Characterisation of cDNAs homologous to Rab5-GTP binding protein expressed during early somatic embryogenesis in chicory

Plant Science 162 (2002) 413– 422 www.elsevier.com/locate/plantsci

Characterisation of cDNAs homologous to Rab5-GTP binding protein expressed during early somatic embryogenesis in chicory Be´atrice Randoux, Marie-Christine Quillet, Caroline Rambaud, Jacques Vasseur, Jean-Louis Hilbert * Laboratoire de Physiologie de la Differenciation Ve´ge´tales UPRES 2702, USTL, Uni6ersite´ des Sciences et Technologies de Lille, Baˆtiment SN2, 3e`me e´tage, F-59655 Villeneu6e d’Ascq Cedex, France Received 17 August 2001; received in revised form 19 October 2001; accepted 14 November 2001

Abstract Transcripts from the Cichorium hybrid ‘474’ (Cichorium intybus L., var. sati6um X C. endi6ia L., var. latifolia) leaf tissues were compared by differential display to identify cDNA corresponding to genes that are expressed early during somatic embryogenesis (S.E.). B1.5, one of the isolated cDNAs had a strong sequence similarity with small Ypt/Rab5 GTP binding proteins. Northern blot analyses showed that transcripts hybridising with this cDNA were present in leaf tissues of the embryogenic responsive genotype ‘474’ submitted to S.E.-inducing conditions, but were absent under these conditions when using a non-embryogenic responsive chicory cultivar. Performing 5%RACE PCR, we were able to identify CHI-GTP1 and CHI-GTP2, 2 cDNAs that represent two highly homologous genes or two alleles of one gene encoding Rab5-like GTP-binding proteins. Amplification of genomic DNA revealed the presence of 2–4 genes in the chicory ‘474’ hybrid genome. The 2 proteins deduced from CHI-GTP1 and CHI-GTP2 are 200 amino-acids long with sizes of about 22 kDa. They differed only in 3 AA. Comparing the different sequences obtained in chicory with GTP-binding proteins from others plants B1.5 most likely represent a product obtained from CHI-GTP1. Expressed in Escherichia coli, the CHI-GTP1 protein was able to bind GTP confirming its identity. In view of the proposed roles of Rab5 GTP-binding protein, the possible function of the protein encoded by CHI-GTP1 in S.E. process is discussed. © 2002 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Cichorium; Differential display; Rab5, GTP-protein; Somatic embryogenesis

1. Introduction The capacity of somatic cells in culture to form complete new embryos via a process that very much resembles zygotic embryos is called somatic embryogenesis (S.E.). The resemblance between zygotic and S.E. made the latter process attractive for in vitro studies on embryo development, especially since somatic embryos are much more accessible and amenable to experimental manipulations. Somatic embryos have been obAbbre6iations: S.E., somatic embryogenesis.  The EMBL accession numbers for the sequences reported in this paper are, respectively, AJ24985 (CHI-GTP1 ), AJ249866 (CHIGTP), AJ249867 (B1.5 ), AJ296338 (gGTP0 ), AJ296339 (gGTP8 ), AJ296340 (gGTP9 ), AJ296333 (CHI-3151 ), AJ296335 (CHI-3152 ), AJ296334 (CHI-3135 ) and AJ296336 (CHI 3154 ). * Corresponding author. Tel.: + 33-3-20436678; fax: + 33-320337244. E-mail address: [email protected] (J.-L. Hilbert).

tained in different plant species, using different starting materials [see for review [1]]. To precise the molecular mechanisms involved in S.E., protein and cDNA libraries approaches have been used [2–6]. Particularly, the carrot system contributed much to our understanding of the process of S.E. Using this model plant, different protein and genes have been identified. One of them, EP2, was identified as a lipid transfer protein whose function was to transport lipids or apolar molecules out of the cells [7]. Another one, EP3, was identified as an acidic chitinase able to restore embryo development in a temperature sensitive ts11 somatic embryo defective cell line [8]. However, these genes are more involved in embryo development than in early S.E. and so far the molecular events involved in the transition of a somatic to an embryogenic competent cell are not known. To induce S.E., the existing gene expression pattern in the starting material must be modified and replaced with an embryogenic gene ex-

0168-9452/02/$ - see front matter © 2002 Elsevier Science Ireland Ltd. All rights reserved. PII: S 0 1 6 8 - 9 4 5 2 ( 0 1 ) 0 0 5 8 2 - 9

414

B. Randoux et al. / Plant Science 162 (2002) 413–422

pression program in cells competent to give rise to somatic embryos. The low number of embryogenic competent cells and the limits of the screening procedures which give access to abundantly expressed genes, are some reasons for the absence of informations about the earliest molecular events concerning the induction of S.E. To overcome these limits, a differential display RT-PCR strategy has been used on carrot embryogenic and non-embryogenic cell cultures [9]. This yield to the identification of a leucine-rich repeat containing receptor kinase that marks specifically plant cells competent to form somatic embryos. To identify genes that are expressed during early induction of S.E. in plants, our group is using a chicory genotype that is highly embryogenic upon applying S.E.-inducing culture conditions [10– 13]. Even more so, by including glycerol in the embryo-culture medium (induction medium) the first cell division of the embryogenic cells can be delayed until a transfer to a medium without glycerol (expression medium). This results in a synchronised initial cell divisions of the induced cells [14] and made clone ‘474’ attractive as material to further investigate S.E. in chicory. Using this plant, we have previously reported that the expression of CG1, a cDNA coding for b-1,3-glucanases [15,16] and CHI3207, a cDNA coding for a leghemoglobin [17], were correlated with the process of S.E. To obtain more information about genes expressed during S.E. we have employed the mRNA differential display method [18]. In this paper we describe the presence of at least 2 GTP-binding protein genes expressed during early S.E. The expression of one of these genes seems to be elevated specifically during the induction of S.E. in leaf tissues. By differential screening of a library and 5%RACE PCR, full size clones were reconstituted. Their sequences revealed that they encode for Rab5 GTPbinding protein homologues. The possible functions of these proteins during S.E. are discussed.

