- Email: [email protected]
Characterisation of a repressor gene (xre) and a temperature-sensitive allele from the Bacillus subtilis prophage, PBSX
Gene, 96 (1990) 83-88 Elsevier
83
GENE 03787
Characterisation of a repressor gene (xre) and a temperature-sensitive allele from the Bacillus subtilis prophage, P B S X (Defective prophage; bacteriocin; phibacin; recombinant DNA; DNA-binding protein; prophage induction; helix-turn-helix motif)
Heather E. Wood, Kevin M. Devine and David J. McConnell Department of Genetics, Trinity College, Dublin 2 (Ireland) Tel. (I) 772941, ext. 1872 Received by J.A. Hoch: 1 March 1990 Revised: 24 July 1990 Accepted: 25 July 1990
SUMMARY
The defective prophage of Bacillus subtilis 168, PBSX, is a chromosomally based element which encodes a nen-infecr, ous phage-like particle with bactericidal activity. PBSX is induced by agents which elicit the SOS response. In a ?BSX thermoinducible strain which carries the xhi1479 mutation, PBSX is induced by raising the growth temperature from 37 °C to 48°C. A 1.2-kb fragment has been cloned which complements the xhi1479 mutation. The nucleotide sequence of this fragment, contains an open reading frame (ORF) which encodes a protein of 113 amino acids (an). This aa sequence resembles that of other bacteriophage repressors and suggests that the N-terminal region forms a helix-turn-helix motif, typical of the DNA-binding domain of many bacterial regulatory proteins. The ORF is preceded by four 15-bp direct repeats, each of which contains an internal palindromic sequence, and by sequences resembling a SigA-dependent promoter. The nt sequence of an equivalent fragment from the PB SX thermoinducible strain has also been determined. There are three aa differences within the ORF compared to the wild type, one of which lies within the helix-turn-helix segment. This ORF encodes a repressor protein of PBSX.
INTRODUCTION
PBSX is a genetic elemer,t of B. subtilis 168, often terme~ a defective prophage becatzse of its potential to encode a phage-like particle. As the PB $X paa'tic!edoes not contain a phage genome, the particle is not infectious and Correspondence to: Dr. H. Wood at his ctrrent address" European Molecular Biology Laboratory, Meyeri~ofstras~e 1, D-6900 !.~eidelberg (F.R.G.) fel. (6221 ) 387480; Fax (6221).387306.
Abbreviatior,s" aa, amino acid(s); bp, base pair(s); CAI, codon adaptation index; Cm, chloramphenicol; EM S: ethyl methanesulfonate; kb, kilobase(s) or IP00 bp; nt, nucleotide(s); ORF, open reading frame; p, p!asmid; PAG, polyacrylamide gel; RBS, ribosome-binding site; SDS, sodium dodecyl ~,~lfate; SigA, B. subtilis major vegetative sigma factor; wt, wild type; Xre, PBSX repressor; [ ], denotes plasmid-carrier state. "Y/~ ~~19/90/$03 .~0 © 1990ElsevierSciencePublishers B.V.(BiomedicalDivision)
hence the element is unable to replicate autonomously (Okamoto et al., 1968). Derepression of this defective prophage is lethal to the host cell, yet PBSX (or one of the morphologically similar defective phages PBSY, PBSZ or PBSV), is found in all strains of B. subtilis 168 and in some strains of B. licheniformis and B. pumilus examined (Steensma et al., 1978). It has been suggested that the ability to produce these phage-like particles confers a selective advantage to the population through their bactericidal activity on strains which contain a heterologous, but not the homologous pr,~phage (Subbaiah et al., 1966) We have called these phage-~ke bacteriocins, phibacins, to distinguish them from low-Mr bacteriocins, and to emphasise that phibacins are not detective. In common with many temperate bacteriophages, PB SX is induced by treatment of the cell with agents which elicit
84 me SOS response, e.g., mitomycm C or UV in'adiation (Okamoto et al., 1%8, Haas and Yoshikawa, 1969). Induction leads to replication of the chromosome in the vicinity of the prophage (Thurm and Garro, 1975; Anderson and Bott, 1985). This is accompanied by the production of PBSX-specific proteins (Mau~l and Karamata, 1984), and ultimately cell lysis with the release of up to 550 phage-like particles per cell (Steensma and Sondermeijer, 1977). We sought to analyse the mechanisms controlling PBSX induction. Given that the phage particle does not contain a phage genome, it is not possible to define an 'immunity region' by classical methods of phage genetics, e.g., using superinfection immunity or clear-plaque mutants. Instead it is simpler to consider the 'prophage' as a host element. A gene which is required for maintaining repression of PB SX has been defined by the xh~1479 mutation, the effect of which is to render the cell thermoinducible for PBSX (Buxton, 1976). This mutation, which maps to the PBSX region of the chromosome, is thought to lie within a gene which encodes a PBSX repressor. We have characterised this repressor by the cloning and nt seouence determination of a restriction fragment from the PBSX region of the chromosome which complements the xhi1479 mutation. We also describe the nt sequence of the equivalex~t fragment from the strain which is thermoinducible for the PBSX prophage. The data reveal an ORF which encodes a protein resembling other bacterial repressors.
RESULTS AND DISCUSSION
capable of complementing the xhi1479 mutation, DNA from a recombinant 2 clone spanning this region was partially digested with Hpall. This was ligated to AccI-digested pRP22, a B. subtilis-Escherichia cell shuttle vector (Devine et al., 1989). The ligation mixture was used to transform B. subtilis IA4201, with selection for Cm g at 37 oC. Transformants were screened for their ability to grow at 48 ° C. Plasmids from five such transformants were isolated. Passaging of the plasmids through E. coB, followed by transformation of B. subtilis IA4201, resulted in Cm R transformants, all of which had lost the temperature-sensitive phenotype. This confirmed that in each case the complementing activity is wholly resident on the plasmid. Cross-hybridization established that the five clones were related and that a 1.2-kb fragment was sufficient to complement the xhi1479 mutation. This fragment was cloned into the EcoRl site of pUBI10 (Gryczan et al., 1978), to give pUBII02. The growth characteristics of B. subalis IA4201[pUBl107] ~n liquid media are shown in Fig. 1. Unlike the strain which contains pUB 110 alone, this strain does not lyse after the shift to the nonpermissive temperature, but shows the growth characteristics of an xhi + strain. This suggested that the 1.2-kb fragment contaivs ~.he xhi + gone, i.e., a PBSX represser gone. Southern-blot analysis in&:cated the absence of this region from both the PBSX deletion strains, RB1081 or RB 1084 (data not shown). These strains were isolated as pseudo-revertants of an xhi1479 mutant strain (l~axton, 10~30). They have previously been shown to have ddetions in the PBSX region of the chromosome which extend from the pcophage to cover phoS, prefAB) and in the case of RB!084. also metC (Buxton, 1980; Piggot and Buxton,
(a) Cloning of a P B S X represser gene
The xhi147~ mutation renders B. subtilis 168 tbermoinducible for PBS Y Strains which contain this mutation are unable to grow at the nonpermisswe temperature of 48 °C due to induction of the prophage (Buxton, 1976). It is presumed that this mutation is located within a prophage represser gone, the mutant gone producing a thermolabile represser protein analogous to the ci857ts gene product of bacteriophage 2 (Sussman and Jacob, 1962). If this is the case, then it might be expected to be recessive to a wt copy of the gone present in the same cell. This property was used to clone the wt represser gene by eomplementation of the xhi1479 mutation in B. subtilis IA4201 (Wood et al., 1990). B. subtilis SO113 (trpC2 amy-3) was used as a source of wt PBSX DNA. DNA from the PBSX region of the chromosome has previously been cloned and characterised. PBS1 transduction indicated that the xhi1479 mutation was extremely closely linked (100% cotransduction) to a Cm g marker carried by the integrated plasmid pWD316 (Wood et al., !990). This suggested that the xhi gone was located within the cloned region. To subclone a fragment
1000
100 ~
f
10
•
0
i
2
•
i
4
•
i
6
"
'
i
•
i--
-
a
8 10 12 time(hours)
Fig. 1. Growth characteristics orB. subti/i: IA4201[pUB1102].Minima~ mediumwas inoculatedto a density of 6 ~: 106cells/mland incubated at 37°C until the cultures reacheda densityof 4 x 107ceils/mi.The cultures as indicated by the arrows were ~.henshiRed to 48°C. Cell density was monitoredusing a Klett-Sommersoncolorimeter(filter No. 54). [MQ__] B. subtilis IA4201[pUB110] (induced); [--[2]--] B. subti/is IA4201[pUBI102] (induced); [--I--] B. subtilis IA4201[pUBII02] (uninduced).
