fajardo, J.B., Chou, M.M., Hanafusa, H., Schaffhausen, B., Cantley, L.C., 1993. SH2 domains recognize specific phosphopeptide sequences. Cell 72, 767–778. Stolt, P.C., Bock, H.H., 2006. Modulation of lipoprotein receptor functions by intracellular adaptor proteins. Cell Signal. 18, 1560–1571. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) Software Version 4.0. Mol. Biol. Evol. 24, 1596–1599. Taylor, J.S., Raes, J., 2004. Duplication and divergence: the evolution of new genes and old ideas. Annu. Rev. Genet. 38, 615–643. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positionspecific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–4680. Tissir, F., Goffinet, A.M., 2003. Reelin and brain development. Nat. Rev. Neurosci. 4, 496–505. Trommsdorff, M., Borg, J.P., Margolis, B., Herz, J., 1998. Interaction of cytosolic adaptor proteins with neuronal apolipoprotein E receptors and the amyloid precursor protein. J. Biol. Chem. 273, 33556–33560. Trommsdorff, M., Gotthardt, M., Hiesberger, T., Shelton, J., Stockinger, W., Nimpf, J., Hammer, R.E., Richardson, J.A., Herz, J., 1999. Reeler/Disabled-like disruption of neuronal migration in knockout mice lacking the VLDL receptor and ApoE receptor 2. Cell 97, 689–701. Vandepoele, K., De, V.W., Taylor, J.S., Meyer, A., Van de, P.Y., 2004. Major events in the genome evolution of vertebrates: paranome age and size differ considerably between ray-finned fishes and land vertebrates. Proc. Natl. Acad. Sci. USA 101, 1638–1643. Yang, C.B., Zheng, Y.T., Kiser, P.J., Mower, G.D., 2006. Identification of disabled-1 as a candidate gene for critical period neuroplasticity in cat and mouse visual cortex. Eur. J. Neurosci. 23, 2804–2808. Zhang, X.H., Chasin, L.A., 2006. Comparison of multiple vertebrate genomes reveals the birth and evolution of human exons. Proc. Natl. Acad. Sci. USA 103, 13427–13432.