2. Materials and methods

2.1. Plant material and somatic embryogenesis conditions Plantlets of chicory hybrid clone ‘474’ (Cichorium intybus L., var. sativum× C. endi6ia L., var. latifolia) were grown in vitro as described previously [19]. Leaf fragments of 6-week-old plantlets were cultured for 5 days at 35 °C in the dark in 20 ml of an agitated Murashige– Skoog medium [20] supplemented with sucrose (60 mM) and glycerol (330 mM) to induce S.E. The presence of glycerol during this induction step allowed activation of the mesophyll cells for embryogenic competence, without cell divisions [14]. This glycerol pre-treatment synchronised the first divisions of the

embryogenic cells, because, these divisions only occurred after transfer of the 5-day-old induced leaf-tissues to glycerol-free medium [21].

2.2. Nucleic acid isolation Total RNA of leaf fragments from non-induced cultures, from 1-day, 2-day, 3-day, 4-day and 5-day old induced cultures, and from 5-day old induced tissues transferred 3 days on glycerol free medium, were extracted according to [22]. Poly(A)+ RNA were purified on oligo (dT)-cellulose column (Gibco BRL). Total genomic DNA was extracted from leaf tissues of the Cichorium ‘474’ hybrid as described [23]. In each PCR reaction, 40 cycles were made using 10 ng of DNA and primers deduced from the RACE PCR results.

2.3. Differential display and cloning of cDNA bands Differential display was performed essentially as described by [18]. Poly(A) + RNA samples (0.5 mg) were used for the first strand cDNA synthesis. T12GC anchor primer was used for reverse transcription reactions. PCR amplification of one-tenth of the first strand synthesis cDNA products was done using a set of 20 decamers (RAPD Primer kit B, Operon Technologies) in combination with T12GC primer. The PCR-reaction mixture (25 ml) contained 5 ml of the 1:50–1:200 diluted RT reaction, 100 mM dNTPs, 500 mM MgCl2, 5 pmol of each cDNA clone specific oligonucleotides and 0.6 U of TAQ polymerase (Appligene). Template cDNA was amplified in a 9600 Perkin–Elmer thermal cycler for 25 cycles of melting at 92 °C and extension at 72 °C. Dilution of RT samples and PCR annealing temperature were optimised for each studied cDNA clone. Amplified cDNAs were electrophoresed through a 6% denaturing polyacrylamide gel. Electrophoresis was done at constant 60 V for 3–4 h and cDNAs were revealed after silver staining [24]. The 1 kb ladder of Gibco BRL was used as the molecular weight markers. cDNA bands of interest, identified on the silver stained gels, were excised, eluted and reamplified using the same primers and PCR conditions as before. PCR products were analysed on a 1.2% agarose gel and cDNAs were purified from agarose slices using the QIAquick gel extraction kit (Qiagen). The PCR product was then ligated and subcloned in pTAg vector of the ligATor plus Ligase kit (R&D Systems) and sequenced. cDNA band inserts were random-radiolabeled and used as probe in RNA blot analysis.

2.4. Library construction and screening A cDNA library was prepared with 1 mg of poly(A)+ RNA, isolated from 3 day-old induced leaf-tissues, using the Uni-Zap XR cDNA kit (Stratagene) and was

B. Randoux et al. / Plant Science 162 (2002) 413–422

415

packaged using Gigapack Gold Packaging extract (Stratagene) following the manufacter’s instructions. The library was screened with a cDNA probe labelled by [32P]-dATP and corresponding to the cDNA cloned previously after differential display. Several full length cDNA clones were isolated and sequenced.

blotted, and the blot hybridised with a probe corresponding to the partial cDNA cloned after differential display RT-PCR. Northern blot hybridisation, using an 18S ribosomal RNA probe from Cichorium intybus [27], was realised to estimate if equal amounts of RNA were used to perform the RT-PCR reactions.

2.5. Northern blot analysis

2.8. Production of a recombinant CHI-GTP1 protein and GTP binding assay

mRNA aliquots (1 mg) from the different samples were electrophoretically separated in 1.2% agarose gels containing 3% formaldehyde, 20 mM sodium phosphate and transferred to GeneScreen nylon membranes (Dupont, NEN). The cDNA inserts were labelled with [32P]-dCTP by random priming with the T7QuickPrime Kit (Pharmacia). Hybridisation was performed in a solution 5× SSC, 5 × Denhardt’s solution, 50 mM sodium phosphate pH 6.8, 0.1% (w/v) SDS, 50% formamide and 10 mg/ml denatured salmon sperm DNA for 24 h at 42 °C. The blots were washed at low stringency with the same solution and then at high stringency with 0.1× SSC, 0.1% SDS. Autoradiograms were prepared by exposing the blots to Kodak X-Omat AR film for 5– 10 days.

2.6. DNA sequence analysis and 5 % rapid amplification of cDNA ends (5 %RACE) Inserts were sequenced using a LI-COR Long ReadIR DNA sequencer. Fluorescently labelled dideoxy terminators were incorporated into the DNA fragment using the Sequenase Version 2 kit (Amersham). The data were collected and analysed using the BASE IMAGE IR L-400005 software. All sequencing reactions were overlapped, to double-check the sequence data, and these data were manually inspected to confirm base assignments. DNA similarities searches were performed using the BLAST network service at the national centre for biotechnology information. 5%RACE was done as described [25] by adding a poly (C) at the end of all cDNA obtained by reverse transcription and by using a 5% —poly(G) — 3% in combination with the specific primer 5%-TCATGCTGTTCATAAGTAATGTTTTT-3% deduced from the partial sequences.