85 1981). However, the full extent of these deletions in the direction of metA is not known. The positioning of the PBSX late operon between phoS and xhi1479 (Wood et al., 1990), suggests that the deleted region in these strains includes the late operon of the prophage and extends at least into the early region of the prophage. (b) Nucleotide sequence and the identification of ORFs The nt sequence ofthe 1.2-kb fragment containing the xhi gene was determined and is shown in Fig. 2. The sequence indicates that the fragment has the potential to encode a protein of L13 aa (13.26 kDa). Indeed, when this fragment was cloned into an expression vector in E. coli, the production of a fragment-specific protein of the
corresponding size was observed (Fig. 3). A smaller 730-bp Bcll-Nael fragment (nt 222-952), which encodes only this 113 aa ORF, retains the ability to complement xhi1479 (data not shown). Based on these observations we have named this ORF, xre (PB SX repressor). Xre is preceded by a potential RBS with a calculated free energy of binding of zig = -18.2 kcal/mol (Tinoco et al., 1973). Similarity searches oft he NBRF/PIR and GenBank sequence databases indicated weak similarity of Xre to the bacteriophage P22 C2 repressor (Sauer et al., 1982), the dicA gene product of E. coil, a protein involved in the regulation of cell division (Bejar et al., 1986), bacteriophage PI/P2 C repressor (Ljungquist etal., 1984), the tpl05 repressor (C,los; Dhaese et al., 1985), and the tpl05 or'3
t a g t gaat tcaacaaccc-~oaatacgtcggaaaaggatagct t t t a t c g t t t t t e a t t g t a c g c c g c t t c t c c t t t t a a c a t c a
80
t t g t c a t g t a t g c t t g a a a c t g t t c c t g c g t t t caaagtgaaacaccggaaggccgcat gcggt a a a c g a a a t g g t gccgccggat
160
a g ---i at tgtccgar~ , = t g g c g c t g a t c t a t g g g a t t t t c a c t a a a a a c g a t t t g g a t c g g a t a [ ~ g t g a t - - c a c t c t c c t g a t c t
238
g
01 02 O3 c ..,____aac _ aa _ _ tTTTTGATACATTTTGTATCggat g t t accaa~lt at aaacGATACATTCT-GTATCat ¢aagt t ~t TTTTGATACTTTTTT 2b-10 0 4 20-35 2-,-10 20-35 lo-35 -_ _ga _ t t T~,TCa(aact t t aTTTTGATACATTTT-GTATCta~aat c a t a a g t aacgt agggagt t t aaaaaagagaggt cat agt at la-10 "lb -35 lb -10 M a t t t g gataggcggcagat t g a a g a g t ¢tcagagggaaaaggacacaggaagaaat c g c a t c a c a c a t c g g t g t g t c a c g § g c a c I G G R L K S L R G K R T 0 E E I A S H I G V S R A R
318
398
478
t g a t a t t c c c a c t a t , , a a a a cgggcgaagcg aa cccga t t a c g a c a c a c t c c a a a a g c t g g c t g a t t a c t t t c a a g t a a c g Y S H Y E N G R S E P D Y D T L O K L A D Y F O V T
558
a c t ga a c t g a t t act t at t a a c g g g g a a a g a c a a a a a a t c c g a t g a c g a t a t g t t ct c a g a t c c g g a c c t g c a g c t t g c a t accg T D Y L L T G K D K K S D D D M F S 0 P D L Q L A Y R
638
t t cgat a t g c a g g a t t t t t c c c c a g a a a g c a a a c a g c a g g c c a t c g a a t t t a t c a a c t a t t t aaaagaaaaagagaaaaacc D M 0 D F 8 P E S K 0 O A I E F I N Y L K E K E K N R
718
g at g a gcaaaccgaaaaataaataaatcgttctctgttctctaaaacatataaaaagtagaccgatataaagaaaaaagtgttta K P K N K <
798
t a t ta ttttttaaagaaaagggaaagattt•ta•a•ta••tt••agt•¢tata•ggg•tttt•ttt•t•g•taaaaacagaacaa
c 878
a
a
acgt t c g a a a g g g a g t a t t c a a t t g g g c g a t t a c t t a t c a c a t ctgga,ggaatacgt t a a a a a t t t at acggccggctgg
958
c c t g c a t e a c a t c c c c t c a t c a e a t t g a c a t g c t g a a a a t c g c a a a g g a ~ c t g g a t at t t g g g t g c a t t t t g a g g a t atgggg
1038
r-~ t t agc~aatacgacggea~gt:~agt.atcgt
1118
a
t g a a at tgaaccaaP~ ~~a~tc~cgg~aagagcaatgggaggat t t c
a
g
a
g
t g g c c a t g a g c t g t g c c a c g t g t t aaagcatgcagg, caat c a t t t t cagatgaacaagct ct t c a g a g a g c t tcaggaat t c 1200
Fig. 2. Nucleotide sequence of the 1.2-kb fragment which comple~,~ents the xhi1479 mutation. Differences in the nt sequence which occur in the temperature-inducible strain, IA4201, are indicated above the sequence. The aa sequenc:" of Xre is indicateO. Start codons for other potential reading frames are boxed. Direct repeats O1, 02, 0 3 and 0 4 are indicated in upper<,asc letters, while inverted repeats arc indicated with facing arrows above the nt sequence. -35 and -10 consensus sequences fi~r possible promoters for transcript;on ofxre (la and lb), and diverging transcription (2a and 2b), are underlined. The nt sequence was determined by the method of Sanger et al. (1977). These nt sequences have been submitted to GenBank with accession Nos. M36478 and M36477.
86
1 2345 PBsx
~:'-
f
~
- 92' 5
- 69 -46
xr.
, ......
MHTQLM--PlE]RII RARiRIKKLIqlRIQ~IRLGKM~US~IUAI]~I~I41EIRSE1]EP[H
P2 C 105 C I ¢I05 ORF3
M- - - SNT[~ISEK I ULII[PySEYLSROQI.[RIDL1pt~pYGTI.[SlVI~EIS[6RS]IIP! = fi . . . . . T~6"]~]I[i~FiI ~ E ~ Q L I ~ K R H - " L I E ' I ~ V L R O ~ I i ~ F ~ M- L DOKKI.J~I[E):IKI~ E~ L - ~ I T ~ I ~ a ~ YI.BI:}IIE~RI~ LI~
P22 c2 E. ~ D I cR P2 C t 105 C I ~105 ORF3
GEItr.~,RNSKfl~SPE.VL, LFGD--LSOTNVAYHSRHEPRGSYPLI SW 6Klt¢~i~JSKV~SPTWI~FGO .............. EEDKQPTP--11[]~JIrlMHI LQTFig~FB~YII~IFMYHI~i flPE . . . . . . ; . . . . . . . . . . . . L~-qEAU[~RLG I QVSAI UGEETLI KEEQAEYHSKEEKD. . . . . . . . V~I,I,I~RI~1L I HLDLHU~RTE I QUUEE. . . . . . . . . . . . . . . . . . . ,,
.--=-
~
- 3o
-14.3
Fig. 3. Proteins expressed from the 1.2-kb fragment in E. coil The 1.2-kb EcoRl fragment was removed from pUB1102 and cloned in both orientations into pUCI9 (Yanisch-Perron et al., 1985) to give pUCI9xrel and pUCi9xre2. Each plasmid was transformed into E. col: CSR603. Maxicelis were prepared, and proteins labelled using [aSS]methionine as described by Sancar etal. (1979). Samples were run on a 0.1% SDS-12,5% PAG using a discontinuous buffer system (Laemmli, 1970). The gel was treated with En~Hance (New England Nuclear Corp,), before drying. Labelled proteins were detected by autoradiography. Lanes: 1, E. coli CSR603; 2, E. coli CSR603[pUCI9]; 3, E. coli CSR603[pUCl9xrel]; 4, E. coil CSR603[pUCI9xre2]; 5, size standards (kDa).