2.7. RT-PCR analyses Non selective RT-PCR was done as described by [26]. mRNA were submitted to reverse transcription as described in RT-PCR reactions. T12 anchor primer was used for reverse transcription reactions and a poly (C) was add at the 3% end. PCR was made using a poly (T)-EcoRI and a poly (G) as primers. The presence of the EcoRI site contributed to choose a similar annealing temperature for the two primers. Finally, amplified DNA fragments were electrophoresed in a 1.5% agarose gel,

BamHI and XhoI sites were introduced, respectively, at the 5% end and the 3% end of the open reading frame of the GTP1 cDNA by PCR-mediated site-directed mutagenesis. The BamHI-Xho1 restriction fragment retaining the CHI-GTP1 open reading frame was ligated into pET16 (Novagen) to generate pET-CHIGTP1 which was used to produce a His-tagged CHI-GTP1 protein. The construction was sequenced to confirm the fidelity of the insert. The bacterial strain BL21 (DE3)pLysS (Novagen) was used as expression host. To induce expression of CHI-GTP1, IPTG (0.2 mM, final concentration) was added to the bacterial culture when cell density reached OD600 0.6. The GTP-g-35S labelling procedures were essentially as described [28]. Bacterial protein were extracted, heated at 100 °C for 3 min, resolved by SDS-PAGE and electroblotted to a nitrocellulose membrane [15]. The electroblotted membrane was incubated for 1 h at 20 °C in a buffer containing 50 mM Tris–HCl, pH 7.5, 0.3% Tween 20, 2 mM MgCl2 and 3 nM of 35S GTP. Labelled protein was visualised by autoradiography after 2 days exposure at room temperature. As control we used a pET construction which was prepared to produce a His-tagged chicory hemoglobin protein [17].

3. Results

3.1. Screening for genes expressed during somatic embryogenesis by DDRT-PCR To study the expression of genes during S.E., poly(A)+ RNA was extracted from leaf tissue explants of the embryogenic ‘474’ Cichorium hybrid and a non-embryogenic Cichorium submitted to S.E. inducing (day 1–5) and expression (day 5+ 3; i.e. present for 3 day in the expression medium after 5 day induction) conditions and used for DDRT-PCR. Of the 25’ arbitrary decamers (B1-20) that were used in combination with the 3%T12GC anchor primer, 19 DDRT-PCR reactions yielded 80–100 DNA bands ranging from 100–600 bp in length. No amplification was observed in the reactions using the B3 decamer (results not shown). DDRT-PCR performed with the B1 decamer (GTTTCGTCC) in combination with the T12GC an-

416

B. Randoux et al. / Plant Science 162 (2002) 413–422

chor primer, revealed the presence of a 540 bp DNA fragment that seemed to correspond to mRNAs that accumulated during the S.E. induction phase and were present at a relative high level during the S.E. expression phase (Fig. 1). After elution from the gel, this DNA fragment B1.5 (obtained using the B1 primer and detected at day 5) was reamplified using the same set of primers as used for the DDRT-PCR, and cloned for further characterisation.

3.2. Expression of the gene corresponding to the B1.5 partial cDNA Upon hybridisation of the DDRT-PCR products using B1.5 as a probe, the increase in the level of mRNAs corresponding to the B1.5 DNA fragment in leaf tissue developing somatic embryos was confirmed (Fig. 2A). In fact, the 540 bp DNA fragment was already detected at day 0, i.e. in the non-induced leaf tissue of the embryogenic ‘474’ hybrid, albeit at a low level. In addition to the 540 bp fragment, two additional signals were observed corresponding to DNA fragments of 340 and 350 bp (Fig. 2A). These latter signals were also detected in leaf tissue of the non-embryogenic genotype ‘Pe´ ve`le’ (Fig. 2B) and remained at constant levels during the induction and expression phase of S.E. culture conditions (Fig. 2A and B). The 540 bp B1.5 DNA

Fig. 2. Hybridisation of DDRT-PCR products with the B1.5 probe. DDRT-PCR products were obtained from poly(A) + RNA isolated from non-induced leaf tissue (day 0), leaf tissues submitted to S.E. induction (day 1 – 5), and leaf tissues submitted 5 days to S.E. induction and cultured for 3 days in expression medium (day 5 + 3) of the Cichorium hybrid‘474’ embryogenic responsive line (A) or of the Cichorium cv.‘Pe´ ve`le’ non-embryogenic responsive cultivar (B). Total DDRT-PCR products were separated by agarose electrophoresis and transferred to GenScreen nylon membranes (Dupont, NEN Biomedical). The probe corresponding to partial B1.5 was [32P] labelled by random priming with the T7 QuickPrime Kit (Pharmacia Biotech.). Autoradiographic gels were revealed after 1 day exposure for the embryogenic responsive genotype and after 10 days for the non-embryogenic responsive Pe´ ve`le.

fragment however was never detected in leaf tissue explants of the non-embryogenic genotype ‘Pe´ ve`le’ (Fig. 2B). These results indicated that the B1.5 cDNA hybridised to the products of three different mRNAs and that one of them seemed to be derived from a gene of which the expression is enhanced upon S.E. Northern blot analysis and hybridisation of non selective RT-PCR products (not shown) obtained from RNA extracted from leaf tissue explants of the embryogenic ‘474’ hybrid, using B1.5 cDNA as a probe, confirmed the presence of at least two mRNAs which differed slightly in length. One of them, about 800 bp long, was present in the non-induced leaf tissue and at a constant level in leaf tissue explants developing somatic embryos, whereas the other, about 1000 bp long, was detected only in the latter.

3.3. Sequence analysis of B1.5 cDNA

Fig. 1. Detection of B1.5 by silver-staining after differential display of poly(A)+ RNA isolated from non-induced leaf tissue (day 0), leaf tissue submitted to S.E. induction (day 1 –5), and leaf tissue submitted 5 days to S.E. induction and cultured for 3 days in expression medium (day 5 +3) of the Cichorium hybrid ‘474’ embryogenic responsive line. mRNA were reverse transcribed with the anchored primer T12GC. The anchor primer and the B1 (-GTTTCGCTCC-) were used for the amplification step of differential display.

Sequencing of the partial B1.5 cDNA clone showed it to consist of a 501 bp fragment containing the complete sequence of the B1 and the first 3 nt of the T12GC primers, and a putative ORF encoding 126 amino acids (not shown). At the nucleotide level, B1.5 showed 77 and 78% sequence similarity with cDNAs encoding the small GTP-binding proteins LJRAB 5A from Lotus japonicus [29] and VFRAB5GTPB from Vicia faba [30], respectively. At the amino acid level, the 126-aa peptide putatively encoded by B1.5 was 92% identical to the 126 amino-acids of the carboxyl end of LJRAB 5A [29], and showed the highly conserved —FMETSA — sequence present in many Rab-like GTP-binding proteins [31]. From these results it appeared that the gene

B. Randoux et al. / Plant Science 162 (2002) 413–422

represented by the B1.5 partial cDNA encodes a GTPbinding protein homologous to Rab5.

3.4. Full length cDNAs encoding Rab5 -like GTP-binding proteins obtained by screening a cDNA library and 5 %RACE PCR A cDNA library from poly(A)+ RNA extracted from leaf tissue explants of the ‘474’ chicory hybrid after 3 day of S.E. induction [17] was screened using the B1.5 partial cDNA as a probe. Four clones -CHI3151, CHI3152, CHI3153, and CHI3154- were obtained containing inserts of 743, 776, 749, and 797 bp long, respectively (data not shown). The inserts of CHI3152 and CHI3154 contained complete 600 bp ORFs that were identical except for a single G-T transition, and encoded Rab-like GTP-binding proteins, but differed in their 3% and 5% non-coding sequences. The inserts of CHI3151 and CHI3153 contained incomplete ORFs that were identical in sequence to the ORF in CHI3152, but missed the first 11 bp of the ORF sequence. Despite that they started at exactly the same position, the inserts in CHI3151 and CHI3153 also differed in the 3%non-coding region. These results suggested that the four cDNA clones obtained by screening the cDNA library represented four different mRNAs present in leaf tissue explants developing somatic embryos that code for GTP-binding proteins. When the sequences of the B1.5 partial cDNA clone and the four cDNA clones from the cDNA library were compared, 12 nt differences were detected in the overlapping ORF sequences with CHI3151, CHI3152 and CHI3154, while 11 nt differences were detected with CHI3153. In addition, there were 5, 8, 19 and 25 nt differences between the overlapping 3% non-coding regions of B1.5 and CHI3151, CHI3154, CHI3152, and CHI3153, respectively (results not shown). This suggested that B1.5 represented a fifth mRNA encoding a GTP-binding protein, or that the sequence of B1.5 has accumulated some mistakes due to the PCR reactions used for differential display and cloning. In an attempt to find out which of the two possibilities was true, 5% RACE PCR was performed using a 26-mer primer (TCATGCTGTTCATAATGTTTTT) that matched a common region around the stop codon present in the ORFs of B1.5 and the 4 other cDNA clones. Two major bands, designed CHI-GTP1 and CHIGTP2, were observed after hybridisation of the 5% RACE PCR products obtained after using poly(A)+ RNA from leaf tissues developing somatic embryos, whereas using poly(A)+ RNA from non-induced leaf tissues yielded only CHI-GTP2 (Fig. 3). These results were similar to the results obtained previously by Northern blot analysis and non selective RT-PCR, and confirmed the enhanced expression of at least one gene encoding a Rab-like GTP-binding protein during S.E.

417

in chicory. The 5% RACE PCR products CHI-GTP1 and CHI-GTP2 were cloned, sequenced, and their sequences compared with B1.5. CHI-GTP1 contained an ORF of 600 bp encoding a 200 amino-acid Rab-like GTP-binding protein that was preceded by a 153 bp 5% non-coding region. Also CHI-GTP2 contained an ORF of 600 bp encoding a 200 amino-acid Rab-like GTPbinding protein, and was preceded by a 38 bp 5% non-coding region. The ORFs in CHI-GTP1 and CHIGTP2 differed in only 10 nt, whereas no differences were detected in the overlapping region of the 5% noncoding region. This suggests that CHI-GTP1 and CHIGTP2 represent two highly homologous genes or two alleles of one gene. When compared with B1.5, the sequences of CHIGTP1 and CHI-GTP2 differed from B1.5 in 8 and 12 nt, respectively, in the overlapping region. The CHIGTP1 and CHI-GTP2 deduced proteins are both 200 amino acids long (Fig. 4), including the N-terminal methionine and have calculated molecular masses of 21 881 and 21 782 Da and pIs of 6.84. and 6.31, respectively. The two proteins were different in three aminoacids only. When compared with the partial protein deduced from the B1.5 clone, the overlapping aminoacid sequence differed in two amino-acids with GTP1 and one amino-acid with GTP2. Sequence alignment of the deduced proteins and those of other small GTPbinding proteins in the SwissProt database (Fig. 4), shows 88–96% identity. The highly conserved regions involved in the binding and hydrolysis of GTP (G1, G3-G5 domains) were present, as well as the conserved Ypt/Rab domain. Comparing the deduced protein sequences (Fig. 4) and GTP protein from other plants, it may be that the few differences observed at the proteins level are the results of mistakes introduced during the initial RT-PCR experiments. In the latter case, B1.5 most likely represent a product obtained from GTP1 mRNAs.

Fig. 3. Hybridisation with B1.5 of the 5% RACE PCR products corresponding to poly(A) + RNA isolated from non-induced leaf tissue (day 0), leaf tissues submitted to S.E. induction (day 1 –5), and leaf tissues submitted 5 days to S.E. induction and cultured for 3 days in expression medium (day 5 + 3) of the Cichorium hybrid ‘474’ embryogenic responsive line. RACE-PCR was done using a 5%— poly(G) — 3% in combination with the specific primer 5%—TCATGCTGTTCATAAGTAATGTTTTT— 3% deduced from the different sequences and corresponding to a region containing the stop codon.