gene product (Van Kaer et a!, 1987). A multiple alignment indicated that the similm'ity between these proteins is restrictc3 to the N-terminal region (Fig. 4). This region includes the proposed helix-turn..helix DNA-binding domain o~ each of the previously characterised proteins and suggests that Xre may also be a DNA-binding protein with a helix-turn, helix motif. Using the systematic approach to the ~-:.tec~ :, r,f potential DNA-binding proteins of this type descr,~ed by Dodd and Egan (1987), the proposed DNAbinding domain ofXre (aa 15-34 inclusive~received a score o! 1911, which lies within the range that these authors observe for 'Cro-like' DNA-binding proteins. Two further ORFs were identified within the nt sequence. The first of these, an ORF of 69 aa, is read from the opposite strand to xre. The second ORF, found 3' to xre and
P
P22 C2
.
.
Fig.4. Alignment ofthe N-terminal regionofXre with other DNA-binding proteins which were identifiedby database similaritysearches.The DicA protein is involved in the regulationofcell division in E. cell(Bejar et al., 1986). The other proteins are bacteriophage repressors: P22 C2 (Sauer et al.,1982); P2 C (Ljungquist et al.,1984); ¢105 C (Dhaese et al.,1984); ~105 ORF 3 (van Kaer et ai., 1987). The alignment was produced using CLUSTAL (Hig,ins and Sharp, 1988). The aa residues in the sequences which are common to Xre are boxed. Asterisks point to residues conserved in all six proteins. Dots indicate nt which are similar to each other in all six p~oteins. Similarity has been determined from a Dayhoff (19q8) aa similarity matrix. The position ofthe proposed helix-turn-helix DNA-binding domain is indicated.
read from the same strand, is an incomplete ORF. The potential ATG start codons for these ORFs are indicated in Fig. 2. We do not know if either of these genes is expressed, although it is notable that these ORFs are maintained in the temperature-inducible strain (see section e, below), with the majority of nt differences occurring in the third position of the codon. Furthermore, both are preceded by putative RBSs. No similarity was found between either of these two ORFs and any sequences contained in the NBRF/PIR or GenBank sequence database~.
(c) Potential transcriptional signals The expression of xre in E. coil, suggested that the gene may be transcribed from a promoter which can be utilised in both B, subtilis 168 and E. coll. ~n obvious candidate would be a SigA-specific promoter whose consensus sequence is similarto promoters recognised by the (T7° subunit of the RNA-polymerase in E. coli (Moran et al., 1982). Indeed, the repressor gene of ~105, a lysogenic phage of B. subtilis,is transcribed from a promoter with a SigAdependent consensus sequence a~d it is thought that this gene istranscribedby the major vegetativeform ofthe R N A polymerase (Dhaese et al., 1985). Transcription of phage repressorgenes by thisform of the polymerase would ensure that repression is maintained throughout vegetativegrowth. Examination of the region 5' to P B S X xre, revealed the presence of two sequences resembling the consensus sequence for SigA rccogniscd promoters (Fig. 2). Potential
87 SigA-dependent promoters, which may be utilised for transcription of d~e divergent ORF, were also detected on the complementary strand (Fig. 2). A further feature of this region is the presence of four 15-bp repeated palindromic sequences with a consensus of 5'-GATACATTTTGTATC. These have been named O 1, 02, 03 and 04. The identity between O1, 03 and 0 4 extends on the 5' side to a total of 19 bp. 03 is flanked on either side by a further inverted-repeat sequence of 7 bp length. These repeated sequences overlap with the proposed promoter dements for transcription of xre. Many phage and cellular repressors axe autoregulatory, and as such are preceded by binding sites for the repressor protein. The length and palindromic nature of these repeats are characteristic of protein binding, or operator sites. We propose that the repressor binds to the direct repeats within this region to regulate transcription both of its own gone (xre), and of a diverging transcriptional unit. Such an organisation, where the repressor differentially controls transcription from divergent promoters, has previously been reported for the immunity regions of many temperate bacteriophages e.g., 2 and ~105 (Ptashne, 1986; Van Kaer et al., 1987). In a similar manner to these bacteriophages, expression of the transcriptional unit which diverges from xre may signal the onset of PBSX induction.
(d) Codon usage The codon usage of xre was examined and found to reflect that of lowly expressed genes of B. subtilis (Sharp et al., 1988). A measure of codon bias is the CA1. The calculated CAI value of xre, is 0.36. This can be compared with CAI values ranging from 0.33 for lovdy expressed B. subtiBs genes to 0.86 for highly expressed genes (Shields and Sharp, 1987). Low levels of expression of xre would be consistent ~ith the role of its gone product as a repressor protein.
(e) Cloning and nt sequence of the temperature-sensitive repressor gene As the result of nt sequence polymorphism, the 1.2-kb E c o R l fragment from strain SO113 hybridises to a 1.8-kb E c o R l fragment from the PBSX temperature-inducible strain, B. subtilis IA4201 (data not shown). This fragment was isolated from a E c o R l chromosomal bank ofB. srlbtilis
sequence from the PBSX temperature-inducible strain was compared to the equivalent sequence from the wt strain, B. subtilis SO113. These differences include 65 bp substitutions, an insertion of 2 bp at nt position 222 of wt sequence, and a deletion of 1 bp at position 830. Of the bp substitutions, 14 occur within xre. Only three of these lead to aa changes: Gly4 to Ser, Ala 19 to Val, and Leu 78 to Val. The Ala 19 to Val change lies within the proposed DNA-binding domain. Val is rarely found at this position in other 'Cro-like' DNA-binding domains and reduces the Dodd and Egan (1987) score from 1911 to 1597, a figure which lies outside the range which these authors observed for the reference set of known helix-turn-helix DNA-binding domains (1684-2968). These authors estimate that approx. 60% of sequences which receive a score in the range 1500-1599, represent a 'Cro-like ~ DNAbinding domain. It will be of interest to determine by sitedirected mutagenesis of the wt sequence, if this aa change results in a temperature-sensitive protein. The PBSX temperature-inducible mutant strain was reported to be isolated following EMS-induced mutagenesis of a B. subtilis 168 derivative (Buxton, 1976). However, from the number of differences (5.5~o) and the variety of changes observed between this and the 'wt' (B. subtilis SOl13) sequence, it is evident that these cannot all have resulted from EMS mutagenesis. Unfortunately, SOl13 and IA4201 are not isogonic strains. It is likely that the sequence in SO113 may have been derived from a non-168 strain.