418

B. Randoux et al. / Plant Science 162 (2002) 413–422

Fig. 4. Alignment of the predicted amino-acid sequence encoded by clone CHI-GTP1 and CHI-GTP2 with 4 GTP-binding proteins from different plant species. Sequences were obtained from the GenBank database and represent accession numbers Z73938 (L. japonicus), Z37503 (V. faba), X64948 (Nicotiana plumbaginifolia), X63875 (Nicotiana tabacum). Alignment of sequences was done using CLUSTALW at the Network Protein Sequence @nalysis (IBCP, France). Identical amino-acid residues are represented by dots. The conserved regions (G1, G3-G5) which are common to nearly all the small GTP binding proteins and the conserved Ypt-Rab-domain [Bourne et al., 1991] are boxed. The G2/effector region and the C-terminal cysteine region are also boxed.

3.5. The chicory genome contains se6eral genes encoding RAB-like GTP-binding proteins The previous results suggested that the chicory genome contains several genes encoding RAB-like GTP-binding proteins. In an attempt to determine the number of Rab5-like genes in the genome of the chicory ‘474’ hybrid, Southern approaches were developed. Due to the low quality of the Southern-blots results, genomic DNA was used as template for a PCR reaction with primers corresponding to two regions (GGGAGCTGGTAAATCAAGTCT and TTCATTTACACGGGCTAAAAA) delimiting a 252 bp sequence of CHI-GTP1. Amplification of genomic DNA with these primers yielded four products of 460, 760, 870, and 1300 bp, respectively, (Fig. 5), suggesting the presence of 2–4 genes in the chicory ‘474’ hybrid genome that code for Rab-like GTP-binding proteins. No one of the amplified products had the expected 252 bp size suggesting that they were constituted at least by one intron. From the four bands visualised three, CHIgGTP0 (468 bp), CHI-gGTP8 (873 bp) and CHIgGTP9 (757 bp), were cloned and sequenced. Alignment of CHI-gGTP0, CHI-gGTP8, CHI-gGTP9, CHI-GTP1 and CHI-GTP2, revealed that the three

genomic sequences had each two intronic regions (data not shown). These sequences were different in size and in nucleotides in each clone but they were inserted in the same exonic region. The comparison of the exonic regions (Table 1) showed that CHI-gGTP0 differed from CHI-GTP1 and CHI-GTP2, respectively, in 24 and 25 bp. But only one nucleotide differed CHIgGTP8 with CHI-GTP1, and CHI-gGTP9 with CHIGTP2. In Fig. 6, comparison of the amino-acid sequences deduced from CHI-gGTP0, CHI-gGTP8, CHI-gGTP9 with those of CHI-GTP1 and CHI-GTP2, revealed in position 29 of GTP1, the presence of a

Fig. 5. Agarose separation of PCR products obtained from genomic DNA using 2 primers — GGGAGCTGGTAAATCAAGTCT and TTCATTTACACGGGCTAAAAA—delimiting a 252 bp sequence of CHI-GTP1. Marker size in the right margin is in bp.

B. Randoux et al. / Plant Science 162 (2002) 413–422

419

Table 1 Nucleotide sequence differences when the exonic regions of the three genomic clones CHI-gGTP0, CHI-gGTP8 and CHI-gGTP9 were compared with CHI-GTP1 and CHI-GTP2

CHI-GTP1 CHI-GTP2

CHI-gGTP0 (nt)

CHI-gGTP8 (nt)

CHI-gGTP9 (nt)

24 25

1 4

4 1

The value indicates the number of nucleotides differences.

leucine in place of the arginine observed in the four other sequences. This corresponds to a CTA/CGA substitution in the nucleotide sequence of CHI-GTP1. In position 53 of GTP2, the alanine present in gGTP0, gGTP8, gGTP9 and GTP1 was substituted by a valine in GTP2. This corresponds to a GTA/GCA substitution in CHI-GTP2. In position 95, we have an alanine except for gGTP0 in which we have a valine. This corresponds to a GTG/GCG substitution in CHIgGTP0. These substitutions are probably the results of mistakes introduced during the PCR experiments. However these comparisons suggest that GTP1 and GTP2 may correspond to two different genomic sequences.

3.6. The CHI-GTP1 encoded protein has affinity to GTP Sequence analysis of CHI-GTP1 and CHI-GTP2 suggested that they represent genes encoding GTPbinding proteins. To test whether the putative GTP1 protein indeed is capable of binding GTP, the CHIGTP1 ORF was subcloned in E. coli and the expressed protein assayed for GTP binding. SDS-PAGE of proteins extracted from the transformed bacteria revealed the presence of a major protein band of 24.1 kDa (Fig. 7A, GTP1), that corresponds to the expected molecular mass of the GTP1 recombinant protein. This protein was absent from bacteria transformed with a chicory hemoglobin cDNA [17] used as a control in the

Fig. 7. GTP-binding activity of GTP1. Total proteins were extracted from BL21 bacterial cells transformed with a pET16-hemoglobin construction (Control) or pET-GTP1 (GTP1). After resolution by SDS-PAGE, proteins were stained with Coomassie blue (A), or transferred to nitrocellulose and incubated with 3 nM 35S GTP gS and 2 mM MgCl2 (B). The 24.1 and the 20.2 kDa signals, respectively, indicate the CHI-GTP1 and the hemoglobin fusion protein.

GTP-binding assay (Fig. 7A and B, Control). As shown in Fig. 7B, this 24.1 kDa protein band was labelled upon incubation of the gel with 35S-labelled GTP. This suggests that the GTP1 protein has indeed affinity for GTP, and thus seems to confirm its identity as a GTP-binding protein.

4. Discussion In chicory, combining mRNA differential display technique, cDNA library screening and RACE-PCR, we have identified and cloned a partial cDNA B1.5 and two full length CHI-GTP1 and CHI-GTP2 cDNAs highly homologous to small Rab5 GTP-binding proteins from L. japonicus [29] and from V. faba [30]. Sequence analysis indicated that (i) the two full length cDNAs differed only in 10 nucleotides in the overlapping sequence, (ii) that the deduced proteins are both 200 amino acids long and were different in 3 amino-

Fig. 6. Alignment of the predicted amino-acid sequence encoded by clone CHI-GTP1 and CHI-GTP2 with the proteic sequences deduced from the coding region of the 3 genomic clones CHI-gGTP0, CHI-gGTP8 and CHI-gGTP9.

420

B. Randoux et al. / Plant Science 162 (2002) 413–422

acids only and (iii) that B1.5 probably correspond to CHI-GTP1. Using specific primers, PCR amplification of the genomic DNA showed the presence in the chicory embryogenic genotype ‘474’ of at least three different genomic sequences highly homologous to the Rab5 family. One of them (gGTP8 ) was very similar to CHI-GTP1 while another (gGTP9 ) was very similar to CHI-GTP2. This suggested that CHI-GTP1 and CHIGTP2 mRNA were resulting from two different genes or represent two alleles of one gene. Higher plant genes coding for small GTP-binding proteins are highly homologous in animal and yeast [32,33]. Based on sequence similarities, subcellular localisation, and putative functions, these proteins have been divided into three major groups, the Ras, the Rho, and Ypt/Rab families. The Ras proteins may be involved in the transduction of external signals and in the regulation of cell growth and differentiation [34]. The Rho proteins seem to play particularly critical roles in cytoskeletal reorganisation, cell polarity and adhesion [32,35]. The Ypt/Rab proteins are putatively involved in the vesicular transport, organelle dynamics and membrane biogenesis [36,37]. Plant small Ypt/Rab GTP binding proteins have been identified in different tissues [31,38]. They have common structural features characterised by the presence of four conserved motifs named G1, G3, G4 and G5 [39,40], involved in the GTP binding and hydrolysis. The factors that will modulate the GTPases are interacting with a G2 element that is unique to each subclass of small GTP-binding proteins. Even so, the presence in the carboxyl terminal region of an hypervariable cystein-residue-containing motif is required for isoprenoid modification used for anchoring to membranes [40,41]. These variations in the structure of many subclasses may suggest that these subclasses interact with different factors. Further it has been proposed that, if GTPase genes are regulated in a mosaic expression patterns, these determinants must have a strong impact on cellular differentiation processes, and hence on tissue and organ development. Different members of the Rab protein family were considered as transducers in transmembrane signalling pathways or supposed to play a role in vesicular transport and secretion but also in organelle dynamics [36]. In the GTP-bound conformation and by interacting with effectors, they are presumed able to direct vesicle trafficking for fusion with target membranes. At present only a few effectors are known, including rabaptin-5, the effector of Rab5 [42]. In the embryogenic responsive genotype ‘474’, the transcription of one Rab5 GTP-binding protein gene (CHI-GTP1 ) was enhanced during S.E., whereas the same gene was not expressed in leaf tissue explants from the non-embryogenic C. intybus cv. Pe´ ve`le cultured under similar conditions. The expression of this gene is not related to stress caused by wounding or

tissue culture conditions, because, it is never detected when using the non-embryogenic responsive genotype. However, in both cultivars at least two other homologous transcripts were present, indicating that other members of the GTP-binding protein gene family were expressed constitutively. Results obtained by screening a cDNA library with the B1.5 probe confirm this possibility. During the embryogenic culture the level of both transcripts hardly changed, suggesting that they encode GTP-binding proteins that may have a function in cell maintenance or other household processes. An analogous situation was described in L. Japonicus nitrogen-fixing root nodules. In these nodules, it has been shown that specific expression of Rab5 GTP-binding proteins was essential for the development of the peribacteroid membrane compartment in effective nodules [43]. A first gene, Lj-Rab5B, was expressed constitutively and similarly in mature or immature nodules and in young leaf tissues. But the expression of a second gene, Lj-Rab5A, was increased during the nodule differentiation and correlated to endocytic processes observed during nodules differentiation. In this plant, the expression of antisense constructions under the control of a root nodule specific promoter drastically decreased the number of root nodule formed on transgenic roots after infection with a Bradyrhizobium. More recently, 33 small GTP-binding proteins were isolated from a cDNA library corresponding to mRNAs accumulated in 3-week-old root nodules of L. Japonicus [29]. If most of them appear to be constitutively expressed, six of them related to the Rab subclass, show elevated levels in the nodules or were enriched in aerial parts of the plants. Even if most GTPases have household functions, these observations suggested that some of them might be required for specialised activities that are important for specialised cells. Upon S.E. induction, 1–2% somatic cells in leaf tissue explants of the Cichorium ‘474’ hybrid will be reactivated and develop into embryos [12]. The expression pattern of the CHI-GTP1 gene suggests that its product might be involved in the responsiveness of the ‘474’ hybrid to the complex process of cell dedifferentiation and redifferentiation leading to the development of somatic embryos. Before their first divisions, the embryogenic cells are characterised by a thicker wall and surrounded by a callose sheath [11]. After the first division, the callose will disappear and the nature of the pectic compounds in the cell wall of the embryos is modified [44]. Small GTP-binding proteins were proposed to be required for zygotic embryo viability in Antirrhinum [45] and were also detected in wheat somatic embryos [46,47]. It was hypothesised that Rha1, identified in the receptacles of flowering Arabidopsis plants and highly homologous to Rab5, may be involved in cell plate formation, cell-wall thickening or membrane biogenesis which requires vesicle-mediated

B. Randoux et al. / Plant Science 162 (2002) 413–422

processes [31,36]. In view of the proposed role(s) of Rab GTP-binding proteins [38], the elevated level of CHI-GTP1 transcripts, during S.E., may also be indicative for a role of the protein(s) encoded by CHI-GTP1 in the processes related to these changes in cell wall composition, e.g. endocytosis of cell wall components. In conclusion, in this paper we have shown a temporal correlation between the differential expression of genes coding for Rab5-like-G-proteins and S.E. in chicory. Irrespective its function, to further study the implication of CHI-GTP1, it will be necessary to precise where and when it is expressed in leaf tissues developing S.E. Due to the structural homology of the different genes identified in this paper, one approach would consist to investigate the promoter of CHI-GTP1 in order to use it in association with a marker gene (i.e. GFP) in transformation assays.