(f) Conclusions and perspectives We have cloned and sequenced a repressor gene and flanking regions from the PBSX-defective prophage and from a temperature-inducible derivative. We hope that this will facilitate an understanding of the mechanisms of control of transcription of this genetic element. Analysis of the nt sequence suggests the presence of divergent transcriptional units within this region which may be differentially regulated by the repressor. We are currently investigating this hypothesis by generating gene fusions to the proposed promoter elements. The cloned repressor gone will also aid in the identification of further promoters under repressor control and ultimately in an understanding of the pathway of 'lytic' development. .,L
IA4201 in pUC 19. Transformants were screened by colony hybridisation using an end-labdled 17-mer oligodeoxyribonucleotide complementary to nt 888-904 of the wt sequence. This E c o R l fragment contains an EcoRI-PstI fragment of 1195 bp which corresponds to nt 1-1195 of the sequenced fragment from strain SO 113. The nt sequence of this fragment was determined and the positions at which this differs from the wt sequence are shown in Fig. 2. A total of 67 differences were observed when the nt
ACKNOWLEDGEMENTS We would like to thank D. Higgins and P. Sharp for help with computer analysis and R. Buxton for strains. This work was supported by the Ei='U. Biotechnology Programme, BAP-0038-1RL.
88 REFERENCES Anderson, L.M. and Bott, K.: DNA packaging by the Bacillus subtilis defective bacteriophage PBSX. J. Virol. 54 (i985) 773-780. Bejar, S., Cam, K. and Bouch6, J.-P.: Control ofcell division in Escherichia coll. DNA sequence of dicA and of a second gone complementing mutation dicA 1, dicC. Nucleic Acids Res. 14 (1986) 6821-6834. Buxton, R.S,: Prophage mutation causing heat tnducibilJ.tyof defective Bacillus subtilis bacteriophage PBSX. J. Virol. 20 (1976) 22-28. Buxton, R.S.: Selection of Bacillus subtilis 168 mutants with deletions of the PBSX prophage. J. Gen. Virol. 46 (1980) 427-437. Dayhoff, M.O.: A model of evolutionary change in proteins. Matrices for detecting distant relationships. In Dayhoff, M.O. (Ed.), Atlas of Protein Sequence and Structure, Vol. 5, Suppl. 3. National Biomedical Research Foundation. Washington, DC, 1978, pp. 345-358. Devine, K.M., Hogan, S.T., Higgins, D.G. and McConnell, D.J.: Replication and segregational stability of the Bacillus plasmid pBAA1. J. Bacteriol. 171 (1989) 1166-1172. Dhaese, P., Seurinck, J., De Smet, B. and Van Montagu, M.: Nucleotide sequence and mutational analysis of an immunity repressor gone from Bacillus subtilis temperate phage ~b105. Nucleic Acids Res. 13 (1985) 5441-5455. Dodd, I.B. and Egan, J.B.: Systematic method for the detection of potential ~.'ro-likeDNA-binding regions in proteins. J. Mol. Biol. 194 (1987) 557-564. Gryczan, T.J., Contente, S. and Dubnau, D.: Characterization ~,f /':taph,,lococcus aureus plasmids introduced by transformation inro Bacillus subtilis. J. Bacteriol. 134 (1978) 318-329. Haas, M, and Yoshikawa, H.: Defective bacteriophage PBSH in Bacillus subtifis, I. Induction, purification and physical properties of the bacteriophage and its deoxyribonu~.leic acid. J. Virol. 3 (1969)233-247. Higgins, D.G. and Sharp, P.M.: CLUSTAL: a package for performing multiple sequence alignment on a microcomputer. Gone 73 (1988) 237-244. Laemmli, U.K.: Cleavage of structural proteins during assembly of the head protein of bacteriophage T4. Nature 227 (1970) 680-685. Ljangquist, E., Kockum, K. and Bertani, L.E,: DNA sequences of the repressor gone and operator region of bacteriophage P2. Proc. Natl. Acad. Sci. USA 81 (1984) 3988-3992. Mau~l, C. and Karamata, D.: Characterisation of proteins induced by mitomycin C treatment ofBacillus subtilis, J. Virol. 49 (1984) 806-812. M Jran, C.P., Long, N., LeGrice, S.F.J., Lee, G., Stephens, M., Sonenshein, A.L,, Pero, J. and Losick, R.: NL,cleotidesequences that signal the initiation of transcriptioa and tran 4ation in Bacillus subtilis. Mol. Gem Goner. 186 (1982) 339-346. Okamoto, K., Mudd, J.A., Mangan, J., Huang, W.M., Subbaiah, T.V. and Marmur, J.: Properties of the defective phage of Baciilu~ ~ubtili Mol. Biol. 34 (1968) 413-428. Piggot, P.J. and Buxton, R.S,: Bacteriophage PBSX-induced deletion
mutants of Bacillus subtilis 168 constitutive for alkaline phosphatase. J. Gen. Microbiol. 128 (1932) 663-669. Ptashne, M.: A Genetic Switch. Blackwell, and Cell Press, Cz~mbridge, MA, 1986. Sancar, A., Hath, H.M. and Rupp, W.D.: Simple method for identification of plasmid-coded proteins. J. Bacteriol. 137 (1979) 692-693. Sanger, F., Nicklen, S. and Coulson, A.R.: DNA sequencing with chainterminating inhibitors. Proc. Natl. Acad. Sci. USA 74 (1977) 5463-5467. Sauer, R.T., Yocum, R.R., Doolittle, R.F., Lewis, M. and Pabo, C.O.: Homology among DNA-binding proteins suggests use of a conserved super-secondary structure. Nature 298 (1982)447-451. Sharp, P.M., Cowe, E., Higgins, D.G., Shields, D.C., Wolfe, K. and Wright, F.: Codon usage patterns in Escherichia coil, Bacillus subtilis, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Drosophila melanogaster and Homo sapiens: a review of the considerable withinspecies diversity. Nucleic Acids Res. 16 (1988) 8207-8211, Shields, D.C. and Sharp, P.M.: Synonymous codon usage in Bacillus subtilis reflects both translational selection and mutational biases. Nucleic Acids Res. 15 (1987) 8023-8040. Steensma, H.Y. and Sondermeijer, P.J.A.: A counting method for determining the burst size of defective phages from B. subtilis. Antonie van Leeuwenhoek 43 (1977) 305-316. Steensma, H.Y., Robertson, I..A. and Van Elsas, J.D.: The occurrence and taxonomic value of PBSX-like defective phages in the genus Bacillus. Antonie van Leeuwenhoek 44 (1978) 353-366. Subbaiah, T.V., Goldthwaite, C.D. and Marmur, J.: Nature of bacteriophages induced in Bacillus subtilis. In Bryson, V. and Vogel, HJ. (Eds.), Evolving Genes and Proteins. Academic Press, New York, 1966, pp. 435-446. Sussman, R, and Jacob, F.: Sur une sysff)mede r/~pression thermt~sensible chez le bact6riophage d'Escherichia coll. C,R. Acad. Sci. 254 (1962) 1517-1519. Thurm, P. and Garro, A.J.: Isolation and characterisation of prophage mutants of the defectiveBacillus subtilis bacteriophage PBSX. J, Virol. 16 (1975) 184-191. Tinoco Jr., I., Borer, P.N., Dengier, B., Levine, M.D., Uhlenbeck, O.C., Crothers, D.M. and Gralla, J.: Improved estimation of secondary structure in ribonucleic acids. Nature New Biol. 246 (1973) 40-41. Van Kaer, L., Van Montagu, M. and Dhaese, P.: Transcriptional control in the EcoRI-F immunity region ofBaciUus subtilis phage ~ 105. J. Mol. Biol. 197 (1987) 55-67. Wood, H.E., Dawson, M.T., Devine, K.M. and McConnell, DJ.: Characterisation of PBSX, a defective prophage oi"Bacillus subtilis. J. Bacterioi. 172 (1990) 2667-2674. Yanisch-Perron, C., Vieira, J. and Messing, J.: Improved MI3 phage cloning vectors and host strains: nucleotide sequences of the M l3mpl8 and pUCI9 vectors. Gene 33 (1985) 103-119.
83
GENE 03787
Characterisation of a repressor gene (xre) and a temperature-sensitive allele from the Bacillus subtilis prophage, P B S X (Defective prophage; bacteriocin; phibacin; recombinant DNA; DNA-binding protein; prophage induction; helix-turn-helix motif)
Heather E. Wood, Kevin M. Devine and David J. McConnell Department of Genetics, Trinity College, Dublin 2 (Ireland) Tel. (I) 772941, ext. 1872 Received by J.A. Hoch: 1 March 1990 Revised: 24 July 1990 Accepted: 25 July 1990
SUMMARY
The defective prophage of Bacillus subtilis 168, PBSX, is a chromosomally based element which encodes a nen-infecr, ous phage-like particle with bactericidal activity. PBSX is induced by agents which elicit the SOS response. In a ?BSX thermoinducible strain which carries the xhi1479 mutation, PBSX is induced by raising the growth temperature from 37 °C to 48°C. A 1.2-kb fragment has been cloned which complements the xhi1479 mutation. The nucleotide sequence of this fragment, contains an open reading frame (ORF) which encodes a protein of 113 amino acids (an). This aa sequence resembles that of other bacteriophage repressors and suggests that the N-terminal region forms a helix-turn-helix motif, typical of the DNA-binding domain of many bacterial regulatory proteins. The ORF is preceded by four 15-bp direct repeats, each of which contains an internal palindromic sequence, and by sequences resembling a SigA-dependent promoter. The nt sequence of an equivalent fragment from the PB SX thermoinducible strain has also been determined. There are three aa differences within the ORF compared to the wild type, one of which lies within the helix-turn-helix segment. This ORF encodes a repressor protein of PBSX.
INTRODUCTION
PBSX is a genetic elemer,t of B. subtilis 168, often terme~ a defective prophage becatzse of its potential to encode a phage-like particle. As the PB $X paa'tic!edoes not contain a phage genome, the particle is not infectious and Correspondence to: Dr. H. Wood at his ctrrent address" European Molecular Biology Laboratory, Meyeri~ofstras~e 1, D-6900 !.~eidelberg (F.R.G.) fel. (6221 ) 387480; Fax (6221).387306.
Abbreviatior,s" aa, amino acid(s); bp, base pair(s); CAI, codon adaptation index; Cm, chloramphenicol; EM S: ethyl methanesulfonate; kb, kilobase(s) or IP00 bp; nt, nucleotide(s); ORF, open reading frame; p, p!asmid; PAG, polyacrylamide gel; RBS, ribosome-binding site; SDS, sodium dodecyl ~,~lfate; SigA, B. subtilis major vegetative sigma factor; wt, wild type; Xre, PBSX repressor; [ ], denotes plasmid-carrier state. "Y/~ ~~19/90/$03 .~0 © 1990ElsevierSciencePublishers B.V.(BiomedicalDivision)
hence the element is unable to replicate autonomously (Okamoto et al., 1968). Derepression of this defective prophage is lethal to the host cell, yet PBSX (or one of the morphologically similar defective phages PBSY, PBSZ or PBSV), is found in all strains of B. subtilis 168 and in some strains of B. licheniformis and B. pumilus examined (Steensma et al., 1978). It has been suggested that the ability to produce these phage-like particles confers a selective advantage to the population through their bactericidal activity on strains which contain a heterologous, but not the homologous pr,~phage (Subbaiah et al., 1966) We have called these phage-~ke bacteriocins, phibacins, to distinguish them from low-Mr bacteriocins, and to emphasise that phibacins are not detective. In common with many temperate bacteriophages, PB SX is induced by treatment of the cell with agents which elicit
84 me SOS response, e.g., mitomycm C or UV in'adiation (Okamoto et al., 1%8, Haas and Yoshikawa, 1969). Induction leads to replication of the chromosome in the vicinity of the prophage (Thurm and Garro, 1975; Anderson and Bott, 1985). This is accompanied by the production of PBSX-specific proteins (Mau~l and Karamata, 1984), and ultimately cell lysis with the release of up to 550 phage-like particles per cell (Steensma and Sondermeijer, 1977). We sought to analyse the mechanisms controlling PBSX induction. Given that the phage particle does not contain a phage genome, it is not possible to define an 'immunity region' by classical methods of phage genetics, e.g., using superinfection immunity or clear-plaque mutants. Instead it is simpler to consider the 'prophage' as a host element. A gene which is required for maintaining repression of PB SX has been defined by the xh~1479 mutation, the effect of which is to render the cell thermoinducible for PBSX (Buxton, 1976). This mutation, which maps to the PBSX region of the chromosome, is thought to lie within a gene which encodes a PBSX repressor. We have characterised this repressor by the cloning and nt seouence determination of a restriction fragment from the PBSX region of the chromosome which complements the xhi1479 mutation. We also describe the nt sequence of the equivalex~t fragment from the strain which is thermoinducible for the PBSX prophage. The data reveal an ORF which encodes a protein resembling other bacterial repressors.
RESULTS AND DISCUSSION
capable of complementing the xhi1479 mutation, DNA from a recombinant 2 clone spanning this region was partially digested with Hpall. This was ligated to AccI-digested pRP22, a B. subtilis-Escherichia cell shuttle vector (Devine et al., 1989). The ligation mixture was used to transform B. subtilis IA4201, with selection for Cm g at 37 oC. Transformants were screened for their ability to grow at 48 ° C. Plasmids from five such transformants were isolated. Passaging of the plasmids through E. coB, followed by transformation of B. subtilis IA4201, resulted in Cm R transformants, all of which had lost the temperature-sensitive phenotype. This confirmed that in each case the complementing activity is wholly resident on the plasmid. Cross-hybridization established that the five clones were related and that a 1.2-kb fragment was sufficient to complement the xhi1479 mutation. This fragment was cloned into the EcoRl site of pUBI10 (Gryczan et al., 1978), to give pUBII02. The growth characteristics of B. subalis IA4201[pUBl107] ~n liquid media are shown in Fig. 1. Unlike the strain which contains pUB 110 alone, this strain does not lyse after the shift to the nonpermissive temperature, but shows the growth characteristics of an xhi + strain. This suggested that the 1.2-kb fragment contaivs ~.he xhi + gone, i.e., a PBSX represser gone. Southern-blot analysis in&:cated the absence of this region from both the PBSX deletion strains, RB1081 or RB 1084 (data not shown). These strains were isolated as pseudo-revertants of an xhi1479 mutant strain (l~axton, 10~30). They have previously been shown to have ddetions in the PBSX region of the chromosome which extend from the pcophage to cover phoS, prefAB) and in the case of RB!084. also metC (Buxton, 1980; Piggot and Buxton,
(a) Cloning of a P B S X represser gene
The xhi147~ mutation renders B. subtilis 168 tbermoinducible for PBS Y Strains which contain this mutation are unable to grow at the nonpermisswe temperature of 48 °C due to induction of the prophage (Buxton, 1976). It is presumed that this mutation is located within a prophage represser gone, the mutant gone producing a thermolabile represser protein analogous to the ci857ts gene product of bacteriophage 2 (Sussman and Jacob, 1962). If this is the case, then it might be expected to be recessive to a wt copy of the gone present in the same cell. This property was used to clone the wt represser gene by eomplementation of the xhi1479 mutation in B. subtilis IA4201 (Wood et al., 1990). B. subtilis SO113 (trpC2 amy-3) was used as a source of wt PBSX DNA. DNA from the PBSX region of the chromosome has previously been cloned and characterised. PBS1 transduction indicated that the xhi1479 mutation was extremely closely linked (100% cotransduction) to a Cm g marker carried by the integrated plasmid pWD316 (Wood et al., !990). This suggested that the xhi gone was located within the cloned region. To subclone a fragment
1000
100 ~
f
10
•
0
i
2
•
i
4
•
i
6
"
'
i
•
i--
-
a
8 10 12 time(hours)
Fig. 1. Growth characteristics orB. subti/i: IA4201[pUB1102].Minima~ mediumwas inoculatedto a density of 6 ~: 106cells/mland incubated at 37°C until the cultures reacheda densityof 4 x 107ceils/mi.The cultures as indicated by the arrows were ~.henshiRed to 48°C. Cell density was monitoredusing a Klett-Sommersoncolorimeter(filter No. 54). [MQ__] B. subtilis IA4201[pUB110] (induced); [--[2]--] B. subti/is IA4201[pUBI102] (induced); [--I--] B. subtilis IA4201[pUBII02] (uninduced).