[10]

[11]

[12]

[13]

[14]

[15]

[16]

Acknowledgements This work was supported by a ‘Contrat Plan-EtatRegion’ to the Laboratoire de Physiologie de la Differenciation Ve´ ge´ tales and by a doctoral fellowship of the Conseil Re´ gional Nord-Pas de Calais to Beatrice Randoux. Many thanks go to Theo Hendriks for helpful discussions and suggestions during the preparation of this manuscript.

References [1] A.P. Mordhorst, M.A.J. Toonen, S.C. de Vries, Plant embryogenesis, Crit. Rev. Plant Sci. 16 (1997) 535 – 576. [2] G. Hahne, J.E. Mayer, H. Lorz, Embryogenic and callus-specific proteins in somatic embryogenesis of the grass, Dactylis glomerata L, Plant Sci. 55 (1988) 267 –279. [3] E.S. Wurtele, H. Wang, S. Durgerian, B.J. Nikolau, T.H. Ulrich, Characterization of a gene that is expressed early in somatic embryogenesis of Daucus carota, Plant Physiol. 102 (1993) 303 – 312. [4] S. Stirn, A.P. Mordhorst, S. Fuchs, H. Lo¨ rz, Molecular and biochemical markers for embryogenic potential and regenerative capacity of barley (Hordeum 6ulgare L.) cell cultures, Plant Sci. 106 (1995) 195 – 206. [5] R.W. Giroux, K.P. Pauls, Characterization of embryogenesis-related proteins in alfalfa (Medicago sati6a), Physiol. Plant 96 (1996) 585 – 592. [6] R.W. Giroux, K.P. Pauls, Characterization of somatic embryogenesis-related cDNAs from alfalfa (Medicago sati6a L.), Plant Mol. Biol. 33 (1997) 393 –404. [7] P. Sterk, H. Booij, G.A. Schellekens, A. van Kammen, S.C. de Vries, Cell-specific expression of the carrot EP2 lipid transfer protein gene, Plant Cell 3 (1991) 907 –921. [8] A.J. De Jong, J. Cordewener, F. Lo Schiavo, M. Terzi, J. Vandekerckove, A. Van Kammen, S.C. de Vries, A carrot somatic embryo mutant is rescued by chitinase, Plant Cell 1 (1992) 425 – 433. [9] E.D.L. Schmidt, F. Guzzo, M.A.J. Toonen, S.C. de Vries, A leucine-rich repeat containing receptor-like kinase marks somatic

[17]

[18]

[19]

[20]

[21]

[22]

[23] [24]

[25] [26]

[27]

[28]

[29]

421

plant cells competent to form embryos, Development 124 (1997) 2049 – 2062. T. Dubois, J. Dubois, M. Guedira, J. Vasseur, Embryogene`se somatique directe sur les styles de Cichorium: effets de la tempe´ rature et origine des embryoı¨des, C.R. Acad. Sci. Paris 307 (se´ rie III) (1988) 669 – 675. T. Dubois, J. Dubois, M. Guedira, J. Vasseur, Direct somatic embryogenesis in roots of Cichorium. Is callose an early marker, Ann. Bot. 65 (1990) 539 – 545. T. Dubois, J. Dubois, M. Guedira, J. Vasseur, Direct somatic embryogenesis in leaves of Cichorium. A histological and SEM study of early stages, Protoplasma 162 (1991) 120 – 127. M. Guedira, T. Dubois-Tylski, J. Vasseur, J. Dubois, Embryogene`se somatique directe a` partir de cultures d’anthe`res du Cichorium (Asteraceae), Can. J. Bot. 67 (1989) 970 – 976. A.-S. Robatche-Claive, J.-P. Couillerot, J. Dubois, T. Dubois, J. Vasseur, Embryogene`se somatique directe dans les feuilles du Cichorium hybride ‘474’: synchronisation de l’induction, C.R. Acad. Sci. 314 (se´ rie III) (1992) 371 – 377. S. Helleboid, G. Bauw, L. Belingheri, J. Vasseur, J.-L. Hilbert, Extracellular ß-1,3-glucanases are induced during early somatic embryogenesis in Cichorium, Planta 205 (1998) 56 – 63. S. Helleboid, A. Chapman, T. Hendriks, J. Vasseur, J.-L. Hilbert, Cloning of ß-1,3-glucanases expressed during Cichorium somatic embryogenesis, Plant Mol. Biol. 42 (2000) 377 –386. T. Hendriks, I. Scheer, M.-C. Quillet, B. Randoux, B. Delbreil, J. Vasseur, J.-L. Hilbert, A non-symbiotic hemoglobin gene is expressed during somatic embryogenesis in Cichorium, Biochim. Biophys. Acta 1443 (1998) 193 – 197. P. Liang, A.B. Pardee, Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction, Science 257 (1992) 967 – 971. S. Helleboid, J.-P. Couillerot, J.-L. Hilbert, J. Vasseur, Inhibition of direct somatic embryogenesis by a-difluoromethylarginine in a Cichorium hybrid: effects on polyamine content and protein patterns, Planta 196 (1995) 571 – 576. T. Murashige, F. Skoog, A revised medium for rapid growth and bioassays with tobacco tissue culture, Physiol. Plant 15 (1962) 473 – 497. A.-S. Blervacq, T. Dubois, J. Dubois, J. Vasseur, First divisions of somatic embryogenic cells in Cichorium hybrid ‘474’, Protoplasma 186 (1995) 163 – 168. J.M. Chirgwin, A.E. Przybyla, R.J. MacDonald, W.J. Rutter, Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease, Biochemistry 18 (1979) 5294 –5299. S.L. Dellaporta, J. Wood, J.B. Hicks, A plant DNA minipreparation: version II, Plant Mol. Biol. Rep. 1 (1983) 19 – 21. J. Lohmann, H. Schickle, T.C.G. Bosch, REN, a rapid and efficient method for non-radiactive differential display and isolation of mRNA, Biotechniques 18 (1995) 200 – 202. D.J. Bertioli, P.R. Burrows, A simple RACE method based on CTAB precipitation, Methods Mol. Cell. Biol. 5 (1995) 118 –121. C. Breton, Clonage et caracte´ risation de ge`nes exprime´ s durant l’embryogene`se zygotique pre´ coce du maı¨s, Ph.D. dissertation, Universite´ de Lyon, France, 1993. A. Bellamy, Application du polymorphisme mole´ culaire de l’ADN a` l’identification varie´ tale de Cichorium intybus, Ph.D. dissertation, Universite´ de Paris-Sud, Orsay, France, 1992. W.Y. Kim, H.K. See, J.Y. Jeong, S.Y. Lee, D.Y. Je, M.J. Cho, J.D. Bahk, Molecular characterization of a Rab-related small GTP binding protein cDNA from Rice (Oryza sati6a L. IR-36), Mol. Cells 7 (1997) 226 – 230. S. Borg, B. Brandstrup, T.J. Jensen, C. Poulsen, Identification of new protein species among 33 different small GTP-binding proteins encoded by cDNAs from Lotus japonicus, and expression of corresponding mRNAs in developing root nodules, Plant J. 11 (1997) 237 – 250.