85 1981). However, the full extent of these deletions in the direction of metA is not known. The positioning of the PBSX late operon between phoS and xhi1479 (Wood et al., 1990), suggests that the deleted region in these strains includes the late operon of the prophage and extends at least into the early region of the prophage. (b) Nucleotide sequence and the identification of ORFs The nt sequence ofthe 1.2-kb fragment containing the xhi gene was determined and is shown in Fig. 2. The sequence indicates that the fragment has the potential to encode a protein of L13 aa (13.26 kDa). Indeed, when this fragment was cloned into an expression vector in E. coli, the production of a fragment-specific protein of the
corresponding size was observed (Fig. 3). A smaller 730-bp Bcll-Nael fragment (nt 222-952), which encodes only this 113 aa ORF, retains the ability to complement xhi1479 (data not shown). Based on these observations we have named this ORF, xre (PB SX repressor). Xre is preceded by a potential RBS with a calculated free energy of binding of zig = -18.2 kcal/mol (Tinoco et al., 1973). Similarity searches oft he NBRF/PIR and GenBank sequence databases indicated weak similarity of Xre to the bacteriophage P22 C2 repressor (Sauer et al., 1982), the dicA gene product of E. coil, a protein involved in the regulation of cell division (Bejar et al., 1986), bacteriophage PI/P2 C repressor (Ljungquist etal., 1984), the tpl05 repressor (C,los; Dhaese et al., 1985), and the tpl05 or'3
t a g t gaat tcaacaaccc-~oaatacgtcggaaaaggatagct t t t a t c g t t t t t e a t t g t a c g c c g c t t c t c c t t t t a a c a t c a
80
t t g t c a t g t a t g c t t g a a a c t g t t c c t g c g t t t caaagtgaaacaccggaaggccgcat gcggt a a a c g a a a t g g t gccgccggat
160
a g ---i at tgtccgar~ , = t g g c g c t g a t c t a t g g g a t t t t c a c t a a a a a c g a t t t g g a t c g g a t a [ ~ g t g a t - - c a c t c t c c t g a t c t
238
g
01 02 O3 c ..,____aac _ aa _ _ tTTTTGATACATTTTGTATCggat g t t accaa~lt at aaacGATACATTCT-GTATCat ¢aagt t ~t TTTTGATACTTTTTT 2b-10 0 4 20-35 2-,-10 20-35 lo-35 -_ _ga _ t t T~,TCa(aact t t aTTTTGATACATTTT-GTATCta~aat c a t a a g t aacgt agggagt t t aaaaaagagaggt cat agt at la-10 "lb -35 lb -10 M a t t t g gataggcggcagat t g a a g a g t ¢tcagagggaaaaggacacaggaagaaat c g c a t c a c a c a t c g g t g t g t c a c g § g c a c I G G R L K S L R G K R T 0 E E I A S H I G V S R A R
318
398
478
t g a t a t t c c c a c t a t , , a a a a cgggcgaagcg aa cccga t t a c g a c a c a c t c c a a a a g c t g g c t g a t t a c t t t c a a g t a a c g Y S H Y E N G R S E P D Y D T L O K L A D Y F O V T
558
a c t ga a c t g a t t act t at t a a c g g g g a a a g a c a a a a a a t c c g a t g a c g a t a t g t t ct c a g a t c c g g a c c t g c a g c t t g c a t accg T D Y L L T G K D K K S D D D M F S 0 P D L Q L A Y R
638
t t cgat a t g c a g g a t t t t t c c c c a g a a a g c a a a c a g c a g g c c a t c g a a t t t a t c a a c t a t t t aaaagaaaaagagaaaaacc D M 0 D F 8 P E S K 0 O A I E F I N Y L K E K E K N R
718
g at g a gcaaaccgaaaaataaataaatcgttctctgttctctaaaacatataaaaagtagaccgatataaagaaaaaagtgttta K P K N K <
798
t a t ta ttttttaaagaaaagggaaagattt•ta•a•ta••tt••agt•¢tata•ggg•tttt•ttt•t•g•taaaaacagaacaa
c 878
a
a
acgt t c g a a a g g g a g t a t t c a a t t g g g c g a t t a c t t a t c a c a t ctgga,ggaatacgt t a a a a a t t t at acggccggctgg
958
c c t g c a t e a c a t c c c c t c a t c a e a t t g a c a t g c t g a a a a t c g c a a a g g a ~ c t g g a t at t t g g g t g c a t t t t g a g g a t atgggg
1038
r-~ t t agc~aatacgacggea~gt:~agt.atcgt
1118
a
t g a a at tgaaccaaP~ ~~a~tc~cgg~aagagcaatgggaggat t t c
a
g
a
g
t g g c c a t g a g c t g t g c c a c g t g t t aaagcatgcagg, caat c a t t t t cagatgaacaagct ct t c a g a g a g c t tcaggaat t c 1200
Fig. 2. Nucleotide sequence of the 1.2-kb fragment which comple~,~ents the xhi1479 mutation. Differences in the nt sequence which occur in the temperature-inducible strain, IA4201, are indicated above the sequence. The aa sequenc:" of Xre is indicateO. Start codons for other potential reading frames are boxed. Direct repeats O1, 02, 0 3 and 0 4 are indicated in upper<,asc letters, while inverted repeats arc indicated with facing arrows above the nt sequence. -35 and -10 consensus sequences fi~r possible promoters for transcript;on ofxre (la and lb), and diverging transcription (2a and 2b), are underlined. The nt sequence was determined by the method of Sanger et al. (1977). These nt sequences have been submitted to GenBank with accession Nos. M36478 and M36477.
86
1 2345 PBsx
~:'-
f
~
- 92' 5
- 69 -46
xr.
, ......
MHTQLM--PlE]RII RARiRIKKLIqlRIQ~IRLGKM~US~IUAI]~I~I41EIRSE1]EP[H
P2 C 105 C I ¢I05 ORF3
M- - - SNT[~ISEK I ULII[PySEYLSROQI.[RIDL1pt~pYGTI.[SlVI~EIS[6RS]IIP! = fi . . . . . T~6"]~]I[i~FiI ~ E ~ Q L I ~ K R H - " L I E ' I ~ V L R O ~ I i ~ F ~ M- L DOKKI.J~I[E):IKI~ E~ L - ~ I T ~ I ~ a ~ YI.BI:}IIE~RI~ LI~
P22 c2 E. ~ D I cR P2 C t 105 C I ~105 ORF3
GEItr.~,RNSKfl~SPE.VL, LFGD--LSOTNVAYHSRHEPRGSYPLI SW 6Klt¢~i~JSKV~SPTWI~FGO .............. EEDKQPTP--11[]~JIrlMHI LQTFig~FB~YII~IFMYHI~i flPE . . . . . . ; . . . . . . . . . . . . L~-qEAU[~RLG I QVSAI UGEETLI KEEQAEYHSKEEKD. . . . . . . . V~I,I,I~RI~1L I HLDLHU~RTE I QUUEE. . . . . . . . . . . . . . . . . . . ,,
.--=-
~
- 3o
-14.3
Fig. 3. Proteins expressed from the 1.2-kb fragment in E. coil The 1.2-kb EcoRl fragment was removed from pUB1102 and cloned in both orientations into pUCI9 (Yanisch-Perron et al., 1985) to give pUCI9xrel and pUCi9xre2. Each plasmid was transformed into E. col: CSR603. Maxicelis were prepared, and proteins labelled using [aSS]methionine as described by Sancar etal. (1979). Samples were run on a 0.1% SDS-12,5% PAG using a discontinuous buffer system (Laemmli, 1970). The gel was treated with En~Hance (New England Nuclear Corp,), before drying. Labelled proteins were detected by autoradiography. Lanes: 1, E. coli CSR603; 2, E. coli CSR603[pUCI9]; 3, E. coli CSR603[pUCl9xrel]; 4, E. coil CSR603[pUCI9xre2]; 5, size standards (kDa).
gene product (Van Kaer et a!, 1987). A multiple alignment indicated that the similm'ity between these proteins is restrictc3 to the N-terminal region (Fig. 4). This region includes the proposed helix-turn..helix DNA-binding domain o~ each of the previously characterised proteins and suggests that Xre may also be a DNA-binding protein with a helix-turn, helix motif. Using the systematic approach to the ~-:.tec~ :, r,f potential DNA-binding proteins of this type descr,~ed by Dodd and Egan (1987), the proposed DNAbinding domain ofXre (aa 15-34 inclusive~received a score o! 1911, which lies within the range that these authors observe for 'Cro-like' DNA-binding proteins. Two further ORFs were identified within the nt sequence. The first of these, an ORF of 69 aa, is read from the opposite strand to xre. The second ORF, found 3' to xre and
P
P22 C2
.
.
Fig.4. Alignment ofthe N-terminal regionofXre with other DNA-binding proteins which were identifiedby database similaritysearches.The DicA protein is involved in the regulationofcell division in E. cell(Bejar et al., 1986). The other proteins are bacteriophage repressors: P22 C2 (Sauer et al.,1982); P2 C (Ljungquist et al.,1984); ¢105 C (Dhaese et al.,1984); ~105 ORF 3 (van Kaer et ai., 1987). The alignment was produced using CLUSTAL (Hig,ins and Sharp, 1988). The aa residues in the sequences which are common to Xre are boxed. Asterisks point to residues conserved in all six proteins. Dots indicate nt which are similar to each other in all six p~oteins. Similarity has been determined from a Dayhoff (19q8) aa similarity matrix. The position ofthe proposed helix-turn-helix DNA-binding domain is indicated.
read from the same strand, is an incomplete ORF. The potential ATG start codons for these ORFs are indicated in Fig. 2. We do not know if either of these genes is expressed, although it is notable that these ORFs are maintained in the temperature-inducible strain (see section e, below), with the majority of nt differences occurring in the third position of the codon. Furthermore, both are preceded by putative RBSs. No similarity was found between either of these two ORFs and any sequences contained in the NBRF/PIR or GenBank sequence database~.
(c) Potential transcriptional signals The expression of xre in E. coil, suggested that the gene may be transcribed from a promoter which can be utilised in both B, subtilis 168 and E. coll. ~n obvious candidate would be a SigA-specific promoter whose consensus sequence is similarto promoters recognised by the (T7° subunit of the RNA-polymerase in E. coli (Moran et al., 1982). Indeed, the repressor gene of ~105, a lysogenic phage of B. subtilis,is transcribed from a promoter with a SigAdependent consensus sequence a~d it is thought that this gene istranscribedby the major vegetativeform ofthe R N A polymerase (Dhaese et al., 1985). Transcription of phage repressorgenes by thisform of the polymerase would ensure that repression is maintained throughout vegetativegrowth. Examination of the region 5' to P B S X xre, revealed the presence of two sequences resembling the consensus sequence for SigA rccogniscd promoters (Fig. 2). Potential
87 SigA-dependent promoters, which may be utilised for transcription of d~e divergent ORF, were also detected on the complementary strand (Fig. 2). A further feature of this region is the presence of four 15-bp repeated palindromic sequences with a consensus of 5'-GATACATTTTGTATC. These have been named O 1, 02, 03 and 04. The identity between O1, 03 and 0 4 extends on the 5' side to a total of 19 bp. 03 is flanked on either side by a further inverted-repeat sequence of 7 bp length. These repeated sequences overlap with the proposed promoter dements for transcription of xre. Many phage and cellular repressors axe autoregulatory, and as such are preceded by binding sites for the repressor protein. The length and palindromic nature of these repeats are characteristic of protein binding, or operator sites. We propose that the repressor binds to the direct repeats within this region to regulate transcription both of its own gone (xre), and of a diverging transcriptional unit. Such an organisation, where the repressor differentially controls transcription from divergent promoters, has previously been reported for the immunity regions of many temperate bacteriophages e.g., 2 and ~105 (Ptashne, 1986; Van Kaer et al., 1987). In a similar manner to these bacteriophages, expression of the transcriptional unit which diverges from xre may signal the onset of PBSX induction.
(d) Codon usage The codon usage of xre was examined and found to reflect that of lowly expressed genes of B. subtilis (Sharp et al., 1988). A measure of codon bias is the CA1. The calculated CAI value of xre, is 0.36. This can be compared with CAI values ranging from 0.33 for lovdy expressed B. subtiBs genes to 0.86 for highly expressed genes (Shields and Sharp, 1987). Low levels of expression of xre would be consistent ~ith the role of its gone product as a repressor protein.
(e) Cloning and nt sequence of the temperature-sensitive repressor gene As the result of nt sequence polymorphism, the 1.2-kb E c o R l fragment from strain SO113 hybridises to a 1.8-kb E c o R l fragment from the PBSX temperature-inducible strain, B. subtilis IA4201 (data not shown). This fragment was isolated from a E c o R l chromosomal bank ofB. srlbtilis
sequence from the PBSX temperature-inducible strain was compared to the equivalent sequence from the wt strain, B. subtilis SO113. These differences include 65 bp substitutions, an insertion of 2 bp at nt position 222 of wt sequence, and a deletion of 1 bp at position 830. Of the bp substitutions, 14 occur within xre. Only three of these lead to aa changes: Gly4 to Ser, Ala 19 to Val, and Leu 78 to Val. The Ala 19 to Val change lies within the proposed DNA-binding domain. Val is rarely found at this position in other 'Cro-like' DNA-binding domains and reduces the Dodd and Egan (1987) score from 1911 to 1597, a figure which lies outside the range which these authors observed for the reference set of known helix-turn-helix DNA-binding domains (1684-2968). These authors estimate that approx. 60% of sequences which receive a score in the range 1500-1599, represent a 'Cro-like ~ DNAbinding domain. It will be of interest to determine by sitedirected mutagenesis of the wt sequence, if this aa change results in a temperature-sensitive protein. The PBSX temperature-inducible mutant strain was reported to be isolated following EMS-induced mutagenesis of a B. subtilis 168 derivative (Buxton, 1976). However, from the number of differences (5.5~o) and the variety of changes observed between this and the 'wt' (B. subtilis SOl13) sequence, it is evident that these cannot all have resulted from EMS mutagenesis. Unfortunately, SOl13 and IA4201 are not isogonic strains. It is likely that the sequence in SO113 may have been derived from a non-168 strain.