422

B. Randoux et al. / Plant Science 162 (2002) 413–422

[30] G. Saalbach, J. Thielmann, Isolation and characterisation of five cDNA-clones encoding small GTP-binding proteins from field bean (Vicia faba), J. Plant Physiol. 145 (1995) 665 – 673. [31] N. Terryn, M. Van Montagu, D. Inze´ , GTP-binding proteins in plants, Plant Mol. Biol. 22 (1995) 143 –152. [32] D.P. Delmer, J.R. Pear, A. Andrawis, D.M. Stalker, Genes for small GTP-binding proteins analogous to mammalian Rac are preferentially expressed in developing cotton fibers, Mol. Gen. Genet. 248 (1995) 43 –51. [33] C. Jako, B. Teyssendier de la Serve, Cloning and characterization of a cDNA encoding a Rab1-like small GTP-binding protein from Petunia hybrida, Plant Mol. Biol. 31 (1996) 923 –926. [34] A. Hall, The cellular functions of small GTP-binding proteins, Science 249 (1990) 635 –640. [35] A. Hall, Small GTP-binding proteins and the regulation of the actin cytoskeleton, Annu. Rev. Cell Biol. 10 (1994) 31 –54. [36] D.P.S. Verma, C.-I. Cheon, Z. Hong, Small GTP-binding proteins and membrane biogenesis in plants, Plant Physiol. 106 (1994) 1 – 6. [37] O. Martinez, B. Goud, Rab proteins, Biochim. Biophys. Acta 1404 (1998) 101 – 112. [38] H. Ma, GTP-binding proteins in plants: new members of an old family, Plant Mol. Biol. 26 (1994) 1611 –1636. [39] H.R. Bourne, D.A. Sanders, F. McCormick, The GTPase superfamily: conserved structure and molecular mechanism, Nature 349 (1991) 117 – 127. [40] C. Nuoffer, W.E. Balch, GTPases: multifunctional molecular switches regulating vesicular traffic, Annu. Rev. Biochem. 63 (1994) 949 – 990.

[41] S. Clarke, Protein isoprenylation and methylation at carboxyl-terminal cysteine residues, Annu. Rev. Biochem. 61 (1992) 355 –386. [42] H. Stenmark, G. Vitale, O. Ulrich, M. Zerial, Rabaptin-5 is a direct effector of the small GTPase Rab5 in endocytic membrane fusion, Cell 83 (1995) 423 – 432. [43] C.I. Cheon, N.G. Lee, A.B.M. Siddique, A.K. Bal, D.P.S. Verma, Roles of plant homologs of Rab1p and Rab7p in the biogenesis of the peribacteorid membrane, a subcellular compartment formed de no6o during root nodule symbiosis, EMBO J. 12 (1993) 4125 – 4135. [44] A. Chapman, A.-S. Blervacq, T. Hendriks, C. Slomianny, J. Vasseur, J.-L. Hilbert, Cell wall differentiation during early somatic embryogenesis in plants. II. Ultrastructural study and pectin immunolocalisation on chicory embryos, Can. J. Bot. 78 (2000) 824 – 831. [45] G.C. Ingram, R. Simon, R. Carpenter, E.S. Coen, The Antirrhinum ERG gene encodes a protein related to bacterial small GTPases and is required for embryogenic viability, Curr. Biol. 8 (1998) 1079 – 1082. [46] G.A. Sacchi, L. Pirovano, G. Lucchini, S. Coccucci, A low-molecular-mass GTP-binding protein in the cytosol of germinated wheat embryos, Eur. J. Biochem. 241 (1996) 286 – 290. [47] A. Nato, C. Fresneau, N. Moursalimova, J. De Buyser, D. Lavergne, Y. Henry, Expression of auxin and light-regulated arrestin-like proteins, G proteins and nucleoside diphosphate kinase during induction and development of wheat somatic embryos, Plant Physiol. Biochem. 38 (2000) 483 – 490.