(f) Conclusions and perspectives We have cloned and sequenced a repressor gene and flanking regions from the PBSX-defective prophage and from a temperature-inducible derivative. We hope that this will facilitate an understanding of the mechanisms of control of transcription of this genetic element. Analysis of the nt sequence suggests the presence of divergent transcriptional units within this region which may be differentially regulated by the repressor. We are currently investigating this hypothesis by generating gene fusions to the proposed promoter elements. The cloned repressor gone will also aid in the identification of further promoters under repressor control and ultimately in an understanding of the pathway of 'lytic' development. .,L
IA4201 in pUC 19. Transformants were screened by colony hybridisation using an end-labdled 17-mer oligodeoxyribonucleotide complementary to nt 888-904 of the wt sequence. This E c o R l fragment contains an EcoRI-PstI fragment of 1195 bp which corresponds to nt 1-1195 of the sequenced fragment from strain SO 113. The nt sequence of this fragment was determined and the positions at which this differs from the wt sequence are shown in Fig. 2. A total of 67 differences were observed when the nt
ACKNOWLEDGEMENTS We would like to thank D. Higgins and P. Sharp for help with computer analysis and R. Buxton for strains. This work was supported by the Ei='U. Biotechnology Programme, BAP-0038-1RL.
88 REFERENCES Anderson, L.M. and Bott, K.: DNA packaging by the Bacillus subtilis defective bacteriophage PBSX. J. Virol. 54 (i985) 773-780. Bejar, S., Cam, K. and Bouch6, J.-P.: Control ofcell division in Escherichia coll. DNA sequence of dicA and of a second gone complementing mutation dicA 1, dicC. Nucleic Acids Res. 14 (1986) 6821-6834. Buxton, R.S,: Prophage mutation causing heat tnducibilJ.tyof defective Bacillus subtilis bacteriophage PBSX. J. Virol. 20 (1976) 22-28. Buxton, R.S.: Selection of Bacillus subtilis 168 mutants with deletions of the PBSX prophage. J. Gen. Virol. 46 (1980) 427-437. Dayhoff, M.O.: A model of evolutionary change in proteins. Matrices for detecting distant relationships. In Dayhoff, M.O. (Ed.), Atlas of Protein Sequence and Structure, Vol. 5, Suppl. 3. National Biomedical Research Foundation. Washington, DC, 1978, pp. 345-358. Devine, K.M., Hogan, S.T., Higgins, D.G. and McConnell, D.J.: Replication and segregational stability of the Bacillus plasmid pBAA1. J. Bacteriol. 171 (1989) 1166-1172. Dhaese, P., Seurinck, J., De Smet, B. and Van Montagu, M.: Nucleotide sequence and mutational analysis of an immunity repressor gone from Bacillus subtilis temperate phage ~b105. Nucleic Acids Res. 13 (1985) 5441-5455. Dodd, I.B. and Egan, J.B.: Systematic method for the detection of potential ~.'ro-likeDNA-binding regions in proteins. J. Mol. Biol. 194 (1987) 557-564. Gryczan, T.J., Contente, S. and Dubnau, D.: Characterization ~,f /':taph,,lococcus aureus plasmids introduced by transformation inro Bacillus subtilis. J. Bacteriol. 134 (1978) 318-329. Haas, M, and Yoshikawa, H.: Defective bacteriophage PBSH in Bacillus subtifis, I. Induction, purification and physical properties of the bacteriophage and its deoxyribonu~.leic acid. J. Virol. 3 (1969)233-247. Higgins, D.G. and Sharp, P.M.: CLUSTAL: a package for performing multiple sequence alignment on a microcomputer. Gone 73 (1988) 237-244. Laemmli, U.K.: Cleavage of structural proteins during assembly of the head protein of bacteriophage T4. Nature 227 (1970) 680-685. Ljangquist, E., Kockum, K. and Bertani, L.E,: DNA sequences of the repressor gone and operator region of bacteriophage P2. Proc. Natl. Acad. Sci. USA 81 (1984) 3988-3992. Mau~l, C. and Karamata, D.: Characterisation of proteins induced by mitomycin C treatment ofBacillus subtilis, J. Virol. 49 (1984) 806-812. M Jran, C.P., Long, N., LeGrice, S.F.J., Lee, G., Stephens, M., Sonenshein, A.L,, Pero, J. and Losick, R.: NL,cleotidesequences that signal the initiation of transcriptioa and tran 4ation in Bacillus subtilis. Mol. Gem Goner. 186 (1982) 339-346. Okamoto, K., Mudd, J.A., Mangan, J., Huang, W.M., Subbaiah, T.V. and Marmur, J.: Properties of the defective phage of Baciilu~ ~ubtili Mol. Biol. 34 (1968) 413-428. Piggot, P.J. and Buxton, R.S,: Bacteriophage PBSX-induced deletion
mutants of Bacillus subtilis 168 constitutive for alkaline phosphatase. J. Gen. Microbiol. 128 (1932) 663-669. Ptashne, M.: A Genetic Switch. Blackwell, and Cell Press, Cz~mbridge, MA, 1986. Sancar, A., Hath, H.M. and Rupp, W.D.: Simple method for identification of plasmid-coded proteins. J. Bacteriol. 137 (1979) 692-693. Sanger, F., Nicklen, S. and Coulson, A.R.: DNA sequencing with chainterminating inhibitors. Proc. Natl. Acad. Sci. USA 74 (1977) 5463-5467. Sauer, R.T., Yocum, R.R., Doolittle, R.F., Lewis, M. and Pabo, C.O.: Homology among DNA-binding proteins suggests use of a conserved super-secondary structure. Nature 298 (1982)447-451. Sharp, P.M., Cowe, E., Higgins, D.G., Shields, D.C., Wolfe, K. and Wright, F.: Codon usage patterns in Escherichia coil, Bacillus subtilis, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Drosophila melanogaster and Homo sapiens: a review of the considerable withinspecies diversity. Nucleic Acids Res. 16 (1988) 8207-8211, Shields, D.C. and Sharp, P.M.: Synonymous codon usage in Bacillus subtilis reflects both translational selection and mutational biases. Nucleic Acids Res. 15 (1987) 8023-8040. Steensma, H.Y. and Sondermeijer, P.J.A.: A counting method for determining the burst size of defective phages from B. subtilis. Antonie van Leeuwenhoek 43 (1977) 305-316. Steensma, H.Y., Robertson, I..A. and Van Elsas, J.D.: The occurrence and taxonomic value of PBSX-like defective phages in the genus Bacillus. Antonie van Leeuwenhoek 44 (1978) 353-366. Subbaiah, T.V., Goldthwaite, C.D. and Marmur, J.: Nature of bacteriophages induced in Bacillus subtilis. In Bryson, V. and Vogel, HJ. (Eds.), Evolving Genes and Proteins. Academic Press, New York, 1966, pp. 435-446. Sussman, R, and Jacob, F.: Sur une sysff)mede r/~pression thermt~sensible chez le bact6riophage d'Escherichia coll. C,R. Acad. Sci. 254 (1962) 1517-1519. Thurm, P. and Garro, A.J.: Isolation and characterisation of prophage mutants of the defectiveBacillus subtilis bacteriophage PBSX. J, Virol. 16 (1975) 184-191. Tinoco Jr., I., Borer, P.N., Dengier, B., Levine, M.D., Uhlenbeck, O.C., Crothers, D.M. and Gralla, J.: Improved estimation of secondary structure in ribonucleic acids. Nature New Biol. 246 (1973) 40-41. Van Kaer, L., Van Montagu, M. and Dhaese, P.: Transcriptional control in the EcoRI-F immunity region ofBaciUus subtilis phage ~ 105. J. Mol. Biol. 197 (1987) 55-67. Wood, H.E., Dawson, M.T., Devine, K.M. and McConnell, DJ.: Characterisation of PBSX, a defective prophage oi"Bacillus subtilis. J. Bacterioi. 172 (1990) 2667-2674. Yanisch-Perron, C., Vieira, J. and Messing, J.: Improved MI3 phage cloning vectors and host strains: nucleotide sequences of the M l3mpl8 and pUCI9 vectors. Gene 33 (1985) 103-119.